Method for determining human genotype by polymorphism in matrix metalloproteinase mmp9-1562 c>t (rs3918242) gene

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

 

1. Area of technology

The proposed method relates to the field of medicine, biology and biotechnology and can be used in the diagnosis of periodontal disease in the oral cavity, predict the severity and speed of progression of the disease and the treatment algorithm of the disease depending on the individual genetic profile of the patient.

For many years, periodontal disease consistently rank as the prevalence of one of the leading places in the world. Despite the extensive development of instrumental and laboratory methods of research, early and accurate diagnosis of various dental diseases is still a matter of extreme importance.

It is known that the development and course of any disease of bacterial origin is determined by the response of the body, which, in turn, depends not only on acquired immunity, but is largely determined by genotype. Over the last 10-15 years the first results on the identification of genetic markers of periodontitis. Established Association with periodontitis polymorphic loci of genes of cytokines, collagen type 1, HLA antigens, vitamin D receptor, of a number of enzymes and regulatory molecules (P. M. Brett et al., 2005; A. A. Agrawal et al., 2006; T. Tervonen et al., 2007; J. Wagner et al., 2007; Pirhan D. et al., 2007; B. Houshmand et al., 2009; L. Chai et al., 2009; K. Erciyas et al., 2010; Screl-Caminaga R. M. et al., 2011).

For the first time the interrelation of option - T (rs3918242) gene matrix metalloproteinase MMR with the development of chronic generalized periodontitis, indicating the involvement of genetically-determined system "proteolysis-antiproteases" in the pathogenesis of periodontal disease (Zorina, 2011).

2. The level of technology

It is a widely accepted method for determining the type of nucleotide in a specific location of the DNA based on the use of allele-specific primers with the registration of the PCR results after completion of the reaction by electrophoresis. When using PCR with registration of results in the reaction, various methods of determining the genotype of the test sample.

There are ways to determine the type of nucleotide in a specific location of the DNA based on the use of allele-specific primers with the registration of the PCR results directly during the reaction using fluorescently-labeled probes (oligonucleotides) (Andreas R. Tobler at all, "THE SNPlex Genotiping System: A Flexible and Scalable Platform for SNP Genotyping", Journal of Biomolecular Techniques, V. 16, issue 4, Desember 2005).

For example, in sets of production Applied Biosystems using one pair of primers for each allele and two probes with different fluorescente marks, depending on the genotype of the allele is fixed with a flare-up of different m�current ("TaqMan SNP Genotyping Assays", Applied Biosistems, Prodakt Bulletin, USA, 06/2006). A disadvantage of the method used in these sets is the relatively low reliability of the results of the study because of the small difference between the obtained fluorescence curves for different alleles.

The proposed approach to the detection of genetic polymorphism is the use of two allele-specific and labeled with different fluorescent-labeled oligonucleotides and oligonucleotide carrying a quencher of fluorescence and hybridizers on the matrix next to the allele-specific oligonucleotide. Hybridization of allele-specific oligonucleotide to the matrix leads to the transfer of energy to the fluorophore donor extinguisher fluorescence adjacent "quenching" of the oligonucleotide. The registration of the results of amplification are after PCR by removing the fluorescence spectrum when the temperature of the reaction mixture in the range from 25 to 80 degrees Celsius (so-called "melting curves"). When you obtain a graph of fluorescence as possible heating and cooling of the reaction mixture at the specified temperature range.

The present invention makes the determination of variable positions in the DNA is more reliable and reduces the cost of such research through the use of standard equipment.

3. Disclosure and�gaining

The technical result, which directed the present invention is to improve the reliability and availability of such studies, since the method may be implemented on a known standard equipment. It also provides the opportunity to conduct research in a single tube, which reduces the cost of the study.

We used genotyping method is a variant of the classical method of "adjacent samples". In determining the substitutions of single nucleotides initially, PCR was performed with primers common to both variants of the sequence, then the temperature of the reaction mixture was reduced to hybridization matrix obtained with oligonucleotide samples. To identify variant sequences used two types of oligonucleotides, gibridizatsiya on the matrix next. One of the oligonucleotides was labeled with the fluorophore from the quencher of fluorescence.

In the reaction used one common oligonucleotide with a quencher of fluorescence and a pair of allele-specific (sequence-specific) oligonucleotides carrying the fluorophore. Oligonucleotide samples corresponding to one or another variant of the sequence was labeled with different fluorophores, which allowed to determine both options in a single tube. Identification of the genotype was performed after PCR and hybridization �UTEM measuring the level of fluorescence during thermal denaturation of duplexes of oligonucleotides derived matrices (or, on the contrary, hybridization). This measurement was performed in real time, it was melting curves.

The reaction conditions were selected to maximize the difference in the melting points of the perfect and imperfect duplexes. Thus, if the test sample contained only one variant sequence, i.e. homozygotes on this polymorphism, the melting temperature for the sample, which forms a perfect duplex was significantly higher than for the sample ,forming an imperfect duplex. If analyzed heterozygous sample, the melting temperature were almost the same.

This result is achieved by the use in PCR fluorescently-labeled allele-specific oligonucleotide probes and primers:

MMP9-1562sCGAAACCAGCCTGGTCAACG
MMR-aTCTGCCTCCCGGGTTCAAGC
MMR-RGGCGCACGCCTATAA-FAM
MMR-RGGCGCATGCCTATAA-HEX
MMR-1562pqBHQ1-ACCAGCTACTCGGGAGGC-3'-(P)

FAM means of the fluorescent dye FAM, HEX means ceiling lights�entry dye HEX, BHQ1 means attached to the 5'-terminal nucleotide dark quencher of fluorescence.

The composition of the amplification mix (per reaction):

ComponentConcentrationVolume
PCR buffer*a 1.25 fold18 µl
A mixture of dNTP0.25 mm (each)0,24 µl
Primers100 PM/μlaccording μl of 0.14
The oligonucleotides labeled with fluorophores100 PM/μl0.07 µl
Oligonucleotide labeled with a quencher of fluorescence100 PM/μl0,14 µl
Tag polymerase10 units of activity/µl0.5 µl
N2O (deionized)-to 30 µl
Genomic DNA-5 µl

* Composition Boo�EPA for PCR

84 mm Tris-HCl pH 8,6

21 mm (NH4)2SO4

3.1 mm MgCl2

0,003% Tween-20

0,003% NP-40

6.25% glycerol

4. The implementation of the invention

As material for research, it is recommended to use blood, scrapings of buccal epithelium, biopsies of soft tissue of a human or other standard biological material. Extraction of DNA from biological material is produced using a set of reagents for DNA extraction (not the subject of this patent).

Polymerase chain reaction and determination of the melting temperature of oligonucleotide samples was performed using detection of amplifier "DPRAM" (000 "NGOs DNA-Technology, Russia). Used the following temperature regime of amplification: 94°C - 10 s, 64°C - 30 C for 50 cycles. Upon completion of the amplification reaction, the reaction mixture was then cooled to 25°C at a rate of 2°C/sec. Melting curves were prepared as follows: the temperature of the reaction mixture increased from 25°C to 75°C with a step of TOS, measuring the level of fluorescence at each step.

The results, i.e. the assignment of the sample to homozygote or heterozygote on this allele, are evaluated in the form of a melting curve of DNA (Fig. 1).

References:

1. Agrawal A. A., Kapley A., Yeltiwar R. K. et al. Assessment of single nucleotide polymorphism at IL-1A14845 and IL-1B 13954 as genetic susceptibility test for chronic periodontitis in Maharashtrian ethnicity. // J. Periodontol. - 2006. - Vol.77. - P. 151-1521.

2. Brett P. M., Zygogianni P., Griffiths, G. S. et al. Functional gene polymorphisms in aggressive and chronic periodontitis. // J. Dent. Res. - 2005. - Vol.84, No. 12. - P. 1149-1153.

3. Pirhan D., Atilla g, Emingil G. et al. Effect of MMP-1 promoter polymorphisms on GCF MMP-1 levels and outcome of periodontal therapy in patients with severe chronic periodontitis. // J. Clin. Periodontol. - 2008. - Vol.35, No. 10. - P. 862-870.

4. Scarel-Caminaga R. M., Trevilatto P. C., A. P. Souza et al. Investigation of IL4 gene polymorphism in individuals with different levels of chronic periodontitis in a Brazilian population. // J. Clin. Periodontol. - 2003. - Vol.30. - P. 341-345.

5. Tervonen, T., Raunio T., Knuuttila M. et al. Polymorphisms in the CD 14 and IL-6 genes associated with periodontal disease. // J. Clin. Periodontol. - 2007. - Vol.34. - P. 377-383.

6. Wagner J., Kaminski W. E., C. Aslanidis Prevalence of OPG and IL-1 gene polymorphisms in chronic periodontitis. // J. Clin. Periodontol. - 2007. - Vol.34. - P. 823-827.

7. Zorina O. A. the Relationship of the qualitative and quantitative composition of biocenoses of the mouth and an individual's genetic profile on the background of inflammatory periodontal diseases. // Dissertation - M., 2011.

The method for determining the genotype at polymorphism in the gene matrix metalloproteinase MMR-1562 C>T (rs3918242), based on the melting curves with fluorescently-labeled allele-specific oligonucleotide probes, characterized in that use is common to all alleles of a pair of primers, wherein for each allele fluorescently-labeled allele-specific oligonucleotide probe and a universal oligonucleotide labeled with a quencher of the fluorescence of the following nucleotide composition:

MMP9-1562sCGAAACCAGCCTGGTCAACG
MMR-aTCTGCCTCCCGGGTTCAAGC
MMR-RGGCGCACGCCTATAA-FAM
MMR-RGGCGCATGCCTATAA-HEX
MMR-1562pqBHQ1-ACCAGCTACTCGGGAGGC-3'-(P)

FAM means of the fluorescent dye FAM, HEX means of the fluorescent dye HEX, BHQ1 means attached to the 5'-terminal nucleotide dark quencher of fluorescence;
the assignment of the sample to homozygote or heterozygote for this allele are evaluated in the form of a melting curve of DNA (the maximum of the first derivative graphs of fluorescence).



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention deals with method of determining biological activity of embryonated eggs of Trichuris. Characterised method includes realisation of at least 3 analyses, selected from: evaluation and/or confirmation of stage of embryonated development of eggs by means of method of quantitative PCR with application of suitable marker sequences for determination of quantity of genome DNA copies, evaluation of metabolic activity of embryonated eggs by means of biochemical and/or molecular-chemical methods, evaluation of inducibility of gene expression in embryonated eggs, evaluation of mobility of Trichurs larvae by means of microscope for long periods of observation after preliminary incubation at higher temperatures and/or evaluation of coefficient of hatchability of Trichurs larvae in organism of laboratory animal.

EFFECT: claimed invention can be used in obtaining safe pharmaceutical products, therapeutically efficient in application in humans.

15 cl, 10 dwg, 11 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to cardiology, and can be used to predict a risk of the cardiovascular mortality in patients with post-infarction chronic heart failure combined with type 2 diabetes mellitus. That is ensured by measuring circulating progenitors of the antigenic phenotype CD34+, CD133 dim, CD45-. If the measured cell count is less than 300 per one million leukocytes, a poor prognosis manifested by progressing heart failure and the increasing risk of the cardiovascular lethality is done.

EFFECT: invention provides predicting the survival rate values in the given group of patients by using the new blood biomarker.

2 cl, 2 dwg

FIELD: medicine.

SUBSTANCE: peripheral blood dead cells are treated with primary oestrogen-binding protein antibodies specifically interacting with segmented granulocyte superficial antigens; secondary anti-species fluorescent-labelled antibodies are added to the antigen-antibody complex; the malignant new growths are diagnosed if the segmented granulocyte surface is reported to be stained; no dye stains on the segmented granulocyte surface enable diagnosing benign new growths. The method is non-invasive, enables fast and 100%-accurate differentiation of the patients suffering from breast cancer and the patients with benign new growths and healthy women.

EFFECT: lower self-discharge, higher efficiency with an increased power density per a unit of weight; the test can be used for the instant diagnosis of breast cancer.

6 ex, 6 dwg

FIELD: medicine.

SUBSTANCE: predicting developing haematogenous metastases following combined treatment of kidney cancer precedes determining the NF-kB p50, HIF-1α expression in the tumour tissue and the concentration of the vascular endothelial growth factor VEGF. Discriminant functions Y1, Y2 are calculated by equations: Y1=-3.2+0.026·X1+0.03·X2-0.02·X3+0.34·X4+0.3·X5; Y2=-33.3-0.01·X1+0.11-X2-1.2·X3+1.57·X4+1.8·X5, wherein X1 is the total proteasome activity ·10-3 IU/mg of protein; X2 is the concentration of VEGF, pg/mg of protein; X3 is HIF-1 expression, standard unit/mg of protein in a well; X4 is NF-kB p50 expression, standard unit/mg of protein in a well. If observing Y1>Y2, the absence of the haematogenous metastases is predicted, while Y1<Y2 enables predicting developing the haematogenous metastases.

EFFECT: predicted developing kidney cancer, timely prescription of the most adequate therapeutic measures.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to obstetrics and gynaecology, and can be used for the prediction of retardation of intrauterine foetus development. For this purpose a relative content of CD3+CD16+56+-lymphocytes, a level of C3-component of the complement and the soluble receptor of tumour necrosis factor (sTNF-R) are determined in a woman's venous blood at early terms of pregnancy. The prognostic index (PI) is calculated by formula: PI=-0.8911X1-0.0321X2-2.3669X3+11.0779, where X1 is the relative content of CD3+CD16+56+-lymphocytes, %; X2 is the concentration of C3-component of the complement, mg/dl; X3 is the concentration of sTNF-R, ng/ml. If PI<0 retardation of intrauterine foetus growth in the second half of pregnancy is predicted, and if PI>0, a conclusion about a low risk of development of the said pathologic condition is made.

EFFECT: method is low-invasive, makes it possible to identify a risk group by the formation of retardation of intrauterine foetus development from the early terms of gestation, which makes it possible to carry out preventive procedures aimed at the prevention of the said pathological condition.

5 ex

FIELD: medicine.

SUBSTANCE: presence of CD31 and S100 positive cells in the cerebrospinal fluid is determined on 1-2 day of a disease by an immunocytochemical method. In case the content of the CD31 is higher than 0.5% and the presence of S100 positive cells, an unfavourable course of bacterial purulent memingitis (BPM) is predicted. If the CD 31 content is lower than 0.5% and the absence of S100 positive cells, a favourable course of the disease is predicted.

EFFECT: application of the claimed method of liquor-cytological prediction of the BPM course in children makes it possible to predict the favourable and unfavourable course of the disease at early terms of the disease, carry out monitoring of vessels of the microcirculatory bed of the brain in the course of the disease and correct therapy.

1 tbl, 2 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: wings of ilium are punctured in an anterior and posterior one-third of the wings with two trocars being inserted into each wing. The bone marrow (BM) is collected by simple aspiration, aspiration irrigation or a combination thereof at an underpressure of 0.6 Atm with using a device. The bone marrow preparation device comprises a disposable multi-channel closed system, an aspiration collection unit and a perfusion unit. The group of inventions also refers to a method for assessing the prepared bone marrow. The effect is ensured by automatic control of myeloaspiration by preparing a biological material with using a special designed device for the bone marrow collection.

EFFECT: using the given method for preparing the bone marrow provides preparing the sterile bone marrow rich in viable multipotent mesenchymal stromal and hemopoietic progenitor cells.

7 cl, 1 ex, 1 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: method describes determining circulating tumour cells sensitive to adjuvant hormone therapy in blood of patients suffering from breast cancer, and involves recovering and enriching the circulating tumour cells with using magnetically marked antibodies, producing lysates of the circulating tumour cells, recovering iRNA from the lysates of the circulating tumour cells, producing cDNA, producing amplified DNA, determining expression of marker genes; if observing one of the markers GA733-2, MUC-1, HER2, the presence of the circulating tumour cells is stated; and if the markers ESR1, PGR are present, the circulating tumour cells sensitive to hormone therapy is concluded.

EFFECT: method enables providing a considerably higher probability of detecting the circulating tumour cells sensitive to adjuvant hormone therapy, increasing the measurement accuracy and the number of analysed characteristics of the tumour cells, ensuring higher sensitivity of the analysis techniques and more effective diagnosis in managing patients with breast cancer for assessing the prediction and therapeutic efficacy, improving the clinical effectiveness and survival rate of oncologic patients.

5 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: lymphocyte subpopulation fractions are measured, and a predictive index is calculated with calculating a lymphocyte subpopulation percentage by flow cytofluorometry. If the predictive index PI<350, achieving the fast virological response to antiviral therapy of CHC is predicted; if the predictive index PI>350, the absence of the fast virological response to antiviral therapy of chronic hepatitis C genotype 1b is predicted.

EFFECT: using the given invention enables making a high-accuracy prognosis of the fast virological response in the patients with chronic hepatitis C genotype 1b to antiviral therapy.

2 ex, 1 dwg

FIELD: medicine.

SUBSTANCE: to predict developing infectious syndrome in patients with acute leukemia, CD16+ neutrophil count is determined in a patient's bone marrow. If bone marrow CD16+ neutrophil count is less than 50%, developing infectious syndrome with clinical manifestations is predicted.

EFFECT: using the given method enables predicting developing infectious syndrome with manifesting acute leukemia prior to chemotherapy.

2 ex

FIELD: medicine.

SUBSTANCE: sodium/iodine symporter expression on a tumour cell membrane is measured in a tumour material taken by fine-needle aspiration biopsy, and if the measured expression is less than 1%, surgery is supposed to be added with the central lymph node dissection. The sodium/iodine symporter expression on the tumour cell membrane is determined by flow cytometry.

EFFECT: on the ground of the preoperative determination of the sodium/iodine symporter expression on the tumour cell membrane, the method enables establishing the extent of surgery for high-differentiated thyroid carcinoma, papillary and follicular, reliably.

2 cl, 2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to a method of predicting a high risk of formation of adeno-tonsillar system chronic pathology in recurrent respiratory infection children (RRI). The level of interleukin -17 and MMP-9 in saliva is determined, and if the level of interleukin-17 is higher than 5 pg/mg and MMP-9 level is higher than 10 ng/ml, a high risk of formation of adeno-tonsillar system chronic pathology in RRI children is predicted.

EFFECT: application of the claimed method makes it possible to determine the high risk of formation of adeno-tonsillar system chronic pathology in RRI children in due time and to carry out early preventive procedures, aimed at the prevention of the above.

4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: newborn's umbilical blood serum agmatine is measured by capillary electrophoresis; the measured concentration of 0.038 mg/ml or more enables predicting convulsive conditions.

EFFECT: invention enables predicting convulsive conditions in newborns suffering perinatal injuries of the central nervous system and prescribing the timely pathogenetic therapy.

3 ex

FIELD: medicine.

SUBSTANCE: substance of the method consists in determining the concentrations of neuron-specific enolase (NSE) and vascular endothelial growth factor (VEGF) in umbilical blood serum and peripheral blood serum, the concentrations of brain-derived neurotrophic factor (BDNF) in peripheral blood serum on the 7th day of birth; that is followed by calculating a prognostic index (PI) by formula: PI=0.033×X1+0.016×X2-0.36×X3+0.002×X4+0.00054×X5-4.0, wherein X1 is the NSE concentration in umbilical blood (mcg/l); X2 is the VEGF concentration in umbilical blood (ng/ml); X3 is the NSE concentration in peripheral blood on the 7th day of life (mcg/l); X4 is the VEGF concentration in peripheral blood on the 7th day of life (ng/ml); X5 is the BDNF concentration in peripheral blood on the 7th day of life (ng/ml); Const=-4.0. If PI is less than 0, a low risk of ICP is stated. If PI is more than 0, a high risk of the given pathology is predicted.

EFFECT: method enables increasing the effectiveness of predicting infantile cerebral paralysis in the premature newborns with extremely low birth weight.

2 ex

FIELD: biotechnology.

SUBSTANCE: fecal sample of a patient is kept at 96% absolute alcohol for 30-60 min in the ratio of alcohol and feces of 1:1, centrifuged for 15-20 minutes, then the fecal sample is treated with 1% solution of sodium deoxycholate in a ratio of 1:1 for 30-60 minutes, centrifuged, the supernatant is removed, then the primary inoculation of precipitation in the medium with addition of 1% lactose and 0.5-1.0 mM arabinose is carried out, incubated in anaerobic culture apparatus for 24-48 hours, the grown colonies are applied to the standard discs impregnated with the chromogenic substrate - ortho nitrophenyl-β-D-galactosidase. When appearance of bright yellow colour of the disc the toxigenic strains of Clostridium difficile are diagnosed.

EFFECT: use of the claimed method enables to diagnose toxigenic strains of Clostridium difficile with high sensitivity and specificity, simplicity and accessibility.

3 ex

FIELD: medicine.

SUBSTANCE: each blood sample is analysed twice. A fresh blood sample is centrifuged at 2,000 rpm for 5 min. The samples are separated in plasma fractions and formed elements. A solid-phase plasma extraction is performed by sequential passing of 100% acetonitrile, plasma, distilled water, 50% acetonitrile solution under vacuum through a cartridge with Oasis HLB 3 cc sorbent. The cartridge with the sorbent is dried under vacuum, and 100% methylene chloride is passed through the sorbent. An aliquot portion of the produced extract is chromatographed. Producing the extract of formed elements is ensured by dispersed solid-phase extraction: by adding 100% acetonitrile thereto and agitating intensively. That is followed by adding a number of QuECHeRS salts for extraction, agitating, centrifuging for 10 minutes at 2,000 rpm; that is accompanying by forming 3 layers; an upper layer is transferred to another test tube, which contains a number of QuECHeRS salts for purification; the layers are centrifuged at 2,000 rpm; the upper layer is sampled. Plasma and formed elements extracts are analysed by Agilent 1200 liquid chromatograph with a fluorimetric detector on Zorbax column 50 mm long and having an inner diameter of 4.6 mm with Eclipse PAH C18 sorbent at column temperature 27°C; a movable phase is presented by mixed acetonitrile and water at flow rate 1.5 cm3/min and optimising elution in the gradient mode (supplying the movable phase of 60 vl % to 68 vl % of acetonitrile for 1 min, increasing 60 vl % to 68 vl % of acetonitrile for 3 min, increasing 68 vl % to 70 vl % for 0.5 min, increasing acetonitrile 70 vl % to 90 vl % for 1.5 min, increasing acetonitrile 90 vl % to 100 vl % for 4.5 min, supplying 100% acetonitrile for 1.5 min, reducing acetonitrile to 60 vl % and supplying 60% acetonitrile for 4 min to balance the column). An excitation wavelength of the fluorimetric detector makes 265 nm, and an emission wavelength makes 412 nm. A calibration chart is used to quantify benz(a)pyrene in plasma and formed elements separately, while the results are summed up.

EFFECT: invention provides high sensitivity of the method and ensures selectivity in a combination with its accessibility for routine analyses.

3 cl, 6 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: cognitive disorders are stated according to the clinical recognition and neuropsychological test results in a child. Child's blood is analysed to measure the manganese content, and if its content tends to increase more than the reference, the levels are stated: lipid hydroperoxide in blood serum, malondialdehyde MDA in blood plasma and 8-hydroxy-2-deoxyguanosine 8-OHdG in urine; glutathione peroxidase GlPO, Cu/Zn-superoxide dismutase Cu/Zn-SOD, antioxidant activity AOA of blood serum; glutamate and γ-aminobutyric acid in blood serum; hormones of the pituitary-adrenal axis: adrenocorticotropic hormone ACTH, cortisol and serotonine in blood serum, cyclic adenosine monophosphate cAMP and cyclic guanosine monophosphate cGMP. If the blood manganese content is more than 0.029 mcg/cm3 with at least 50% of the above clinical-laboratory values having the following characteristics: lipid hydroperoxide, MDA, 8-OHdG, glutamate, ACTH, cortisol, cGMP increased as compared to the age physiological norms; GlPO, Cu/Zn-SOD, AOA, γ-aminobutyric acid and cAMP reduced as compared to the age physiological norms, cognitive disorders associated with the exposure to manganese in the child.

EFFECT: using the invention provides high diagnostic accuracy.

2 cl, 1 ex

FIELD: medicine.

SUBSTANCE: blood is sampled, acidified to pH 2-3 with aqueous oxalic acid, extracted in toluene for 5 min; the prepared extract is centrifuged for 60 min at 7,000 rpm, added with sodium sulphate to dewater and acetylated for 3 hours by introducing trifluoroacetic anhydride while stirring continuously in the pyridine medium. The blood sample, toluene, trifluoroacetic anhydride and pyridine are taken in volume ratio 5:2.5:0.2:0.1 respectively.

EFFECT: simplifying the stage of sample preparation and increasing the sensitivity of pentachlorophenol test.

3 cl, 4 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention describes the diagnostic technique for oxidative stress in children exposed to nickel from the external environment and involves measuring nickel in blood samples and determining the laboratory values: in blood serum - lipid hydroperoxide, in urine - 8-hydroxy-2-deoxyguanosine; that is follows by a correlation analysis of the above laboratory values and blood nickel, if establishing the significant dependencies: high blood nickel more than 0.083 mg/dm3 and blood serum lipid hydroperoxide increased as compared to the reference and urine 8-hydroxy-2-deoxyguanosine increased as compared to the reference enables diagnosing the oxidative stress in the body at the level of cell DNA and membrane.

EFFECT: invention provides high diagnostic accuracy for the oxidative stress at the early stage in the exposure to nickel from the external environment by the complex use with interpreting the results along with the laboratory values describing the oxidative damages of cell DNA and membrane, as well as the values of blood chemical contaminant - blood nickel.

2 tbl, 2 dwg, 1 ex

FIELD: biotechnology.

SUBSTANCE: method is implemented as follows: the biological material containing novocaine is crushed, treated three times with acetone, containing 0.2-0.4% water, the liquid extract is separated, the acetone from the liquid extract is evaporated together with water in the air stream at a temperature of 18-22°C until complete removal of the solvent, the residue obtained as a result of evaporation is repeatedly treated with acetone containing 0.2-0.4% water, the acetone extract is separated, combined, and the solvent from the combined extract is evaporated, the residue is dissolved in diethyl ether, the resulting solution is diluted in hexane in a ratio of 1:1 by volume, extracted with buffer solution with pH 1-2, the acid-water extract is separated, neutralized with 10% ammonia solution, alkalized with ammonium buffer solution to pH 9.0-9.5, the resulting aqueous alkaline solution is saturated with ammonium sulphate, extracted twice with portions of the organic extractant which is used as a 30% solution of camphor in methyl acetate, at a ratio of aqueous and organic phases as 1:1 by volume, the organic extracts are separated, combined, and the solvent from the combined extract is evaporated in a stream of air at a temperature of 18-22°C to dry residue, the residue is dissolved in a mixture of dichloromethane and ethanol taken in a volume ratio of 1:1, the resulting solution is applied to a column of silica gel CRA No. 80/120 mcm, chromatographed using two-phase movable phase dichloromethane-ethanol in a ratio of 1:1 by volume, the fractions of eluate containing the analyte, combined, the eluent is evaporated, the residue is dissolved in methanol and determining is performed by gas-liquid chromatography coupled with mass spectrometric detection in a capillary column DB-5 MS EVIDEX with the length of 25 m and an inner diameter of 0.2 mm with the stationary phase, which is 5%-phenyl-95%-methylpolysiloxane using helium carrier gas supplied at a rate of 0.6 ml/min and a mass selective detector operating in electron impact mode, the initial temperature of the column oven is 80°C, this temperature is maintained for 1 minute, then the temperature is raised from 80°C to 200°C with the rate of 40°C per minute, then from 200°C to 300°C with the rate of 12.5°C per minute, the final column temperature is maintained for 16 minutes, the temperature of the injector is 200°C, the temperature of quadrupole is 150°C, the temperature of the detector interface is 300°C, the intensity of the signal is recorded, due to charged particles produced by bombarding of the analyte emerged from the capillary column and entered into the ion source, with ionizing electron beam with energy of 70 eV, a mass spectrum is recorded on total ion current and the amount of novocaine is calculated based on the chromatogram peak area.

EFFECT: increased sensitivity of determining.

2 ex, 3 tbl

FIELD: medicine.

SUBSTANCE: claimed invention relates to the field of biotechnology, namely to the preliminary estimation of the efficiency of the autologic cell material transplantation to stimulate the growth of blood vessels, and can be applied in medicine. Claimed is a method of the complex estimation of the angiogenic potential of progenitor cells in patients with cardiovascular diseases, tested on mesenchymal stromal cells of the adipose tissue (MSC-AT) of patients with ischemic heart disease and including the measurement of content of mRNA and proteins of basic angiogenic factors, produced by the progenitor cells such as the vascular endothelial growth factor (VEGF), the placental growth factor (PIGF), the hepatocyte growth factor (HGF), angiopoetin-1 and angiogenin, the angiogenic activity of total cell secretion products, as well as the estimation of the ability of the progenitor cells to stimulate the vascularisation of subcutaneous Matrigel implants, introduced to immunodeficient mice. As the screening method used is a simpler and more available but less informative method of express-assessment of the angiogenic properties of the progenitor cells, based on the measurement of the angiogenic activity of the total cell secretion products.

EFFECT: invention makes it possible to carry out testing of the autologic cell material obtained from the patients, including those with ischemic heart disease, before transplantation in order to choose the optimal tactics of cell therapy aimed at the stimulation of the growth of blood vessels.

2 cl, 2 dwg, 4 tbl, 4 ex

Up!