Method of predicting frequent development of acute respiratory viral infections during first year in term new-born babies with intrauterine flu a(h3n2)

FIELD: medicine.

SUBSTANCE: level of anti-flu antibodies in blood serum from umbilical vein (A), concentration of middle molecular peptides in blood plasma from umbilical vein (units of optical density) (B), total number of T-lymphocytes (CD3+) in points: 1 point - CD3+ higher than 48%; 2 points - CD3+ 47%-41%; 3 points - CD3+ 40% and lower in venous umbilical blood are determined in term new-born babies at birth. After that, prediction of frequent development of acute respiratory viral infections is realised by means of discriminant equation: D=+0.008×A-111.694×B-1.537×C, where D is discriminant function with boundary value, equal - 34.16. If D is equal or is larger than boundary value, absence of development of frequent respiratory viral infections during the first year of life in term new-born babies with intrauterine flu A(H3N2) is predicted. If D is lower than boundary value, frequent development of acute respiratory viral infections during the first year of life in term new-born babies is predicted.

EFFECT: increased probability of correct prediction of frequent development of acute respiratory viral infections during the first year of life in term new-born babies.

2 ex

 

The invention relates to medicine, namely to Perinatology and Pediatrics.

It is now established a clear correlation between increased susceptibility of children to respiratory viral infections and low titer natural antiviral antibodies [3, 4, 6]. There is a view that the frequent development of acute respiratory viral infection in full-term infants during the first year of life and the transition of acute inflammation in chronic form due to impaired antiviral protection through the decrease in their body level of transplacental antibodies penetrated [3, 6] and their inhibition of cell-mediated immunity [1, 5]. Known method for predicting frequent development of acute respiratory viral infections during the first year of life in preterm infants with in utero influenza A(H3N2) [7].

The disadvantage of this method [7] is the inability to predict the frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2) in the moment of their birth, as it is designed to predict frequent acute respiratory viral infections in premature, the reaction of which on antenatal infection significantly different from full-term.

Forecasting the frequent development of acute resp�rotornyh viral infections during the first year of life in full-term infants with in utero influenza A(H3N2) will allow timely and reasonable to prevent respiratory pathology during the first year.

The proposed method is the ability to predict in the first days of life frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2).

This object is achieved in that the prediction of the frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2) by definition in whey of blood from a vein of the umbilical cord in full-term newborns the magnitude of the titer of anti-influenza antibodies in its four-fold excess compared to that of mothers) (A), the level of medium molecular peptides in cord blood plasma (in units the opt. the raft.) (In), total T lymphocytes (CD3+) in points: 1 point - CD3+ 48%; 2 points - CD3+ 47%-41%; 3 points - CD3+ 40% and less) in the venous blood of the umbilical cord, and then carry out a forecast of the frequent development of acute respiratory viral infections by using a discriminant equation:

D=+0,008×A-111,694×In-1,537×C, where

D - discriminant function with boundary value equal to - 34,16.

The method consists in the determination using discriminant of the equation in full-term infants with in utero influenza A(H3N2) discriminant functions (D), in relation to which the boundary value�Oia discriminant functions predict the frequent development of acute respiratory viral infections during the first year of life.

The method includes the following techniques:

1. With the help of response inhibition of haemagglutination determines the magnitude of the titer of anti-influenza antibodies in the serum of venous blood of the umbilical cord in full-term newborns; forecasting is performed in the case of his four-fold excess compared with that in the serum of venous blood of their mothers (A) [2, 7].

2. Estimate the concentration of medium molecular peptides in blood plasma of umbilical venous (unit opt. the raft) in full-term newborns [8] (B).

3. Determine the total content of T-lymphocytes % (CD3+) (in points) in the venous blood of the umbilical cord in full-term newborns, for example, using the method of flow cytopfuorometry apparatus BD FACS CANTO II using monoclonal antibodies Becton Dickinson (USA) (C).

4. Using discriminant equations that determine the magnitude of discriminant functions:

D=+0,08×A-111,694×In-1,537×S.

5. Compare the value of the discriminant function with boundary value equal to - 34,16;

6. Predicting development during the first year of life, frequent acute respiratory viral infections: when D is equal to or greater than the boundary values, predict the absence of frequent acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2), and when D is less than the boundary values predict frequent times�the itia acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2).

The probability of a correct forecast 83,1%.

To illustrate the effectiveness of the proposed method for predicting frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2) here are clinical examples.

Example 1

Newborn I. was Born from the first pregnancy. The mother at 19 weeks showed signs of influenza A(H3N2) with a clinical picture of acute rhinopharyngitis. In the study of paired sera by reaction of hemagglutination-inhibition antibody titer was 1:16-1:64. Influenza infection proceeded with temperatures up to 38°C, headache, cough, runny nose, chills, weakness. At 32 weeks was diagnosed placental insufficiency, for which the patient was treated in the hospital. Blood group A(II), RH - positive. In female consultations were observed regularly from 5 weeks of gestation. First birth at term, vaginally. Amniotic fluid light.

Clinical diagnosis of the mother: a Birth in the first term, quick. Chronic fetoplacental insufficiency. Amniotomy.

The boy was born weighing 3480 g, length 52 cm, head circumference 34 cm and chest 33 cm blood type A(II), RH - positive. In the blood from the vein of the umbilical cord of the child's total hemoglobin is 213 g/l, leukocyte count of 11.2×109/l, eosinophils - 2%, stab neutrophils - 4%, segmented neutrophils - 70%, lymphocytes - 20%, and monocytes - 4%. The concentration of antibodies to influenza A(H3N2) in the sera of pairs "mother-newborn" was 1:64-1:256.

A newborn's condition at birth was close to satisfactory. The skin of the trunk - pink. During the inspection it was noted: cyanosis of nasolabial triangle, a moderate decrease in motor activity, muscle tone and tendon reflexes. Physiological reflexes fuzzy. Heart tones are clear, rhythmic to 144 beats per 1 minute. Respiratory rate 46 in 1 minute. Auscultation of the lungs was recorded puerile breath. The external genitals were developed proper of a male. Peeing in the delivery room. Laboratory examination of a child in the cord blood plasma concentration of medium molecular peptides amounted 0,273% opt. raft., and the number of T lymphocytes (CD3+) 45% (2 points).

Clinical diagnosis of the newborn: Intrauterine infection (influenza A(H3N2) influenza titers of antibodies in the system "mother-newborn" 1:64-1:256).

The above indicators were then entered into a discriminant equation:

+0,08×256-111,694×0,273-1,537×2=-13,08, where D is the discriminant function with boundary value equal to - 34,16.

Dynamic observation of the child at the site in the child Palicki�ICA predicted the absence of frequent development of acute respiratory viral infections during the first year of life. The clinical picture of acute respiratory viral infections (acute nasopharyngitis) was diagnosed once.

Example 2

Newborn P. was Born from the first pregnancy. In 15 weeks the mother suffered from influenza A(H3N2) (antibody titer of 1:4-1:16) with the rise of temperature to 37.6°C, with a headache, cough, runny nose and weakness. At 30 weeks was diagnosed placental insufficiency, was treated for 20 days in the hospital. Blood group b(III) RH - positive. In female consultations were observed regularly from 7 weeks of pregnancy. Birth vaginally. Amniotic fluid is tinged with green.

Clinical diagnosis of the mother: a Birth in the first period. Early discharge of amniotic fluid. Intrauterine hypoxia. Chronic placental insufficiency.

The boy was born weighing 3250 g, length 53 cm, head circumference 34 cm and chest 33 cm blood Group b(III) RH - positive. In the venous blood from the umbilical cord of the child at birth, total hemoglobin was 212 g/l, white blood cell count is 10.2×109/l, eosinophils - 2%, stab neutrophils - 4%, segmented neutrophils 72%, lymphocytes - 20%, and monocytes - 2%. The concentration of antibodies to influenza A(H3N2) in the sera of pairs "mother-newborn" was 1:16-1:64.

A newborn's condition at birth was close to satisfactory. The skin of the face, konechnosti� and trunk was clean. Was observed cyanosis nasolabial triangle and limbs. Registered a decrease of muscle tone and tendon reflexes. Physiological reflexes were fuzzy. Heart sounds clear, rhythmic to 143 beats per 1 minute. Respiratory rate 47 in 1 minute. The breath in his lungs was puerilism. The external genitals were developed proper of a male. The child urinated in the delivery room. Laboratory examination of a child in the cord blood plasma concentration of medium molecular peptides amounted 0,311 units wholesale. raft., and the number of T lymphocytes (CD3+) 39% (3 points).

Clinical diagnosis of the newborn: Intrauterine infection (influenza A(H3N2), influenza titers of antibodies in the system "mother-newborn" 1:16-1:64).

The above symptoms were entered into the discriminant equation:

+0,08×64-111,694×0,311-1,537×3=-34,23, where D is the discriminant function with boundary value equal to - 34,16.

Predicted frequent development in full-term child acute respiratory viral infections during the first year of life.

When monitoring a full-term infant during the first year of life with acute respiratory viral infection was diagnosed 5 times.

The method was tested in 68 cases.

A correct prediction was confirmed in 83.1% of cases.

Information sources

1. Bohr T. F., Geneva E. A., Kozlov V. K. and d�pie. Features of the quantitative parameters of the immune system in newborns from women with placental insufficiency syndrome // far East medical. log. - 1997. - No. 2. - Pp. 47-49.

2. The flu: a Guide for physicians / ed. by Acad. Academy of natural Sciences, Professor G. I. Karpukhin. SPb.: Hippocrates, 2001. - 360 p.

3. Netreba N. And. Features of immune responses in young children and the role of maternal immunity in protection against acute respiratory viral infections // Antenatal care in pregnancy and prevention of perinatal pathology / Theses of reports, the Ministry of health of the Ukrainian SSR, Kiev scientific research Institute of Pediatrics, obstetrics and gynecology named after Hero of the Soviet Union, Professor P. M. buyko. Kiev, 1979. P. 190-191.

4. Nisevich L. L. Antiviral immunity in chronic bronchopulmonary diseases in children: author. dis. doctor. honey. Sciences. Moscow, 1983. - 47 p.

5. Kim, E. N., Luchaninova V. N., Burmistrova T. I. the Effect of intrauterine infection on the health of young children // far East medical. log. - 2008. - No. 2. - Pp. 74-76.

6. Tretiakevich Z. N. Restorative therapy of children, often suffering from acute respiratory infections // the Main ways of improving the specialized pulmonary care to the population // the Collection of scientific. works under the editorship of V. A. S. V. I. Tyreckogo and senior researcher I. G. Cory. Leningrad, 1990. P. 94-95.

7. Gorik I. N., Lutsenko M. T., Nachamkin L.�., Sudakov, A. G., Samsonov I. P. Method for predicting frequent development of acute respiratory viral infections during the first year of life in premature infants with in utero influenza A(H3N2). Pat. 2439567 Grew. Federation: IPC GO1N 33/50/ I. N. Gorik, Lutsenko M. T., L. G. Nachamkin, A. G. Sudakov, I. P. Samsonova; applicant and patentee GU, Dagestan scientific center SB RAMS. - No. 2010142470/15; various types. 18.10.2010; publ. 10.01.2012, bull. No. 1.

8. Samsonov, V. P., Lutsenko M. T., Novik E. V. Diagnostics of various degrees of endotoxemia abscesses in the lungs: methodical recommendations of Ministry of health of Russia, Institute of physiology and pathology of respiration SB AMS USSR. - Blagoveshchensk, 1988. 10 s.

A method for predicting frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2), namely that at birth they determine the magnitude of the titer of anti-influenza antibodies in serum from the umbilical vein (A), concentration of medium molecular peptides in blood plasma of umbilical venous (unit opt. the raft) (B), the total number of T lymphocytes (CD3+) in points: 1 point - more than 48%; 2 points - 47%-41%; 3 points 40% or less) in the venous blood of the umbilical cord, and then carry out a forecast of the frequent development of acute respiratory viral infections by using a discriminant equation:
D=+0,008×A-111,694×In-1,537×C, where
D - discriminant function with �these officers need to be value equal 34,16;
when D is equal to or more boundary values predict the absence of frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2), and when D is less than the boundary values predict frequent development of acute respiratory viral infections during the first year of life in full-term infants with in utero influenza A(H3N2).



 

Same patents:

FIELD: medicine.

SUBSTANCE: biological object, which contains mixture of hydroxybenzene and its monomethyl-substituted are crashed, processed twice with ethylacetate for 30 minutes with ethylacetate, ethylacetate extracts are combined, treated with ethanol solution of calcium hydroxide, solvent from combined ethylacetate extract is evaporated at 16-20°C, residue is repeatedly treated with acetone, containing hydrochloric acid in excess with respect to potassium hydroxide, present of residue, acidified acetone extracts are combined, treated with water solution of sodium hydroxide to neutralise residues of hydrochloric acid in acetone and create excess of alkaline medium, acetone is evaporated from combined extract, water-alkali residue is diluted with water, formed solution is acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether, extract is dehydrated, evaporated, chromatographed in column with silica gel with application of mobile phase hexane-diethyl ether with ratio 6:4 in volume, eluate fractions, containing hydroxybenzene and its monomethyl substituted, are combined, extracted with buffer solution with pH 12-13, water-alkali extract is acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulphate, extracted with dichloromethane, dichloromethane extract is dehydrated, analysed substances, contained in dichloromethane extract, are transferred into corresponding trimethylsilyl derivatives, for which purpose dichloromethane extract is treated for 20 minutes with N-methyl-N-trimethylsilyltrifluoracetamide under conditions of heating at temperature 60°C, qualitative and quantitative determination by physical-chemical method, such as chromate-mass-spectrometry, is performed in capillary column, 25 m long with internal diameter 0.2 mm with immobile phase (5%-phenyl)-methylpolysiloxane, with application of helium carrier gas, supplied at rate 0.6 ml/min, and mass-selective detector, working in electron impact mode, initial temperature of column thermostat constitutes 70°C, said temperature is maintained for 3 minutes, and then temperature is programmed from 70°C to 290°C at rate 20°C, final temperature of column is maintained for 10 minutes, injector temperature constitutes 250°C, quadrupole temperature - 150°C, temperature of ion source - 230°C, temperature of detector interface - 300°C, intensity of signal, conditioned by charged particles, formed in bombardment of analysed substance, leaving capillary column and getting into source of ions, with ionising beam of electrons with energy 70 eV, is registered, mass-spectrum is registered by full ion flow, qualitative determination of analysed substance is realised by time of exposure, set and intensity of signals of characteristic charged particles in mass-spectrum of its trimethylsilyl derivative, with quantity of determined compound being calculated by area of chromatographic peak of its trimethylsilyl derivative.

EFFECT: increasing sensitivity and reduction of determination duration.

6 tbl, 1 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to method of predicting development of terminal stages in patients with chronic myeloleukaemia. Essence of method consists in the fact that activity of two degydrogenases - glycerol-3-phosphatedehydrogenase (G3PDH) and lactatedehydrogenases (LDG) is determined in lymphocytes of peripheral blood of chronic leukaemia patients in open stage. In case of combination of G3PDH in the range from 0 to 0.02 mcE and activity of LDG in the range from 0.04 to 5.02 mcE development of terminal stage is predicted.

EFFECT: application of claimed invention makes it possible to diagnose progress of disease, correct plan and tactics of treating given category of patients and improve results of their rehabilitation in due time.

FIELD: medicine.

SUBSTANCE: invention refers to microbiology, namely to a method for the microbiological examination of a native smear from a tongue root mucosa. The substance of the method consists in the fact that a wooden spatula is used to sample biomaterial 0.5 ml by deep scraping from the mucous membrane at the boundary of the posterior one-third of the tongue dorsum and root; two smears are prepared on two slides, 1.5-2.0 cm2 in area; the smears are dried out for 20 minutes and fixed by flame heat of an alcohol lamp continuously for 5-6 seconds, Gram-stained by a complicated differential method, microscoped with immersion with the use of a ×100 objective lens; at least 10 visual fields are inspected on each slide taking into account quantitative and qualitative characteristics of microorganisms, cells and nuclei of the epithelium.

EFFECT: invention enables the more precise examination of the native smear of the tongue.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves patient's blood analysis on the first day following ST elevation myocardial infarction for insulinemia, glycemia, free fatty acids (FFAs), retinol-binding protein, tumour necrosis factor and ghrelin; the measured values are used to calculate linear classification discriminator function (LCDF1-c) by formula: LCDF1-c=-3.877+0.095Adp+0.246Grl-0.025IL-6-0.053TNF, wherein ADP is the adiponectin concentration, Grl is the ghrelin level, IL-6 is the interleukin 6 concentration, while TNF is tumour necrosis factor, a probable risk of insulin resistance is stated if LSDF1 is less than a cluster separation point of 0.4545 and approaching a centroid line of -0.561 as close as possible.

EFFECT: more reliable early hospital diagnosis of potential insulin resistance in the patients suffered ST elevation myocardial infarction.

2 ex, 2 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: invention describes a diagnostic technique for nutritional insufficiency accompanying ulcerative colitis by immunoassay, wherein blood serum is analysed to measure the soluble adhesion molecules sICAM-1, sICAM-2 and sICAM-3; a mild degree of nutritional insufficiency is characterised by the blood lymphocyte level of 1,500-1,800·109/l, while the sICAM-1 level is 13.4-24.7 ng/ml, the sICAM-2 level is 8.1-17 ng/ml, and the sICAM-3 level is 4.4-19 ng/ml; the IgG level is 650-500 mg/l; a moderate level of nutritional insufficiency is accompanied by the blood lymphocyte level making 900-1,490·109/l, and the sICAM-1 level is 25-37.8 ng/ml; the sICAM-2 level is 17.1-23.9 ng/ml, and the sICAM-3 level is 19.5-30.8 ng/ml, the IgG level is 950-1,400 mg/l; a severe degree of nutritional insufficiency is accompanied by the blood lymphocyte level of 890·109/l and less, the sICAM-1 level is 38-63 ng/ml; the sICAM-2 level is 24-29 ng/ml and the sICAM-3 level is 30.9-42.3 ng/ml; the IgG level is 1,500-1,800 mg/l.

EFFECT: more accurate diagnosis of nutritional insufficiency accompanying ulcerative colitis.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to a method for predicting the clinical course of sarcoidosis. Substance of the method consists in analysing biopsy material of a middle lobe of the right lung. What is involved is an immunohistochemical analysis in at least 5 visual fields at magnification ×400 to measure an average myofibroblast count in the interalveolar interstitial tissue. If the derived value is more than 50, the unfavourable outcome of sarcoidosis is predicted; the value of 15 and less average myofibroblast count, the favourable outcome of sarcoidosis is predicted.

EFFECT: using the declared method enables the early prediction and detection of the group of patients not requiring a great number of additional examinations.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: sodium/iodine symporter expression on a tumour cell membrane is measured in a tumour material taken by fine-needle aspiration biopsy, and if the measured expression is less than 1%, surgery is supposed to be added with the central lymph node dissection. The sodium/iodine symporter expression on the tumour cell membrane is determined by flow cytometry.

EFFECT: on the ground of the preoperative determination of the sodium/iodine symporter expression on the tumour cell membrane, the method enables establishing the extent of surgery for high-differentiated thyroid carcinoma, papillary and follicular, reliably.

2 cl, 2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to a method of predicting a high risk of formation of adeno-tonsillar system chronic pathology in recurrent respiratory infection children (RRI). The level of interleukin -17 and MMP-9 in saliva is determined, and if the level of interleukin-17 is higher than 5 pg/mg and MMP-9 level is higher than 10 ng/ml, a high risk of formation of adeno-tonsillar system chronic pathology in RRI children is predicted.

EFFECT: application of the claimed method makes it possible to determine the high risk of formation of adeno-tonsillar system chronic pathology in RRI children in due time and to carry out early preventive procedures, aimed at the prevention of the above.

4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: newborn's umbilical blood serum agmatine is measured by capillary electrophoresis; the measured concentration of 0.038 mg/ml or more enables predicting convulsive conditions.

EFFECT: invention enables predicting convulsive conditions in newborns suffering perinatal injuries of the central nervous system and prescribing the timely pathogenetic therapy.

3 ex

FIELD: medicine, hepatology.

SUBSTANCE: one should detect the level of hepato-specific enzymes (HSE) in blood plasma, such as: urokinase (UK), histidase (HIS), fructose-1-phosphataldolase (F-1-P), serine dehydratase (L-SD), threonine dehydratase (L-TD) and products of lipid peroxidation (LP), such as: dienic conjugates (DC), malonic dialdehyde (MDA). Moreover, one should detect the state of inspecific immunity parameters, such as: immunoregulatory index (IRI) as the ratio of T-helpers and T-suppressors, circulating immune complexes (CIC). Additionally, one should evaluate the state of regional circulation by applying rheohepatography (RHG), the system of microhemocirculation with the help of conjunctival biomicroscopy (CB) to detect intravascular index (II). In case of increased UK, HIS levels up to 0.5 mcM/ml/h, F-1-P, L-SD, L-Td, LP products, CIC by 1.5 times, higher IRI up to 2 at the norm being 1.0-1.5, altered values of regional circulation, increased II up to 2 points at the norm being 1 point, not more one should diagnose light degree of process flow. At increased level of UK, HIS up to 0.75 mcM/ml/h, F-1-P, L-SD, L-TD, LP products, CIC by 1.5-2 times, increased IRI up to 2.5, altered values of regional circulation, increased II up to 3-4 points one should diagnose average degree of process flow. At increased level of UK, HIS being above 0.75 mcM/ml/h, F-1-P, L-SD, L-TD, LP products, CIC by 2 and more times, increased IRI being above 2.5, altered values of regional circulation, increased II up to 5 points and more one should diagnose severe degree of process flow.

EFFECT: higher accuracy of diagnostics.

3 ex

FIELD: medicine, infectology, hepatology.

SUBSTANCE: in hepatic bioptate one should detect products of lipid peroxidation (LP), such as: dienic conjugates (DC), activity of antioxidant enzymes, such as: catalase (CAT)and superoxide dismutase (SOD). One should calculate by the following formula: C = DC/(SOD x CAT)x100, where DC - the content of dienic conjugates, SOD - activity of superoxide dismutase, CAT - activity of catalase. At coefficient (C) values being above 65 one should predict high possibility for appearance of cirrhosis, at 46-645 - moderate possibility and at 14-45 -low possibility for appearance of cirrhosis.

EFFECT: higher accuracy of prediction.

3 ex

FIELD: medicine, clinical toxicology.

SUBSTANCE: at patient's hospitalization one should gather the data of clinical and laboratory values: on the type of chemical substance, patient's age, data of clinical survey and laboratory values: body temperature, the presence or absence of dysphonia, oliguria being below 30 ml/h, hemoglobinuria, erythrocytic hemolysis, exotoxic shock, glucose level in blood, fibrinogen and creatinine concentration in blood serum, general bilirubin, prothrombin index (PTI), Ph-plasma, the state of blood clotting system. The state of every sign should be evaluated in points to be then summed up and at exceeding the sum of points being above "+20" one should predict unfavorable result. At the sum of "-13" prediction should be stated upon as favorable and at "-13" up to "+20" - prediction is considered to be doubtful.

EFFECT: higher accuracy of prediction.

2 ex, 3 tbl

FIELD: medicine, juvenile clinical nephrology.

SUBSTANCE: disease duration in case of obstructive pyelonephritis should be detected by two ways: either by detecting the value of NADPH-diaphorase activity, as the marker of nitroxide synthase activity in different renal department and comparing it to established norm, or by detecting clinico-laboratory values, such as: hemoglobin, leukocytes, eosinophils, urea, beta-lipoproteides, lymphocytes, neutrophils, the level of glomerular filtration, that of canalicular reabsorption, urinary specific weight, daily excretion of oxalates, arterial pressure, and estimating their deviation against average statistical values by taking into account a child's age.

EFFECT: higher efficiency of detection.

7 dwg, 1 ex, 6 tbl

FIELD: clinical medicine, pulmonology.

SUBSTANCE: one should carry out complex estimation of interleukin-1β) concentration in blood, saliva, bronchoalveolar liquid. Moreover, one should detect distribution coefficient (DC) for IL-1β as the ratio of IL-1β blood content to IL-1β salivary content. At increased IL-1β blood content by 10 times and more, by 2 times in saliva, unchanged level of bronchoalveolar IL-1β, at DC for IL-1β being above 1.0 one should predict bronchial obstruction. The method enables to conduct diagnostics of the above-mentioned disease at its earlier stages.

EFFECT: higher efficiency of prediction.

2 tbl

FIELD: medicine, diagnostics.

SUBSTANCE: the present innovation deals with genetic trials, with diagnostic field of oncological diseases due to analyzing DNA by altered status of gene methylation that take part in intracellular regulation of division, differentiating, apoptosis and detoxication processes. One should measure the status of methylation in three genes: p16, E-cadherine and GSTP1 in any human biological samples taken out of blood plasma, urine, lymph nodes, tumor tissue, inter-tissue liquid, ascitic liquid, blood cells and buccal epithelium and other; one should analyze DNA in which modified genes of tumor origin or their components are present that contain defective genes, moreover, analysis should be performed due to extracting and purifying DNA out of biological samples followed by bisulfite treatment of this DNA for modifying unprotected cytosine foundations at keeping 5-methyl cytosine being a protected cytosine foundation followed by PCR assay of bisulfite-treated and bisulfite-untreated genes under investigation and at detecting alterations obtained according to electrophoretic result of PCR amplificates, due to detecting the difference in the number and electrophoretic mobility of corresponding fractions at comparing with control methylated and unmethylated samples containing normal and hypermethylated forms of genes one should diagnose oncological diseases. The method provides higher reliability in detecting tumors, detection of remained tumor cells after operation.

EFFECT: higher efficiency of therapy.

1 cl, 3 dwg, 4 ex

FIELD: medicine, gastroenterology.

SUBSTANCE: one should carry out diagnostic studying, moreover, on the 5th -6th d against the onset of exacerbation in case of gastric and duodenal ulcerous disease one should detect the content serotonin, histamine and acetylcholine in blood, then during 2-3 wk one should conduct medicinal therapy to detect serotonin, histamine and acetylcholine level in blood again and at serotonin content being by 2-3 times above the norm, histamine - by 1.15-1.4 times above the norm and acetylcholine - by 20-45% being below the norm one should predict the flow of gastric and duodenal ulcerous disease as a non-scarring ulcer.

EFFECT: higher accuracy of prediction.

3 ex

FIELD: medicine.

SUBSTANCE: method involves taking blood from ulnar vein (systemic blood circulation) and from large vein of the injured extremity proximal with respect to lesion focus (regional blood circulation). Spontaneous NST-test value is determined and difference is calculated in systemic and regional blood circulation as regional-to-systemic difference. The difference value is used for predicting clinical course of pyo-inflammatory disease in extremities.

EFFECT: high accuracy of diagnosis.

4 cl, 2 tbl

FIELD: medicine, gastroenterology.

SUBSTANCE: one should introduce biologically active substance, moreover, in patient's blood serum one should detect the content of acetyl choline and choline esterase activity followed by 2-h-long intragastric pH-metry at loading with biologically active substance as warm 40-45%-honey water solution at 35-40 C, and at increased content of acetyl choline being above 1.0 mM/l, choline esterase being above 0.5 mM/l/30 min and pH level being 6.0-6.9 it is possible to consider apitherapy to be useful for treating ulcerous duodenal disease.

EFFECT: higher efficiency and accuracy of detection.

3 ex

FIELD: medicine, gastroenterology.

SUBSTANCE: it has been suggested a new method to detect pharmacological sensitivity to preparations as acidosuppressors. After the intake of the preparation a patient should undergo fibrogastroduodenoscopy 3 h later, then, through endoscopic catheter one should introduce 0.3%-Congo red solution intragastrically and the test is considered to be positive at keeping red color that indicates good sensitivity to the given preparation, and in case of dark-blue or black color the test is considered to be negative that indicates resistance to this preparation. The suggested innovation widens the number of diagnostic techniques of mentioned indication.

EFFECT: higher efficiency of diagnostics.

2 ex

Up!