Method of producing artificial oligonucleotides potentially capable of forming imperfect g-quadruplexes

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, specifically a method of producing artificial oligonucleotides that are potentially capable of forming non-canonical structures that stable in physiological conditions and conditions close to physiological, said structures being imperfect G-quadruplexes (lmGQ) which include one nucleotide substitution in the G4 plane in the G-quadruplexes (GQ). Said method includes using an algorithm describing nucleotide sequences in form of a defined set of formulae for further synthesis of selected oligonucleotides.

EFFECT: invention enables to use bioinformation analysis to obtain artificial oligonucleotides that are potentially capable of forming a new conformation - imperfect G-quadruplexes.

4 dwg, 2 tbl, 2 ex

 

The technical field to which the invention relates.

The present invention relates to the field of genomics and structural biology and can be used for genomic analysis of texts, a study of the structural and functional properties and mechanisms of DNA and RNA. Predicting the existence of new non-canonical tertiary structures of polynucleotides, namely imperfect G-quadruplexes (ImGQ), potentially stable in physiological conditions, will also allow you to find the exact molecular targets and biomarkers of pathological conditions of the person, to develop new drugs directed action. The subject of the present patent search algorithm ImGQ, potentially stable under physiological conditions (1), and a method of producing oligonucleotides capable of forming ImGQ (2).

The level of technical condition

In recent years shows that the native DNA in addition to the predominant B-forms there are other non-canonical spatial structures (conformers, ncDNA). Such sites are considered as structurally-mediated controls genomes, for example, regulators of gene transcription [1]. Among the famous ncDNA can be called G-QUADRUPLEX (GQ) and I-motifs [2, 3], triplexes and fragments of parallel duplexes [4-6]. The most studied of ncDNA G-QUADRUPLEX.

Vnutrimolekulyarnim is th G-QUADRUPLEX (eng. G-quadruplex, and G-tetrads, GQ) - oligonucleotide or fragment poliolefinovoy acid, capable of forming chutyrehzveznuyu helix, stabilized by the interaction of four Gurinovich grounds. Each G-Quartet bonded in the sum of eight hydrogen bonds and forms a flat structure (Figure 1).

GQ found in vivo in the promoters of human genes c-kit, c-myc, hTERT and others [7-12]. The sequence of nucleotides capable of forming QG, widely represented in the untranslated 5'-region of many genes and can participate directly in the regulation of their expression [13]. To the formation of GQ tend also many micro - and minisatellite repeats in the human genome, for example, telomeric repeat (TTAGGG)nor satellite (GGGTCT)n. It was shown that mutations in the field of GQ underlie many diseases [14]. Now GQ-sites polynucleotides considered as a promising therapeutic target in Oncology [15].

It is known that the formation of GQ you want the movie polynucleotide meet certain requirements. Sequence, potentially capable of forming GQ, must comply with the following formula (GxLyi)Gxwhere x=2, 3, 4... - the number of G-quartets GQ; y=1, 2, 3... is the number of nucleotides in the i-th loop connecting the G4plane.

To search for PQS (Potential Quadruplex Sequence) in f is ogmento of polynucleotides and genomic texts was developed algorithm [5, 16] (the closest prototype) and created online programs, for example, QGRS (http://bioinformatics.ramapo.edu/QGRS/analyze.php and quadfinder (http://miracle.igib.res.in/quadfinder/).

To confirm the existence of each found GQ must obtain the appropriate oligonucleotide and to determine its conformation instrumental and physico-chemical methods.

In this application we first prove that G-QUADRUPLEX not describe all conformational States of polynucleotides, stable stacking interaction of the four Gurinovich grounds. Imperfect G-QUADRUPLEX (eng. ImG-quadruplex, and ImG-tetrads, ImGQ) - oligonucleotide or fragment poliolefinovoy acid, similar to GQ sequence, but bearing, unlike GQ, one replacement Quartet-forming guanine to another nucleotide or its analogue (Figure 1A-D), may also have a stable conformation in vivo.

None of the known algorithms of analysis of the primary sequences of DNA on the basis of the education potential of the non-canonical conformations does not take into account the rules of formation of imperfect quadruplexes, and search programs, created on their basis, do not provide identification of sites capable of forming ImGQ.

Disclosure of the invention and the technical result

The technical result of the present invention is the creation of new and the instrument of bioinformatics analysis, identifying in the primary sequences of polynucleotides sites capable of forming a potentially stable in physiological conditions, the new conformation is imperfect G-QUADRUPLEX (ImGQ). To achieve that it was necessary to develop a method of obtaining ImGQ-natural oligonucleotides and model sequences and their examples to prove the existence ImGQ and confirm their high stability (see data in table 2).

The technical result is also achieved by the fact that on the basis of the study of properties of oligonucleotides and analysis of literary data generated rules ImGQ (algorithm).

The proposed search algorithm ImGQ provides a description of the sequences of potential imperfect quadruplexes set of formulas that can be represented in the form of a table (table 1) format k×4, where n (number of rows) corresponds to the number of quartets formed four successive parts of the site and may not be less than 4 (k≥4). The sum of the elements of the table describes all monopsonists ImGQ able to adopt a conformation ImGQ in physiological and close to physiological conditions (e.g., 50-100 mM K+Cl, 10 mm TrisHCl, pH 7-8).

It is important to note that in this approach previously described GQ (perfect GQ) be a special case of ImGQ realized when N=G.

For the osnovaniya of the proposed algorithm, aimed at the search of stable conformers, it is necessary to clarify a number of key positions.

1. The possibility of forming only intramolecular GQ.

In vivo concentration of polynucleotides relatively small, in addition to DNA and RNA are part of complex supramolecular complexes with different biopolymers and low molecular weight compounds, which in most cases prevents the formation of intermolecular GQ.

2. ImGQ, stable under physiological conditions, are able to form in the case of four or more Quartet GQ, bearing a single substitution in the G4the planes.

It is known that nucleotide substitutions in the G4planes and even change the nature of the chemical bond between guanine destabilize and two trequartista GQ [16-19]. Example 1 illustrates the effect on stability chetyrekhchastichnykh GQ - gGQ (sequence 1) and Ctg (sequence 2) (table 2) one - and two-nucleotide substitution (G to other nucleotides in QUADRUPLEX-forming units GGGG. From the Table 2 data shows that single substitutions lead to a slight decrease of the melting temperature GQ (up to 82°C for bclGQ (sequence 3) and to 62-82°C for oligonucleotides Ct series). Note that the stability of these structures ImGQ remains high and significantly greater than the physiological norm.

Replacement of two guanine in G4-p is Ascoli reduce the stability of the tertiary structure of oligonucleotide and erosion of the CD spectra (table 1. Figure 2A, oligomers aGQ (G/A, G/A) (sequence 4) and tGQ (G/A,G/T) (sequence 5)). For example, the melting temperature tGQ (sequence 5) does not exceed 52°C, therefore, it cannot be reliably attributed to stable in physiological conditions, GQ, and the oligomer aGQ (sequence 4) forms an intermolecular structure.

Table 1.
Formulas of the sequences of fragments of polynucleotides (PImQS), potentially able to adopt a conformation imperfect quadruplexes.
A numberA sequence of potential imperfect ImGQ
1NGk-1(LxGk)3GkLxNGk-1(LxGk)2(GkLx)2NGk-1LxGk(GkLx)3NGk-1
2GNGk-2(LxGk)3GkLxGNGk-2(LxGk)2(GkLx)2GNGk-2LxGk(GkLx)3GNGk-2
3G2NGk-3(LxGk)3GkLxG2NGk-3(LxGk)2(GkLx)2G2NGk-3LxGk(GkLx)3G2NGk-3
kGk-1N(LxGk)3GkLxGk-1N(LxGk)2(GkLx)2Gk-1N(LxGk)(GkLx)3Gk-1N
where k is the number of quartets formed four consecutive G-rich fragments of the sequence (k≥4); L (1÷7) any nucleotide in the loop GQ; N is any nucleotide in the group GQ. If N=G, the formula described is no perfect GQ.

On the formation chetyrekhletnego highly imperfect QUADRUPLEX evidenced by the fact that thermostability ImQG bclGQ (G/A) (sequence 3) - the natural sequence of the promoter region of the gene bcl2 - significantly (27°C) exceeds the stability trequartista homolog trGQ (sequence 6), the formation of which was predicted using the previous search algorithm QG (for example, program quadfinder based on a known algorithm [16]).

Character CD spectra ImGQ (Figure 2A and D) in the presence of potassium ions, stabilizing GQ, and differential melting curves ImGQ (Figure 2B) typical for GQ. Moreover, ImGQ as perfect QUADRUPLEX (in this example, Ctg (sequence 2)) lose stability conformation in the presence of lithium ions (Figure 2G).

Reliable evidence of the formation ImGQ is a comparison of PMR spectra (in the region of 12 ppm) natural ImQG Ct1 (sequence 7) and the spectrum of the oligonucleotide GQ1 (sequence 8). Both sequence in accordance with known search algorithm PQS are capable of forming 2-tetrad GQ, because the maximum length of four G-blocks in their composition equal to two. This means that in the field Justinska interactions (region 12 ppm) should be 8 signals, which corresponds to the range of GQ1 (sequence 8) (Figure 3, bottom). However, in the spectrum of the oligomer Ct1 (sequence 7) (Figure 3, top spec is p) is found not 8, and 14 of the signals of the protons involved in the formation of planes ImGQ patterns. This fact is well described chetyrehryadnaya scheme structure ImGQ (Figure 3).

The above argument allows us to conclude that the new search algorithm is highly stable ImGQ should relate to the four - or-more-Quartet structures ImGQ and faithful for n≥4.

The length of the loops ImQG by analogy with GQ is considered in the range from 1 to 7 nucleotides [20]. The composition of the loops may include any nucleotide.

Interval 1-7 is not mandatory and can be extended. However, the limitation of the length of the loops to 7 links increases the probability of detecting the most stable in physiological conditions GQ [20, 21], this pattern can be attributed to ImGQ.

3. The algorithm involves searching for potential ImGQ, can exist simultaneously, ie, for example, block GGGTGG when searching chetyrekhchastichnykh ImGQ counted as one, not as three fragments of different GQ, resulting from alternative folding.

Taking into account the above rules was developed computer program to search for ImGQ in the genomic nucleotide data (table 1), named ImGQfinder (filing date of the application for state registration: 06.09.2012). With its help it is possible to analyze large amounts of data, to obtain the list of sequences ImGQ with the decree, the provisions of the genome, statistics of occurrences of defects (N) and other results. The program is written in C#. The output format can be changed.

The analysis of the primary nucleotide sequences of the forward and reverse circuits 18 chromosomes person (http://www.ncbi.nlm.nih.gov/nuccore/NC_000018.9 with the help of the described program ImGQfinder were identified 3243 chetyrehtrubnye (n=4) ImGQ. Moreover, only 17% of them is perfect GQ (N=G) and could be identified with previously known algorithms (Example 2. Figure 4A). Thus, sequence analysis of only one chromosome has allowed to identify more than 2.5 thousand new potentially highly non-canonical structures. The analysis of the found sequences ImGQ showed that in the nature of replacement can meet both internal (ImEn, 48%), and external (ImEx, 35%) planes of the structure. Moreover, replacing G nucleotide N most often represented by T and a, and rarely (less than 13%) (Figure 4A-C).

To confirm the formation of non-canonical structures ImGQ and to study their thermal stability under physiological conditions were synthesized oligonucleotides bclGQ (sequence 3) and Ct1 (sequence 7). The sequence of the oligomers correspond to natural sites found using ImGQfinder, the promotor region of the gene bcl2 (one of the key genes of carcinogenesis) and intron gene CTIF (component SWR/SWR complex initiation lecture is AI [22]). The study results confirmed that the oligomers really form a highly stable (Tmelting point>70°C), steric-employed non-canonical patterns ImGQ (Examples 1.1 to 1.5. Figures 2 and 3).

Based on the found generation rules ImGQ were designed and obtained oligomers, simulating different position and nature mononucleotide substitutions in the composition of the artificial ImGQ (table 2). Studies have shown that in all cases we observed the formation of stable ImGQ (Example 1, table 2, Figure 2-3)that can serve as a reliable confirmation of the adequacy of the developed generation rules ImGQ and programs ImGQfinder.

The way of finding and predicting the formation of new non-canonical tertiary structures of polynucleotides, namely imperfect G-quadruplexes potentially stable in physiological conditions, will help to find new molecular targets and biomarkers of pathological conditions of the person, to develop the new drugs directed action.

Description of the drawings

The Figure 1 shows the schematic structure chetyrekhchastichnykh intramolecular GQ with antiparallel (a and B)parallel (C) and mixed (G) the mutual location GGGG fragments of the nucleotide sequence. When replacing one guanine in the same plane G4on the other the th or artificial nucleotide (examples of the substitution positions highlighted in gray) structures correspond to potentially stable ImGQ. L1, L2, L3 - fragments of the sequence of any nucleotide composition included in the loops GQ.

The Figure 2 presents the spectra of the CH GQ and ImGQ two natural fragments of the human genome - the promoter of the gene Bcl-2 (a) and intron gene CTIF (D) and their mutants (100 mM KCl, 10 mm TrisHCl, pH 7.5). Scheme of parallel QUADRUPLEX with two imperfect tetrad presented in Figure 2B. Specified external (endo-) and internal (Exo-) G4plane quadruplexes. Figure 2B shows the differential spectra melting GQ Ctg (sequence 2) and ImGQ Ct1 (sequence 7), Ct2, Ct3 and Ct4 (sequences 9-11), and Figure 2 presents the spectra of the CH GQ and ImGQ intron of the gene CTIF and his positional mutants obtained in the presence of 100 mM lithium ion battery, which prevents the formation of GQ patterns. Figure 2E shows the dependence of the rotational correlation intercalator (ethidium bromide) in complexes with GQ1 (sequence 8) (control), bclGQ (sequence 3), TrGQ (sequence 6), Ct1 (sequence 7), Ct2 (sequence 9), Ct3 (sequence 10) and Ctg (sequence 2) from the amount of molecules (number of nucleotides).

The Figure 3 shows a comparison of the H1The NMR spectra of 2-Quartet QUADRUPLEX GQ1 (sequence 2) and oligomer Ct1 (sequence 7) - ImGQ. The rooms were eight signals of the protons of the two G4 planes in the spectrum GQ1 (sequence 2) (spectrum at the bottom of the figure) and 14 of the four signals G4 planes ImGQ Ct1 (sequence 7) (spectrum at the top of the figure), which is in accordance with previously known approaches was also sod is neigh only 8 proton signals in the region of 12 ppm.

The Figure 4 shows the results of sequence analysis of 18 chromosomes of man using a new algorithm to search for the sites that are able to form new non-canonical patterns - ImGQ. Presents the histogram distribution in the sequence 18 human chromosome sites capable of forming 4-Quartet committed GQ (Perfect GQ) and imperfect ImGQ, carrying a single nucleotide substitution (A). Histograms B and C reflect the composition mononucleotide substitutions at sites ImGQ 18 chromosomes and their distribution in the outer (ImEn) and internal (ImEx) planes of the structures.

Description of examples of implementation of the invention

Example 1 describes obtaining oligodeoxyribonucleotides natural and model sequences listed in Table 2 (Example 1.1) and study of their thermodynamic and spectral properties (Examples 1.2-1.4).

In Examples 1.2-1.3 shows the high stability of natural imperfect GQ of the promotor region of the gene BCL-2 and intron gene CTIF under physiological conditions. Presents evidence for the existence of the oligonucleotide with a sequence of bcl2 ImGQ (sequence 1) in the solution is in the form of defective 4-Quartet, not perfect 3-Quartet GQ, found under the standard algorithm [16] using the program quadfinder. We studied the possibility of formation of double-defective quadruplexes - derived ImGQ bcl2 (sequences 2-5) (That is person 2).

Similar results were obtained for synthetic non-natural sequences, Ct2, Ct3, Ct4 (sequences 9-11), Cta (sequence 12), Ctc (sequence 13) and shows that they form ImGQ, and oligomer Ctg (sequence 2) - perfect GQ, which is fully consistent with our calculations.

Typical GQ influence of potassium ions (stabilization) and lithium (destabilization) was observed for ImGQ. CD-spectra of oligonucleotides Ct2, Ct3 and Ct4 (sequences 9-11) - positional isomers of natural Ct1 and perfect GQ Ctg, obtained by replacing T in the third position Ct1 on G correspond to the spectra of GQ with various contributions parallel and antiparallel structures in the presence of K+(Figure 2D). The presence of Li+inhibits the formation of non-canonical structures that clearly reflect similar spectra of oligomers in Figure 2G.

Example 1.4. describes the experiments confirm the formation of intramolecular structures. Monomolecular of quadruplexes follows from the data shown in Figure 2E, reflecting the proportionality of the change of rotational relaxation complexes of oligomers with bromide by ethidium volume of the molecule, i.e. the number of nucleotide units in the composition of the oligomers. In addition, the independence of the indicators of the melting temperature ImGQ on their concentration also indicates the formation of intramolecular conformations.

Example 1.5. describes how to obtain H1I have the P-spectra of 2-Quartet GQ 5'-GGGAGGCTGAGGCAGG (GQ1) and oligomer Ct1. On the basis of previously known representations oligomer Ct1 must also provide 2-Quartet GQ, because the maximum length of four G-blocks in its composition does not exceed two. However, unlike the spectrum GQ1 presented in field 12 ppm 8 signals, corresponding to two G4-planes in the spectrum Ct1 observed 14 signals (region 12 ppm). This fact confirms the assumption that the oligonucleotide Ct1 forms ImGQ-conformation, consisting of three G4and one G3T (see scheme in Figure 1A, B).

Thus, the formation of imperfect 4-Quartet ImGQ proven set of experimental data, including the formation of ImGQ follows from the significant differences of melting and CD spectra of the oligonucleotides, the sequences of which correspond to the full and shortened bcl2 PQS (MP. bclGQ ~82°C >> MP. trGQ ~58°C, trGQ = tikvatenu GQ, shortened sequence), thermodynamic and spectral characteristics (table 2, Figure 2A and Figure 3).

Table 2. The melting temperature bcl2 ImGQ and its derivatives in Tris-HCl buffer (pH 7.5).

Example 2 presents the results of the analysis of the primary sequences of the forward and reverse circuits 18 chromosomes of man (total length is ~140 million nucleotides) ImGQ using the found algorithm and prog is Amma ImGQfinder and their comparison with results GQ in an environment known programs quadfinder.

Example 2.1 describes the search options

Example 2.2 describes the data processing and mapping the occurrence of G/A, G/T and G/C substitutions in the imperfect QUADRUPLEX. In addition, in example 2.2 a comparison of the amount advanced and montevecchi imperfect 4-Quartet GQ in the 18th chromosome (Figure 4A-C).

It is shown that the most frequent replacement G/T (47% of the total number ImGQ). Replace the G/A is also well represented (23% of the total number GQ). Replace G/C presents a lesser extent (13%). Replacement inner (Central) quartets dominated (48% of the total number of changes).

The share of committed GQ accounts for only 17% of the total number of potentially stable quadruplexes. Thus, the main part of the possible 4-Quartet noncanonical structures (more than¾) was identified as a result of application of the new algorithm. The obtained data were the basis for studies of the mechanisms of genome functioning and are an important new molecular targets for drug development directed action.

Below are examples of implementation of the invention.

Examples of implementation of the invention

Example 1. Getting oligodeoxyribonucleotides natural and model sequences (Table 2) and the study of their thermodynamic and spectral properties.

Example 1.1. The synthesis of the of ihatesalliemaedotcom

Solid-phase method was used on an automatic DNA synthesizer AFM 800 (Biosset", Russia) were obtained oligonucleotides, the sequences of which are shown in Table 2.

In the synthesis used standard commercial nucleoside-amidophosphate and nucleoside polymers (all reagents Glen Research, USA). Removal of the synthesized oligomer from the media and release was carried out by ammonolysis (28% ammonia, 5 hours, 50°C). 5'-O-Dimethoxytrityl (DMTr-) derivatives of oligonucleotides were isolated HPLC (Agilent Chemstation) in a gradient of acetonitrile in 0.1 M ammonium acetate. Column Teknokroma (Spain), 1×25 cm, 45°C, 1.5 ml/min Destruction of DMTr-groups were 80% aqueous solution of acetic acid (20 min). The structure and purity of the oligonucleotides was confirmed by the data of MALDI-TOF-mass spectra. Mass spectra were obtained in the registration mode, the positive ions in the mass spectrometer Bruker Microflex (Germany). Oligonucleotides were absoluely on ZipTipC18 (Millipore, USA) before MALDI-TOF-MS analysis.

Example 1.2. Determination of thermodynamic parameters of formation of conformers DNA profiles of thermal dissociation. Spectra circular dichroism oligonucleotides.

Profiles of thermal dissociation of quadruplexes were recorded on a spectrophotometer Jasco V-550 (USA), equipped with a thermostatic console, at λ=295 nm in the temperature range of 20-90°C. the Melt at a given d is ine wave was considered a proof of quadruplexes patterns. Thermodynamic parameters of formation of quadruplexes, in particular the melting point was calculated by the method of nonlinear regression in the program KaleidaGraph v. 4.0 (Synergy, UK), based on the model of two States (1).

CD spectra of oligonucleotides were registered on spectropolarimeter Jasco 715 (USA) with a thermostatted cell at 20°C in the wavelength range 220-330 nm.

Immediately before the registration of the CD spectra and melting curves solutions of oligonucleotides in 20 mm Tris-HCl buffer (pH 7.5) containing various concentrations of KCl and LiCl was heated to 90°C, kept at this temperature for 3 min and quickly cooled to 0°C.

Example 1.3. The composition of the stable steric conformations of oligonucleotides as potential ImGQ the rotational relaxation complexes ethidium bromide (EtBr) : QUADRUPLEX.

Rotational relaxation (ρ) complexes was calculated by the equation Perrin-Weber [23]:ρ=3t(1Po-13)1P-1Powhere P is the observed polarization of the fluorescence of EtBr in complex with the oligonucleotide, Pabout=41±1% - polars the grouting in the absence of rotational diffusion, τ is the lifetime of the fluorescence of EtBr in complex with the oligonucleotide.

The polarization of fluorescence of EtBr in complex with the oligonucleotide was determined by the ratio of the intensities of the vertical and horizontal component of fluorescence when excited with vertically polarized light. The intensity of fluorescence (λ=610 nm) was measured on an Cary Eclipse (Varian, USA) with excitation light with a wavelength of 540 nm at 20°C. fluorescence Polarization was calculated by the formula [24]:

P=(I-I)/(I+I)

The lifetime of fluorescence of complexes EtBr : QUADRUPLEX was determined using an Easy Life V (Optical Building Blocks, USA) in a pulsed mode.

Example 1.4. H1The NMR spectra of oligonucleotides were obtained (0.1 mm solution of the oligonucleotide in water, H2O/D2O, 9/1, 100 mM KCl, 20 mM TrisHCl, pH 7.5). Spectra were obtained using the instrument Bruker AMX400 (Germany), at a temperature of 19°C with the suppression of the water signal. For the interpretation of the spectra used MestReNova software version 7.0.3 (Mestrelab Research SL, Spain).

Example 2. Description of the search algorithm ImGQ and its application for analysis of primary nucleotide sequences and constructing artificial DNA fragments - potential ImGQ.

Example 2.1. The description of the algorithm of search of potential sites ImGQ as part of polynucleotides.

Formula sequence fragment is in polynucleotides (ImGQ), potentially able to adopt a conformation imperfect quadruplexes are shown in Table 1.

When scheduling algorithm takes into account only the intramolecular ImGQ, can exist simultaneously. For example, the fragment GGGTGG is recorded only once, without considering the possibility of implementing alternative conformers.

For sampling stable under physiological conditions of imperfect sequences GQ have entered the following boundary conditions:

- to consider only mono-imperfect ImGQ, i.e. in all planes GQ only one possible substitution of guanine to another nucleotide;

n≥4 (n is the number of quartets formed four consecutive G-rich sequence fragments);

- x=1÷7 (x - length loops in the structure ImGQ);

If N=G, the formula describes a perfect GQ.

Based on this algorithm written a program search stable ImGQ in the primary nucleotide sequences - ImGQfinder (Application for State registration from 06.09.2012)

Example 2.2. Search GQ and potentially stable ImGQ in the primary sequence of chromosome 18 were performed using the program ImGQFinder (Application for State registration of the computer program from 06.09.2012).

Analyzed the sequence of the 18 chromosomes of man from the NCBI database (http://www.ncbi.nlm.nih.gov/nuccore/NC_000018.9) Search ImGQ conducted separately on the nternet and reverse circuits. Considered perfect and nondefective 4-Quartet GQ. Each multivariate GQ (PQS, are capable of forming multiple GQ different patterns) were taken into account only once. This was achieved by mapping the coordinates of the found GQ. At the intersection of the coordinates of the defective and perfect GQ defective QUADRUPLEX cast, recorded perfect as thermodynamically more likely.

Comparing the representation of perfect and imperfect GQ in the 18th chromosome. Determining frequencies of occurrence of different types of defects in an imperfect GQ.

Counted separately the number of executed GQ and GQ with substitutions of G/A, G/C and G/T. the search Results for forward and reverse circuits summarized. The number of GQ with external defects was calculated as the sum of substitutions in the first and fourth quartets, with internal defects as the sum of substitutions in the second and third quartets.

Literature

1. Raiber E.A., Kranaster, R., Lam, E., Nikan M. Balasubramanian S. A non-canonical DNA structure is a binding motif for the reduced factor SP1 in vitro // Nucleic Acids Res. - 2011.

2. Kouzine F. Levens D. Supercoil-driven DNA structures regulate genetic transactions // Front Biosci. - 2007; 12 4409-4423.

3. Brown R.V. Hurley L.H. DNA acting like RNA // Biochem Soc Trans. - 2011; 39 (2): 635-640.

4. Nelson L.D., Bender S., Mannsperger h, Buergy D., Kambakamba P., Mudduluru, G., U. Korf, D. Hughes, M.W. Van Dyke Allgayer H. Triplex DNA-binding proteins are associated with clinical outcomes revealed by proteomic measurements in patients with colorectal cancer // Mol Cancer. - 2012; 11 (1): 38.

5. Cer THIS, Bruce K.H., Donohue D.E., Temiz N.A., Mudunuri U.S., Yi M., N. Volfovsky, Bacolla, A., Luk B.T., Collins J. R. R. Stephens Searching for non-B DNA-forming motifs using nBMST (non-B DNA motif search tool) // Curr Protoc Hum Genet. - 2012; Chapter 18 Unit 18 17 11-22.

6. Shchyolkina A.K., Borisova O.F., M.A. Livshits, Pozmogova G.E., Chernov B.K., R. Klement Jovin T.M. Parallel-stranded DNA with mixed AT/GC composition: role of trans G.C base pairs in sequence dependent helical stability // Biochemistry. - 2000; 39 (33): 10034-10044.

7. S.T. Hsu, P. Varnai, Bugaut, A., Reszka A.P., Neidle S. Balasubramanian S. A G-rich sequence within the c-kit oncogene promoter forms a parallel G-quadruplex having asymmetric G-tetrad dynamics // J Am Chem Soc. - 2009; 131 (37): 13399-13409.

8. Shahid R., Bugaut, A. Balasubramanian S. The BCL-2 5' untranslated region contains an RNA G-quadruplex-forming motif that modulates protein expression // Biochemistry. - 2011; 49 (38): 8300-8306.

9. Tolmachov O.E. Self-entangled of long linear DNA vectors using transient non-B-DNA attachment points: A new concept for improvement of non-viral therapeutic gene delivery // Med Hypotheses. - 2012.

10. Fisette J.F., Montagna D.R., Mihailescu M.R. Wolfe M.S. A G-Rich element forms a G-quadruplex and regulates BACE1 mRNA alternative splicing // J Neurochem. - 2012.

11. Cheng L.C., Pai T.W. Li L.A. Regulation of human CYP11B1 and CYP11B2 promoters by transposable elements and conserved cis elements // Steroids. - 2012; 77 (1-2): 100-109.

12. Zhou W., Brand N.J. L. Ying G-quadruplexes-novel mediators of gene function // J Cardiovasc Transl Res. - 2011; 4 (3): 256-270.

13. Huppert J.L. S. Balasubramanian G-quadruplexes in promoters throughout the human genome // Nucleic Acids Res. - 2007; 35 (2): 406-413.

14. Wu Y. R. Brosh, Jr. G-quadruplex nucleic acids and human disease // FEBS J. - 2010; 277 (17): 3470-3488.

15. Balasubramanian, S., Hurley L.H. Neidle S. Targeting G-quadruplexes in gene promoters: a novel anticancer strategy? // Nat Rev Drug Discov. - 2011; 10 (4): 261-275.

16. Huppert J.L. Balasubramanian S. Prevalence of quadruplexes in the human genome // Nucleic Acids Res. - 2005; 33 (9): 2908-2916.

17. Gonzalez V., Guo K., Hurley L. Sun, D. Identification and characterization of nucleolin as a c-myc G-quadruplex-binding protein // J Biol Chem. - 2009; 284 (35): 23622-23635.

18. ai J., Dexheimer T.S., Chen D., Carver M., Ambrus A., Jones R.A. Yang D. An intramolecular G-quadruplex structure with mixed parallel/antiparallel G-strands formed in the human BCL-2 promoter region in solution // J Am Chem Soc. - 2006; 128 (4): 1096-1098.

19. Zaitseva, M., Kaluzhny D., Shchyolkina A., Borisova O., Smirnov I. Pozmogova G. Conformation and thermostability of oligonucleotide d(GGTTGGTGTGGTTGG) containing thiophosphoryl internucleotide bonds at different positions // Biophysical Chemistry. - 2010; 146 (1): 1-6.

20. Hazel P., Huppert J., Balasubramanian S. Neidle S. Loop-length-dependent folding of G-quadruplexes // J Am Chem Soc. - 2004; 126 (50): 16405-16415.

21. Guedin A., De Cian, A., Gros J., Lacroix L. J.L. Mergny Sequence effects in single-base loops for quadruplexes // Biochimie. - 2008; 90 (5): 686-696.

22. Kim C.M., H. Cho, K. Choi, J. Kim, B.W. Kim, Y.G. Ko, S.K. Jang Kim Y.K. A new MIF4G domain-containing protein, CTIF, directs nuclear cap-binding protein CBP80/20-dependent translation // Genes Dev. - 2009; 23 (17): 2033-2045.

23. Marky L.A. K.J. Breslauer Calculating thermodynamic data for transitions of any molecularity from equilibrium melting curves // Biopolymers. - 1987; 26 (9): 1601-1620.

24. Weber G. Anderson S.R. The effects of energy transfer and rotational diffusion upon the fluorescence polarization of macromolecules // Biochemistry. - 1969; 8 (1): 361-371.

The method of obtaining unnatural synthetic oligonucleotides, potentially capable of forming stable in physiological and close to the physiological conditions of the non-canonical patterns - imperfect G-QUADRUPLEX (ImGQ)that includes a single nucleotide substitution in the G4plane in G-QUADRUPLEX (GQ), including the use of the algorithm description of the nucleotide sequences as set the following structural formulas

(for k≥4; x=1÷7)where k is the number of quartets, about asavanich four consecutive G - rich fragments of the nucleotide sequence; L is any nucleotide in the loop ImGQ; x is the number of nucleotides in the loop; N is any non-G nucleotide in the plane ImGQ; for further synthesis of unnatural synthetic oligonucleotides, potentially able to form ImGQ and characterized by the selected sequences.



 

Same patents:

FIELD: information technology.

SUBSTANCE: pre-examination patient information gathering system comprises an electronic user interface including a display and at least one user input device, and an electronic processor configured to present an initial set of questions to a patient via the electronic user interface, receive responses to the initial set of questions from the patient via the electronic user interface, construct or select follow-up questions based on the received responses, present the constructed or selected follow up questions to the patient via the electronic user interface, and receive responses to the constructed or selected follow up questions from the patient via the electronic user interface. A physiological sensor may be configured to autonomously measure a patient physiological parameter as the patient interacts with the electronic user interface.

EFFECT: high efficiency of a medical facility.

11 cl, 3 dwg

FIELD: information technology.

SUBSTANCE: apparatus includes a subject record database, a time-dependent relationship identifier, an event predictor, a coded subject record database, a decision support system processor and a user interface. The time-dependent relationship identifier processes the data in the subject record database to identify time-dependent relationships in the data. Information indicative of the identified relationships is processed by the processor and presented to a user via the user interface.

EFFECT: identifying relationships in subject information which includes event data indicative of an event experienced by the subject, outcome data indicative of an outcome experienced by the subject, and intervention data indicative of an intervention applied to the subject.

8 cl, 7 dwg

FIELD: physics.

SUBSTANCE: method involves determining current time characteristics, taking into account the state of the atmosphere, determining the spatial position of the imaging means, based on data from spatial positioning means, the obtained image is compared with three-dimensional models of the surrounding environment and electronic maps stored in a dynamically populated knowledge base, identifying objects of the surrounding environment that are part of the image using means of recognising and identifying samples associated with said base, where said base is constantly populated and improved with knew data obtained from identification of said objects.

EFFECT: high accuracy of displaying artificial objects on an image of the surrounding environment in real time owing to analysis of dynamic changes in the surrounding environment.

5 cl, 1 dwg

FIELD: information technology.

SUBSTANCE: portable storage device has a data management application which receives and processes data with measurement results from a measuring device which measures an analysed substance. The portable device can use an interface protocol which directly provides compatibility of the portable device with different operating systems and hardware configurations. The data management application is launched automatically upon connecting the portable device with a master computer.

EFFECT: managing medical data using different processing devices without the need for pre-installation of additional programs, clients, device drivers or other program components on separate processing devices.

60 cl, 19 dwg

FIELD: medicine.

SUBSTANCE: group of inventions relates to medicine. In realisation of methods implanted gastric restricting device is implanted into patient's body. Data, containing information about values of parameter, perceived inside the body, are collected for a time period. In the first version of method realisation determined are values of perceived parameter, which exceed the first threshold, are below the first threshold or below the second threshold in such a way that pulse is determined by time between values, which exceed the first threshold and values, which are below the first threshold or below the second threshold. In the second version of the method additional values of perceived parameter, accompanied by decreasing values, are determined. In the third version of the method areas under the curve of pressure dependence on time are determined, compared and the result of comparison is correlated with the state. In the fourth version of the method values of perceived pressure are formed for demonstration on display or further analysis. In the fifth version of the method average value of pressure for time X within the specified time period is calculated on the basis of values of perceived pressure within the window of averaging in specified period of time.

EFFECT: group of inventions makes it possible to increase treatment safety and efficiency due to control of implanted device.

32 cl, 77 dwg

FIELD: medicine.

SUBSTANCE: group of inventions relates to medical equipment. Wireless system of cardiac control contains ECG monitor and mobile phone. ECG monitor contains transceiver for wireless transmission of ECG signal data. ECG monitor contains connected with transceiver unit of notification about status for transmission of notification in case of change of ECG monitor status. Mobile phone contains electronics, transceiver for wireless reception of ECG signal data or notifications from ECG monitor and controller for transmission of ECG signal data into the control centre by electronics via mobile connection net. Controller can respond to notification from ECG monitor by communicating notification to patient by means of mobile phone or transmission of notification into the control centre. Notification is communicated to patient by means of mobile phone display, tone signal or verbal prompt, formed by mobile phone. Controller can delay transmission of specified notification into the control centre to give time for reception of notification about status of disorder elimination. When patient is informed about change in status patient is given possibility to answer immediately or to delay respond to notification.

EFFECT: invention makes it possible for patient to recognize and correct situation with changed status without transmission of notification or response of the control centre.

6 cl, 38 dwg, 1 tbl

FIELD: oil and gas industry.

SUBSTANCE: system contains one or more sources providing data representing aggregated fractures in formation, processor of computer connected to one or more sources of data, at that processor of computer contains carriers containing output code of the computer consisting of the first program code for selection of variety of materials to control drill mud losses out of list of materials in compliance with data representing total number of fractures in formation and the second program code related to the first program code and purposed for determination of optimised mixture for selected materials to control drill mud losses to apply them for fractures; at that optimised mixture is based on comparison of statistical distribution for selected sizes of materials to control drill mud losses and sizes of aggregated fractures.

EFFECT: reducing loss of materials and improving operational efficiency of wells.

20 cl, 6 dwg

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine. System of cardiac monitoring contains battery-supplied ECG monitor, which is worn by patient and has processor of patient's ECG signal, device for identification of arrhythmia and wireless transceiver for sending messages about the state and obtaining information about configuration of device of arrhythmia identification. System of cardiac control additionally contains mobile phone, which has electronic devices of mobile phone, transceiver and controller. In the process of method version realisation, parameter of specified arrhythmia to be identified, and limit of switching on alarm signals for specified arrhythmia, are determined and stored in configuration file in the centre of monitoring. ECG monitor is fixed to patient and activated to start ECG monitoring. Message about state is sent by wireless communication line from ECG monitor into the centre of monitoring. Reply to message, which includes only configuration file, is sent to ECG monitor. Configuration file is used to adjust device for arrhythmia identification.

EFFECT: invention makes it possible to provide completely wireless ECG monitoring to increase patient's comfort and convenience.

18 cl, 48 dwg, 1 tbl

FIELD: information technologies.

SUBSTANCE: in the method a type of the map is built and placed using logics determined by the map type component, corresponding to each visual element, besides, such logics may depend on one or more values of parameters of the map type component. Some of these values of parameters correspond to available values of map model parameters, and other ones are calculated using a model, which determines analytic ratios between parameters of the map model. Sequence of operations for building of map type may be fully controlled by data and may include a mechanism for canonisation of input data and linkage of canonised input data to model parameters.

EFFECT: expansion of functional capabilities, due to provision of generation of a layout controlled by infrastructure data, which depends on input data.

20 cl, 16 dwg

FIELD: medicine.

SUBSTANCE: invention relates to medicine. In method realisation current values of each of parameters of clinical data characterising current state of cardiovascular system are measured and fixed. Results of assessment of values of clinical data parameters are transformed. Results of assessment of current values of each parameter of clinical data are fixed depending on time of performed measurements. Results of transformation of assessment of current values of each parameter of clinical data are visualised on plane, coinciding with plane of displaying multicolour screen of videomonitor. Information about dynamics of cardiovascular system state is obtained. Also performed is digitisation and weighting of fixed instant values of each parameter of clinical data in physical values. Three-dimensional image of cardiovascular system state AN(t) is created in form of totality of geometrical places of points in N-dimensional space of cardiovascular system states, with coordinates of each point of N-dimensional space of cardiovascular system states being determined by totality of non-invasively and invasively measured in physical values digitised instant values of various clinical data, which characterise current state of cardiovascular system. Two-dimensional images of cardiovascular system states A2(t) are formed in form of projections of formed AN(t) on plane, coinciding with plane of displaying multicolour screen of videomonitor. Coordinates in 2-dimensional state of cardiovascular system states of each point of formed A2(t) are memorised. Virtual three-dimensional models of various nosologic forms of cardiovascular system diseases Bi are built in form of totality of M-geometrical places of points in N-dimensional space of cardiovascular system state, where i=1; 2; 3;…M is the number of displayed diseases of cardiovascular system. Coordinates of each point of each of B are determined by totality of values of various clinical data in physical values, describing characteristic clinical-morphological picture of corresponding disease and degree of CVS pathology manifestation, respectively. Coordinates in N-dimensional space of cardiovascular system state of all points of three-dimensional images Bi are memorised. Two-dimensional models of various nosologic forms of cardiovascular system diseases B2i are formed in form of projections, formed by B2i on plane, coinciding with plane of displaying multicolout screen of videomonitor. Coordinates in 2-dimensional space of cardiovascular system state of all points formed by B2i are memorised. Formed B2i are visualised on screen of multicolour videomonitor in such a way that colour of each point B2i in visible ranges of wavelengths Δλr, Δλo, Δλy, Δλg, Δλb…Δλ,m corresponds to certain type of disease, and degree of pathology is characterised by value, inversely proportional to wavelength of respective range. Visualisation on screen of multicolour videomonitor of successively formed in time values A2(t) is also performed, with each previous value A2(t) being connected by means of straight lines with their following values, and colour of A2(t) and connecting straight lines is formed by addition of red (Δλr), green (Δλg) and blue (Δλb) colours with similar amplitude proportion. Check of satisfaction of set of conditions A2(t) ⊂ B2i is carried out. Decision about cardiovascular system disease is taken in case of satisfaction of a condition from set A2(t) ⊂ B2i. Ambiguity of taking decision about cardiovascular system disease is excluded if mutual intersections B2i are present, when instant value A2(t) simultaneously belongs to two and more B2i, by formation on screen of multicolour videomonitor of each of new images of state A2k(t) and non-intersecting images of diseases в2ik by respective k transmissions of origin of coordinates of N-dimensional space of cardiovascular system state into selected by cardiologist points on plane of multicolour screen of videomonitor and carrying out procedure of projecting A(t) and Bi on plane coinciding with plane of displaying multicolour screen of videomonitor and after each of k transmissions of origin of coordinates of N-dimensional space of cardiovascular system state, where k=1; 2; 3;…j. Formed A2k(t) and в2ik are visualised on screen of multicolour videomonitor. procedure of A2k(t) and в2ik formation is stopped when condition, when A2k(t) belongs only to one в2ik is satisfied. Decision about absence of disease is taken if condition A2(t) ⊄ B2i is satisfied. Assessment of dynamics of change of cardiovascular system state is performed by results of analysis of preliminarily determined values of quantities Δτ=A2(t1)-A2(t2) and dΔτdτ for specified time interval, where t1; t2 are moments of time of beginning and end of specified time interval respectively.

EFFECT: invention makes it possible to simplify process of operative analysis of clinical data by set of measured clinical signs and avoid mistakes in generation of medical control decision for diagnosing.

5 dwg

FIELD: biotechnologies.

SUBSTANCE: there proposed is the method for obtaining vaccine against HIV-1 with the use of method of reverse paning at bacterial virus-presented library of HIV-1 - specific scFv antibodies obtained on the basis of mRNA B-lymphocytes of the patients infected by HIV-1 and enriched via paning on HIV-1 peptides and induced systems of expression of recombinant proteins with eukaryotic glycosylation. There also reviewed is the vaccine against HIV-1 and its use for immunisation of non-infected people against infection and development of HIV infection.

EFFECT: HIV-1 vaccine obtained due to this invention provides the appearance of immune response in organism with formation of HIV-1-specific antibodies.

12 cl, 27 dwg, 9 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically binds heparin-binding EGF-like growth factor (HB-EGF) and its antigen-binding fragment. Invention describes a nucleic acid molecule, an expressing vector, a host cell and a method for obtaining an antibody or its antigen-binding fragment, as well as use of antibody or its antigen-binding fragment for obtaining pharmaceutical composition for diagnostics, prevention or treatment of hyperproliferation disease, methods and sets for diagnostics and prevention or treatment of the state associated with HB-EGF expression. This invention can be further found in therapy of diseases determined with or related to HB-EGF expression.

EFFECT: improving efficiency of composition and treatment method.

34 cl, 43 dwg, 28 ex, 12 tbl

FIELD: biotechnology.

SUBSTANCE: method comprises the following stages: preparing cells in the first set comprising at least 96 receivers, adding an agent at least to one receiver; incubating the agent with the cells, lysing the cells by adding a buffer which is hypotonic or comprises detergent, and contains an inhibitor of DNAase; removal of RNA from the cell lysate with ribonuclease; centrifugation of the first set of receivers at low speed; transfer of a supernatant containing DNA fragments to the second set of receivers; adding a detectable compound capable of intercalation with DNA fragments in a buffer for detection containing DNAase inhibitor to at least one receiver; measuring the amount of intercalated detectable compound; and comparing the amount of intercalated detectable compound to the control for determining the difference that enables to identify the said agent as a modifying agent if the difference exceeds a predetermined limit.

EFFECT: invention enables to detect agents that affect the formation of DNA fragments in cells using high performance screening applications.

10 cl, 14 dwg, 2 tbl, 11 ex

FIELD: biotechnology.

SUBSTANCE: deoxyribonucleic acid (DNA) is separated from biological objects on carrier objects - gauze, paper, synthetic fabrics. The biological object - bone, horny tissue - is crushed. It is placed in a test tube containing a lytic buffer solution of the composition: 0.1 M Tris-HCl, 0.1 M EDTA, 0.1 M NaCl, 0.5% N-laurylsarcosil Na and proteinase K, pH 6-7. Cell lysate is obtained and is added with sorbent of magnetic nanoparticles of iron oxide Fe3O4, modified with chitosan. The mixture is stirred and incubated for 25-35 min. The test tube is placed on a magnetic rack and the mixture is divided into fractions - sorbent associated with DNA and the supernatant. The supernatant is removed. The residue is added with poured eluting buffer solution of the composition: 10 mM Tris-HCl, pH 7.4, 100 mM NaCl; 1 mM EDTA, and incubated. The test tubes are placed on a magnetic rack. The mixture is divided into fractions - sorbent - residue and supernatant - DNA, dissolved in the eluting buffer solution. The residue is removed. The final product of DNA is left in the supernatant.

EFFECT: invention enables to obtain DNA from different biological objects and increase the yield of the separated DNA not less than 1,5 times.

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented invention refers to medical microbiology, particularly to molecular-genetic typing of the strains Helicobacter pylori. What is presented is a method for differentiation of the strains H.pylori by multilocal VNTR-typing with the PCR involving oligonucleotide primers on VNTR-comprising loci of H.pylori - HpA, HpD, HpE and HpF; the strains H.pylori are differentiated by a number of repetitions in the amplified fragments in each VNTR-comprising locus of H.pylori - HpA, HpD, HpE and HpF that enables genetic typing of the studied strains.

EFFECT: what is presented is the method for differentiation of the strains Hpylori by multilocal VNTR-typing.

1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method provides for performance of a reaction of multi-segment reverse transcription (M-RT) of virus RNA, matched with reaction of cDNA amplification. Reactions are carried out in one stage with the help of one pair of universal primers selected to highly conservative areas available in all virus segments, in presence of fluorescently labelled nucleotides. The matrix for this reaction is a single-chain RNA of flu virus from analysed biological samples. The quality of the produced fluorescently labelled cDNA of type A flu virus is checked by the method of electrophoresis in 1% agarose body. The proposed method makes it possible to perform quick production of fluorescently labelled amplificates of a virus cDNA for all segments of a virus genome.

EFFECT: using this method considerably reduces time required to do detection and subtyping of A flue virus on diagnostic biochips in analysed samples.

2 dwg

FIELD: medicine.

SUBSTANCE: method involves genome DNA recovery, hydrolysis by methyl-sensitive and non-methyl-sensitive isoschizomers of restriction endonucleases. The DNA hydrolysis products are ligated with universal adapters from oligonucleotides CCGGTCAGAGCTTTGCGAAT and ATTCGCAAAGCTCTGA. It is followed by a chain reaction with universal fluorescence-labelled primers ATTCGCAAAGCTCTGACCGGGN conjugated in 5'-terminal with the fluorescent dye FAM with further capillary electrophoresis which induces formation of the marker system in the form of electrophoretogram peaks. The electrophoretogram peaks are analysed with the use of the whole kit of the system markers in the form of complete representation.

EFFECT: invention provides higher reproducibility of the formed DNA methylation marker system, simplifying a procedure of characterising normal tissue methylotypes, reducing a time of screening cycle, providing high performance of the method.

3 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of molecular biology and biotechnology and can be used in medicine and in pharmaceutical industry. RNA molecule, capable of target-specific RNA interference, represents double-stranded RNA molecule, 23 nucleotides long, which has 3'-overhang from 1-5 nucleotides. It is obtained by joining two RNA strands and used for obtaining pharmaceutical composition. When introduced into multicellular eukaryotic organism or in a cell of multicellular eukaryotic organism, said RNA molecule ensures promotion of target-specific RNA interference and leads to reduction of target-gene expression level or to target-gene knockout. Method of promoting target-specific RNA interference by means of said RNA molecule is applied for determination or modulation of gene function. Cell, containing endogenic target nucleic acid, RNA molecule, capable of target-specific RNA interference, and exogenic target nucleic acid, is used in analytical procedures.

EFFECT: application of invention ensures target-gene silencing, mediated by target-specific RNA interference.

40 cl, 23 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: biomaterial preparation is RNA recovery, cDNA synthesis on the RNA matrix, control of the TFDP1 cDNA concentration by a control gene, quantitative PCR-amplification of a TFDP1 gene fragment. These procedures are followed by evaluation of the amplified TFDP1 DNA fragment for a biomaterial sample. If the TFDP1 gene cDNA concentration in physiological fluids exceeds 1.5% of the ACTB beta-actin gene cDNA concentration, the presence of transitional cell bladder cancer is diagnosed. A kit for implementing the CR-based technique includes two primers with a certain sequence at molar ratio 1:1. A version technique provides the ELISA-based diagnosing. Patient's urine and blood are sampled to recover a mixture of protein components of urine and blood that is followed by ELISA with monoclonal antibodies and/or polyclonal antibodies and/or their fragments to TFDP1 recombinant protein and/or its unique fragments more than 8 amino acids long. Bladder cancer is diagnosed if observing the TFDP1 protein concentration in the analysed samples exceeding the 5-fold TFDP1 protein concentration in the reference.

EFFECT: technique enables high-reliability diagnosing of bladder cancer, including at the early stage of progressing neoplastic aberration.

3 cl, 4 tbl, 4 dwg

FIELD: medicine.

SUBSTANCE: invention may be used for target modification of a duplex DNA (double straight DNA) sequence. What is presented is a donor oligonucleotide a sequence of which is complementary along its whole length to the modified acceptor DNA with the exception of one nucleotide forming a mispairing with the modified duplex DNA sequence describing the expected substitute. The oligonucleotide under the invention comprises two modified nucleotide which represent LNA, and spaced at one nucleotide from a mispairing point from both sides.

EFFECT: what is described is a method for effective modification of the duplex DNA sequence with the use of the new oligonucleotide; conditions and means required for implementation thereof are disclosed.

14 cl, 3 dwg, 1 ex

FIELD: biotechnologies.

SUBSTANCE: proposed method involves the following: obtaining EML4-ALK cDNA by means of a polymerase chain reaction with reverse transcription (RT-PCR) on RNA matrix of EML4-ALK gene using specific primers; amplification of fragments of EML4-ALK gene by means of a multiplex PCR method on cDNA matrix obtained at the first stage of RT-PCR by means of high-specific primers; obtaining fluorescent-marked PCR-product at the second stage of RT-PCR; creation of a biochip for analysis of EML4-ALK translocations, which contains a set of immobilised probes; hybridisation of fluorescent-marked PCR-product with probes in gel cells on a plastic substrate of the biochip; recording and interpretation of hybridisation results. The method provides for use of a technology of DNA biochips designed for the purpose of determining 6 versions of EML4-ALK translocations (V2, V3, V5, V4, V7, V1).

EFFECT: method has high sensitivity and specificity; it is general-purpose, and its implementation is possible with operating material and tumour tissue enclosed in paraffin units; recording of results is performed on a single occasion at the end of the investigation; the method's implementation lasts for less than 24 hours.

3 dwg, 3 tbl, 3 cl

Up!