Method of obtaining libraries of serial bilateral deletions by means of pcr with degenerate primer
FIELD: chemistry.
SUBSTANCE: claimed invention relates to field of biotechnology. Claimed is method of constructing libraries of gene deletion derivatives based on PCR with random primer. Single-strand breaks are introduced into investigated gene in form of linear DNA by treatment with pancreatic DNAse I in a series of dilutions. Breaks are extended by treatment with polymerase I from E.coli in absence of nucleotidetriphosphates. After that, random primer, which has on 3'-tail 6-, 11- or 17-membered random sequence, and on 5'-tail - constant site (20 nucleotides), intended for adapter primer annealing is attached to matrix. After that, performed is preparative elaboration of library by PCR method with symmetric adapter primer, which is attached to prepared matrix by treatment with T4 DNA-ligase, which makes it possible to delete dimers of primers, formed due to mutual annealing of random sequences, in efficient way. Banks of deletion derivatives obtained in vivo can be further subjected to screening to select variants for their further expression in vivo. Method can be used for obtaining libraries of gene deletion derivatives for their further application in the field of biotechnology, agriculture and food, pharmaceutical industries and medicine.
EFFECT: method makes it possible to obtain shortened variants of practically important genes with improved biotechnological characteristics.
12 dwg, 1 ex
The technical field to which the invention relates.
The invention relates to the field of biotechnology, in particular, enables a method of constructing and screening a Bank of deletion derivatives to obtain a shortened version of practically important genes with improved biotechnological characteristics. The method allows to reduce the toxicity of the recombinant product to producer cells and to improve the folding of the target product in a heterologous system. The urgency of development due to the high propensity of many practically important proteins, primarily, of viral origin, to form aggregates in trying their products in the bacterial cells, and the toxicity of many of these proteins with respect to the cells of recombinant producer. It is assumed that a common reason for this behavior of the majority of viral proteins, as well as many bacterial antigens, receptors and surface proteins of eukaryotic cells is the presence in their structure of two or more domains with a strong binding ability in relation to cellular structures such as lipid membranes, nucleic acids, proteins, polysaccharides, and other. Such an organization is likely leads to the formation in the cell recombinant producer unwanted network physical contact, violating the normal transmission when galow in the cytoplasm. From the point of view of this hypothesis division of natural genes or protein fragments encoding the isolated globular domains, are able to reduce the overall toxicity of multidomain proteins, to improve their expression in heterologous systems. However, to date, has not been proposed a universal heuristic approach to fragmentation of the protein into isolated domains on the flanks of the linker amino acid sequence of small extent, is optimal for broadcast, retransmission folding and releasing products from the ribosome.
Our approach is aimed at solving the problem of segmentation of the target gene fragments, optimal for expression in bacterial cells, the method of constructing and screening a Bank of deletion derivatives. This approach allows you to work with non-characterized genes with unknown spatial organization products. This task is particularly important for most structural and non-structural viral antigens, preliminary crystallographic studies are hampered by the inability to obtain these proteins in native water-soluble form. Thus, a rational approach to the delineation in their composition globular domains are additionally complicated. At the same time of deletion derivatives of viral antigens, with Granada immunogenicity and antigenicity, good compatibility with recombinant expression systems are the best tool for creating diagnostic systems and vaccines, greatly facilitate the study of the structural-functional organization of these proteins in vivo and in vitro.
The level of technology
Receiving serial deletions is an important task for the past twenty years. Deletion derivatives used in the sequencing of long DNA segments, the identification of polymorphism of genes in order to study the structural-functional organization of proteins and enhance their products in heterologous systems. A variety of methods to create serial deletions: using ectonucleoside III nuclease Bal31, transposons and Gnkazy.
Historically the first, and at the same time popular method is the use of ectonucleoside III [1]. Major drawbacks of this method are one-sided divisions and a large flow of the original DNA.
The use of nuclease Bal31 allows you to get two-way symmetrical division, but also requires a significant amount of original DNA.
Method of obtaining serial divisions, based on the transposon principle [2], allows to obtain a Bank with a uniform representation of deletions. As disadvantages of the method should be noted insufficient the th reproducibility and difficulty regulating the intensity of transposition in vivo.
In the literature [3] also described is a method of obtaining serial deletions using PCR in combination with the removal of the formed dimers random primers by gel-filtration on a column of media Sephadex. This approach is devoid of the disadvantages of the techniques previously described, but its practical application is hampered by the high degree of contamination of the working area of PCR products at the time of the chromatography.
Disclosure of inventions
Most of these methods are used to obtain sets of clones for further sequencing. This task does not require randomization breaks with an accuracy of 1 nucleotide: given the length of the reading modern capillary or NGS-sequencers enough so that the ends of the clones covered the study area of the genome in increments of one or several hundred base pairs. Thus, the randomness of the primary gaps made a pancreatic Dnazol due to GC-composition sequence, the degree of stability of the duplex, the tendency to form non-canonical patterns and other factors, is irrelevant to the literature methods. However, when optimizing the ability of fragments of genes for expression in vivo there is an urgent need for clones, differing in length by one or more codons, which then increases the demand for randomization point breaks. The proposed method allows to solve effectively the problem of randomization through the use of DNA polymerase I, the speed of which as a 3'-5'-accoucheuse practically does not depend on the sequence. Shifting the ends of the obtained clones on a small, but not a fixed distance from the primary gaps pankreaticheskoi Gnkazy, you can achieve almost random distribution.
A feature of most of the described methods of obtaining deletions, based on the use of nucleases, is the degradation of the original DNA in the process. Thus, to obtain the Bank requires a significant amount of original DNA, and the resulting Bank may not be reproduced. The use of circuits with legirovaniem primary fragments of double-stranded adapters allows to solve the problem, but leads to contamination of the Bank dimers adapters and clones with inserts of insignificant size. Use in the proposed scheme PCR with symmetric adapter primer specific for the constant portion of random primer, can effectively solve this problem. Despite the low yield of symmetric PCR primer compared to asymmetric, its advantage is the selection of size of clones falling in a range of sizes from 200 to 700 BP (this is due to the rigidity of the DNA duplexes, not assalaya them to form patterns like "frying pan with handle" in this fragment size). Thus, our proposed scheme for banks using a standard set of enzymes are closest to the task of creating a set of clones intended for selection is well expressed in vivo variants with optimal biotechnological characteristics.
The invention consists in the possibility of eliminating the fundamental limitations of the technique Poland with a random seed, consisting in the ability of random seed to form in the solution duplexes, spontaneous breeding by PCR in the absence of a specific DNA template.
In the first stage of the procedure, get the Bank of fragments of the original gene in the form of a mixture of PCR products, sequentially perform the following operations:
(1) at random sites of the target gene, in the form of a linear DNA fragment, make a single-strand breaks using the limited hydrolysis by pancreatic desoksiribonukleaza 1 (Dnoti);
(2) enlarge the holes in the side of the 5'-end of DNA polymerase I of E. coli in the absence of deoxyribonucleotides;
(3) conduct the annealing of synthetic oligonucleotides with 3'-end of the 6-, 11 - or 17-membered random sequence, and the 5'-end - const section (20 nucleotides)that is designed for annealing adapter primer (random primers); covalently connec who have random primers, connected with the DNA matrix via complementary interactions, by ligating the DNA ligase of phage T4;
(4) remove the surplus is not associated with a matrix of random DNA primers by batch chromatography on macroporous glass sorbent;
(5) conduct a PCR reaction with adapter primer ("toprimary" PCR).
To optimize the concentration of reagents, requiring precise stoichiometric ratios with the aim of selecting the desired average length of the fragments deletion derivatives, prepare a serial dilution of pancreatic deoxyribonuclease 1 and random primers, combining the reaction products obtained under different conditions. For the selection of deletion derivatives that are suitable for expression in vivo, in vitro slices (peeled PCR products) are cloned into a vector for direct selection pQL30, containing the gene for β-galactosidase of E. coli with built-in polylinkers with mutations shift the translational reading frame. Insert a deletion derivative of the target gene in polylinker with a certain probability leads to the restoration framework that allows you to visually control the expression of the protein in the obtained clones. A significant feature of the proposed method is the possibility of selecting only those fragments of the original gene, which not only due to the recovery continuous the spine of the open reading frame, but in virtue of their sequence, secondary and tertiary structures of the encoded product have the ability to highly efficient expression in bacterial cells.
1) Hydrolysis by pancreatic desoksiribonukleaza 1 DNA containing a target gene, in the form of a linear segment in the amount of 8-10 μg diluted in a volume of 80 μl buffer 10 mm Tris-HCl, pH 7.5, 1 mm MgCl2, 50 mm NaCl, 1 mm recovered dithiothreitol. The resulting mixture was divided into four aliquots of 20 ál each. In the first test tube add Tenkasu (Promega) with an activity of 10-4u/ál, thoroughly mixed and an aliquot of the resulting solution with a volume of 2 μl is transferred to the second tube. The operation of the serial dilution of Gnkazy with step 10 repeat with the third and fourth tubes. Cooking time series of dilutions of Gnkazy should not exceed 2 minutes
Prepared a series of dilutions incubated 20 min at 37°C, after which the reaction is stopped contributing to each tube, 20 ál of a mixture of saturated neutral phenol - chloroform (1:1). The degree of degradation of the DNA assessed by electrophoresis in 1.8%-agarose gel. For further work are combined and used samples with a visible degree of degradation. This combined DNA subjected to phenol extraction, precipitated with isopropanol under standard conditions and dissolved in a minimum amount of dei is organized water.
2) Reaction processing hydrolysis of DNA with DNA polymerase 1 from E. coli in the direction of 5'→3' end
For DNA, obtained at the previous step, add 4 units of polymerase 1 from E. coli (Pharmacia) in a suitable buffer. The reaction is carried out for 1 h at 37°C and stopped by phenol extraction.
3) Annealing of synthetic oligonucleotides
Prepared the original matrix with the introduced gaps spend annealing random primers:
supl(5'-GGATCCGCAGCATCCGGAGCNNNNNN-3'),
supl-11(5'-GGATCCGCAGCATCCGGAGCNNNNNNNNNNN-3'),
or
supl-17(5'-GGATCCGCAGCATCCGGAGCNNNNNNNNNNNNNNNNN-3'),
having at the 3'-end of the 6-, 11 - or 17-membered random sequence, and the 5'-end - const section (20 nucleotides)that is designed for annealing adapter primer; covalently attach a random primer, formed a Watson-Cricova duplex DNA matrix by ligating DNA ligase of phage T4.
For this DNA obtained after phenol extraction, dissolved in water and the ligase buffer in a total volume of 30 ál, add 3-5 units of DNA ligase of phage T4. Divide the mixture into three equal portions of 10 µl. In the first test tube add 4 pmol of primers in a volume of 1 μl, mixed, transfer 2 ál of the second tube, and then 2 μl of the second to the third test tube.
Ligation occurs within 14 h at 4°C.
4) Remove excess unbound random primer by batch chromatography
Excess is unrelated to the random primer is removed by batch chromatography using a set of Silica bead DNA gel extraction kit (Fermentas) according to the manufacturer's Protocol.
5) PCR with adapter primer
Purified ligase mixture is used as template for PCR with adapter primer:
ES1 (5'-GGGGATCCGCAGCATCCGGAGC-3') or
ES3 (5'-GGGGATCCGCAGCATCCG-3').
Carry out 30 cycles of PCR in a volume of 30 μl, introducing into the reaction mixture of 4 pmol of adapter primer. The temperature of annealing of primers during PCR 60°C. the Sign of the passage of the reaction is the appearance of a set of DNA fragments in the size range 150-600 BP observed when carrying out agarose gel electrophoresis.
6) Clone serial deletions in vector direct selection pQL30
The PCR product obtained in the previous phase, purified using a set of Silica bead DNA gel extraction kit (Fermentas) according to the manufacturer's Protocol. The purified product is subjected to the influence of the restriction enzyme BamHI at 37°C for 2 hours by the same enzyme treated DNA vector pQL30. Ligation carried out for 14 h at 4°Skladki E. coli strain TG1 transform ligase mixture and plated on cups with LB medium in the presence of 100 μg/ml ampicillin and X-gal. For further work selected clones expressing the activity of β-galactosidase activity (blue color colonies on medium containing X-gal). Profitability analysis for determining the activity of β-galactosidase in the colonies of transformants is carried out in a period of about 40 hours since the end of the transformation, the cultivation temperature of 37°C.
Everything Sobranie clones review:
- the presence of β-galactosidase activity in soluble and insoluble cellular fractions of the selected clone;
the maintenance of the specific activity of the target protein in the cells of the producer (usually by the method of immunoscreening version of the dot-blotting or Wester blot).
7) recombinant protein Biosynthesis
The resulting producer cultured for 14-18 h at 30°C in liquid medium (0.5% of yeast extract, 1% peptone and 0.5% NaCl) supplemented with 100 μg/ml ampicillin in test tubes of 10 ml with 3 ml of medium each. Induction of the promoter in the cells of a producer is conducted by introducing a solution of IPTG to a final concentration of 1 mm.
8) Determination of β-galactosidase activity in the cells of the producer
Each of the obtained cultures of selected clones subjected to disintegration. For this, cells collected from 600 μl of culture, suspended in 600 µl of buffer containing 25 mm Tris-HCl, 5 mm EDTA, the pancreatic RNase (1 mg/ml), pH 8.0, add 30 mg of glass beads with a diameter of 0.5 mm and shaken on a hand shaker for test tubes for 5 min at maximum amplitude. Processing is conducted at room temperature.
Thus obtained coarse cell lysate centrifuged at 14000 G for 15 min to separate the soluble and insoluble cell fractions. Insoluble cellular fraction of suspen irout in 600 μl water. 20 µl of soluble and insoluble (in the form of suspension) cell fractions obtained from each culture mixed with 50 μl of the substrate mixture containing 0,02% X-gal, 25 mm Tris-HCl, pH8,5. The mixture is incubated at 37°C for 2-4 h, and then produce a measurement signal on a tablet spectrophotometer at λ=620 nm.
9) analysis of the yield of the target protein
Evaluation of the yield of the target product perform using electrophoretic separation of proteins according to laemmli's method with subsequent Western blotting on nitrocellulose membrane and detection of the target protein using antibodies specific to a given protein. This of coarse cell lysate of each culture are selected based on 100 µl. The lysate centrifuged at 14000 G for 15 min and separate the soluble and insoluble cell fractions. Proteins soluble and insoluble cell fractions solubilizer in 30 ál of buffer laemmli's method and separated in 15% SDS page under denaturing conditions. The proteins transferred to nitrocellulose membrane. After staining the membrane dye Ponco To see the band corresponding to the calculated mass of the protein (~120 kDa).
Detection of the target protein on the membrane includes: a) blocking of non-specific contacts by incubation of the membrane with 1% BSA, b) interaction with antibodies specific to the target protein; C) interaction with secondary what ntially, conjugated to horseradish peroxidase; d) staining with diaminobenzidine (DAB) in the presence of 1% hydrogen peroxide. After staining with DAB see the band corresponding to the calculated mass of the protein (~120 kDa).
Example 1
For 27 samples were used for cDNA gene NS5A-NS5B from HCV genotype 1b (GenBank accession number JX022751-JX022777) 1670 P.N., tried and tested by PCR with primers 1b_6117_S_L (TCCCCCACGCACTATGTGCC) and 1b_7780_AS_L (CGGTARTGGTCGTCCAGGAC). The samples listed cDNA fragments were subjected to secondary PCR amplification with the purpose of accumulation of DNA of the target gene NS5A-NS5B, pooled and purified using a set of Silica bead DNA gel extraction kit (Fermentas) according to the manufacturer's Protocol.
The purified PCR product containing the target gene, in an amount of 10 μg diluted in a volume of 80 μl buffer 10 mm Tris-HCl, pH 7.5, 1 mm MgCl2, 50 mm NaCl, 1 mm recovered dithiothreitol. The resulting mixture was divided into four aliquots of 20 ál each. In the first test tube was made to Tenkasu (MBI Fermentas) with an activity of 1×10-4u/ál, thoroughly mixed, and an aliquot of the resulting solution with a volume of 2 µl was transferred into a second tube. The operation of the serial dilution of Gnkazy increments of 10 times repeated with the third and fourth tubes. Cooking time series of dilutions of Gnkazy did not exceed 2 minutes
The prepared dilution series were incubated 20 min at 37°C, after which the reaction is ostanavlivali, contributing to each tube, 20 ál of a mixture of saturated neutral phenol-chloroform (1:1). The degree of degradation of the DNA was assessed by electrophoresis in 1.8%-agarose gel. For further work were combined and used samples with a visible degree of degradation: concentration Gnkazy equal to 1×10-5-1×10-6u/ál. Combined DNA was subjected to phenol extraction, precipitated with isopropanol under standard conditions and was dissolved with 10 ál of deionized water.
To 10 μl of each sample was added 1 μl (4 units) polymerase 1 from E. coli in an appropriate buffer and incubated for 1 h at 37°C. the Reaction was stopped by phenol extraction.
DNA obtained after phenol extraction, was dissolved in water and the ligase buffer in a total volume of 30 μl, was added to the DNA ligase of phage T4. Divide mixture into three equal portions of 10 µl. In the first test tube was made 1 mm (pmol) primer (supl, supl-11 or supl-17 mix, 2 μl was transferred into another test tube, and then 2 μl of the second to the third test tube. Ligation proceeded for 14 h at 4°C. Then the ligase mixture was used as template for PCR with primers ES1 and ES3. Assessment completion of the reaction was assessed by electrophoretic.
The PCR product obtained in the previous phase was purified using the kit Gel extraction kit (MBI Fermentas) according to the manufacturer's Protocol. The purified product was subjected to the impact of the restriction enzyme BamHI at 37°C for 2 hours Similarly treated plasmid DNA vector pQL30. Ligation was carried out for 14 h at 4°C. Cells of E. coli strain TG1 transformed ligase mixture was sown on cups with LB medium containing 100 μg/ml ampicillin and 0.05% X-gal. The ratio of blue (expressed inset) and white (without insert or inexpressibles insert) colonies was 63:1460. From the colonies with the restored activity of β-galactosidase was isolated plasmid DNA. The presence of the appropriate insert in clones compared to non-recombinant vector pQL30 was detected by PCR with standard primers pQE-for and pUC-for. As a negative control were used non-recombinant vector pQL30. Thus, managed to gain 40 clones with the size of the insert, visually higher than the control. The size of the inserts ranged from 50 to 700 BP no significant differences between groups.
All selected clones representing the derivative of the strain E. coli TG1 carrying selected from the Bank plasmids were used for the recombinant proteins. As a negative control not containing the target insert was chosen as the producer of a full-sized β-galactosidase from E. coli (βGal) and merged bifunctional derivatives containing genes of pectins from the endoplasmic reticulum of Saccharomyces cerevisiae: pLacZ-emp46 and pLacZ-emp47.
The obtained p is docenti (including the control culture) were cultured for 14-18 h at 30°C in liquid medium (0.5% of yeast extract, 1% peptone, 0.5% of Nad) with the addition of 100 μg/ml ampicillin in test tubes of 10 ml with 3 ml of medium each. Induction of the promoter in the producer cells was performed by adding IPTG to 1 mm. The cells were collected by low-speed centrifugation and subjected to disintegration, as described above.
For the quantitative determination of βGal activity 100 ál of coarse cell lysate was separated into soluble and insoluble fraction, given equivalent volume (insoluble cellular fraction is suspended in water to a volume of 100 μl). 20 µl of soluble and insoluble cellular fractions obtained from each culture was mixed with 50 μl of the substrate mixture containing 0,02% X-gal, 25 mm Tris-HCl, pH 8.5. As a negative control used a cell lysate of the strain TGl(pQL30). The mixture is incubated at 37°C for 2-4 h, and then measured the signal on the spectrophotometer at a wavelength of λ=620 nm (figure 5).
Evaluation of the yield of the target product was carried out using electrophoretic separation of proteins according to laemmli's method with subsequent Western blotting on nitrocellulose membrane and detection of the target protein using the blood sera of individuals infected with hepatitis C. For this coarse cell lysate was centrifuged at 14000 G for 15 min Proteins soluble and insoluble cell fractions were solubilizers in 30 ál of buffer laemmli's method and abdelali in 15% SDS page under denaturing conditions. After transfer of proteins to nitrocellulose membrane and reversible staining of transferred proteins Ponco C watched the band corresponding to the calculated mass of the protein (~CD) clone s3 in the soluble fraction (6).
To block nonspecific binding incubated the membrane with transferred proteins in 1% solution of bovine serum albumin prepared in PBS buffer. Then the membrane protein were incubated with a pool of blood sera 7 patients infected with hepatitis C virus genotype 1b (total breeding polerowanie serum in PBST buffer was 1/300), and then with secondary antivirovym antibodies to human IgG, conjugated with horseradish peroxidase (PBST-buffer, dilution of antibodies 1/10000). Staining with DAB (up to 0.1 mg/ml) was performed in PBS buffer in the presence of 0.01% hydrogen peroxide. As a result, the clone s3 from the group SVR watched the band corresponding to the calculated mass of the protein (~130 kDa), showing a pronounced reaction with antibodies from patients infected with HCV, but not healthy donors (6).
A brief description of graphics:
Figure 1. The distribution of the number of colonies depending on the LacZ gene expression: grey columns correspond to white colonies obtained on the test environment (βGal-), and the black columns - blue (βGal+). Shaded columns soo is relevant to the colonies, expressing βGal activity, and bearing insert target size (>100 BP) PCR results.
Figure 2. The following chart shows the percentage of clones βGal+(black color) and clones βGal+insert the target size (shaded) to the total number of clones in the library.
Figure 3. The graph shows the distribution of the value of the insertion of the target gene within the Bank according to the results of Poland with standard primers (pQE-for and pUC-for).
Figure 4 (a)-(g). The results of electrophoresis in 1.8% agarose gel purified NDP-products of clones with insert.
Figure 5. Determination of the specific activity βGal (normalized to the volume fraction) in the soluble (dark columns) and insoluble (light columns) cell fractions. On the ordinate axis indicates the value of A620.
6. Electrophoretic analysis (a-b) and Western blotting (b) proteins. Proteins are separated in denaturing 15% page, followed by staining Ponco C total protein, transferred to nitrocellulose filter and detection of the target protein using the serum of individuals infected with hepatitis C.
Sources of information
1. US Patent 4521509, Benkovic, et al, 1985, Method for degrading DNA.
2. US Patent 6265159, Sugino, et al. 2001, Method for producing DNA nested deletions by an in vitro reaction using transposase.
3. J.M. Whitcomb et al. A new PCR based method for the generation of nested deletions, Nucleic Acids Research, 1993, Vol.21, No.17 4143-4146.
Method of constructing libraries businessman who was derived genes based on PCR with random seed, where in the studied gene in the form of linear DNA make single-strand breaks, attached to the matrix of the random seed, followed by preparative the runtime library by PCR with symmetric adapter primer, wherein (1) single-strand breaks contribute by treating a pancreatic Dnazol I in a series of dilutions; (2) gaps extend processing polymerase I from E. coli in the absence of nucleotidase; (3) the seed is on the 3'-end of the 6-, 11 - or 17-membered random sequence, and the 5'-end - const section (20 nucleotides), designed for annealing adapter primer; (4) adapter primer attached to the prepared matrix by treatment with T4 DNA ligase, which can effectively remove primer-dimer formed through mutual annealing random sequences.
FIELD: chemistry.
SUBSTANCE: invention relates to computer method, which uses biochemical databases in design of novel protein compounds. Design is performed by operator by means of specially written software PROTCOM basing on application of database of protein pentafragments. Design process consists in specifying and introduction into PROTCOM software of initial sequence of five amino acids (specified initial pentafragment) and written in binary system ten-digit number, which describes secondary structure of specified initial pentafragment. Search of said sequence is performed in database fold with the number, corresponding to specified ten-digit number. Search is performed until specified initial pentafragment is found in database. After its finding, said pentafragment is considered to be the first of possible number N of pentafragments of designed primary protein structure, and it, together with ten-digit number of fold, describing its secondary structure, is recorded into the programme working file. After that, secondary structures of each following number of (N-1) pentafragments are specified by introduction of the same or changed ten-digit number, describing secondary structure of the previous pentafragment into the programme, and search is performed in database of pentafragments, containing four amino acids of each of (N-1) pentafragments, recorded in working file, and one new one. When such pentafragments are found, one of new amino acids is selected and linked to four last amino acids of the previous pentafragment, new amino acid and ten-digit number of fold, describing secondary structure of each found pentafragment are recorded into working file. Obtained in working file sequence of amino acids, with corresponding description of its secondary structure, is considered to be designed primary structure of protein.
EFFECT: claimed method of designing primary structure of protein considerably simplifies and accelerates the task of designing proteins with specified secondary structure.
5 dwg, 21 tbl, 2 ex
FIELD: chemistry.
SUBSTANCE: invention relates to biotechnology, specifically a method of producing artificial oligonucleotides that are potentially capable of forming non-canonical structures that stable in physiological conditions and conditions close to physiological, said structures being imperfect G-quadruplexes (lmGQ) which include one nucleotide substitution in the G4 plane in the G-quadruplexes (GQ). Said method includes using an algorithm describing nucleotide sequences in form of a defined set of formulae for further synthesis of selected oligonucleotides.
EFFECT: invention enables to use bioinformation analysis to obtain artificial oligonucleotides that are potentially capable of forming a new conformation - imperfect G-quadruplexes.
4 dwg, 2 tbl, 2 ex
FIELD: information technology.
SUBSTANCE: pre-examination patient information gathering system comprises an electronic user interface including a display and at least one user input device, and an electronic processor configured to present an initial set of questions to a patient via the electronic user interface, receive responses to the initial set of questions from the patient via the electronic user interface, construct or select follow-up questions based on the received responses, present the constructed or selected follow up questions to the patient via the electronic user interface, and receive responses to the constructed or selected follow up questions from the patient via the electronic user interface. A physiological sensor may be configured to autonomously measure a patient physiological parameter as the patient interacts with the electronic user interface.
EFFECT: high efficiency of a medical facility.
11 cl, 3 dwg
FIELD: information technology.
SUBSTANCE: apparatus includes a subject record database, a time-dependent relationship identifier, an event predictor, a coded subject record database, a decision support system processor and a user interface. The time-dependent relationship identifier processes the data in the subject record database to identify time-dependent relationships in the data. Information indicative of the identified relationships is processed by the processor and presented to a user via the user interface.
EFFECT: identifying relationships in subject information which includes event data indicative of an event experienced by the subject, outcome data indicative of an outcome experienced by the subject, and intervention data indicative of an intervention applied to the subject.
8 cl, 7 dwg
FIELD: physics.
SUBSTANCE: method involves determining current time characteristics, taking into account the state of the atmosphere, determining the spatial position of the imaging means, based on data from spatial positioning means, the obtained image is compared with three-dimensional models of the surrounding environment and electronic maps stored in a dynamically populated knowledge base, identifying objects of the surrounding environment that are part of the image using means of recognising and identifying samples associated with said base, where said base is constantly populated and improved with knew data obtained from identification of said objects.
EFFECT: high accuracy of displaying artificial objects on an image of the surrounding environment in real time owing to analysis of dynamic changes in the surrounding environment.
5 cl, 1 dwg
FIELD: information technology.
SUBSTANCE: portable storage device has a data management application which receives and processes data with measurement results from a measuring device which measures an analysed substance. The portable device can use an interface protocol which directly provides compatibility of the portable device with different operating systems and hardware configurations. The data management application is launched automatically upon connecting the portable device with a master computer.
EFFECT: managing medical data using different processing devices without the need for pre-installation of additional programs, clients, device drivers or other program components on separate processing devices.
60 cl, 19 dwg
FIELD: medicine.
SUBSTANCE: group of inventions relates to medicine. In realisation of methods implanted gastric restricting device is implanted into patient's body. Data, containing information about values of parameter, perceived inside the body, are collected for a time period. In the first version of method realisation determined are values of perceived parameter, which exceed the first threshold, are below the first threshold or below the second threshold in such a way that pulse is determined by time between values, which exceed the first threshold and values, which are below the first threshold or below the second threshold. In the second version of the method additional values of perceived parameter, accompanied by decreasing values, are determined. In the third version of the method areas under the curve of pressure dependence on time are determined, compared and the result of comparison is correlated with the state. In the fourth version of the method values of perceived pressure are formed for demonstration on display or further analysis. In the fifth version of the method average value of pressure for time X within the specified time period is calculated on the basis of values of perceived pressure within the window of averaging in specified period of time.
EFFECT: group of inventions makes it possible to increase treatment safety and efficiency due to control of implanted device.
32 cl, 77 dwg
FIELD: medicine.
SUBSTANCE: group of inventions relates to medical equipment. Wireless system of cardiac control contains ECG monitor and mobile phone. ECG monitor contains transceiver for wireless transmission of ECG signal data. ECG monitor contains connected with transceiver unit of notification about status for transmission of notification in case of change of ECG monitor status. Mobile phone contains electronics, transceiver for wireless reception of ECG signal data or notifications from ECG monitor and controller for transmission of ECG signal data into the control centre by electronics via mobile connection net. Controller can respond to notification from ECG monitor by communicating notification to patient by means of mobile phone or transmission of notification into the control centre. Notification is communicated to patient by means of mobile phone display, tone signal or verbal prompt, formed by mobile phone. Controller can delay transmission of specified notification into the control centre to give time for reception of notification about status of disorder elimination. When patient is informed about change in status patient is given possibility to answer immediately or to delay respond to notification.
EFFECT: invention makes it possible for patient to recognize and correct situation with changed status without transmission of notification or response of the control centre.
6 cl, 38 dwg, 1 tbl
FIELD: oil and gas industry.
SUBSTANCE: system contains one or more sources providing data representing aggregated fractures in formation, processor of computer connected to one or more sources of data, at that processor of computer contains carriers containing output code of the computer consisting of the first program code for selection of variety of materials to control drill mud losses out of list of materials in compliance with data representing total number of fractures in formation and the second program code related to the first program code and purposed for determination of optimised mixture for selected materials to control drill mud losses to apply them for fractures; at that optimised mixture is based on comparison of statistical distribution for selected sizes of materials to control drill mud losses and sizes of aggregated fractures.
EFFECT: reducing loss of materials and improving operational efficiency of wells.
20 cl, 6 dwg
FIELD: medicine.
SUBSTANCE: invention relates to field of medicine. System of cardiac monitoring contains battery-supplied ECG monitor, which is worn by patient and has processor of patient's ECG signal, device for identification of arrhythmia and wireless transceiver for sending messages about the state and obtaining information about configuration of device of arrhythmia identification. System of cardiac control additionally contains mobile phone, which has electronic devices of mobile phone, transceiver and controller. In the process of method version realisation, parameter of specified arrhythmia to be identified, and limit of switching on alarm signals for specified arrhythmia, are determined and stored in configuration file in the centre of monitoring. ECG monitor is fixed to patient and activated to start ECG monitoring. Message about state is sent by wireless communication line from ECG monitor into the centre of monitoring. Reply to message, which includes only configuration file, is sent to ECG monitor. Configuration file is used to adjust device for arrhythmia identification.
EFFECT: invention makes it possible to provide completely wireless ECG monitoring to increase patient's comfort and convenience.
18 cl, 48 dwg, 1 tbl
FIELD: computers.
SUBSTANCE: device has decoder, registers, AND groups elements, delay elements, memory blocks, counter, trigger, signs input block, comparators.
EFFECT: higher productiveness.
2 dwg
FIELD: advertisement.
SUBSTANCE: method includes, before transfer of combined video and audio signal from remote center to multiple control servers, selection of blocks of video and audio information about goods, in remote center, which goods are present in trading location, where appropriate control server is positioned, and playback is performed continuously on each display by means of respective controls server, at least portion of selected blocks of video and audio information about advertised goods is played, which are appropriate for goods present in trading location, wherein appropriate controlling server is located and matching display, after that analysis of blocks of video and audio information indicated on displays, is performed, and report information is formed.
EFFECT: higher efficiency.
2 cl, 1 dwg
FIELD: computers.
SUBSTANCE: device has registers, comparators, signs input block, counters, adder, decoder, memory block, means for determining support test address, triggers, AND elements, groups of AND elements, OR elements, delay elements.
EFFECT: higher precision.
4 dwg
FIELD: biochemistry, proteins, pharmacy.
SUBSTANCE: invention relates to a computer method for identifying peptides that can be used as targets for medicinal agents. Method involves creating peptides library from protein sequences of different organisms and the following comparison is carried out for identification of retained conservative peptide motifs that are identified by the direct comparison of sequences for different microorganisms and host genomes being without any suggestions. Method is useful for identifying possible targets for medicinal agents and can be used for screening antibacterial medicinal agents of broad spectrum. Also, method can be used for carrying out the specific diagnosis of infections and, in addition, for conferring functions to proteins with unknown functions using indices of invariant peptide motifs. The advantage of invention involves accelerating method for identification of peptide motifs.
EFFECT: improved method for identifying peptide motifs.
11 cl, 4 dwg, 8 ex
FIELD: devices for processing data with copyrights.
SUBSTANCE: device for processing data, realizing a method for processing of data with copyrights within limits of given rights, contains memory device for distributed data, means for recording data concerning rights and data, means for converting data, means for realization of processing method.
EFFECT: higher efficiency.
3 cl, 60 dwg
FIELD: computer science.
SUBSTANCE: device has main processor, auxiliary processor, main module body, display, while auxiliary processor is made with possible receiving in parallel format of controlled data from multiple sensors and outputting signals in serial format to main processor.
EFFECT: computer can possibly receive signals from large set of sensors without increase of contacts amount on main module body.
3 cl, 12 dwg
FIELD: computer science.
SUBSTANCE: method includes performing a block of operations along N1 channels, where N1 is selected from 1 to 2256, wherein received information is separated on logically finished fragments, encoded on basis of preset algorithm, to produce a block of N-dimensional sets adequate for converted source information Aj with elements like {Bm, X1, X2,...,Xn}, where j - order number of set in range from 1 to 2256, Bm - identifier, X1-Xn - coordinate of element from its coordinates center, m and n are selected from 1 to 2256; received block of sets is compared to already accumulated and/or newly produced sets from multiple channels, intersecting portions of sets are found and cut out; after that cut intersections and sets remaining after cutting are distributed among databases, placing each same set into database appropriate for it and each of sets different with some parameter to databases appropriate for them and identifiers of databases storing these sets are substituted in place of cut sets.
EFFECT: higher speed of operation, higher precision, lower costs, broader functional capabilities, higher efficiency.
9 dwg
FIELD: economical processes modeling technologies.
SUBSTANCE: system has block for calculating sells, block for profit distribution, block for distributing savings, block for modeling distribution coefficients, block for modeling full costs of production and taxes, block for modeling costs of main funds, block for modeling external borrowings, block for modeling consumption, block for analyzing total supply and demand and control.
EFFECT: higher precision.
3 dwg
FIELD: technologies for realization of an additional useful effect during purchase of consumer goods.
SUBSTANCE: method for realization of additional useful effect includes dispensing an individual code to consumer, providing access to commonly accessed data transfer network by means of appropriate data processing device, while wherein a software storage is present. Access to storage is performed by means of individual code, launched selected software remains accessible for a certain time, and after anticipated number of accesses individual code is blocked for any further access.
EFFECT: expanded functional capabilities and range of technical means of communication network for users, purchasing goods.
3 cl
FIELD: engineering of information-gathering and controlling systems, possible use for accumulation and processing of information, completing missions and generating controlling commands for weapon systems and technical equipment, in particular, for naval weaponry.
SUBSTANCE: automated workplace for naval weapon control complex operator contains computing machines, long-term memorizing devices, adapters of multiplex information exchange channels, system interface mains, device for input of discontinuous signals, device for outputting discontinuous signals, devices for displaying graphic information, isolated transformer of serial interfaces, local network adapters, local network commutator, buttons block, indication devices block, keyboard, coordinate-pointing device, temperature indicator, device for synchronization of signals of temperature indicator, device for commutation of keyboard signals and coordinate-pointing device, connected by appropriate links.
EFFECT: improved reliability and fault tolerance.
5 dwg