Method of obtaining libraries of serial bilateral deletions by means of pcr with degenerate primer. RU patent 2511424.

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biotechnology. Claimed is method of constructing libraries of gene deletion derivatives based on PCR with random primer. Single-strand breaks are introduced into investigated gene in form of linear DNA by treatment with pancreatic DNAse I in a series of dilutions. Breaks are extended by treatment with polymerase I from E.coli in absence of nucleotidetriphosphates. After that, random primer, which has on 3'-tail 6-, 11- or 17-membered random sequence, and on 5'-tail - constant site (20 nucleotides), intended for adapter primer annealing is attached to matrix. After that, performed is preparative elaboration of library by PCR method with symmetric adapter primer, which is attached to prepared matrix by treatment with T4 DNA-ligase, which makes it possible to delete dimers of primers, formed due to mutual annealing of random sequences, in efficient way. Banks of deletion derivatives obtained in vivo can be further subjected to screening to select variants for their further expression in vivo. Method can be used for obtaining libraries of gene deletion derivatives for their further application in the field of biotechnology, agriculture and food, pharmaceutical industries and medicine.

EFFECT: method makes it possible to obtain shortened variants of practically important genes with improved biotechnological characteristics.

12 dwg, 1 ex

The technical field to which the invention relates

The invention relates to biotechnology, in particular allows construction method and screening Bank deletion of derivative get shortened versions of practically important genes with improved biotechnology characteristics. The method allows to reduce the toxicity of recombinant product for cell producer and improve folding of the target product in heterologous systems. The urgency of development due to the high inclination of many practically important proteins, primarily viral origin, to form aggregates at attempts of their products in the cells of bacteria, as well as the toxicity of many of these proteins in relation to the cells of recombinant producer. It is assumed that the common reason of such behaviour of the majority of viral proteins, and many bacterial antigens, receptors and surface proteins of eukaryotic cells is the presence in their structure of two or more domains with a strong binding power over cellular structures: lipid membranes, nucleic acids, proteins, polysaccharides, and other. This organization is likely leads to the formation in the cell recombinant producer unwanted network physical contact, violating the normal transmission of signals in the cytoplasm. From the point of view of this hypothesis dismemberment of genes natural protein fragments encoding isolated globular domains that can reduce the overall toxicity multi-domain proteins, to improve their expression in heterologous systems. However, to date, has not been proposed universal heuristic approach to the dismemberment of a protein on isolated domains used on the flanks of the linker amino acid sequence of small extent, optimal for broadcasting, retransmission folding and releasing of products of ribosomes.

Our approach is aimed at solving the problem of segmentation of the target gene fragments, for optimal expression in bacterial cells, construction method and screening Bank deletion derivatives. This approach allows you to work with non-characterized genes of unknown spatial organization products. This task is particularly important for most structural and nonstructural viral antigens, preliminary crystallographic studies are hampered by the inability to obtain these proteins in native water-soluble form. Thus, a rational approach to the delineation in their structure of globular domain additionally complicated. At the same time, analysis of derivatives viral antigens, preserving the immunogenicity and antigenicity, provided good compatibility with recombinant expression systems are optimal tool for creating diagnostic systems and vaccines, and greatly facilitate the investigation of structural-functional organization of such proteins in vivo and in vitro.

The level of technology

Obtain the serial deletions is an actual problem for the past twenty years. Analysis of derivatives used in the sequencing of extended sites DNA detection of polymorphism of genes to study structural and functional organization of proteins and improve their products in heterologous systems. A variety of methods to create serial deletions: using economiesi III, nucleases Bal31, transposons and Dnkuz.

Historically the first and at the same time popular method is the use of economiesi III [1]. Major drawbacks of this method are unilateral nature of the divisions and the large flow of the original DNA.

The use of nucleases Bal31 enables to receive bilateral symmetrical division, but also requires a significant amount of the original DNA.

Method of obtaining serial divisions based transposon principle [2]that allows to obtain a Bank with a uniform representation deletions. As disadvantages of the method, it is necessary to note the lack of reproducibility and the difficulty of regulation of the intensity of transposition in vivo.

In the literature [3] also describes how to obtain the serial deletions by PCR in combination with the removal of the formed dimers random primers gel-filtration on the column of the media Sephadex. This approach drawbacks of the previously described methods, but its implementation is hampered by the high degree of contamination of the working area of PCR products in the time of the chromatography.

Disclosure of the invention

Most of these methods are used to obtain sets of clones with the purpose of their subsequent sequencing. This task does not require randomization breaks with an accuracy of 1 nucleotide: taking into account the length of the reading modern capillary or NGS-sequencers enough to the ends of the clones covered the analyzed region of the genome in increments of one or a few hundred base pairs. Thus, randomness primary breaks made a pancreatic Ankaty due GC-composition of the sequence, the degree of its stability in the duplex, the tendency to the formation of the non-canonical structure and other factors, is irrelevant to the literature methods. However, when optimizing the ability of gene fragments to expression in vivo there is an urgent need for clones, differing in length to one or several codons that increases the demand for randomization point breaks. The proposed method allows to solve effectively the problem of randomization through the use of DNA polymerase I, the speed of which the 3'-5'-economiesi practically does not depend on the sequence. Shifting the ends of the obtained clones small but not a fixed distance from the primary gaps pankreaticheskoi Dnkuz, you can achieve almost random distribution.

A feature of most of the described methods of obtaining deletions based on the use of nucleases, is the degradation of the original DNA in the process. Thus, to obtain a Bank requires a significant amount of the original DNA, and the Bank may be reproduced. The use of schemes with legirovaniem primary fragments with double-stranded adapters allows to solve the problem, but leads to the pollution of the Bank by dimers adapters and clones with inserts of minor size. The use in the proposed scheme PCR with symmetric adapter primers specific to a constant part of random primer, can effectively solve this problem. Despite the low yield PCR with symmetric primer compared with asymmetric, its advantage is the size selection clones, being in the size range from 200 to 700 gel, due to the rigidity of DNA duplexes, not allowing them to form the structure of a type "a frying pan with a handle" this fragment size). Therefore, our proposed scheme for banks using a standard set of enzymes are closest to the creation of a set of clones intended for selection of well expressed in vivo options with an excellent biotechnology characteristics.

Summary of the invention consists in the possibility of eliminating the fundamental limitations of Poland with a random seed, consisting in the ability of random seed form in the solution duplexes, spontaneous breeding by PCR in the absence of specific DNA matrix.

On the first stage procedure receive the Bank fragments of the original gene in the form of a mixture of PCR products, consistently performing the following operations:

(1) in random sites target gene, which is in the form of linear DNA fragment, make a single-strand breaks with limited hydrolysis pancreatic the desoksiribonukleaza 1 (Dnoti);

(2) extend the holes in the side of the 5'-end using DNA polymerase I E. coli in the absence of deoxyribonucleotides;

(3) conduct annealing synthetic oligonucleotides with the 3'end of the 6-, 11 - or 17-membered random sequence, and at the 5'-end - const area (20 nucleotides), intended for annealing adapter primer (random primers); covalently attached random primers, connected with DNA matrix by complementary interactions, by ligating DNA ligase phage T4;

(4) remove the excess is not associated with matrix DNA random primer by batch chromatography on microporous glass sorbent;

(5) conduct reaction PCR with adapter primer ("odnovremennoe" PCR).

To optimize the concentration of reagents, requiring precise stoichiometric ratios in order to select the desired average the length of fragments deletion derivatives, prepare serial cultivation pancreatic deoxyribonuclease 1 and random primer, combining the reaction products obtained under different conditions. For selection deletion derivatives suitable for expression in vivo, in vitro fragments (peeled PCR products) are cloned into a vector direct selection pQL30 containing the gene of b-galactosidase gene with built-in polylinker with a mutation bias translational reading frames. Insertions deletions derivatives target gene in polylinker with certain probability leads to the restoration of the frame that allows you to visually monitor the expression of a protein derived clones. A significant feature of the proposed method is the possibility of selecting only those fragments the source of the gene that was not due only to restore the continuity of open reading frame, but also because of its sequence, secondary and tertiary structures of the encoded product are capable of highly effective expression in bacterial cells.

Prepared a series of dilutions incubated for 20 min at 37 C, then the reaction is stopped making in each tube in 20 ml of a mixture of saturated neutral phenol - chloroform (1:1). The degree of degradation of the DNA appreciated by electrophoresis 1.8%-agarose gel. For further work to unite and use samples with the apparent degree of degradation. To do this, combined DNA subjected phenol extraction, precipitated by isopropanol in standard conditions and dissolve in a minimum amount of deionized water.

2) Reaction progressivnogo hydrolysis DNA DNApolymerase 1 of E.coli in the direction 5'→3' end

To DNA obtained in the previous phase, add 4% polymerase 1 of E.coli (Pharmacia) in the corresponding buffer. The reaction is carried out for 1 h at 37 C and stop phenol extraction.

3) Annealing synthetic oligonucleotides

On prepared the original matrix amended breaks spend annealing random primers:

supl(5'-GGATCCGCAGCATCCGGAGCNNNNNN-3'),

supl-11(5'-GGATCCGCAGCATCCGGAGCNNNNNNNNNNN-3'),

supl-17(5'-GGATCCGCAGCATCCGGAGCNNNNNNNNNNNNNNNNN-3'),

with the 3'end of the 6-, 11 - or 17-membered random sequence, and at the 5'end - const area (20 nucleotides), intended for annealing adapter primer; covalently attached random primer, formed Watson-Cricova duplex DNA matrix, by ligating DNA ligase phage T4.

For this DNA obtained after phenol extraction, dissolved in water and ligase buffer total 30 MKL add 3-5 units of DNA ligase phage T4. Divide the mixture into three equal portions of 10 ml. In the first test tube contributed 4 pmol primers volume 1 mm, mixed, carry 2 MCL in the second test tube, and then 2 MKL from the second to the third test tube.

Ligation flows within 14 h at 4 C.

4) Remove excess unbound random primer by batch chromatography

Excess unbound random primer is removed by batch chromatography using a set of Silica bead DNA extraction gel kit (Fermentas) according to the Protocol of the manufacturer.

5) PCR with adapter primer

Purified ligase the mix is used as a matrix for PCR with adapter primer:

ES1 (5'-GGGGATCCGCAGCATCCGGAGC-3') or

ES3 (5'-GGGGATCCGCAGCATCCG-3').

Spend 30 PCR cycles in the amount of 30 MKL, bringing in the reaction mixture 4 pmol adapter primer. Temperature annealing primers during PCR - 60 C. a Sign of the passage of the reaction is the emergence of a set of DNA fragments in a range of sizes 150-600 P.N. observed when conducting agarose gel electrophoresis.

6) Cloning serial deletions in the vector direct selection pQL30

PCR-product obtained in the previous phase, clean with a set of Silica bead DNA extraction gel kit (Fermentas) according to the Protocol of the manufacturer. The purified product is exposed to the restriction enzyme BamHI at 37 C for 2 H. the same enzyme is processed and DNA vector pQL30. Ligation performed within 14 hours at 4oC Sklejki E.coli strain TG1 transform ligase mixture and sow the Cup with the environment LB in the presence of 100 mcg/ml ampicillin and X-gal. For further work are selected clones, expressing the activity of b-galactosidase (dark blue colonies in an environment with X-gal). Records of the results of determination of activity of beta-galactosidase in the colonies of transformants is in a period of about 40 hours since the end of the transformation, the temperature cultivation 37 C.

All the selected clones review:

- in the presence of b-galactosidase activity in soluble and insoluble cellular fractions of selected clone;

- the maintenance of specific activity of the target protein in the cells of the producer (usually method of immunoscreening in the version of the dot-blot or Vester blot).

7) the recombinant protein Biosynthesis

Received producer of cultured for 14 to 18 hours at 30 C in the liquid environment (0,5% yeast extract, 1% peptone, 0,5% NaCl) with the addition of 100 mcg/ml ampicillin in vials of 10 ml with 3 ml of the environment in each. The induction of promoter in the cells of a producer spend making solution IPTG to a final concentration of 1 mm.

8) Definition β galactosidase activity in cells producer

Each of the derived crops selected clones subjected to disintegration. To do this, the cells collected from 600 ml of culture, suspended in 600 ml of buffer containing 25 mm Tris-HCl, 5 mm EDTA, pancreatic the RNase (1 mg/ml), pH 8.0, add 30 mg of glass balls with a diameter of 0.5 mm and shaken on hand shaker for tubes for 5 minutes at the maximum amplitude. Processing is conducted at room temperature.

Thus obtained rough cell lysate centrifuged at 14000 G for 15 min to share soluble and insoluble cellular fractions. Insoluble cell fraction of suspended 600 MKL water. On 20 ml of soluble and insoluble (in the form of suspension) cellular fractions obtained from each culture mixed with 50 ml of the substrate mixture, containing 0,02% X-gal, 25 mm Tris-HCl, pH8,5. The mixture was incubated at 37 C for 2-4 hours, then make measurements of signal on a tablet spectrophotometer at λ=620 nm.

9) analysis of the output of the target protein

Assessment of target product yield perform using electrophoretic separation of proteins in laemmli's method with subsequent Western blot testing on the nitrocellulose and detection of the target protein using antibodies specific to a given protein. This of coarse cell lysate of each culture are selected based on 100 ml. Lysate centrifuged at 14000 G for 15 min and share soluble and insoluble cellular fractions. Protein soluble and insoluble cellular fractions solubilizing in 30 ml of buffer laemmli's method and share of 15% PAG under denaturing conditions. Then proteins transferred to nitrocellulose membrane. After application of the membrane dye Ponso To see the band corresponding to the estimated weight of protein (about 120 kDa).

Detection of the target proteins in the membrane includes: a) blocking non-specific links by incubation membranes with 1% BSA, b) interaction with antibodies specific to the target protein C) cooperation with secondary antibody conjugated to horseradish peroxidase; d) staining with diaminobenzidine (DUB) in the presence of 1% of hydrogen peroxide. After staining with DUB see the band corresponding to the estimated weight of protein (about 120 kDa).

Example 1

For 27 samples were used cDNA gene NS5A-NS5B of HCV genotype 1b (GenBank accession number JX022751-JX022777) 1670 P.N. developed by PCR with primers 1b_6117_S_L (TCCCCCACGCACTATGTGCC) and 1b_7780_AS_L (CGGTARTGGTCGTCCAGGAC). Samples listed cDNA fragments were subjected to secondary PCR amplification with the purpose of accumulation of DNA target gene NS5A-NS5B, pooled and cleaned using a set of Silica bead DNA extraction gel kit (Fermentas) according to the Protocol of the manufacturer.

Purified PCR product containing the target gene, in the amount of 10 mg diluted in the amount of 80 MCL in the buffer of 10 mm Tris-HCl, pH 7.5, 1 mm MgCl 2 , 50 mm NaCl, 1 mm restored dithiothreitol. The resulting mixture is divided into four aliquots of 20 ml each. In the first test tube contributed to Tnkase (MBI Fermentas) activity 1 x 10 -4 IU/ml, thoroughly mixed, and an aliquot of the obtained solution with a volume of 2 MCL suffered during the second tube. The operation of serial dilution of Dnkuz increments of 10 times repeated with the third and fourth test tubes. Cooking time series of dilutions Dnkuz not exceed 2 minutes

Prepared a series of breeding incubated for 20 min at 37 C, then the reaction was stopped by contributing to each tube in 20 ml of a mixture of saturated neutral phenol-chloroform (1:1). The degree of degradation of the DNA was evaluated by electrophoresis 1.8%-agarose gel. For further work were combined and used the samples with visible degree of degradation: concentration Dnkuz equal to 1 x 10 -5 -1 x 10 -6 IU/ml. United DNA subjected phenol extraction, besieged by isopropanol in standard conditions and dissolved 10 ul of deionized water.

To 10 ul of each sample added 1 mm (4 units) polymerase 1 of E.coli in the appropriate buffer and incubated for 1 h at 37 C. The reaction was stopped by the phenol extraction.

DNA obtained after phenol extraction, was dissolved in water and ligase buffer total 30 MKL, added DNA ligase phage T4. Shared the mixture into three equal portions of 10 ml. In the first test tube made 1 mm (pmal) primer (supl, supl-11 or supl-17), mixed, endured 2 MCL in the second test tube, and then 2 MKL from the second to the third test tube. Ligation proceeded within 14 h at 4 C. Then ligase mixture used as a matrix for PCR with primers ES1 and ES3. Assessment of passing response was assessed by electrophoretic.

PCR-product obtained in the previous phase, purified using the set Gel extraction kit (MBI Fermentas) according to the Protocol of the manufacturer. The purified product was subjected to the restriction enzyme BamHI at 37 C for 2 hours Similarly treated plasmid DNA vector pQL30. Ligation lasted for 14 hours at 4 C. The cells of E. coli strain TG1 transformed ligase mixture and were sown on the Cup with the environment LB containing 100 mg/ml of ampicillin and 0.05% X-gal. The ratio of blue (expressed insert) and white (no insert or inexpressibles insert) colonies was 63:1460. From the colonies with the restored activity of beta-galactosidase was allocated plasmid DNA. Proper insertion of the clones compared with non-recombinant vector pQL30 was detected by PCR with standard primers pQE-for and pUC-for. As a negative control was used non-recombinant vector pQL30. Thus, managed to gain 40 clones with the size of the insert, visually exceeding control. The size of the insert ranged from 50 to 700 gel no significant differences between groups.

All the selected clones representing derivatives strain of E.coli TG1 carrying selected from the Bank plasmids, was used for producing recombinant proteins. As a negative control, not containing target insert was selected as producer of a full-size b-galactosidase gene (βGal) and merged bifunctional derivatives containing genes of pectin from the endoplasmic reticulum of yeast Saccharomyces cerevisiae: pLacZ-emp46 and pLacZ-emp47.

For the quantitative determination of activity βGal 100 ul of rough cell lysate was divided into soluble and insoluble fraction, converted to an equivalent volume (insoluble cell fraction suspended in water to volume of 100 ml). On 20 ml of soluble and insoluble cellular fractions obtained from each culture mixed with 50 ml of the substrate mixture, containing 0,02% X-gal, 25 mm Tris-HCl, pH 8,5. As a negative control used cell lysate strain TGl(pQL30). The mixture was incubated at 37 C for 2-4 h, and then measured the signal on the spectrophotometer at a wavelength of λ=620 nm (figure 5).

Assessment of target product yield was carried out using electrophoretic separation of proteins in laemmli's method with subsequent Western blot testing on the nitrocellulose and detection of the target protein using blood serum of people infected with hepatitis C. For this rough cell lysate was centrifuged at 14000 G for 15 minutes Proteins which become soluble and insoluble cell fraction was soljubilizatory in 30 ml of buffer laemmli's method and shared a 15% PAG under denaturing conditions. After the transfer of proteins on nitrocellulose membrane and reversible staining of proteins transferred Ponso C watched the band corresponding to the estimated weight of protein (about CD) the clone s3 soluble fraction (Fig.6).

To lock the nonspecific binding incubated membrane with a transferred protein in 1% solution of bovine serum albumin, prepared on PBS buffer. Then membrane proteins were incubated with a pool of blood sera 7 of patients infected With HCV genotype 1b (the total breeding polerowanej sera in buffer PBST amounted to 1/300), continue with secondary individuuma antibodies to human IgG conjugated to horseradish peroxidase (PBST-buffer, breeding antibodies 1/10000). Staining with DUB (up to 0.1 mg/ml) was performed in the buffer PBS in the presence of 0.01% hydrogen peroxide. As a result, the clone s3 from the group SVR watched the band corresponding to the estimated weight of protein (about 130 kDa), showing a pronounced reaction with antibodies from patients infected with HCV, but not healthy donors (6).

Short description of graphical images:

Fig 1. The distribution of the number colonies depending on the LacZ gene expression: grey columns correspond to the colonies of white colour, obtained on the test environment (βGal - )and the black columns blue (βGal + ). Shaded columns corresponding to the colonies, expressing activity βGal, and bearing insert target size (>100 gel) on the results of PCR.

2. The chart shows the percentage of clones βGal + (black color) and clones βGal + insert target size (shaded) to the total number of clones of the library.

3. The graph shows the distribution of the value of the insert target gene within the Bank by results of a panorama with standard primers (pQE-for and pUC-for).

Figure 4 (a)-(g). The results electrophoresis 1.8% agarose gel treated Poland-products clones with insert.

Figure 5. Determination of specific activity βGal (normalized volume fraction) in soluble (dark bars) and insoluble (light bars) cell fractions. On the axis of ordinates specified A 620 .

6. Electrophoretic analysis (a-b) and Western blot () proteins. Proteins separated in denaturing 15% SDS page, with the subsequent coloring Ponso C total protein, are transferred to nitrocellulose filter and detection of the target protein using blood serum of people infected with hepatitis C.

Sources of information

1. US Patent 4521509, Benkovic, et al, 1985, the Method for degrading DNA.

2. US Patent 6265159, Sugino, et al. 2001, Method for producing DNA nested deletions by an in vitro reaction using transposase.

3. J.M. Whitcomb et al. A new PCR-based method for the generation of nested deletions, Nucleic Acids Research, 1993, Vol.21, No.17 4143-4146.

The method of constructing libraries deletion derived genes by PCR with a random seed, where the investigated gene in the form of linear DNA make-strand breaks, attached to the matrix of the random seed, followed by preparative the runtime library PCR with symmetric adapter primer, wherein the (1) single-strand breaks contribute by treating pancreatic Ankaty I in a series of dilutions; (2) breaks expand processing polymerase I E. coli in the absence of nucleotidase; (3) seed has a 3'-end of the 6-, 11 - or 17-membered random sequence, and at the 5'end - const area (20 nucleotides), intended for annealing adapter primer; (4) adapter primer prepared attached to the matrix by processing T4 DNA ligase that can effectively remove primer-dimer, formed through mutual annealing random sequences.