|
Method of predicting severity of depressive disorders in men with ischemic heart disease Invention relates to field of medicine, namely to method of predicting depression of severe degree in men with ischemic heart disease (IHD). Essence of method consists in the fact that time and structure connection between IHD and signs of depression are determined in men with IHD, level of personal anxiety is measured by Spielberg-Khanin test. If level of personal anxiety is lower than 45 points polymorphisms -1438A/G in gene of serotonin receptor of 2A type and Val66Met gene of neurotrophic brain factor are determined, after which depression of severe degree is predicted in patients who are carriers of allele S of polymorphism 5-HTTLPR, allele G of polymorphism -1438A/G and genotype ValVal of polymorphism Val66Met. |
|
|
Invention represents a method for the prediction of a risk of genital prolapse (GP) in the females having childbirth-related injuries in the past medical history, involving sampling a biological material for DNA recovery, genotyping DNA by the tetra-primer allele-specific polymerase chain reaction, identifying FBLN5 gene polymorphism in rs12586948, rs2018736, rs12589592 and rs2474028 sites, and predicting the high risk of genital prolapse if stating a combination of: rs12586948-A/*, rs2018736-C/*, rs12589592-G/G and rs2474028-T/* genotypes, whereas the low risk is shown by a combination of: rs12586948-G/G, rs2018736-A/A, rs12589592-A/A and rs2474028-C/C genotypes. |
|
Differential diagnostic technique for melanocytic skin growths Technique involves sampling a biopsy material from a skin growth of interest, carrying out real-time PCR of the sampled material to measure a relative microRNA expression level as shown by snRNA-U6 normalising microRNA with hsa-miR-205 gene taken as a differential diagnostic marker. If the relative expression level falls within the range of 0.29926 to 13.202, the analysing skin growth is considered to be melanoma; the relative expression level from 25.70993 to 1583.114 shows a nevus; an intermediate range of values falling within 13.202 to 25.70993 requires performing an immunohistochemical study of the biopsy material with using primary antibodies against the specific markers: S 100, HMB 45, MART 1, MELAN A, CD-63, MITF. |
|
|
Invention relates to medicine, namely to labour medicine, and describes a method of diagnosing early disorders caused by an impact of harmful production factors in the organisms of workers, employed in the production of synthetic resins for not more than 5 years. The method is characterised by the fact that the content of myeloperoxidase is determined in neutrophils of blood smear of the workers, employed in the production of synthetic resins with the work experience of not more than 5 years, average cytochemical coefficient is estimated, and if its value is lower than 2.23 c. u., the impact of harmful production factors is diagnosed. The claimed method makes it possible to diagnose early disorders caused by the impact of harmful production factors on the organisms of workers, employed in the production of synthetic resins, with minimal labour and financial expenditures. |
|
|
New biomarkers for assessing renal diseases Group of inventions refers to medicine, namely to nephrology and refers to using a combination of metabolites containing at least two amino acids, at least two acylcarnitines and at least two biogenic amines as a biomarker array aiming at assessing a chronic renal disease in a blood sample. There are also presented a method and a set of biomarkers for assessing the chronic renal disease in a mammal. |
|
Diagnostic technique for temporary tooth pulp inflammation Gingival fluid within an involved tooth is analysed to measure the enzyme activity of aspartate aminotransferase and alanine aminotransferase. If observing the decreased activity of aspartate aminotransferase and alanine aminotransferase and an aspartate aminotransferase/alanine aminotransferase ratio is > 1.5, the pulp inflammation is diagnosed. |
|
Method of predicting risk of primary open-angle glaucoma development Peripheral venous blood is sampled, DNA from the blood is isolated and the analysis of polymorphisms of gens TNFR2 (+1663A/G TNFR2) is performed. Values y1 and y2 are determined by formulae of a linear discriminant function with taking into account the patients' age, presence of the cardio-vascular system pathology, systolic and diastolic arterial pressure, presence of primary open-angle glaucoma (POAG) in relatives, presence of the accompanying eye pathology, micro-vascular disorders in the front section of the eye and the state of a pigment rim of the papillary edge of the iris, presence of a degree of the front angle chamber pigmentation and genetic version by locus +1663A/G TNFR2. A risk to form primary open-angle glaucoma is predicted in case if y2 is larger than y1. The claimed method makes it possible to predict POAG development basing on data about genetic polymorphism +1663A/G TNFR2 in a combination with other predictors of glaucoma development. The invention can by applied for obtaining criteria for the evaluation of the risk of POAG development in inhabitants of the Central Chernozem (Black Soil) Region of Russia of Russian nationality to form a group with an increased risk of POAG development. |
|
Molecular-genetic type of breast cancer is determined by the immune histochemical study of primary tumour tissue specimens; the patients' menstrual function state and morphological signs are also taken into consideration, and a regression equation Y is calculated by formula: Y=(11+32X1-69.2X2+1.04X3-3.5X4), wherein Y is the regression equation; (11) is an intercept ratio; X1 is the patients' menstrual function state (1 - preserved; 2 - menopause); (32) is a regression ratio of this parameter; X2 is tubular structures in the tumour infiltrate (1 - not found; 2 - found); (-69.2) is a regression ratio of this parameter; X3 is the number of different types of structures in the tumour infiltrate (1 - one, 2 - two, 3 - three, 4 - four, 5 - five; (1.04) is a regression ratio of this parameter; X4 is an intensity of the stroma inflammatory infiltration (1 - mild, 2 - moderate, 3 - pronounced; (-3.5) is a regression ratio of this parameter. A probability P is determined by formula: P=eY/(1+eY), wherein e is a mathematical constant equal to 2.72; if P≥50%, a high risk of the lymphatic cancer spread is stated, whereas P<50% shows a low risk thereof. |
|
Invention refers to medicine, particularly oncology and aims at predicting the anti-oestrogen tamoxifen therapy effectiveness. An immune histochemical analysis of a tumour tissue is performed in the patients suffering luminal breast cancer, and a tumour tissue distribution pattern of oestrogen receptors alpha expression is described. Rs2228480 G/A polymorphism is stated in exon 8 of oestrogen receptors alpha (ERα) gene by real-time polymerase chain reaction. The state of regional lymph nodes is assessed. The tumour grade and the anti-oestrogen tamoxifen therapy effectiveness are calculated by formula. If P>0.5, the high anti-oestrogen tamoxifen therapy effectiveness is predicted. P<0.5 shows the low therapy effectiveness and a high probability of progression are predicted. |
|
|
Method of detecting oncogenic fused proteins, based on analysis of close mutual location Group of inventions discloses antibody matrices for the determination of an activation condition and/or the total quantity of one or several oncogenic fused proteins in such biological samples as whole blood or a cancer tissue, as well as methods of application thereof. In some cases the activation condition and/or the total quantity of oncogenic fused protein in a sample can be measured in a combination with one or several molecules of signal transduction. |
|
Method for prediction of developing occupational hyperkeratosis in fibre glass production workers Invention refers to medicine, namely to a method for the prediction of developing occupational hyperkeratosis. Substance of the method consists in recovering DNA from peripheral venous blood lymphocytes, genotyping TP53 gene rs1625895 polymorphism by polymerase chain reaction with restriction enzyme digest analysis. Finding G/A genotype and A allele ensured predicting a risk of developing occupational hyperkeratosis. |
|
|
Method of diagnosing gestational diabetes mellitus Invention relates to the field of medicine, namely to a method of diagnosing gestational diabetes mellitus in pregnant women, which includes carrying out a blood test in the morning on an empty stomach with the determination of the venous plasma glucose content. The essence of the method consists in the fact that if the level of venous plasma on an empty stomach is lower than 5.1 mmole/l, detection of diabetes risk factors: obesity with an initial, pre-pregnancy, excess body weight of more or equal 30 kg/m2, or diabetes mellitus of 2 type in the nearest relatives, or impairment of carbohydrate exchange in past medical history, or glycosoria, in pregnancy terms before 24 weeks, determination of capillary blood glucose is performed by continuous monitoring for 3 days. If registered are: one or several indices of the level of glucose in venous plasma blood on an empty stomach higher or equal to 5.1 mmole/l, but lower than 7.0 mmole/l, one hour after meal, index of the level of glucose in venous plasma higher or equal to 10 mmole/l, 2 hours after meal, index of the level of glucose in venous plasma higher or equal to 8.5 mmole/l gestational diabetes mellitus is diagnosed. |
|
Diagnostic technique for hepatic fibrosis accompanying viral hepatitis c Diagnostic technique for the presence and stage of hepatic fibrosis accompanying chronic viral hepatitis C consists in determining the concentrations of gamma glutamine transferase, thrombocyte growth factor-β1, tissue inhibitor of metalloproteinases-1 and MMP-9/TIMP-2 complex in blood serum; the first stage involves calculating a probability of HCV-associated hepatic fibrosis (PPHF) by formula: PPHF=(ey/(1+ey))×100%, wherein y=-13.6+3.78·X1-0.1·X2 wherein X1 is a serum value of the prognostic factor MMP-9/TIMP-2, X2 is a serum value of the prognostic factor TIMP-1, ey is an exponential function. If PPHF>50%, the presence of HCV-associated fibrosis changes in the liver are predicted. At the second stage, a probability of the stage of the HCV-associated hepatic fibrosis (PSHF) is specified by formula: PSHF=(ey/(1+ey))×100%, wherein y=-12+0.134317·X1+0.527778·X2-0.05·X3, wherein X1 is a serum value of the prognostic factor MMP-9/TIMP-2, X2 is a serum value of the prognostic factor TGF-β1; X3 is a serum value of the prognostic factor of gamma glutamine transferase. If PSHF>50%, the presence of the pre-cirrhotic stage of fibrosis and hepatic cirrhosis accompanying chronic viral hepatitis C (F3-4 stage); PSHF<50% shows HCV-associated hepatic fibrosis of the primary stage (F0-2 stage). |
|
Composition, inhibiting platelet aggregation Invention relates to the field of biotechnology, namely, to obtaining inhibitors of adhesion and/or aggregation of platelets, and can be used in medicine. A polypeptide, used as a component of a pharmaceutical composition and in sets for screening of the inhibitors of platelet adhesion or aggregation, is obtained in a recombinant way with the application of a matrix of the salivary gland cDNA of Anopheles stephensi. |
|
Invention relates to medicine, namely to dentistry, and can be used in diagnostics of dental caries by method of infrared spectroscopy. For this purpose sample of patient's saliva is preliminarily dries, dry residue is crushed and suspended in vaseline oil. IR-spectroscopy is carried out in spectrum area 1200-800 cm-1 and height of peaks of absorption bands with maximums 1070, 1017, 960, 860 cm-1 is determined. After that, values of four ratios of peak height with maximum at 1070 cm-1 to peak height with maximum 1017 cm-1, peak height with maximum at 1070 cm-1 to peak height with maximum 960 cm -1, peak height with maximum at 1070 cm-1 to peak height with maximum 860 cm -1, ratio of peak height with maximum at 1017 cm-1 to peak height with maximum 860 cm-1. Dental caries is diagnosed at the following values of ratios of peak heights 1070/1017, equal to 11.64±0.14, peak heights 1070/960, equal to 1.08±0.12, peak heights 1070/860, equal to 6.40±0.41, and peak heights 1017/860, equal to 4.15±0.44. |
|
|
Method of intraoperative evaluation of peripheral nerves condition Method consists in production of cryostat sections of nerve, washing them in two portions of maleate buffer, incubation in incubation medium. Incubation is carried out for 30-60 minutes and incubation medium has the following composition: acetylcholine iodide 10 mg; 0.1 M Na-maleate buffer 2 ml; 0.1 M sodium citrate 4 ml; 0.03 M copper sulphate 4 ml; 0.005M potassium ferricianide 4 ml; medium pH constitutes from 7.4 to 7.6 and temperature is from 50 to 55°C. |
|
|
Method of diagnosing staphylococcal allergy in case of allergic rhinitis Functional activity of neutrophilic granulocytes is studied by means of hemiluminiscent analysis, calculated is an index of formation of active forms of oxygen (IFAFO), representing the ratio of the area under the curve of luminol-dependent hemiluminiscence of the neutrophilic granulocytes, induced by a live bacterial suspension of staphylococcus aureus, to the time of achieving the maximum of luminol-dependent hemiluminiscence of the neutrophilic granulocytes, induced by the live bacterial suspension of staphylococcus aureus. If IFAFO value is higher than 100 o.u./s, sensitisation to staphylococcus aureus in patients with allergic rhinitis is diagnosed. |
|
|
Invention represents a method for determining a probability of preserving the myocardium following infarction by creating an admission examination-based data array of 7 peripheral blood parameters, 11 biochemical analysis parameters and 6 parameters of standard 12-lead electrocardiogram in 200 patients with the Q-myocardial infarction and 200 patients without the myocardial infarction. The parameters are stratified with respect to 7 intervals, wherein values related to the probability of preserving the myocardium following infarction are derived by calculating a ratio of the patients without myocardial infarction to all the patients with acute coronary syndrome. The probability is evaluated in a specific patient by analysing the above parameters, searching the respective intervals and values related to the probability of preserving the myocardium in the data array. Summing up the derived values enables calculating an integrated index, which is normalised, and a dimension from 0 to 100% is reduced. |
|
Test system for human interferon activity testing Group of inventions refers to medicine, namely to immunology, and can be used in laboratory diagnostics, as a test system and a method for measuring interferon alpha (IFN-α) antiviral activity in human blood serum. The test system for measuring IFN-α activity in the human blood serum comprises diploid cells, a virus-containing fluid and standard human interferon-α (IFN-α). As the diploid cells, the test system comprises cells of the characterised line of the diploid cells - human M-20 fibroblasts at 20-33 passages cultured in the medium with added 10% fibrinolytically active plasma (FAP). As the virus, the system contains the A vesicular stomatitis virus (VSV) adapted to M-20 cells, the Indiana strain; the test system additionally contains a viral dye based on two fluorochromes - acriflavine and rhodamine C. The group of inventions also involves a method for measuring IFN-α activity in the human blood serum with the use of the developed system. |
|
Invention describes a diagnostic technique for infected pancreonecrosis with establishing the indications for a surgical intervention by examining a patient, wherein acetic, propionic, butyric and isovaleric acids are measured in the blood by gas chromatography, and if the acetic acid concentration is more than 0.11 mmole/l enables stating infected pancreonecrosis, and if the concentration of any of three acids: propionic more than 0.095 mmole/l, butyric more than 0.0035 mmole/l, isovaleric acid more than 0.0003 mmole/l enables stating infected pancreonecrosis with active development of an anaerobic infection requiring one of versions of the surgical intervention. |
|
|
Invention relates to medicine, namely to a method of predicting a probability of reduction of the glomerular filtration rate (GFR) after 3 months of observation after aortocoronary bypass surgery without artificial blood circulation (ACBS without ABC). The essence of the method consists in the fact that the concentration of a kidney injury molecule of type 1 (KIM-1) is determined in blood serum, the ratio of the biomarker KIM-1 concentrations in two time points after 48 hours and 7 days after the operation is calculated and if its value is higher than 1.5, a conclusion about the probability of (GFR) reduction in the remote period after ACBS without ABC is made. |
|
Method includes determination of a titre of antibodies to cytomegalovirus, content of 2,3 DPG (2,3-diphosphoglycerate), and oxyhaemoglobin in erythrocytes. If the titre of the antibodies to cytomegalovirus increases to 1:1600, DPG increases to 6.7±0.3 mcmole/ml, content of HbO2 is 95.0±1.7%, with the reduction of the specific optical density of haemoglobin to 0.70±0.01, it is concluded that a threat of anaemia development is formed. |
|
|
Method of diagnosing severity of consequences of ischemic brain stroke Neurovisualisation examination of brain is carried out, Cirs comorbidity index and Kaplan-Feinstein comorbidity index are determined, cochleovestibular syndrome, eye-moving impairments, type of diabetes mellitus are identified. Value of discriminate function (D) is calculated. If D value is higher than zero, diagnosed are consequences of ischemic brain stroke (IBS) with hyperhomocysteinemia (HH), if D is lower than zero, consequences of IBS without HH are diagnosed. |
|
|
Method of non-invasive express-diagnostics of inflammatory process in intestines of calves Method includes detection of leukocytes, protein, haemoglobin in faeces, and PH-reaction of faeces. A sample of faeces is dissolved in distilled water and applied drop by drop onto appropriate test fields of a test strip designed for urine testing. By variation of colour within 1 minute the reaction is assumed as positive. If pH is less than 7.0 or more than 7.5, and faeces contain soluble protein, haemoglobin and leukocytes at the same time, availability of the inflammatory process in the intestines is confirmed. |
|
|
Invention refers to medicine and aims at diagnosing vaginitis in females of a reproductive age. Expression levels of mRNA of TNF, IL18, GATA3 and TLR4 genes are measured in vaginal smears. Expression levels of mRNA of TLR4/GATA3 and TNF/IL18 genes are related, and the derived threshold cycles are used to predict a probability of vaginitis by formula. If P≤57% for nonpregnant females or P≤68.5% for pregnant females, the absence of vaginitis is stated. If P≥57% for nonpregnant females or P≥68.5% for pregnant females, vaginitis is diagnosed. |
|
|
Biomarker for patient selection and related methods Group of inventions refers to medicine, namely to a method of analysing ex-vivo if a patient suffering a cancer is expected to respond therapeutically to a method of treating. To this purpose, a biological sample specified in a group consisting of total blood, plasma or serum samples is taken from the patient. The levels IL10 and IFNγ are measured in the above biological sample; the levels are determined with using the respective IL10 and INFγ specific antibodies. The IL10/IFNγ ratio is derived and compared to a threshold. If the IL10/IFNγ ratio of less than 4 shows that the patient is expected to develop the preventive or therapeutic response to the immunogenic composition. The group of inventions also refers to using IL10 and INFγ as biomarkers and a kit for analysing the above method. |
|
Invention deals with early diagnostics of infectious complications in patients with acute lymphoblastic leukaemia (ALL), obtaining chemotherapy (CT). Claimed method consists in the following: concentration of fibrinogen, time of XIIa-dependent euglobulin lysis (XIIa-DEL), level of soluble fibrin-monomer complexes (SFMC), activity of protein C (prC) are analysed in ALL patients during CT 2-3 times per week. If at least 2 of 4 criteria are detected, namely: ≥41% increase of fibrinogen level, ≥76% increase of SFMC, ≥11% prolongation of XIIa-DEL time and ≥12% reduction of prC activity in comparison with previous analysis, development of infectious complications is predicted. |
|
Level of anti-flu antibodies in blood serum from umbilical vein (A), concentration of middle molecular peptides in blood plasma from umbilical vein (units of optical density) (B), total number of T-lymphocytes (CD3+) in points: 1 point - CD3+ higher than 48%; 2 points - CD3+ 47%-41%; 3 points - CD3+ 40% and lower in venous umbilical blood are determined in term new-born babies at birth. After that, prediction of frequent development of acute respiratory viral infections is realised by means of discriminant equation: D=+0.008×A-111.694×B-1.537×C, where D is discriminant function with boundary value, equal - 34.16. If D is equal or is larger than boundary value, absence of development of frequent respiratory viral infections during the first year of life in term new-born babies with intrauterine flu A(H3N2) is predicted. If D is lower than boundary value, frequent development of acute respiratory viral infections during the first year of life in term new-born babies is predicted. |
|
|
Method of determining hydroxybenzene and its monomethyl-substituted in biological material Biological object, which contains mixture of hydroxybenzene and its monomethyl-substituted are crashed, processed twice with ethylacetate for 30 minutes with ethylacetate, ethylacetate extracts are combined, treated with ethanol solution of calcium hydroxide, solvent from combined ethylacetate extract is evaporated at 16-20°C, residue is repeatedly treated with acetone, containing hydrochloric acid in excess with respect to potassium hydroxide, present of residue, acidified acetone extracts are combined, treated with water solution of sodium hydroxide to neutralise residues of hydrochloric acid in acetone and create excess of alkaline medium, acetone is evaporated from combined extract, water-alkali residue is diluted with water, formed solution is acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether, extract is dehydrated, evaporated, chromatographed in column with silica gel with application of mobile phase hexane-diethyl ether with ratio 6:4 in volume, eluate fractions, containing hydroxybenzene and its monomethyl substituted, are combined, extracted with buffer solution with pH 12-13, water-alkali extract is acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulphate, extracted with dichloromethane, dichloromethane extract is dehydrated, analysed substances, contained in dichloromethane extract, are transferred into corresponding trimethylsilyl derivatives, for which purpose dichloromethane extract is treated for 20 minutes with N-methyl-N-trimethylsilyltrifluoracetamide under conditions of heating at temperature 60°C, qualitative and quantitative determination by physical-chemical method, such as chromate-mass-spectrometry, is performed in capillary column, 25 m long with internal diameter 0.2 mm with immobile phase (5%-phenyl)-methylpolysiloxane, with application of helium carrier gas, supplied at rate 0.6 ml/min, and mass-selective detector, working in electron impact mode, initial temperature of column thermostat constitutes 70°C, said temperature is maintained for 3 minutes, and then temperature is programmed from 70°C to 290°C at rate 20°C, final temperature of column is maintained for 10 minutes, injector temperature constitutes 250°C, quadrupole temperature - 150°C, temperature of ion source - 230°C, temperature of detector interface - 300°C, intensity of signal, conditioned by charged particles, formed in bombardment of analysed substance, leaving capillary column and getting into source of ions, with ionising beam of electrons with energy 70 eV, is registered, mass-spectrum is registered by full ion flow, qualitative determination of analysed substance is realised by time of exposure, set and intensity of signals of characteristic charged particles in mass-spectrum of its trimethylsilyl derivative, with quantity of determined compound being calculated by area of chromatographic peak of its trimethylsilyl derivative. |
|
Method of predicting development of terminal stage in patients with chronic myeloleukaemia Invention relates to medicine, namely to method of predicting development of terminal stages in patients with chronic myeloleukaemia. Essence of method consists in the fact that activity of two degydrogenases - glycerol-3-phosphatedehydrogenase (G3PDH) and lactatedehydrogenases (LDG) is determined in lymphocytes of peripheral blood of chronic leukaemia patients in open stage. In case of combination of G3PDH in the range from 0 to 0.02 mcE and activity of LDG in the range from 0.04 to 5.02 mcE development of terminal stage is predicted. |
|
Method for microscopic examination of native smear from tongue root Invention refers to microbiology, namely to a method for the microbiological examination of a native smear from a tongue root mucosa. The substance of the method consists in the fact that a wooden spatula is used to sample biomaterial 0.5 ml by deep scraping from the mucous membrane at the boundary of the posterior one-third of the tongue dorsum and root; two smears are prepared on two slides, 1.5-2.0 cm2 in area; the smears are dried out for 20 minutes and fixed by flame heat of an alcohol lamp continuously for 5-6 seconds, Gram-stained by a complicated differential method, microscoped with immersion with the use of a ×100 objective lens; at least 10 visual fields are inspected on each slide taking into account quantitative and qualitative characteristics of microorganisms, cells and nuclei of the epithelium. |
|
Method involves patient's blood analysis on the first day following ST elevation myocardial infarction for insulinemia, glycemia, free fatty acids (FFAs), retinol-binding protein, tumour necrosis factor and ghrelin; the measured values are used to calculate linear classification discriminator function (LCDF1-c) by formula: LCDF1-c=-3.877+0.095Adp+0.246Grl-0.025IL-6-0.053TNF, wherein ADP is the adiponectin concentration, Grl is the ghrelin level, IL-6 is the interleukin 6 concentration, while TNF is tumour necrosis factor, a probable risk of insulin resistance is stated if LSDF1 is less than a cluster separation point of 0.4545 and approaching a centroid line of -0.561 as close as possible. |
|
Diagnostic technique for nutritional insufficiency accompanying ulcerative colitis Invention describes a diagnostic technique for nutritional insufficiency accompanying ulcerative colitis by immunoassay, wherein blood serum is analysed to measure the soluble adhesion molecules sICAM-1, sICAM-2 and sICAM-3; a mild degree of nutritional insufficiency is characterised by the blood lymphocyte level of 1,500-1,800·109/l, while the sICAM-1 level is 13.4-24.7 ng/ml, the sICAM-2 level is 8.1-17 ng/ml, and the sICAM-3 level is 4.4-19 ng/ml; the IgG level is 650-500 mg/l; a moderate level of nutritional insufficiency is accompanied by the blood lymphocyte level making 900-1,490·109/l, and the sICAM-1 level is 25-37.8 ng/ml; the sICAM-2 level is 17.1-23.9 ng/ml, and the sICAM-3 level is 19.5-30.8 ng/ml, the IgG level is 950-1,400 mg/l; a severe degree of nutritional insufficiency is accompanied by the blood lymphocyte level of 890·109/l and less, the sICAM-1 level is 38-63 ng/ml; the sICAM-2 level is 24-29 ng/ml and the sICAM-3 level is 30.9-42.3 ng/ml; the IgG level is 1,500-1,800 mg/l. |
|
|
Method for predicting clinical course of sarcoidosis Invention refers to medicine, namely to a method for predicting the clinical course of sarcoidosis. Substance of the method consists in analysing biopsy material of a middle lobe of the right lung. What is involved is an immunohistochemical analysis in at least 5 visual fields at magnification ×400 to measure an average myofibroblast count in the interalveolar interstitial tissue. If the derived value is more than 50, the unfavourable outcome of sarcoidosis is predicted; the value of 15 and less average myofibroblast count, the favourable outcome of sarcoidosis is predicted. |
|
|
Invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative. |
|
Method for preoperative determination of extent of surgery for high-differentiated thyroid carcinoma Sodium/iodine symporter expression on a tumour cell membrane is measured in a tumour material taken by fine-needle aspiration biopsy, and if the measured expression is less than 1%, surgery is supposed to be added with the central lymph node dissection. The sodium/iodine symporter expression on the tumour cell membrane is determined by flow cytometry. |
|
Invention relates to a method of predicting a high risk of formation of adeno-tonsillar system chronic pathology in recurrent respiratory infection children (RRI). The level of interleukin -17 and MMP-9 in saliva is determined, and if the level of interleukin-17 is higher than 5 pg/mg and MMP-9 level is higher than 10 ng/ml, a high risk of formation of adeno-tonsillar system chronic pathology in RRI children is predicted. |
|
|
Newborn's umbilical blood serum agmatine is measured by capillary electrophoresis; the measured concentration of 0.038 mg/ml or more enables predicting convulsive conditions. |
|
|
Substance of the method consists in determining the concentrations of neuron-specific enolase (NSE) and vascular endothelial growth factor (VEGF) in umbilical blood serum and peripheral blood serum, the concentrations of brain-derived neurotrophic factor (BDNF) in peripheral blood serum on the 7th day of birth; that is followed by calculating a prognostic index (PI) by formula: PI=0.033×X1+0.016×X2-0.36×X3+0.002×X4+0.00054×X5-4.0, wherein X1 is the NSE concentration in umbilical blood (mcg/l); X2 is the VEGF concentration in umbilical blood (ng/ml); X3 is the NSE concentration in peripheral blood on the 7th day of life (mcg/l); X4 is the VEGF concentration in peripheral blood on the 7th day of life (ng/ml); X5 is the BDNF concentration in peripheral blood on the 7th day of life (ng/ml); Const=-4.0. If PI is less than 0, a low risk of ICP is stated. If PI is more than 0, a high risk of the given pathology is predicted. |
|
|
Method of diagnosing toxigenic strains clostridium difficile Fecal sample of a patient is kept at 96% absolute alcohol for 30-60 min in the ratio of alcohol and feces of 1:1, centrifuged for 15-20 minutes, then the fecal sample is treated with 1% solution of sodium deoxycholate in a ratio of 1:1 for 30-60 minutes, centrifuged, the supernatant is removed, then the primary inoculation of precipitation in the medium with addition of 1% lactose and 0.5-1.0 mM arabinose is carried out, incubated in anaerobic culture apparatus for 24-48 hours, the grown colonies are applied to the standard discs impregnated with the chromogenic substrate - ortho nitrophenyl-β-D-galactosidase. When appearance of bright yellow colour of the disc the toxigenic strains of Clostridium difficile are diagnosed. |
|
|
Method for quantitation of blood penzapyrene by liquid chromatography Each blood sample is analysed twice. A fresh blood sample is centrifuged at 2,000 rpm for 5 min. The samples are separated in plasma fractions and formed elements. A solid-phase plasma extraction is performed by sequential passing of 100% acetonitrile, plasma, distilled water, 50% acetonitrile solution under vacuum through a cartridge with Oasis HLB 3 cc sorbent. The cartridge with the sorbent is dried under vacuum, and 100% methylene chloride is passed through the sorbent. An aliquot portion of the produced extract is chromatographed. Producing the extract of formed elements is ensured by dispersed solid-phase extraction: by adding 100% acetonitrile thereto and agitating intensively. That is followed by adding a number of QuECHeRS salts for extraction, agitating, centrifuging for 10 minutes at 2,000 rpm; that is accompanying by forming 3 layers; an upper layer is transferred to another test tube, which contains a number of QuECHeRS salts for purification; the layers are centrifuged at 2,000 rpm; the upper layer is sampled. Plasma and formed elements extracts are analysed by Agilent 1200 liquid chromatograph with a fluorimetric detector on Zorbax column 50 mm long and having an inner diameter of 4.6 mm with Eclipse PAH C18 sorbent at column temperature 27°C; a movable phase is presented by mixed acetonitrile and water at flow rate 1.5 cm3/min and optimising elution in the gradient mode (supplying the movable phase of 60 vl % to 68 vl % of acetonitrile for 1 min, increasing 60 vl % to 68 vl % of acetonitrile for 3 min, increasing 68 vl % to 70 vl % for 0.5 min, increasing acetonitrile 70 vl % to 90 vl % for 1.5 min, increasing acetonitrile 90 vl % to 100 vl % for 4.5 min, supplying 100% acetonitrile for 1.5 min, reducing acetonitrile to 60 vl % and supplying 60% acetonitrile for 4 min to balance the column). An excitation wavelength of the fluorimetric detector makes 265 nm, and an emission wavelength makes 412 nm. A calibration chart is used to quantify benz(a)pyrene in plasma and formed elements separately, while the results are summed up. |
|
Cognitive disorders are stated according to the clinical recognition and neuropsychological test results in a child. Child's blood is analysed to measure the manganese content, and if its content tends to increase more than the reference, the levels are stated: lipid hydroperoxide in blood serum, malondialdehyde MDA in blood plasma and 8-hydroxy-2-deoxyguanosine 8-OHdG in urine; glutathione peroxidase GlPO, Cu/Zn-superoxide dismutase Cu/Zn-SOD, antioxidant activity AOA of blood serum; glutamate and γ-aminobutyric acid in blood serum; hormones of the pituitary-adrenal axis: adrenocorticotropic hormone ACTH, cortisol and serotonine in blood serum, cyclic adenosine monophosphate cAMP and cyclic guanosine monophosphate cGMP. If the blood manganese content is more than 0.029 mcg/cm3 with at least 50% of the above clinical-laboratory values having the following characteristics: lipid hydroperoxide, MDA, 8-OHdG, glutamate, ACTH, cortisol, cGMP increased as compared to the age physiological norms; GlPO, Cu/Zn-SOD, AOA, γ-aminobutyric acid and cAMP reduced as compared to the age physiological norms, cognitive disorders associated with the exposure to manganese in the child. |
|
|
Method for measuring blood pentachlorophenol by gas chromatography analysis Blood is sampled, acidified to pH 2-3 with aqueous oxalic acid, extracted in toluene for 5 min; the prepared extract is centrifuged for 60 min at 7,000 rpm, added with sodium sulphate to dewater and acetylated for 3 hours by introducing trifluoroacetic anhydride while stirring continuously in the pyridine medium. The blood sample, toluene, trifluoroacetic anhydride and pyridine are taken in volume ratio 5:2.5:0.2:0.1 respectively. |
|
Diagnostic technique for oxidative stress in children exposed to nickel from external environment Invention describes the diagnostic technique for oxidative stress in children exposed to nickel from the external environment and involves measuring nickel in blood samples and determining the laboratory values: in blood serum - lipid hydroperoxide, in urine - 8-hydroxy-2-deoxyguanosine; that is follows by a correlation analysis of the above laboratory values and blood nickel, if establishing the significant dependencies: high blood nickel more than 0.083 mg/dm3 and blood serum lipid hydroperoxide increased as compared to the reference and urine 8-hydroxy-2-deoxyguanosine increased as compared to the reference enables diagnosing the oxidative stress in the body at the level of cell DNA and membrane. |
|
Method of determining novocaine in biological material Method is implemented as follows: the biological material containing novocaine is crushed, treated three times with acetone, containing 0.2-0.4% water, the liquid extract is separated, the acetone from the liquid extract is evaporated together with water in the air stream at a temperature of 18-22°C until complete removal of the solvent, the residue obtained as a result of evaporation is repeatedly treated with acetone containing 0.2-0.4% water, the acetone extract is separated, combined, and the solvent from the combined extract is evaporated, the residue is dissolved in diethyl ether, the resulting solution is diluted in hexane in a ratio of 1:1 by volume, extracted with buffer solution with pH 1-2, the acid-water extract is separated, neutralized with 10% ammonia solution, alkalized with ammonium buffer solution to pH 9.0-9.5, the resulting aqueous alkaline solution is saturated with ammonium sulphate, extracted twice with portions of the organic extractant which is used as a 30% solution of camphor in methyl acetate, at a ratio of aqueous and organic phases as 1:1 by volume, the organic extracts are separated, combined, and the solvent from the combined extract is evaporated in a stream of air at a temperature of 18-22°C to dry residue, the residue is dissolved in a mixture of dichloromethane and ethanol taken in a volume ratio of 1:1, the resulting solution is applied to a column of silica gel CRA No. 80/120 mcm, chromatographed using two-phase movable phase dichloromethane-ethanol in a ratio of 1:1 by volume, the fractions of eluate containing the analyte, combined, the eluent is evaporated, the residue is dissolved in methanol and determining is performed by gas-liquid chromatography coupled with mass spectrometric detection in a capillary column DB-5 MS EVIDEX with the length of 25 m and an inner diameter of 0.2 mm with the stationary phase, which is 5%-phenyl-95%-methylpolysiloxane using helium carrier gas supplied at a rate of 0.6 ml/min and a mass selective detector operating in electron impact mode, the initial temperature of the column oven is 80°C, this temperature is maintained for 1 minute, then the temperature is raised from 80°C to 200°C with the rate of 40°C per minute, then from 200°C to 300°C with the rate of 12.5°C per minute, the final column temperature is maintained for 16 minutes, the temperature of the injector is 200°C, the temperature of quadrupole is 150°C, the temperature of the detector interface is 300°C, the intensity of the signal is recorded, due to charged particles produced by bombarding of the analyte emerged from the capillary column and entered into the ion source, with ionizing electron beam with energy of 70 eV, a mass spectrum is recorded on total ion current and the amount of novocaine is calculated based on the chromatogram peak area. |
|
Method of determining 3-methoxyhydroxybenzene in biological material Biological material containing 3-methoxyhydroxybenzene is repeatedly (three times) treated for 45 minutes with an alkyl acetate in the form of methyl acetate; the separate extracts are combined; the solvent from the combined alkyl acetate extract is evaporated; the residue is repeatedly treated with acetone; the acetone extracts are combined, evaporated in an air current at 18-22°C, and then in an nitrogen current until complete removal of the solvent; the residue is dissolved in ether; the obtained solution is diluted with hexane in volume ratio of 1:1, extracted with a buffer solution with pH 12-13; the water-alkaline extract is separated, acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether; the ether extract is separated, dehydrated, evaporated in an air current at 18-22°C and then in a nitrogen current until complete removal of the solvent; the residue is dissolved in a hexane-dioxane-propanol-2 solvent mixture, taken in volume ratio of 20:5:1, subjected to chromatography in a silica gel macrocolumn L 40/100 mcm using a mobile phase of hexane-dioxane-propanol-2 in volume ratio of 20:5:1; eluate fractions containing the analyte are combined; the eluent is evaporated in an air current at 18-22°C and then in a nitrogen current until complete removal of the solvent; the residue is dissolved in dichloromethane, followed by determination using a chromatographic-mass-spectrometric technique using a capillary column with length of 25 m and internal diameter of 0.2 mm with a stationary phase with thickness (5% phenyl)-methylpolysiloxane, using a helium carrier gas, fed at a rate of 0.6 ml/min, and a mass-selective detector operating in electronic impact mode; the initial thermostat temperature of the column is 70°C; said temperature is maintained for 3 min, and the temperature is then raised from 70°C to 290°C at a rate of 20°C/min; the injector temperature is 250°C, the detector interface temperature is 300°C; the method also includes detecting the strength of the signal resulting from charged particles formed when bombarding the analyte coming from the capillary column and falling into an ion source which ionises an electron beam with energy of 70 eV; recording the mass spectrum on the full ion current and calculating the amount of 3methoxyhydroxybenzene from the area of the chromatographic peak obtained by detecting the signal from the characteristic molecular ion 124 m/Z. |
|
Method for predicting metastases in patients with skin melanoma Invention refers to medicine, particularly to medical diagnostics in oncology, and describes a method for predicting metastases in the patients with skin melanoma. The method involves measuring VEGF C and VEGF A markers in the tumour tissue removed intraoperatively, calculating their relation; if the relation increases 5 times as much in relation to the values in intact skin derived intraoperatively from non-oncologic patients, lymphatic metastases are predicted, whereas decreasing this value 10 times as much enables predicting haematogenous metastases. The invention can be used in routine clinical practice of health care institutions, research and development establishments and oncologic dispensaries. |
|
|
Genetic polymorphisms accompanying age-related macular degeneration Presented group of inventions refers to medicine. What is presented is a method for the prediction of a high probability of the therapeutic effect of high-affinity anti-VEGF antibody, particularly ranibizumab in the patient suffering age-related moist macular degeneration. What is presented is a kit comprising a first oligonucleotide and additional nucleotides specific for allele polymorphisms of matrix metalloprotease 25 (MMP25) gene corresponding to rs1064875. If the respective genotype contains AA or AG, the high probability of the effect of the above treatment is predicted. |
|
Differential diagnostic technique for hepatic steatosis and steatohepatitis Invention represents a method for the differential diagnostics of hepatic steatosis and steatohepatitis by biochemical tests characterised by measuring blood serum phospholipase A2, nitrogen oxide and endotoxin; if phospholipase A2 is 199.7-252.5 ng/ml, nitrogen oxide is 93-94.6 mcmole/l and endotoxin is 2.2-2.6 EU/ml, hepatic steatosis is diagnosed; if phospholipase A2 is 412.5-576.5 ng/ml, nitrogen oxide is 137.5-168.5 mcmole/l and endotoxin is 3.32-4.18 EU/ml, steatohepatitis is diagnosed. |
|
|
Invention described a method for predicting the high risk of industrial and occupational diseases in chemical workers employed in harm involving measuring the total antioxidant status in blood serum, which is also analysed for quantitative content of lipid peroxidation products; if an increase of lipid peroxidation products of more than 4.31 mcmole/l and a decrease of total antioxidant status of less than 1.3 mcmole/l are observed, the high risk of industrial and occupational diseases is predicted. |
Another patent 2551317.