Method of predicting infection development in patients with acute lymphoblastic leukaemia at chemotherapy background

FIELD: medicine.

SUBSTANCE: invention deals with early diagnostics of infectious complications in patients with acute lymphoblastic leukaemia (ALL), obtaining chemotherapy (CT). Claimed method consists in the following: concentration of fibrinogen, time of XIIa-dependent euglobulin lysis (XIIa-DEL), level of soluble fibrin-monomer complexes (SFMC), activity of protein C (prC) are analysed in ALL patients during CT 2-3 times per week. If at least 2 of 4 criteria are detected, namely: ≥41% increase of fibrinogen level, ≥76% increase of SFMC, ≥11% prolongation of XIIa-DEL time and ≥12% reduction of prC activity in comparison with previous analysis, development of infectious complications is predicted.

EFFECT: method provides early prediction of infection development in patients with acute lymphoblastic leukaemia during chemotherapy.

7 tbl, 4 ex

 

The invention relates to medicine, namely to clinical laboratory diagnostics, and relates to the prediction of infectious complications in patients with acute lymphoblastic leukemia (ALL) receiving treatment with modern chemotherapy protocols (XT).

Acute leukemias (AL) lead to significant impairment of the immune system. Already at diagnosis is often found in patients with fever or infection. Infectious diseases occur in more than 50% of patients receiving XT about OL [11]. The consequence of XT is neutropenia, during which the frequency of infectious complications increases to 80% [4].

In ALL all patients demonstrated functional defects of cells both before treatment and during remission and in the development of relapse [3]. The factors that reduce cellular and humoral immunity, include long-term use of corticosteroids, purine analogues, alemtuzumab, alkylating drugs, methotrexate, rituximab. Glucocorticoids at a dose equivalent to 15 mg or more of prednisone per day, for the duration of the 1 month cause severe suppression of T-lymphocytes in a dose equivalent to 40 mg or more of prednisone per day, cause inhibition of the production of antibodies by b-lymphocytes [2].

In modern programs of treatment for ALL (Hoelzer, ALL-2005, MV-2008, ALL-2009) during predpisu and I FA�s induction daily from the 1st to the 28th day of therapy used prednisone at a dose of 60 mg/m 2a day or dexamethasone at a dose of 10 mg/m2. Glucocorticoids are administered during consolidation courses for 7 days, during maintenance 3 days.

It is important to note that severe infections in patients with weakened immune systems, which are ALL patients, may occur almost imperceptible symptoms. For example, pneumonia during neutropenia initially accompanied by only a slight shortness of breath or cough. In addition, any infectious disease can manifest non-specific symptoms such as fever or malaise [2]. Manifestation of infection only in the form of hyperthermia is observed in 30-50% of patients. And in 15.3% of patients receiving modern XT, severe infection is not accompanied by fever and occur at normal body temperature. Particularly common infectious episodes without fever or low grade fever was observed in patients receiving corticosteroids at the time of their development or in history [3, 8, 10]. When agranulocytosis temperature over 38°C, maintained for 2 hours and not related to administration of blood components or drugs, is regarded as infectious fever [4]. In case of fever or infection, the source of which in patients with AL is not always known, occurs when the neutrophil count is more than 1×109l, pok�needs urgent examination and immediate initiation of empiric therapy [2].

It is known that infection complicates the course and treatment of herpes zoster, cause activation of intravascular coagulation by minor deviations of a number of indicators of coagulation, to pronounced shifts that lead to severe disseminated intravascular coagulation (DIC). DIC is a natural manifestation of sepsis [1, 6, 12]. Appearing in the blood microorganisms or their waste products cause the release of inflammatory mediators (prostaglandins, interleukins, tumor necrosis factor, etc.) that play a significant role in activation of the coagulation cascade [5]. Most severe hemorrhages seen in patients with acute leukemia, because infectious activation of coagulation occurs on the background of thrombocytopenia. Based on the above we can assume that a number of indicators of drug test etc, anticoagulant and fibrinolytic systems can be objective prognostic markers not only of thrombohemorrhagic, but also infectious and inflammatory processes.

With a view to the timely diagnosis and establish any necessary treatment of complications patients of herpes zoster need a thorough daily inspection and regular laboratory tests. The basic rule that determines the treatment strategy, the physician should assume that all bol�tion OL with fever infection exists, until proven otherwise [11]. Thus, development of methods for early detection of infection in ALL patients with no visible lesions seems urgent. This will ensure timely administration of antimicrobial drugs and improve treatment outcomes.

The closest analogue to the claimed invention is "a Method of determining hemostatic criteria of adverse outcome of sepsis in patients with acute myeloid leukemia" (EN 2320996 Tarasova L. N. etc., priority of 05.07.2006) [7], in which to establish adverse outcome of sepsis determine the concentration of fibrinogen, the level rfmk in ethanol test and D-dimer levels and the amount of fibrinogen 6.0 g/l and more, rfmk above 3.7 V CONV.ed. and D-dimers in the range of 1001-2000 ng/ml or more state poor prognosis, which can lead to the development of multiple organ failure (MOF) and death. However, the findings in relation to patients with acute myeloblastic leukemia (AML), may not apply to ALL patients because of tumor substrate leukemia data are cells that have different immunological activity (myeloid or lymphoid series). In addition, the analog shows the clinical and laboratory criteria for the development has already occurred in patients with sepsis and its harmful� flow with possible formation of MOF and death.

The object of the present invention is the prediction of ALL patients on the background of XT of infection at an early stage, if the results of the study of a number of indicators of coagulation hemostasis.

The essence of the claimed invention lies in the fact that ALL patients receiving treatment according to modern protocols XT, 2-3 times per week determine the concentration of fibrinogen, time Xiia-dependent èuglobulinovyj lysis (Hiia-SEL), the level of soluble fibrin-monomer complexes (SFMC), activity of protein C (PRs) and the detection of at least 2 of 4 criteria, namely: raising the level of fibrinogen at ≥ 41%, rfmk - ≥ 76%, the elongation time Hiia-SEL to ≥ 11% and the decrease in the activity of PRs at ≥ 12% compared to the previous study, predict the development of infectious complications.

The technical result

The method provides early prediction of the development of infection in patients during the XT.

A method of predicting the development of infection in ALL patients is as follows. In patients with ALL receiving XT in addition to standard surveys (thorough daily inspection, conducting bacteriological and biochemical studies, the General analysis of blood and urine) to determine the rates of coagulation. For this purpose blood is taken in a plastic tube containing an anticoagulant is 3.8% RA�creative ways to 5.5 aqueous sodium citrate (0,11 mmol/l) in a ratio of 9:1. Allowed taking blood in a vacuum tube, also containing 3.8% sodium citrate (blue cap). Then obtain platelet-poor plasma, centrifuger blood at room temperature and 1000-2000 rpm for 10 min. the Concentration of fibrinogen is determined by the method of Clauss; time XIIa-dependent èuglobulinovyj lysis (Hiia-SEL) - A. G. Arkhipov and G. F. Eremin; the level of soluble fibrin-monomer complexes (SFMC) in orthophenanthroline test V. A. Lukombo and A. P. Momot [9]. The activity of protein C (PRs) determine amylolyticus method using sets of "Refrom-Protein C" (NGO "RENA", Moscow).

% change index is calculated as follows:

;

where X1- the index value for the last number;

X2- the index value for today's (current) number.

CLINICAL and LABORATORY STUDIES

The proposed criteria for the prediction of infection derived from the results of the analysis of 40 infectious episodes were observed at different stages of treatment in ALL 17 patients (8 men, 9 women) aged from 16 to 71 years (median 40 years). Therapy patients underwent the following protocols: ALL-2005 - 6 persons, MV-2008 - 3, ALL-2009 - 8. The indicators of hemostasis in patients was determined regularly, 2-3 times a week. The results obtained on the day of pervaporative infection (appearance of the hearth, or increased body temperature) (sample 2), were compared with those obtained the day before, on a clean background when there were no any signs of infection (sample 1). The data presented in table 1.

Table 1
Indicators of hemostasis in ALL patients without infection and its development on the background of XT (median, minimum-maximum values)
Indicatorssample 1 (no infection)sample 2 (infection)healthy subjects (n=35)
Fibrinogen, g/l2,34,4*2,83
(0,9-4,4)(From 0.8 to 7.7)(1,94 is 3.59)
Time CPA-SEL, min7,822*7,0
(5,0-65)(A 7.2-65)(5,0-12,5)
Rfmk, mcg/ml30240*35
(30-200)(30-280)(30-55)
PRs, %122*9487
(80-381)(54-148)(58-146)
* - the difference from the norm, p<0,05 (criterion Kruskal-Wallis test)

From table 1 it is evident that the levels of fibrinogen, Hiia-SEL and rfmk ALL patients without infectious complications did not differ from the norm and started to exceed it during the accession of infection. The activity of PRs on a clean background was increased. Obviously, this compensatory reaction in response to activating the hemostatic effect of leukemic process XT and aggressive. Under the influence of infection intravascular coagulation is enhanced, resulting in the consumption begins PRs, resulting in a reduction of its activity to the levels of norms, and the emergence markers thrombinemia - rfmk.

Indicators prior to infection and at the beginning were compared in pairs (Wilcoxon test analysis dependent variables); it revealed significant differences for all studied parameters (p<0,05).

To identify the extent of changes in the levels of fibrinogen, rfmk, time Hiia-SEL, PRs activity was compared the results of their studies, every patient�NTA before and during infection and determined, how much % of the original value has changed indicator. Then we calculated the median change in the level of the index, and 1 and 3 quartiles (Q1 and Q3) (tables 2 and 3).

It was found that the concentration of fibrinogen in the development of infection was increased on average by 74%, time Hiia-SEL lengthened by 73%, the level rfmk increased by 333% (more than 3 times), and the PRs activity was decreased by 17%. After calculating the lower quartile had proposed the following criteria for prediction of infection: increased fibrinogen concentration at ≥ 41%, rfmk - ≥ 76%, the elongation time Hiia-SEL to ≥ 11% and decrease of activity of DSC - ≥ 12%.

td align="center"> 7,83
Table 2
The change in the level of fibrinogen and time Hiia - SEL ALL patients before infection and at the beginning
No. patientFibrinogen, g/lTime Hiia - SEL, min
X1 (no infection)X2 (infection)the rise from the initial level, %X1 (no infection)X2 (infection)extension from the initial level, %
3,355,4462Of 41.86556
2To 2.94Is 4.575515,6743,5178
32,665,4210413,1745242
42,665,510734,8334,870
52,345,513520,752835
62,773,24176,1721,98256
71,923,22 697,1721,97206
81,713,23894821,9-54
92,113,24547,6721,95186
103,063,25610,4221,97111
111,597,323605,6732464
121,372,14567,8313,8377
132,185,481516 10-85
142,69To 7.681865581060
153,17Of 3.376The 6.759,1736
162,12System 6.341995,7312,23113
174,44System 6.3443The 7.2512,2169
18To 2.74Of 4.54666,3311,3379
19To 2.745,481006,337,171
202,273,053465650
212,27To 2.74216546-29
222,633,43307,526,67256
231,462,32596,837,175
241,32,277512,9326,6106
251,294,442446,3365927
26122 4,42264At 6.9265839
270,934,44377The 7.7565739
283,844,43166,838,5525
2934,4486,17Of 8.5739
302,554,42746,878,5425
312,27Of 4.04787,838,225
322,27Of 4.0478The 8.255
332,325,6614414,6964342
342,035,661796,8365852
3513,59259Equal to 16.8352209
361,952,271611,9217,7549
37Of 4.047,17659,1735,7-41
382,272,27029,0827,33 -6
392,534,786512140
402,20,8-64810,8335
The median (Q1-Q3)74The median (Q1-Q3)73
(41-137)(11-217)

Table 3
The change in the level rfmk and protein C in patients with ALL before infection and at the beginning
No. patientRfmk, mcg/mlThe activity of protein C, %
X1 (no infection)X2 (infection)the rise from the initial level, % X1 (no infection)X2 (infection)the decrease from the initial level, %
1----
21652605812010711
35528040912410317
450280460907616
53028083384805
63028083324261
7302808332029453
8302808332509462
9302808331589441
101102801551439434
1130280833--
12301002331195455
13 20020008588-4
143028083316312225
154575671551485
163524058611610212
177024024311610212
18302407008489-6
1930280833 847214
203030014812913
21301403671487947
22502403801376354
235035-3022814835
24304550998316
253026076733412762
263026076738112767
273026076734812764
2812060-50978512
2930601008185-5
3030601008085-6
3145130189928310
3230130 3331128326
333017046713710424
346517016212610417
3530701331149120
3630403317514716
37200270351209025
3835658611690 22
39301504001078818
4030403314712316
The median (Q1-Q3)333The median (Q1-Q3)18
(76-767)(12 to 39)

The developed method allows to predict the clinical manifestations of infectious complications in ALL patients at an early stage. This will contribute to the timely diagnosis of infection and the appointment of antibiotic therapy. The proposed methods are economically and technically available.

The EXAMPLES DESCRIBE a METHOD

Example 1. Patient J., 51, was admitted to the clinic of the Institute 17.08.10 G. Diagnosis: ALL, newly identified. Received therapy for induction of remission (phase I) according to the Protocol ALL-2009 20.08.10 on 01.10.10 G. Indicators of coagulation during this period endure�Ali changes however, deviations corresponding to our proposed criteria of infectious complications, have been identified (table 4). At this time the patient had no identified infection, the body temperature remained normal. Thus, the claimed criteria showed no infectious process, which is true.

Table 4
The indicators of hemostasis patient Ya (in brackets the % change compared with the previous one)
Date researchIndicators of coagulationCRP, mg/l
Fibrinogen, g/lTime XIIa-SEL, minRfmk, mcg/mlPRs, %
18.08.107,18332807412
25.08.102,69 (-63%)18,75 (-43%)55 (-80%)83 (+12%)8
30.08.103,17 (+18%)6,33 (-66%)260(+373%)97 (+17%)6
02.09.102,69 (-15%)Of 6.79 (+7%)75 (-71%)97 (0%)3
06.09.102,69 (0%)6,83 (+1%)45 (-40%)91 (-6%)4
08.09.102,69 (0%)7,08 (+4%)150(+233%)107 (+18%)1
13.09.101,95 (-28%)6,87 (-3%)30 (-80%)120 (+12%)0
16.09.102,12 (+9%)4,92 (-28%)35 (+17%)119 (-1%)0
20.09.10To 1.61 (-24%)7,83(+59%)30 (-14%) 112 (-6%)1
23.09.101,8 (+12%)6,29 (-20%)30 (0%)113 (+1%)1
24.09.101,95 (+8%)To 7.33(+17%)30 (0%)115 (+2%)0
27.09.101,46 (-25%)31,67(+332%)30 (0%)107 (-7%)2
29.09.100,83 (-43%)10,87 (-71%)30 (0%)80(-25%)0
01.10.101,73(+108%)6,0 (-45%)30 (0%)97 (+21%)1
Note: underlined parameters corresponding to the proposed criteria.

Example 2. Patient G., 16 l, was admitted to the clinic of the Institute 18.03.2009 G. Diagnosis: ALL, relapse bone marrow from 12.03.09 G.; conducted anti�recidiva therapy according to Protocol ALL-REZ-BFM-2002 (2 induction unit). The results are given in table 5.

At the beginning of the observation took date 20.04.09 G., as throughout the previous week, the patient had no infection. 23.04.09 G. body temperature 37°C; thus, there were no foci of infection; CRP level was 0 mg/L. we offer 4 hemostatic criteria were detected only one time XIIa-SEL was lengthened by 11%. The forecast has been made about the absence of infection; indeed, in the next 3 days infection is not apparent.

27.04.09 G. infectious complications were also absent, the body temperature is 36.6°C; SRB - 0 mg/l. However, our proposed criteria identified two: the level of fibrinogen was increased by 43%, rfmk - 83%. The forecast of the possible development of infection.

30.04.09 G. the patient marked febrile fever of unknown origin, up to 40°C; DRR - 48 mg/l Of hemostasis identified three criteria: the level of fibrinogen increased by 52%, time Hiia-SEL lengthened by 56%, PRs activity decreased by 25%. Thus, the prognosis from 27.04.09 G. on the possible development of infection was confirmed.

Table 5
Indicators of hemostasis in patient G. (in brackets the % change compared with the previous one)
IndicatorsDate research
20.04.0923.04.0927.04.0930.04.09
Fibrinogen, g/lA 1.541,412,013,05
(-8%)(+43%)(+52%)
Time XIIa-SEL, min10,211,36,29,7
(+11%)(-5,1%)(+56%)
Rfmk, mcg/ml30305570
(0%)(+83%)(+27%)
PRs, %7794109 82
(+27%)(+15%)(-25%)
Signs of infectiont° body36,637,036,640,0
infectious focinononono
CRP, mg/l00048
Note: underlined parameters corresponding to the proposed criteria.

Example 3. Patient S., 67 L., was admitted to the clinic of the Institute 12.03.08 G. Diagnosis: ALL, newly identified. Received therapy remission induction Protocol ALL-2005.

With 17.03.08 G. (beginning of therapy) 03.04.08 G. infectious complications. However, 03.04.08, as compared with the previous study 31.03.08 G. fibrinogen level increased by 93%, rfmk - by 143%, time XIIa-SAIL - 123% (table 6). The manifestations of infection were absent, the body temperature was normal. The forecast of the possible development of infectious�'s complications; the next day 04.04.08 G. appeared infectious lesions: ulcer disease and enteropathy (chair 3 times a day).

06.04.08 G. enteropathy became severe (stool 10 times a day), fever febrile (39°C). The next day 07.04.08 G. febrile fever persisted; was diagnosed with left-sided pneumonia. Koagulologicescoe criteria infection also continued to increase. Thus, the prognosis from 03.04.08 G. was confirmed.

Table 6
Indicators of hemostasis in patient S. (in brackets the % change compared with the previous one)
IndicatorsDate research
31.03.0803.04.0807.04.08
Fibrinogen, g/l1,122,165,44
(+93%)(+152%)
Time XIIa-SEL, min7,8317,5
(+123%)(+27%)
Rfmk, mcg/ml3073280
(+143%)(+284%)
PRs, %8291-
(+9%)
Signs of infectiont° body36,636,638,5
infectious focinonopneumonia, stomatitis, severe enteropathy
CRP, mg/l27-
Note: underlined parameters corresponding to the proposed criteria.

Example 4. Patient M., 30 years old, was admitted to the clinic of the Institute 12.11.10 G. Diagnosis: ALL, VPE�curves revealed. Received therapy remission induction Protocol ALL-2009. With 14.11.10 G. (beginning of therapy) on 30.11.10 G. infectious complications were absent; the body temperature was 36.6°C; SRB - 0 mg/l; change of parameters of coagulation were also insignificant (table 7).

06.12.10 G. fibrinogen level increased by 136%, rfmk is 100%. The forecast of development of infectious complications.

The next day, 07.12.10 G., the patient appeared fungal thrush (Candida); appointed antifungal therapy.

09.12.10 G. signs of stomatitis decreased (positive dynamics), indicators of coagulation were also not indicative of infection. Thus, the prognosis from 06.12.10 G. was confirmed.

Table 7
The indicators of hemostasis in the patient M. (in brackets the % change compared with the previous one)
IndicatorsDate research
16.11.1019.11.1023.11.1030.11.1006.12.1009.12.10
Fibrinogen, g/l 2,431,951,370,942,221,56
(-20%)(-30%)(-31%)(+136%)(-30%)
Time XIIa-SEL, min6,676,58Is 5.58The 6.256,085,42
(-1%)(-15%)(+12%)(-3%)(-11%)
Rfmk, mcg/ml303030306030
(0%)(0%)(0%)(+100%)(-50%)
PRs, %109 111146148151138
(+2%)(+32%)(+1%)(+2%)(-9%)
Signs of infectiont° body36,636,636,636,636,636,6
infectious foci----fungal stomatitis from 07.12.10-
CRP, mg/l200000
Note: underlined parameters corresponding to the proposed criteria.

LITERATURE

1. Barkagan Z. S., Momot A. P. Modern aspects of pathogenesis, diagnosis and therapy of disseminated intravascular coagulation syndrome // journal of Hematology - 2005. - Volume I, No. 2. - P. 5-14.

2. Duggan J. M. Infectious complications // cancer chemotherapy: a guide / edited by Roland T. Skeel; per. s angl. V. S. Pokrovsky; under. ed S. V. Orlov. - M.: GEOTAR-Media, 2011. - S. 857-890.

3. Infections in Oncology / edited by M. I. Davydov and N. In. Dmitrieva. - M.: Practical medicine, 2009. Pp. 379-400.

4. Klasowa G. A. Prevention and treatment of infectious complications // In the book. Manual of Hematology: V 3 t. T. 2 / ed. - M.: "Yudiamed, 2002. Pp. 210-230.

5. Kuznik B. I., Tsybikov N. N., Witkowski A. single cell-humoral body's defence system // Thrombosis, hemostasis and rheology. - 2005. - No. 2. - P. 3-16.

6. Momot A. P., Mamaev A. N. Modern aspects of pathogenesis, diagnosis and therapy of disseminated intravascular coagulation syndrome // Clinical Oncohematology. - 2008. - Vol. 1, No. 1. - P. 63-71.

7. Patent RU 2320996 (application dated 05.07.2006) "Method for determining hemostatic criteria of adverse outcome of sepsis in patients with acute myeloid leukemia" // FGU "Kirov research Institute of Hematology and blood transfusion of the Federal Agency for healthcare and social development". Tarasova L. N., Cherepanov V. V., Vladimirova S. G., Silin N. N.

8. Program treatment of leukemia / ed. by V. G. Savchenko. - HEMATOLOGY CENTER, 2008. - 488 p.

9. E. Roitman, A. Smolyanitsky, J. research Methods of hemostasis // Clinical laboratory analyst. Volume III. �istnie analytical technologies in the clinical laboratory / edited by Vladimir Menshikov. - M.: Subpress, 2000. - S. 156-345.

10. Rumyantsev V., Timofeev V. N., Mansurov, E. G. et al. risk Factors for development of severe infectious complications in patients with cancer// Questions of Hematology/Oncology and immunology in Pediatrics. - 2010. - Vol. 9, No. 1. - P. 22-31.

11. Frankfurt O., M. S. Talman Acute leukemias // cancer chemotherapy: a guide / edited by Roland T. Skeel; per. s angl. V. S. Pokrovsky; under. ed S. V. Orlov. - M.: GEOTAR-Media, 2011. - S. 605-666.

12. Barbui T, Falanga A. Disseminated Intravascular Coagulation in Acute Leukemia // Semin. Thrombos. Haemostas. - 2001. - Vol.27. - No. 6. - P. 593-604.

Method for early diagnosis of infectious complications in patients with acute lymphoblastic leukemia (ALL) receiving treatment with modern chemotherapy protocols by examining fibrinogen concentration, time XIIa-dependent èuglobulinovyj lysis (XIIa-SEL), the level of soluble fibrin-monomer complexes (SFMC), activity of protein C (PRs) 2-3 times a week, characterized in that when changes in at least 2 of 4 of the listed parameters, namely the increase in the level of fibrinogen at ≥41%, rfmk - ≥76%, the elongation time XIIa-SEL to ≥11% and the reduction in the activity of PRs at ≥12% compared with the previous study, predict the development of infectious complications.



 

Same patents:

FIELD: medicine.

SUBSTANCE: level of anti-flu antibodies in blood serum from umbilical vein (A), concentration of middle molecular peptides in blood plasma from umbilical vein (units of optical density) (B), total number of T-lymphocytes (CD3+) in points: 1 point - CD3+ higher than 48%; 2 points - CD3+ 47%-41%; 3 points - CD3+ 40% and lower in venous umbilical blood are determined in term new-born babies at birth. After that, prediction of frequent development of acute respiratory viral infections is realised by means of discriminant equation: D=+0.008×A-111.694×B-1.537×C, where D is discriminant function with boundary value, equal - 34.16. If D is equal or is larger than boundary value, absence of development of frequent respiratory viral infections during the first year of life in term new-born babies with intrauterine flu A(H3N2) is predicted. If D is lower than boundary value, frequent development of acute respiratory viral infections during the first year of life in term new-born babies is predicted.

EFFECT: increased probability of correct prediction of frequent development of acute respiratory viral infections during the first year of life in term new-born babies.

2 ex

FIELD: medicine.

SUBSTANCE: biological object, which contains mixture of hydroxybenzene and its monomethyl-substituted are crashed, processed twice with ethylacetate for 30 minutes with ethylacetate, ethylacetate extracts are combined, treated with ethanol solution of calcium hydroxide, solvent from combined ethylacetate extract is evaporated at 16-20°C, residue is repeatedly treated with acetone, containing hydrochloric acid in excess with respect to potassium hydroxide, present of residue, acidified acetone extracts are combined, treated with water solution of sodium hydroxide to neutralise residues of hydrochloric acid in acetone and create excess of alkaline medium, acetone is evaporated from combined extract, water-alkali residue is diluted with water, formed solution is acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether, extract is dehydrated, evaporated, chromatographed in column with silica gel with application of mobile phase hexane-diethyl ether with ratio 6:4 in volume, eluate fractions, containing hydroxybenzene and its monomethyl substituted, are combined, extracted with buffer solution with pH 12-13, water-alkali extract is acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulphate, extracted with dichloromethane, dichloromethane extract is dehydrated, analysed substances, contained in dichloromethane extract, are transferred into corresponding trimethylsilyl derivatives, for which purpose dichloromethane extract is treated for 20 minutes with N-methyl-N-trimethylsilyltrifluoracetamide under conditions of heating at temperature 60°C, qualitative and quantitative determination by physical-chemical method, such as chromate-mass-spectrometry, is performed in capillary column, 25 m long with internal diameter 0.2 mm with immobile phase (5%-phenyl)-methylpolysiloxane, with application of helium carrier gas, supplied at rate 0.6 ml/min, and mass-selective detector, working in electron impact mode, initial temperature of column thermostat constitutes 70°C, said temperature is maintained for 3 minutes, and then temperature is programmed from 70°C to 290°C at rate 20°C, final temperature of column is maintained for 10 minutes, injector temperature constitutes 250°C, quadrupole temperature - 150°C, temperature of ion source - 230°C, temperature of detector interface - 300°C, intensity of signal, conditioned by charged particles, formed in bombardment of analysed substance, leaving capillary column and getting into source of ions, with ionising beam of electrons with energy 70 eV, is registered, mass-spectrum is registered by full ion flow, qualitative determination of analysed substance is realised by time of exposure, set and intensity of signals of characteristic charged particles in mass-spectrum of its trimethylsilyl derivative, with quantity of determined compound being calculated by area of chromatographic peak of its trimethylsilyl derivative.

EFFECT: increasing sensitivity and reduction of determination duration.

6 tbl, 1 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to method of predicting development of terminal stages in patients with chronic myeloleukaemia. Essence of method consists in the fact that activity of two degydrogenases - glycerol-3-phosphatedehydrogenase (G3PDH) and lactatedehydrogenases (LDG) is determined in lymphocytes of peripheral blood of chronic leukaemia patients in open stage. In case of combination of G3PDH in the range from 0 to 0.02 mcE and activity of LDG in the range from 0.04 to 5.02 mcE development of terminal stage is predicted.

EFFECT: application of claimed invention makes it possible to diagnose progress of disease, correct plan and tactics of treating given category of patients and improve results of their rehabilitation in due time.

FIELD: medicine.

SUBSTANCE: invention refers to microbiology, namely to a method for the microbiological examination of a native smear from a tongue root mucosa. The substance of the method consists in the fact that a wooden spatula is used to sample biomaterial 0.5 ml by deep scraping from the mucous membrane at the boundary of the posterior one-third of the tongue dorsum and root; two smears are prepared on two slides, 1.5-2.0 cm2 in area; the smears are dried out for 20 minutes and fixed by flame heat of an alcohol lamp continuously for 5-6 seconds, Gram-stained by a complicated differential method, microscoped with immersion with the use of a ×100 objective lens; at least 10 visual fields are inspected on each slide taking into account quantitative and qualitative characteristics of microorganisms, cells and nuclei of the epithelium.

EFFECT: invention enables the more precise examination of the native smear of the tongue.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves patient's blood analysis on the first day following ST elevation myocardial infarction for insulinemia, glycemia, free fatty acids (FFAs), retinol-binding protein, tumour necrosis factor and ghrelin; the measured values are used to calculate linear classification discriminator function (LCDF1-c) by formula: LCDF1-c=-3.877+0.095Adp+0.246Grl-0.025IL-6-0.053TNF, wherein ADP is the adiponectin concentration, Grl is the ghrelin level, IL-6 is the interleukin 6 concentration, while TNF is tumour necrosis factor, a probable risk of insulin resistance is stated if LSDF1 is less than a cluster separation point of 0.4545 and approaching a centroid line of -0.561 as close as possible.

EFFECT: more reliable early hospital diagnosis of potential insulin resistance in the patients suffered ST elevation myocardial infarction.

2 ex, 2 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: invention describes a diagnostic technique for nutritional insufficiency accompanying ulcerative colitis by immunoassay, wherein blood serum is analysed to measure the soluble adhesion molecules sICAM-1, sICAM-2 and sICAM-3; a mild degree of nutritional insufficiency is characterised by the blood lymphocyte level of 1,500-1,800·109/l, while the sICAM-1 level is 13.4-24.7 ng/ml, the sICAM-2 level is 8.1-17 ng/ml, and the sICAM-3 level is 4.4-19 ng/ml; the IgG level is 650-500 mg/l; a moderate level of nutritional insufficiency is accompanied by the blood lymphocyte level making 900-1,490·109/l, and the sICAM-1 level is 25-37.8 ng/ml; the sICAM-2 level is 17.1-23.9 ng/ml, and the sICAM-3 level is 19.5-30.8 ng/ml, the IgG level is 950-1,400 mg/l; a severe degree of nutritional insufficiency is accompanied by the blood lymphocyte level of 890·109/l and less, the sICAM-1 level is 38-63 ng/ml; the sICAM-2 level is 24-29 ng/ml and the sICAM-3 level is 30.9-42.3 ng/ml; the IgG level is 1,500-1,800 mg/l.

EFFECT: more accurate diagnosis of nutritional insufficiency accompanying ulcerative colitis.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to a method for predicting the clinical course of sarcoidosis. Substance of the method consists in analysing biopsy material of a middle lobe of the right lung. What is involved is an immunohistochemical analysis in at least 5 visual fields at magnification ×400 to measure an average myofibroblast count in the interalveolar interstitial tissue. If the derived value is more than 50, the unfavourable outcome of sarcoidosis is predicted; the value of 15 and less average myofibroblast count, the favourable outcome of sarcoidosis is predicted.

EFFECT: using the declared method enables the early prediction and detection of the group of patients not requiring a great number of additional examinations.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: sodium/iodine symporter expression on a tumour cell membrane is measured in a tumour material taken by fine-needle aspiration biopsy, and if the measured expression is less than 1%, surgery is supposed to be added with the central lymph node dissection. The sodium/iodine symporter expression on the tumour cell membrane is determined by flow cytometry.

EFFECT: on the ground of the preoperative determination of the sodium/iodine symporter expression on the tumour cell membrane, the method enables establishing the extent of surgery for high-differentiated thyroid carcinoma, papillary and follicular, reliably.

2 cl, 2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to a method of predicting a high risk of formation of adeno-tonsillar system chronic pathology in recurrent respiratory infection children (RRI). The level of interleukin -17 and MMP-9 in saliva is determined, and if the level of interleukin-17 is higher than 5 pg/mg and MMP-9 level is higher than 10 ng/ml, a high risk of formation of adeno-tonsillar system chronic pathology in RRI children is predicted.

EFFECT: application of the claimed method makes it possible to determine the high risk of formation of adeno-tonsillar system chronic pathology in RRI children in due time and to carry out early preventive procedures, aimed at the prevention of the above.

4 tbl, 2 ex

FIELD: medicine, hepatology.

SUBSTANCE: one should detect the level of hepato-specific enzymes (HSE) in blood plasma, such as: urokinase (UK), histidase (HIS), fructose-1-phosphataldolase (F-1-P), serine dehydratase (L-SD), threonine dehydratase (L-TD) and products of lipid peroxidation (LP), such as: dienic conjugates (DC), malonic dialdehyde (MDA). Moreover, one should detect the state of inspecific immunity parameters, such as: immunoregulatory index (IRI) as the ratio of T-helpers and T-suppressors, circulating immune complexes (CIC). Additionally, one should evaluate the state of regional circulation by applying rheohepatography (RHG), the system of microhemocirculation with the help of conjunctival biomicroscopy (CB) to detect intravascular index (II). In case of increased UK, HIS levels up to 0.5 mcM/ml/h, F-1-P, L-SD, L-Td, LP products, CIC by 1.5 times, higher IRI up to 2 at the norm being 1.0-1.5, altered values of regional circulation, increased II up to 2 points at the norm being 1 point, not more one should diagnose light degree of process flow. At increased level of UK, HIS up to 0.75 mcM/ml/h, F-1-P, L-SD, L-TD, LP products, CIC by 1.5-2 times, increased IRI up to 2.5, altered values of regional circulation, increased II up to 3-4 points one should diagnose average degree of process flow. At increased level of UK, HIS being above 0.75 mcM/ml/h, F-1-P, L-SD, L-TD, LP products, CIC by 2 and more times, increased IRI being above 2.5, altered values of regional circulation, increased II up to 5 points and more one should diagnose severe degree of process flow.

EFFECT: higher accuracy of diagnostics.

3 ex

FIELD: medicine, infectology, hepatology.

SUBSTANCE: in hepatic bioptate one should detect products of lipid peroxidation (LP), such as: dienic conjugates (DC), activity of antioxidant enzymes, such as: catalase (CAT)and superoxide dismutase (SOD). One should calculate by the following formula: C = DC/(SOD x CAT)x100, where DC - the content of dienic conjugates, SOD - activity of superoxide dismutase, CAT - activity of catalase. At coefficient (C) values being above 65 one should predict high possibility for appearance of cirrhosis, at 46-645 - moderate possibility and at 14-45 -low possibility for appearance of cirrhosis.

EFFECT: higher accuracy of prediction.

3 ex

FIELD: medicine, clinical toxicology.

SUBSTANCE: at patient's hospitalization one should gather the data of clinical and laboratory values: on the type of chemical substance, patient's age, data of clinical survey and laboratory values: body temperature, the presence or absence of dysphonia, oliguria being below 30 ml/h, hemoglobinuria, erythrocytic hemolysis, exotoxic shock, glucose level in blood, fibrinogen and creatinine concentration in blood serum, general bilirubin, prothrombin index (PTI), Ph-plasma, the state of blood clotting system. The state of every sign should be evaluated in points to be then summed up and at exceeding the sum of points being above "+20" one should predict unfavorable result. At the sum of "-13" prediction should be stated upon as favorable and at "-13" up to "+20" - prediction is considered to be doubtful.

EFFECT: higher accuracy of prediction.

2 ex, 3 tbl

FIELD: medicine, juvenile clinical nephrology.

SUBSTANCE: disease duration in case of obstructive pyelonephritis should be detected by two ways: either by detecting the value of NADPH-diaphorase activity, as the marker of nitroxide synthase activity in different renal department and comparing it to established norm, or by detecting clinico-laboratory values, such as: hemoglobin, leukocytes, eosinophils, urea, beta-lipoproteides, lymphocytes, neutrophils, the level of glomerular filtration, that of canalicular reabsorption, urinary specific weight, daily excretion of oxalates, arterial pressure, and estimating their deviation against average statistical values by taking into account a child's age.

EFFECT: higher efficiency of detection.

7 dwg, 1 ex, 6 tbl

FIELD: clinical medicine, pulmonology.

SUBSTANCE: one should carry out complex estimation of interleukin-1β) concentration in blood, saliva, bronchoalveolar liquid. Moreover, one should detect distribution coefficient (DC) for IL-1β as the ratio of IL-1β blood content to IL-1β salivary content. At increased IL-1β blood content by 10 times and more, by 2 times in saliva, unchanged level of bronchoalveolar IL-1β, at DC for IL-1β being above 1.0 one should predict bronchial obstruction. The method enables to conduct diagnostics of the above-mentioned disease at its earlier stages.

EFFECT: higher efficiency of prediction.

2 tbl

FIELD: medicine, diagnostics.

SUBSTANCE: the present innovation deals with genetic trials, with diagnostic field of oncological diseases due to analyzing DNA by altered status of gene methylation that take part in intracellular regulation of division, differentiating, apoptosis and detoxication processes. One should measure the status of methylation in three genes: p16, E-cadherine and GSTP1 in any human biological samples taken out of blood plasma, urine, lymph nodes, tumor tissue, inter-tissue liquid, ascitic liquid, blood cells and buccal epithelium and other; one should analyze DNA in which modified genes of tumor origin or their components are present that contain defective genes, moreover, analysis should be performed due to extracting and purifying DNA out of biological samples followed by bisulfite treatment of this DNA for modifying unprotected cytosine foundations at keeping 5-methyl cytosine being a protected cytosine foundation followed by PCR assay of bisulfite-treated and bisulfite-untreated genes under investigation and at detecting alterations obtained according to electrophoretic result of PCR amplificates, due to detecting the difference in the number and electrophoretic mobility of corresponding fractions at comparing with control methylated and unmethylated samples containing normal and hypermethylated forms of genes one should diagnose oncological diseases. The method provides higher reliability in detecting tumors, detection of remained tumor cells after operation.

EFFECT: higher efficiency of therapy.

1 cl, 3 dwg, 4 ex

FIELD: medicine, gastroenterology.

SUBSTANCE: one should carry out diagnostic studying, moreover, on the 5th -6th d against the onset of exacerbation in case of gastric and duodenal ulcerous disease one should detect the content serotonin, histamine and acetylcholine in blood, then during 2-3 wk one should conduct medicinal therapy to detect serotonin, histamine and acetylcholine level in blood again and at serotonin content being by 2-3 times above the norm, histamine - by 1.15-1.4 times above the norm and acetylcholine - by 20-45% being below the norm one should predict the flow of gastric and duodenal ulcerous disease as a non-scarring ulcer.

EFFECT: higher accuracy of prediction.

3 ex

FIELD: medicine.

SUBSTANCE: method involves taking blood from ulnar vein (systemic blood circulation) and from large vein of the injured extremity proximal with respect to lesion focus (regional blood circulation). Spontaneous NST-test value is determined and difference is calculated in systemic and regional blood circulation as regional-to-systemic difference. The difference value is used for predicting clinical course of pyo-inflammatory disease in extremities.

EFFECT: high accuracy of diagnosis.

4 cl, 2 tbl

FIELD: medicine, gastroenterology.

SUBSTANCE: one should introduce biologically active substance, moreover, in patient's blood serum one should detect the content of acetyl choline and choline esterase activity followed by 2-h-long intragastric pH-metry at loading with biologically active substance as warm 40-45%-honey water solution at 35-40 C, and at increased content of acetyl choline being above 1.0 mM/l, choline esterase being above 0.5 mM/l/30 min and pH level being 6.0-6.9 it is possible to consider apitherapy to be useful for treating ulcerous duodenal disease.

EFFECT: higher efficiency and accuracy of detection.

3 ex

FIELD: medicine, gastroenterology.

SUBSTANCE: it has been suggested a new method to detect pharmacological sensitivity to preparations as acidosuppressors. After the intake of the preparation a patient should undergo fibrogastroduodenoscopy 3 h later, then, through endoscopic catheter one should introduce 0.3%-Congo red solution intragastrically and the test is considered to be positive at keeping red color that indicates good sensitivity to the given preparation, and in case of dark-blue or black color the test is considered to be negative that indicates resistance to this preparation. The suggested innovation widens the number of diagnostic techniques of mentioned indication.

EFFECT: higher efficiency of diagnostics.

2 ex

Up!