Method of determining hydroxybenzene and its monomethyl-substituted in biological material

FIELD: medicine.

SUBSTANCE: biological object, which contains mixture of hydroxybenzene and its monomethyl-substituted are crashed, processed twice with ethylacetate for 30 minutes with ethylacetate, ethylacetate extracts are combined, treated with ethanol solution of calcium hydroxide, solvent from combined ethylacetate extract is evaporated at 16-20°C, residue is repeatedly treated with acetone, containing hydrochloric acid in excess with respect to potassium hydroxide, present of residue, acidified acetone extracts are combined, treated with water solution of sodium hydroxide to neutralise residues of hydrochloric acid in acetone and create excess of alkaline medium, acetone is evaporated from combined extract, water-alkali residue is diluted with water, formed solution is acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether, extract is dehydrated, evaporated, chromatographed in column with silica gel with application of mobile phase hexane-diethyl ether with ratio 6:4 in volume, eluate fractions, containing hydroxybenzene and its monomethyl substituted, are combined, extracted with buffer solution with pH 12-13, water-alkali extract is acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulphate, extracted with dichloromethane, dichloromethane extract is dehydrated, analysed substances, contained in dichloromethane extract, are transferred into corresponding trimethylsilyl derivatives, for which purpose dichloromethane extract is treated for 20 minutes with N-methyl-N-trimethylsilyltrifluoracetamide under conditions of heating at temperature 60°C, qualitative and quantitative determination by physical-chemical method, such as chromate-mass-spectrometry, is performed in capillary column, 25 m long with internal diameter 0.2 mm with immobile phase (5%-phenyl)-methylpolysiloxane, with application of helium carrier gas, supplied at rate 0.6 ml/min, and mass-selective detector, working in electron impact mode, initial temperature of column thermostat constitutes 70°C, said temperature is maintained for 3 minutes, and then temperature is programmed from 70°C to 290°C at rate 20°C, final temperature of column is maintained for 10 minutes, injector temperature constitutes 250°C, quadrupole temperature - 150°C, temperature of ion source - 230°C, temperature of detector interface - 300°C, intensity of signal, conditioned by charged particles, formed in bombardment of analysed substance, leaving capillary column and getting into source of ions, with ionising beam of electrons with energy 70 eV, is registered, mass-spectrum is registered by full ion flow, qualitative determination of analysed substance is realised by time of exposure, set and intensity of signals of characteristic charged particles in mass-spectrum of its trimethylsilyl derivative, with quantity of determined compound being calculated by area of chromatographic peak of its trimethylsilyl derivative.

EFFECT: increasing sensitivity and reduction of determination duration.

6 tbl, 1 dwg, 5 ex

 

The invention relates to biology and Toxicological chemistry, namely to methods of determining the hydroxybenzene and its monometallic substituted in biological material, and can be used in the practice of epidemiological stations, chemical-Toxicological and veterinary laboratories. Method refers to the mass number.

The known method of determination of hydroxybenzene in biological material by grinding a biological object, acidification with a solution of tartaric acid, the addition of cadmium sulfate, the distillation with steam generator, the selection of distillate, shaking the distillate with aluminum oxide, followed by treatment of the distillate water-ethanol solution of 2,6-dibrominated in the presence of borate buffer with a pH of 10.5 and the photometry of the resulting coloured solution against water (Gadasin I. D., Phil V. A. Transformations and the definition of industrial organic poisons in the body. - L.: Medicine, 1970. - P. 38-39).

The way maloclussion, characterized by insufficiently high precision and sensitivity.

The known method of determining 4-methylhydroxybenzoate in the urine, which consists in the fact that the analyzed sample was acidified with sulfuric acid, distilled with steam, the distillate obtained is treated with 65% nitric acid, incubated at 37°C for 24 hours, �eutrality 20% sodium hydroxide solution, added to the reaction mixture buffer solution with pH 12 and spend the polarographic determination (Gadasin I. D., Phil V. A. Transformations and the definition of industrial organic poisons in the body. L.: Medicine, 1970. - P. 204).

The method is characterized by the length of execution, a lack of high sensitivity, can provide a selective definition of hydroxybenzene and its monometallic substituted in their joint presence.

The closest is a method of determining the hydroxybenzene and its monometallic substituted in biological material, which is that the biological object is crushed, treated twice for 30 minutes, ethyl acetate, ethylacetate extracts were pooled, dried, the solvent from combined ethylacetate extracts evaporated at 16-20°C, the residue dissolved in a mixture solvent of hexane-diethyl ether in a ratio of 6:4 by volume, chromatographic in a column with silica gel using the mobile phase hexane: diethyl ether 6:4 by volume, fractions of eluate containing hydroxybenzene and its monoethylene substituted, are selected, pooled, dehydrated, eluent evaporated to obtain a residue analyte in the remainder transferred to the appropriate polynitroderivative, for which the residue is diluted with water and treated with a nitrating agent in equal�m volume ratio, as a nitrating agent, a mixture of 65% nitric and 94% sulfuric acid in a ratio of 1:1 by volume, the treatment is carried out by boiling in a water bath, after which the reaction mixture is alkalinized to pH 4 and diluted with buffer solution to pH 4, the resulting solution was twice extracted with diethyl ether in the ratio 1:1 by volume, ether extract, containing polynitroderivative 2-methylhydroxybenzoate and 4-methylhydroxybenzoate, separated, and the aqueous layer acidified to pH 1 and diluted with buffer solution with pH 1, the resulting solution was again treated twice with diethyl ether in the ratio 1:1 by volume, the extract from the solution with pH 4 is evaporated to dry residue, the residue dissolved in the solvent system hexane-dioxane-propanol-2 in a ratio of 40:5:1 by volume, conduct qualitative and quantitative determination of physico-chemical method, which is an HPLC column with stationary phase "Selasar-600" using the mobile phase hexane-dioxane-propanol-2 in a ratio of 40:5:1, when the feed rate of eluent 50 ál/min, the concentration of the respective monometallic substituted hydroxybenzene calculated according to the chromatograms obtained registration of the optical density of the solution emerging from the column, the qualitative determination monometallic produce substituted by the values of the characteristic amount�s or retention time of the respective polynitroderivative, extract from the solution with pH 1 containing polynitroderivative of hydroxybenzene and 3-methylhydroxybenzoate, evaporated to dry residue, the residue dissolved in the solvent system hexane-dioxane-formic acid in the ratio 5:3:0,2 by volume, conduct qualitative and quantitative determination of physico-chemical method, which is an HPLC column with stationary phase "Selasar-600" using the mobile phase hexane-dioxane-formic acid in the ratio 5:3:0,2 by volume in the feed rate of eluent 100 ál/min, the concentration of hydroxybenzene and a corresponding monoethylene substituted hydroxybenzene calculated according to the chromatograms obtained registration of the optical density of the solution emerging from the column, the qualitative determination of hydroxybenzene and monoethylene produce substituted by the values of the characteristic volume or retention time of the respective polynitroderivative (patent RU 2269137).

The method is characterized characterized by a lack of high sensitivity and the relative duration of the definitions of hydroxybenzene and its monometallic substituted in their joint presence.

The technical result of the present invention is to increase the sensitivity and reduce the duration of determination.

The technical result achieved�tsya, that the biological object is crushed, treated twice for 30 minutes, ethyl acetate, ethylacetate extracts were pooled, treated with ethanolic potassium hydroxide, the solvent from combined ethylacetate extracts evaporated at 16-20°C, the residue is repeatedly treated with acetone containing hydrochloric acid in excess relative to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with an aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract, aqueous alkaline residue diluted with water, the resulting solution acidified to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether, the extract dried, evaporated, chromatographic in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume, fractions of eluate containing hydroxybenzene and its monoethylene substituted, pooled, extracted with a buffer solution with a pH of 12-13, aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with dichloromethane, dichlormethane extract is dewatered, the analyte contained in dichlormethane extract,translate into the corresponding trimethylsilyl derivatives, what dichlormethane extract treated for 20 minutes, N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, and conduct qualitative and quantitative determination of physico-chemical method, which is chromatography-mass spectrometry, capillary column (25 m length and an internal diameter of 0.2 mm with a stationary phase (5%-phenyl)-methylpolysiloxanes using a carrier gas of helium supplied at a speed of 0.6 ml/min, and mass-selective detector operating mode electronic shock, the initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, qualitative determination of an analyte is carried out by retention time, set � intensity of the signals characteristic of the charged particles in the mass spectrum of its trimethylsilyl derivative, and the number of identified compounds are calculated from the chromatographic peak area of its trimethylsilyl derivative.

The invention is illustrated by drawings. The figure presents the chromatogram of a mixture of trimethylsilyl derivatives of hydroxybenzene and its monometallic substituted 1 - hydroxybenzene, 2 - 2-methylhydroxybenzoate, 3 - 3-methylhydroxybenzoate, 4 - 4-methylhydroxy benzene.

The method is as follows: the biological object containing a mixture of hydroxybenzene and its monometallic substituted, crushed, treated twice for 30 minutes, ethyl acetate, ethylacetate extracts were pooled, treated with ethanolic potassium hydroxide, the solvent from combined ethylacetate extracts evaporated at 16-20°C, the residue is repeatedly treated with acetone containing hydrochloric acid in excess relative to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with an aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract, aqueous alkaline residue diluted with water, the resulting solution acidified to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether, the extract dried, evaporated, x�omatography in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume, fractions of eluate containing hydroxybenzene and its monoethylene substituted, pooled, extracted with a buffer solution with a pH of 12-13, aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with dichloromethane, dichlormethane extract is dewatered, the analyte contained in dichlormethane extract, translate into the corresponding trimethylsilyl derivatives, which dichlormethane extract treated for 20 minutes, N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, and conduct qualitative and quantitative determination of physico-chemical method which is chromatography-mass spectrometry, capillary column (25 m length and an internal diameter of 0.2 mm with a stationary phase (5%-phenyl)-methylpolysiloxanes using a carrier gas of helium supplied at a speed of 0.6 ml/min, and mass selective detector, operating in the electron impact, the initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C per minute, final column temperature is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole - 150°C, ion source temperature was 230°C temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, the ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, qualitative determination of an analyte is carried out by retention time, and intensity of the signals characteristic of the charged particles in the mass spectrum of its trimethylsilyl derivative, and the number of identified compounds are calculated from the chromatographic peak area of its trimethylsilyl derivative.

The method is illustrated by the following examples.

Example 1

Qualitative determination of hydroxybenzene and its monometallic substituted in liver tissue

The biological object, representing a 10 g tissue liver, finely ground (particle size 0.2-0.5 g), finely crushed liver tissue was added a mixture of hydroxybenzene, 2-methylhydroxybenzoate, 3-methylhydroxybenzoate and 4-methylhydroxybenzoate 5 mg of each of the substances are thoroughly mixed biological tissue with substances and leave for days at a temperature of 16-20°C. after this time the biological object is treated twice for 30 minutes in portions of ethyl acetate to a volume of 20 ml each for ne�iadicicco stirring. Separate ethylacetate hoods separated, pooled, treated with 1 ml of 8% ethanol solution of potassium hydroxide, the solvent from combined ethylacetate extracts evaporated in a stream of air at 16-20°C, the residue was repeatedly (three times for 3 minutes) was treated with vigorous stirring portions (15 g each) of acetone containing a concentrated (10 M) hydrochloric acid in an amount of 1%, which provides an excess of hydrochloric acid to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with 2 ml of 10% aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract under a stream of air at a temperature of 16-20°C, aqueous alkaline residue is diluted with water, adjusting the solution volume to 10 ml, the resulting solution was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether twice in portions of 10 ml, of ether and the extracts combined, the combined extract was dehydrated, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, the filter is additionally washed with 20 ml of diethyl ether. Separate the filtrates were combined, evaporated in a stream of air at 16-20°C �about the volume of 4-5 ml, the obtained volume is mixed with 1.5 g of silica gel L 40/100 µm residues and evaporate the ether from the sorbent in flowing air at 16-20°C.

In column (240×15 mm make at the beginning of 18.5 g of silica gel L 40/100 μm, and then, on top of the formed layer, 1.5 g of silica gel L 40/100 μm, containing the analyzed substance, previously introduced in the form of the ethereal solution.

Chromatographic in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume. The eluate is collected in separate fractions of 2 ml each. Fractions 5 to 13, inclusive, containing hydroxybenzene and its monoethylene substituted, unite, eluent is evaporated in a stream of air at a temperature of 16-20°C to a volume of 6-8 ml, adjusted to 10 ml with a mixture of solvents hexane-diethyl ether in a ratio of 6:4 by volume, extracted twice with portions of buffer solution with a pH of 12-13, the individual extracts were separated, combined, the combined aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with the resulting solution with sodium sulfate and extracted with portions of dichloromethane three times with 8 ml each. Separate the organic extracts are separated, unite, United dichlormethane extract dehydrate, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 1 ml dichloromethane. Separate the filtrates were combined, evaporated in a stream of air at a temperature of 16-20°C to a volume of 2-3 ml of dichloromethane and bring to 5 ml (solution A).

0.1 ml of the solution And contribute in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml derivatizing reagent, which is N-methyl-N-trimethylsilyl-triptorelin, under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark (solution B).

4 μl of a solution injected into the chromato-mass-spectrometer.

The determination is carried physico-chemical method, which is chromatography-mass spectrometry using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, temperature quadrupel�I - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, the ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

General view of the chromatogram of a mixture of hydroxybenzene and its monometallic substituted represented in the drawing (Fig.). The peaks on the chromatogram (in order of increasing retention time) match trimethylsilyl derivatives of hydroxybenzene (1), 2-methylhydroxybenzoate (2), 3-methylhydroxybenzoate (3), 4-methylhydroxybenzoate (4).

The values of retention time trimethylsilyl derivatives of hydroxybenzene and its monometallic substituted are presented in table 1.

In the mass spectra of trimethylsilyl derivatives of the analytes captured on the full ion current detected signals of a number of har�cteristics charged particles (ions) with defined mass numbers. The intensity of the most intense particles (primary ion) in each of the mass spectra is taken as 100%.

Massive numbers characteristic of charged particles (ions) in the mass spectra of trimethylsilyl derivatives of analytes and the intensity of charged particles relative to the intensity of the primary ion are presented in table 1.

Qualitative determination of analytes (hydroxybenzene and its monometallic substituted) in the form of corresponding trimethylsilyl derivatives is carried out by retention time corresponding trimethylsilyl derivatives in the stationary phase of the column, as well as specific recruitment and the intensity of the characteristic signals of charged particles in their mass spectra.

Example 2

Quantification of hydroxybenzene in liver tissue in the presence of 2-methylhydroxybenzoate, 3-methylhydroxybenzoate and 4-methylhydroxybenzoate

The biological object, representing a 10 g tissue liver, finely ground (particle size 0.2-0.5 g), finely crushed liver tissue was added a mixture of hydroxybenzene, 2-methylhydroxybenzoate, 3-methylhydroxybenzoate and 4-methylhydroxybenzoate 5 mg of each of the substances are thoroughly mixed biological tissue with substances and leave for days at a temperature of 16-20°C. after a specified time bio�agicheskii object is treated twice for 30 minutes in portions of ethyl acetate to a volume of 20 ml each with periodic stirring. Separate ethylacetate hoods separated, pooled, treated with 1 ml of 8% ethanol solution of potassium hydroxide, the solvent from combined ethylacetate extracts evaporated in a stream of air at 16-20°C, the residue was repeatedly (three times for 3 minutes) was treated with vigorous stirring portions (15 g each) of acetone containing a concentrated (10 M) hydrochloric acid in an amount of 1%, which provides an excess of hydrochloric acid to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with 2 ml of 10% aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract under a stream of air at a temperature of 16-20°C, aqueous alkaline residue is diluted with water, adjusting the solution volume to 10 ml, the resulting solution was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether twice in portions of 10 ml, of ether and the extracts combined, the combined extract was dehydrated, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, the filter is additionally washed with 20 ml of diethyl ether. Separate the filtrates were combined, evaporated in a stream of air at 16-20°C �about the volume of 4-5 ml, the obtained volume is mixed with 1.5 g of silica gel L 40/100 µm residues and evaporate the ether from the sorbent in flowing air at 16-20°C.

In column (240×15 mm make at the beginning of 18.5 g of silica gel L 40/100 μm, and then, on top of the formed layer, 1.5 g of silica gel L 40/100 μm, containing the analyzed substance, previously introduced in the form of the ethereal solution.

Chromatographic in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume. The eluate is collected in separate fractions of 2 ml each. Fractions 5 to 13, inclusive, containing hydroxybenzene and its monoethylene substituted, unite, eluent is evaporated in a stream of air at a temperature of 16-20°C to a volume of 6-8 ml, adjusted to 10 ml with a mixture of solvents hexane-diethyl ether in a ratio of 6:4 by volume, extracted twice with portions of buffer solution with a pH of 12-13, the individual extracts were separated, combined, the combined aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with the resulting solution with sodium sulfate and extracted with portions of dichloromethane three times with 8 ml each. Separate the organic extracts are separated, unite, United dichlormethane extract dehydrate, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 1 ml dichloromethane. Separate the filtrates were combined, evaporated in a stream of air at a temperature of 16-20°C to a volume of 2-3 ml of dichloromethane and bring to 5 ml (solution A).

0.1 ml of the solution And contribute in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml derivatizing reagent, which is N-methyl-N-trimethylsilyl-triptorelin, under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark (solution B).

4 μl of a solution injected into the chromato-mass-spectrometer.

The determination is carried physico-chemical method, which is chromatography-mass spectrometry using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, temperature quadrupel�I - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, the ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, and calculates the number of hydroxybenzene on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

The peak on the chromatogram with the retention time of the 6,98 min corresponds to a trimethylsilyl derivative of hydroxybenzene. In the mass spectrum of this compound, a film based on the full ion current detected signals of some characteristic of the charged particles with mass numbers 75, 77, 91, 95, 135, 151, 152, 166. The most intense is a particle with mass number 151, the intensity of which is taken as 100%.

The chromatographic peak area obtained when registering the intensity on full�th ion current, determine the quantitative content of hydroxybenzene, using the equation of the calibration curve, and count on a portion of the analyte introduced into biological material.

Construction of calibration curve

In a series of volumetric flasks with a capacity of 25 ml contribute 0,01, 0,1, 1,0, 2,0, 10.0 ml of 0.125% solution and 2.5, 5,0, 10,0 ml of a 1.25% solution of hydroxybenzene in dichloromethane and the volume was adjusted contents of each flask to the mark with dichloromethane.

0.1 ml each of solutions made in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml of N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark.

4 μl of each of the obtained solutions was injected into the chromato-mass-spectrometer.

The determination is carried physico-chemical method, which is chromatography-mass spectrometry using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes. The initial temperature of the column thermostat SOS�ulation of 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, the ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, and calculates the number of hydroxybenzene on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

According to the results of measurements on gas chromatography-mass spectrometer build a graph of peak area against the concentration of the analyte. Graph linear in the concentration range from 1·10-11-4·10-7G. the Method of least Quadrato� calculate the equation of the calibration curve, which looks like this:

S=6034717·+4880,

where S - the area of the chromatographic peak trimethylsilyl derivative of hydroxybenzene, C - conditional concentration of hydroxybenzene in khromatograficheskoi sample, ng.

The results of quantitative determination of hydroxybenzene in liver tissue are presented in table 2.

Example 3

Quantitative determination of 2-methylhydroxy-benzene in liver tissue in the presence of hydroxy-benzene, 3-methylhydroxybenzoate and 4-merger-oxybenzone

The biological object, representing a 10 g tissue liver, finely ground (particle size 0.2-0.5 g), finely crushed liver tissue was added a mixture of hydroxybenzene, 2-methylhydroxybenzoate, 3-methylhydroxybenzoate and 4-methylhydroxybenzoate 5 mg of each of the substances are thoroughly mixed biological tissue with substances and leave for days at a temperature of 16-20°C. after this time the biological object is treated twice for 30 minutes in portions of ethyl acetate to a volume of 20 ml each with periodic stirring. Separate ethylacetate hoods separated, pooled, treated with 1 ml of 8% ethanol solution of potassium hydroxide, the solvent from combined ethylacetate extracts evaporated in a stream of air at 16-20°C, the residue was repeatedly (three times for 3 minutes) was treated with vigorous stirring portions (p� 15 g each) of acetone, containing a concentrated (10 M) hydrochloric acid in an amount of 1%, which provides an excess of hydrochloric acid to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with 2 ml of 10% aqueous sodium hydroxide solution to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract under a stream of air at a temperature of 16-20°C, aqueous alkaline residue is diluted with water, adjusting the solution volume to 10 ml, the resulting solution was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether twice in portions of 10 ml, of ether and the extracts combined, the combined extract was dehydrated, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 20 ml of diethyl ether. Separate the filtrates were combined, evaporated in a stream of air at from 16 to 20°C to a volume of 4-5 ml, the obtained volume is mixed with 1.5 g of silica gel L 40/100 µm residues and evaporate the ether from the sorbent in flowing air at 16-20°C.

In column (240×15 mm make at the beginning of 18.5 g of silica gel L 40/100 μm, and then, on top of the formed layer, 1.5 g of silica gel L 40/100 μm, containing the analyzed substance, previously BB�data in the form of the ethereal solution.

Chromatographic in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume. The eluate is collected in separate fractions of 2 ml each. Fractions 5 to 13, inclusive, containing hydroxybenzene and its monoethylene substituted, unite, eluent is evaporated in a stream of air at a temperature of 16-20°C to a volume of 6-8 ml, adjusted to 10 ml with a mixture of solvents hexane-diethyl ether in a ratio of 6:4 by volume, extracted twice with portions of buffer solution with a pH of 12-13, the individual extracts were separated, combined, the combined aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with the resulting solution with sodium sulfate and extracted with portions of dichloromethane three times with 8 ml each. Separate the organic extracts are separated, unite, United dichlormethane extract dehydrate, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 10 ml of dichloromethane. Separate the filtrates were combined, evaporated in a stream of air at a temperature of 16-20°C to a volume of 2-3 ml of dichloromethane and bring to 5 ml (solution A).

0.1 ml of the solution And contribute in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml derivatizing reagent, which is N-methyl-N-trimethylsilyl-triptorelin, �conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark (solution B).

4 μl of a solution injected into the chromato-mass-spectrometer.

The determination is carried physico-chemical method, which is chromatography-mass spectrometry using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, ionizing electron beam with electron energy of 70 eV, record the mass�pectr the full ion current, and calculates the number of 2-methylhydroxybenzoate on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

The peak on the chromatogram with the retention times of 7.75 min corresponds to a trimethylsilyl derivative of 2-methylhydroxybenzoate. In the mass spectrum of this compound, a film based on the full ion current detected signals of some characteristic of the charged particles with mass numbers 73, 77, 91, 135, 149, 165, 166, 180. The most intense is a particle with mass number 165, the intensity of which is taken as 100%.

The chromatographic peak area obtained at registration full intensity of the ion current, determine the quantitative content of 2-methylhydroxybenzoate using equation hail eremochloa graphics, and count on a portion of the analyte introduced into biological material.

Construction of calibration curve

In a series of volumetric flasks with a capacity of 25 ml make 0,1, 1,0, 2,0, 5,0, 10,0 ml of 0.125% solution and 5,0, 10,0, 20,0 ml of a 1.25% solution of 2-methylhydroxybenzoate in dichloromethane and the volume was adjusted contents of each flask to the mark with dichloromethane.

0.1 ml of each of R�of cross-sections made in a test tube with a capacity of 0.2 ml, treated for 20 minutes 0,016 ml of N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark.

4 μl of each of the obtained solutions was injected into the chromato-mass-spectrometer.

Determination is carried out using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, ionizing beam e�of chronou with energy of 70 eV, record the mass spectrum of the full ion current, and calculates the number of 2-methylhydroxybenzoate on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

According to the results of measurements on gas chromatography-mass spectrometer build a graph of peak area against the concentration of the analyte linear in a concentration range from 1·10-10-4·10-7G. using the least squares Method to calculate the equation of the calibration curve, which looks like this:

S=127196·C-12351,

where S - the area of the chromatographic peak trimethylsilyl derivative of 2-methylhydroxybenzoate, C - conditional, the concentration of 2-methylhydroxybenzoate in khromatograficheskoi sample, ng.

The results of quantitative determination of 2-methylhydroxybenzoate in liver tissue are presented in table 3.

Example 4

Quantitative determination of 3-methylhydroxy-benzene in liver tissue in the presence of hydroxy-benzene, 2-methylhydroxybenzoate and 4-merger-oxybenzone

The biological object, made�accounting for a 10 g liver tissue, finely ground (to a particle size of 0.2-0.5 g), finely crushed liver tissue was added a mixture of hydroxybenzene, 2-methylhydroxybenzoate, 3-methylhydroxybenzoate and 4-methylhydroxybenzoate 5 mg of each of the substances are thoroughly mixed biological tissue with substances and leave for days at a temperature of 16-20°C. after this time the biological object is treated twice for 30 minutes in portions of ethyl acetate to a volume of 20 ml each with periodic stirring. Separate ethylacetate hoods separated, pooled, treated with 1 ml of 8% ethanol solution of potassium hydroxide, the solvent from combined ethylacetate extracts evaporated in a stream of air at 16-20°C, the residue was repeatedly (three times for 3 minutes) was treated with vigorous stirring portions (15 g each) of acetone containing a concentrated (10 M) hydrochloric acid in an amount of 1%, which provides an excess of hydrochloric acid to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with 2 ml of 10% aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract under a stream of air at a temperature of 16-20°C, aqueous alkaline residue is diluted with water, bringing �the volume of the solution to 10 ml the resulting solution was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether twice in portions of 10 ml, of ether and the extracts combined, the combined extract was dehydrated, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 20 ml of diethyl ether. Separate the filtrates were combined, evaporated in a stream of air at from 16 to 20°C to a volume of 4-5 ml, the obtained volume is mixed with 1.5 g of silica gel L 40/100 µm residues and evaporate the ether from the sorbent in flowing air at 16-20°C.

In column (240×15 mm make at the beginning of 18.5 g of silica gel L 40/100 μm, and then, on top of the formed layer, 1.5 g of silica gel L 40/100 μm, containing the analyzed substance, previously introduced in the form of the ethereal solution.

Chromatographic in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume. The eluate is collected in separate fractions of 2 ml each. Fractions 5 to 13, inclusive, containing hydroxybenzene and its monoethylene substituted, unite, eluent is evaporated in a stream of air at a temperature of 16-20°C to a volume of 6-8 ml, adjusted to 10 ml with a mixture of solvents hexane-diethyl ether in a ratio of 6:4 by volume, extracted twice with portions of buffer solution with a pH of 12-13, separate the extract� is separated, unite, the combined aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with the resulting solution with sodium sulfate and extracted with portions of dichloromethane three times with 8 ml each. Separate the organic extracts are separated, unite, United dichlormethane extract dehydrate, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 10 ml of dichloromethane. Separate the filtrates were combined, evaporated in a stream of air at a temperature of 16-20°C to a volume of 2-3 ml of dichloromethane and bring to 5 ml (solution A).

0.1 ml of the solution And contribute in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml derivatizing reagent, which is N-methyl-N-trimethylsilyl-triptorelin, under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark (solution B).

4 μl of a solution injected into the chromato-mass-spectrometer.

The determination is carried physico-chemical method, which is chromatography-mass spectrometry using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out� in a capillary column DB-5 MS EVIDEX length 25 m, an inner diameter of 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current and calculate the number of 3-methylhydroxybenzoate on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

The peak on the chromatogram with the retention time of the 783 min corresponds to a trimethylsilyl derivative 3-methylhydroxybenzoate. In the mass spectrum of this compound, a film based on the full ion current detected signals of some characteristic of the charged particles with mass numbers 65, 73, 77, 91, 149, 165, 166, 180. The most intense is a particle with mass number 165, the intensity of which is taken as 100%.

The chromatographic peak area obtained at registration full intensity of the ion current, determine the quantitative content of 3-methylhydroxybenzoate, using the equation of the calibration curve, and count on a portion of the analyte introduced into biological material.

Construction of calibration curve

In a series of volumetric flasks with a capacity of 25 ml make 0,5, 1,0, 5,0, 20.0 ml of 0.125% solution and 2.5, 5,0, 10,0, 15,0 ml of 2.5% solution of 3-methylhydroxybenzoate in dichloromethane and the volume was adjusted contents of each flask to the mark with dichloromethane.

0.1 ml each of solutions made in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml of N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark.

4 μl of each of the obtained solutions was injected into the chromato-mass-spectrometer.

Determination is carried out using a gas chromatograph from Agilent Technologies (USA) model 850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current and calculate the number of 3-methylhydroxybenzoate on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Range scan�of duplication is 40-500 m/z.

According to the results of measurements on gas chromatography-mass spectrometer build a graph of peak area against the concentration of the analyte linear in a concentration range from 5·10-10-6·10-7G. using the least squares Method to calculate the equation of the calibration curve, which looks like this:

S=39863·+9728,

where S - the area of the chromatographic peak trimethylsilyl derivative 3-methylhydroxybenzoate, C - conditional, the concentration of 3-methylhydroxybenzoate in khromatograficheskoi sample, ng.

The results of the quantitative determination of 3-methylhydroxybenzoate in liver tissue are presented in table 4.

Example 5

Quantitative determination of 4-methylhydroxy-benzene in liver tissue in the presence of hydroxy-benzene, 2-methylhydroxybenzoate and 3-metalgear-oxybenzone

The biological object, representing a 10 g tissue liver, finely ground (particle size 0.2-0.5 g), finely crushed liver tissue was added a mixture of hydroxybenzene, 2-methylhydroxybenzoate, 3-methylhydroxybenzoate and 4-methylhydroxybenzoate 5 mg of each of the substances are thoroughly mixed biological tissue with substances and leave for days at a temperature of 16-20°C. after this time the biological object is treated twice for 30 minutes in portions of ethyl acetate to a volume of 20 ml at each periodic premesis�research Institute. Separate ethylacetate hoods separated, pooled, treated with 1 ml of 8% ethanol solution of potassium hydroxide, the solvent from combined ethylacetate extracts evaporated in a stream of air at 16-20°C, the residue was repeatedly (three times for 3 minutes) was treated with vigorous stirring portions (15 g each) of acetone containing a concentrated (10 M) hydrochloric acid in an amount of 1%, which provides an excess of hydrochloric acid to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with 2 ml of 10% aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract under a stream of air at a temperature of 16-20°C, aqueous alkaline residue is diluted with water, adjusting the solution volume to 10 ml, the resulting solution was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether twice in portions of 10 ml, of ether and the extracts combined, the combined extract was dehydrated, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, the filter is additionally washed with 20 ml of diethyl ether. Separate the filtrates were combined, evaporated in a stream of air at 16-20°C �about the volume of 4-5 ml, the obtained volume is mixed with 1.5 g of silica gel L 40/100 µm residues and evaporate the ether from the sorbent in flowing air at 16-20°C.

In column (240×15 mm make at the beginning of 18.5 g of silica gel L 40/100 μm, and then, on top of the formed layer, 1.5 g of silica gel L 40/100 μm, containing the analyzed substance, previously introduced in the form of the ethereal solution.

Chromatographic in a column with silica gel using the mobile phase hexane-diethyl ether in a ratio of 6:4 by volume. The eluate is collected in separate fractions of 2 ml each. Fractions 5 to 13, inclusive, containing hydroxybenzene and its monoethylene substituted, unite, eluent is evaporated in a stream of air at a temperature of 16-20°C to a volume of 6-8 ml, adjusted to 10 ml with a mixture of solvents hexane-diethyl ether in a ratio of 6:4 by volume, extracted twice with portions of buffer solution with a pH of 12-13, the individual extracts were separated, combined, the combined aqueous alkaline extract was acidified with 24% solution of hydrochloric acid to pH 2-3, saturated with the resulting solution with sodium sulfate and extracted with portions of dichloromethane three times with 8 ml each. Separate the organic extracts are separated, unite, United dichlormethane extract dehydrate, passing through a glass filter with a diameter of 4 cm layer of anhydrous sodium sulfate in the thickness of 1-1,5 cm, a filter is additionally washed with 1 ml dichloromethane. Separate the filtrates were combined, evaporated in a stream of air at a temperature of 16-20°C to a volume of 2-3 ml of dichloromethane and bring to 5 ml (solution A).

0.1 ml of the solution And contribute in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml derivatizing reagent, which is N-methyl-N-trimethylsilyl-triptorelin, under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark (solution B).

4 μl of a solution injected into the chromato-mass-spectrometer.

The determination is carried physico-chemical method, which is chromatography-mass spectrometry using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, temperature quadrupel�I - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, the ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, and calculates the number of 4-methylhydroxybenzoate on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

The peak on the chromatogram with the retention times of 8.00 min corresponds to a trimethylsilyl derivative 4-methylhydroxybenzoate. In the mass spectrum of this compound, a film based on the full ion current detected signals of some characteristic of the charged particles with mass numbers 73, 82, 91, 135, 149, 165, 166, 180. The most intense is a particle with mass number 165, the intensity of which is taken as 100%.

The chromatographic peak area obtained when registering intensity: high�desired full ion current, determine the quantitative content of 4-methylhydroxybenzoate, using the equation of the calibration curve, and count on a portion of the analyte introduced into biological material.

Construction of calibration curve

In a series of volumetric flasks with a capacity of 25 ml make 0,6, 1,0, 5,0, 20.0 ml of 0.125% solution and 2.5, 5,0, 10,0, 15,0 ml of 2.5% solution of 4-methylhydroxybenzoate in dichloromethane and the volume was adjusted contents of each flask to the mark with dichloromethane.

0.1 ml each of solutions made in a test tube with a capacity of 0.2 ml, were treated for 20 minutes 0,016 ml of N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, the reaction product along with the contents of the tubes were quantitatively transferred to a volumetric flask with a capacity of 10 ml dichloromethane and bring to the mark.

4 μl of each of the obtained solutions was injected into the chromato-mass-spectrometer.

Determination is carried out using a gas chromatograph from Agilent Technologies (USA) model 6850 Network GC System with a quadrupole mass selective detector model 5973 Network of the same company.

The chromatography is carried out in a capillary column DB-5 MS EVIDEX length 25 m, internal diameter 0.2 mm with a stationary phase thickness of 0.33 μm, representing (5%-phenyl)-methylpolysiloxanes.

The initial temperature of the column thermostat is 70°C, this temperature is maintained for a period of minutes, further the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the ion source, the ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, and calculates the number of 4-methylhydroxybenzoate on the chromatographic peak area of its trimethylsilyl derivative.

As the carrier gas is helium. The gas flow is at a speed of 0.6 ml/min Mode with division of the flow of 1:2. Mass selective detector operates in electron impact (70 eV). Registration of the mass spectrum is performed on the full ion current with a delay of 3.5 minutes. Scanning range is 40-500 m/z.

According to the results of measurements on gas chromatography-mass spectrometer build a graph of peak area against the concentration of the analyte linear in the concentration range from 6·10-10-6·10-7G. using the least squares Method to calculate the calibration equation Gras�ICA, which looks like this:

S=37080·C-11183,

where S - the area of the chromatographic peak trimethylsilyl derivative 4-methylhydroxybenzoate, C - conditional, the concentration of 4-methylhydroxybenzoate in khromatograficheskoi sample, ng.

The results of the quantitative determination of 4-methylhydroxybenzoate in liver tissue are presented in table 5.

The proposed method in comparison with the prototype is more than 100 times increases the sensitivity of detection in khromatograficheskoi the sample and 33 times in the biological material, in 1,15 times increases the degree of extraction of hydroxybenzene and its monometallic derivatives of liver tissue (4-methoxybenzoyl the degree of extraction increases with RUR 75.05% to 86,12%), and also reduces the duration of the determination process for 2 hours.

Comparative characteristics of known and proposed methods are presented in table 6.

Method of determination of hydroxybenzene and its monometallic substituted in biological material, which is that the biological object is crushed, treated twice for 30 minutes, ethyl acetate, ethylacetate extracts were pooled, the solvent from the volume�United ethylacetate extracts evaporated at 16-20°C, the rest chromatographic in a column with silica gel using the mobile phase hexane: diethyl ether 6:4 by volume, fractions of eluate containing hydroxybenzene and its monoethylene substituted, unite, the analyte is transferred into the corresponding derivatives and conduct a qualitative and quantitative determination of physico-chemical method in the column with the stationary phase, characterized in that after the merger ethylacetate extracts treated with ethanolic potassium hydroxide, after evaporation of the solvent from the combined ethylacetate exhaust the residue was repeatedly treated with acetone containing hydrochloric acid in excess relative to the potassium hydroxide in the residue, acidified acetone extraction were pooled, treated with an aqueous solution of sodium hydroxide to neutralize any remaining hydrochloric acid in acetone and excess alkaline medium, the acetone is evaporated from the combined extract, aqueous alkaline residue diluted with water, the resulting solution acidified to pH 2-3, saturated with sodium sulfate, extracted with diethyl ether, the extract dried and evaporated, after pooling the fractions of eluate containing hydroxybenzene and its monoethylene substituted, extracted with a buffer solution with a pH of 12-13, aqueous alkaline extract podkisst% solution of hydrochloric acid to pH 2-3, saturated with sodium sulfate, extracted with dichloromethane, dichlormethane extract is dewatered, the analyte contained in dichlormethane extract, translate into the corresponding trimethylsilyl derivatives, which dichlormethane extract treated for 20 minutes, N-methyl-N-trimethylsilyl-triptoreline under conditions of heating at 60°C, as a physico-chemical method used gas chromatography-mass spectrometry, determination is carried out in a capillary column of 25 m length and an internal diameter of 0.2 mm with a stationary phase (5%-phenyl)-methylpolysiloxanes using the carrier gas helium, served with a speed of 0.6 ml/min, and mass selective detector, operating in the electron impact, the initial temperature of the column thermostat is 70°C, this temperature is maintained for 3 minutes, the temperature is programmed from 70°C to 290°C at a rate of 20°C / minute, final temperature of the column is maintained for 10 minutes injector temperature 250°C, the temperature of the quadrupole - 150°C, ion source temperature was 230°C, temperature interface detector 300°C, record the intensity of the signal, due to charged particles produced by the bombardment of analyte released from the capillary column and trapped in the source and�new, ionizing electron beam with electron energy of 70 eV, record the mass spectrum of the full ion current, qualitative determination of an analyte is carried out by retention time, and intensity of the signals characteristic of the charged particles in the mass spectrum of its trimethylsilyl derivative, and the number of identified compounds are calculated from the chromatographic peak area of its trimethylsilyl derivative.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to method of predicting development of terminal stages in patients with chronic myeloleukaemia. Essence of method consists in the fact that activity of two degydrogenases - glycerol-3-phosphatedehydrogenase (G3PDH) and lactatedehydrogenases (LDG) is determined in lymphocytes of peripheral blood of chronic leukaemia patients in open stage. In case of combination of G3PDH in the range from 0 to 0.02 mcE and activity of LDG in the range from 0.04 to 5.02 mcE development of terminal stage is predicted.

EFFECT: application of claimed invention makes it possible to diagnose progress of disease, correct plan and tactics of treating given category of patients and improve results of their rehabilitation in due time.

FIELD: medicine.

SUBSTANCE: invention refers to microbiology, namely to a method for the microbiological examination of a native smear from a tongue root mucosa. The substance of the method consists in the fact that a wooden spatula is used to sample biomaterial 0.5 ml by deep scraping from the mucous membrane at the boundary of the posterior one-third of the tongue dorsum and root; two smears are prepared on two slides, 1.5-2.0 cm2 in area; the smears are dried out for 20 minutes and fixed by flame heat of an alcohol lamp continuously for 5-6 seconds, Gram-stained by a complicated differential method, microscoped with immersion with the use of a ×100 objective lens; at least 10 visual fields are inspected on each slide taking into account quantitative and qualitative characteristics of microorganisms, cells and nuclei of the epithelium.

EFFECT: invention enables the more precise examination of the native smear of the tongue.

4 dwg, 1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method involves patient's blood analysis on the first day following ST elevation myocardial infarction for insulinemia, glycemia, free fatty acids (FFAs), retinol-binding protein, tumour necrosis factor and ghrelin; the measured values are used to calculate linear classification discriminator function (LCDF1-c) by formula: LCDF1-c=-3.877+0.095Adp+0.246Grl-0.025IL-6-0.053TNF, wherein ADP is the adiponectin concentration, Grl is the ghrelin level, IL-6 is the interleukin 6 concentration, while TNF is tumour necrosis factor, a probable risk of insulin resistance is stated if LSDF1 is less than a cluster separation point of 0.4545 and approaching a centroid line of -0.561 as close as possible.

EFFECT: more reliable early hospital diagnosis of potential insulin resistance in the patients suffered ST elevation myocardial infarction.

2 ex, 2 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: invention describes a diagnostic technique for nutritional insufficiency accompanying ulcerative colitis by immunoassay, wherein blood serum is analysed to measure the soluble adhesion molecules sICAM-1, sICAM-2 and sICAM-3; a mild degree of nutritional insufficiency is characterised by the blood lymphocyte level of 1,500-1,800·109/l, while the sICAM-1 level is 13.4-24.7 ng/ml, the sICAM-2 level is 8.1-17 ng/ml, and the sICAM-3 level is 4.4-19 ng/ml; the IgG level is 650-500 mg/l; a moderate level of nutritional insufficiency is accompanied by the blood lymphocyte level making 900-1,490·109/l, and the sICAM-1 level is 25-37.8 ng/ml; the sICAM-2 level is 17.1-23.9 ng/ml, and the sICAM-3 level is 19.5-30.8 ng/ml, the IgG level is 950-1,400 mg/l; a severe degree of nutritional insufficiency is accompanied by the blood lymphocyte level of 890·109/l and less, the sICAM-1 level is 38-63 ng/ml; the sICAM-2 level is 24-29 ng/ml and the sICAM-3 level is 30.9-42.3 ng/ml; the IgG level is 1,500-1,800 mg/l.

EFFECT: more accurate diagnosis of nutritional insufficiency accompanying ulcerative colitis.

3 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to a method for predicting the clinical course of sarcoidosis. Substance of the method consists in analysing biopsy material of a middle lobe of the right lung. What is involved is an immunohistochemical analysis in at least 5 visual fields at magnification ×400 to measure an average myofibroblast count in the interalveolar interstitial tissue. If the derived value is more than 50, the unfavourable outcome of sarcoidosis is predicted; the value of 15 and less average myofibroblast count, the favourable outcome of sarcoidosis is predicted.

EFFECT: using the declared method enables the early prediction and detection of the group of patients not requiring a great number of additional examinations.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: sodium/iodine symporter expression on a tumour cell membrane is measured in a tumour material taken by fine-needle aspiration biopsy, and if the measured expression is less than 1%, surgery is supposed to be added with the central lymph node dissection. The sodium/iodine symporter expression on the tumour cell membrane is determined by flow cytometry.

EFFECT: on the ground of the preoperative determination of the sodium/iodine symporter expression on the tumour cell membrane, the method enables establishing the extent of surgery for high-differentiated thyroid carcinoma, papillary and follicular, reliably.

2 cl, 2 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to a method of predicting a high risk of formation of adeno-tonsillar system chronic pathology in recurrent respiratory infection children (RRI). The level of interleukin -17 and MMP-9 in saliva is determined, and if the level of interleukin-17 is higher than 5 pg/mg and MMP-9 level is higher than 10 ng/ml, a high risk of formation of adeno-tonsillar system chronic pathology in RRI children is predicted.

EFFECT: application of the claimed method makes it possible to determine the high risk of formation of adeno-tonsillar system chronic pathology in RRI children in due time and to carry out early preventive procedures, aimed at the prevention of the above.

4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: newborn's umbilical blood serum agmatine is measured by capillary electrophoresis; the measured concentration of 0.038 mg/ml or more enables predicting convulsive conditions.

EFFECT: invention enables predicting convulsive conditions in newborns suffering perinatal injuries of the central nervous system and prescribing the timely pathogenetic therapy.

3 ex

FIELD: medicine.

SUBSTANCE: substance of the method consists in determining the concentrations of neuron-specific enolase (NSE) and vascular endothelial growth factor (VEGF) in umbilical blood serum and peripheral blood serum, the concentrations of brain-derived neurotrophic factor (BDNF) in peripheral blood serum on the 7th day of birth; that is followed by calculating a prognostic index (PI) by formula: PI=0.033×X1+0.016×X2-0.36×X3+0.002×X4+0.00054×X5-4.0, wherein X1 is the NSE concentration in umbilical blood (mcg/l); X2 is the VEGF concentration in umbilical blood (ng/ml); X3 is the NSE concentration in peripheral blood on the 7th day of life (mcg/l); X4 is the VEGF concentration in peripheral blood on the 7th day of life (ng/ml); X5 is the BDNF concentration in peripheral blood on the 7th day of life (ng/ml); Const=-4.0. If PI is less than 0, a low risk of ICP is stated. If PI is more than 0, a high risk of the given pathology is predicted.

EFFECT: method enables increasing the effectiveness of predicting infantile cerebral paralysis in the premature newborns with extremely low birth weight.

2 ex

FIELD: chemistry.

SUBSTANCE: concentration of pentaerythritol in aqueous solutions is determined using a solution with pentaerythritol content of 1-100 100 mg/dm3. The method includes determining pentaerythritol concentration therein at spectrophotometric detector wavelength of 190 nm. The eluent used is 0.0002 M sulphuric acid solution in deionised water. A column of weakly cross-linked styrene divinylbenzene resins is used.

EFFECT: shorter time for determining a chemical substance in water, simplifying the process while maintaining the quality of determination.

1 tbl

FIELD: medicine.

SUBSTANCE: invention refers to diagnostic technique in medicine and describes a laboratory diagnostic technique for Alzheimer disease by using metal-binding domain modified 1-16 forms of human beta-amyloid as Alzheimer disease pathogenesis biomarkers. The method is characterised by the fact that total peptide fraction, then beta-amyloid fraction and fragments of 1-16 beta-amyloid fraction to be further analysed after the targeted proteolysis is recovered from a denatured sample of biological fluid, urine, cerebrospinal fluid. If the biological fluid sample appears to contain a metal-binding domain modified, asparlic acid isomerised (position 7) form of beta-amyloid in the relative amount of more than 5% of the total amount of the 1-16 beta-amyloid fraction and/or a metal-binding domain modified, serine phosphorylated (position 8) form of beta-amyloid, Alzheimer disease is diagnosed.

EFFECT: invention can be used to establish a diagnosis of Alzheimer disease.

1 ex

FIELD: biotechnology.

SUBSTANCE: method is implemented as follows: the biological material containing novocaine is crushed, treated three times with acetone, containing 0.2-0.4% water, the liquid extract is separated, the acetone from the liquid extract is evaporated together with water in the air stream at a temperature of 18-22°C until complete removal of the solvent, the residue obtained as a result of evaporation is repeatedly treated with acetone containing 0.2-0.4% water, the acetone extract is separated, combined, and the solvent from the combined extract is evaporated, the residue is dissolved in diethyl ether, the resulting solution is diluted in hexane in a ratio of 1:1 by volume, extracted with buffer solution with pH 1-2, the acid-water extract is separated, neutralized with 10% ammonia solution, alkalized with ammonium buffer solution to pH 9.0-9.5, the resulting aqueous alkaline solution is saturated with ammonium sulphate, extracted twice with portions of the organic extractant which is used as a 30% solution of camphor in methyl acetate, at a ratio of aqueous and organic phases as 1:1 by volume, the organic extracts are separated, combined, and the solvent from the combined extract is evaporated in a stream of air at a temperature of 18-22°C to dry residue, the residue is dissolved in a mixture of dichloromethane and ethanol taken in a volume ratio of 1:1, the resulting solution is applied to a column of silica gel CRA No. 80/120 mcm, chromatographed using two-phase movable phase dichloromethane-ethanol in a ratio of 1:1 by volume, the fractions of eluate containing the analyte, combined, the eluent is evaporated, the residue is dissolved in methanol and determining is performed by gas-liquid chromatography coupled with mass spectrometric detection in a capillary column DB-5 MS EVIDEX with the length of 25 m and an inner diameter of 0.2 mm with the stationary phase, which is 5%-phenyl-95%-methylpolysiloxane using helium carrier gas supplied at a rate of 0.6 ml/min and a mass selective detector operating in electron impact mode, the initial temperature of the column oven is 80°C, this temperature is maintained for 1 minute, then the temperature is raised from 80°C to 200°C with the rate of 40°C per minute, then from 200°C to 300°C with the rate of 12.5°C per minute, the final column temperature is maintained for 16 minutes, the temperature of the injector is 200°C, the temperature of quadrupole is 150°C, the temperature of the detector interface is 300°C, the intensity of the signal is recorded, due to charged particles produced by bombarding of the analyte emerged from the capillary column and entered into the ion source, with ionizing electron beam with energy of 70 eV, a mass spectrum is recorded on total ion current and the amount of novocaine is calculated based on the chromatogram peak area.

EFFECT: increased sensitivity of determining.

2 ex, 3 tbl

FIELD: chemistry.

SUBSTANCE: biological material containing 3-methoxyhydroxybenzene is repeatedly (three times) treated for 45 minutes with an alkyl acetate in the form of methyl acetate; the separate extracts are combined; the solvent from the combined alkyl acetate extract is evaporated; the residue is repeatedly treated with acetone; the acetone extracts are combined, evaporated in an air current at 18-22°C, and then in an nitrogen current until complete removal of the solvent; the residue is dissolved in ether; the obtained solution is diluted with hexane in volume ratio of 1:1, extracted with a buffer solution with pH 12-13; the water-alkaline extract is separated, acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether; the ether extract is separated, dehydrated, evaporated in an air current at 18-22°C and then in a nitrogen current until complete removal of the solvent; the residue is dissolved in a hexane-dioxane-propanol-2 solvent mixture, taken in volume ratio of 20:5:1, subjected to chromatography in a silica gel macrocolumn L 40/100 mcm using a mobile phase of hexane-dioxane-propanol-2 in volume ratio of 20:5:1; eluate fractions containing the analyte are combined; the eluent is evaporated in an air current at 18-22°C and then in a nitrogen current until complete removal of the solvent; the residue is dissolved in dichloromethane, followed by determination using a chromatographic-mass-spectrometric technique using a capillary column with length of 25 m and internal diameter of 0.2 mm with a stationary phase with thickness (5% phenyl)-methylpolysiloxane, using a helium carrier gas, fed at a rate of 0.6 ml/min, and a mass-selective detector operating in electronic impact mode; the initial thermostat temperature of the column is 70°C; said temperature is maintained for 3 min, and the temperature is then raised from 70°C to 290°C at a rate of 20°C/min; the injector temperature is 250°C, the detector interface temperature is 300°C; the method also includes detecting the strength of the signal resulting from charged particles formed when bombarding the analyte coming from the capillary column and falling into an ion source which ionises an electron beam with energy of 70 eV; recording the mass spectrum on the full ion current and calculating the amount of 3methoxyhydroxybenzene from the area of the chromatographic peak obtained by detecting the signal from the characteristic molecular ion 124 m/Z.

EFFECT: high sensitivity.

3 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to application of ion-exchange processes, ionites, namely complex-forming ionites (complexite), for instance, highly basic anionites in form of complex-forming agents, and can be applied for determination of dynamic sorption capacity of complexites by ions of transition metals (TM). Method includes forced filtration of fixed volume of model solution (VS) with known initial concentration TM (C1) from reservoir from top to bottom through column with specified volume of complexite (VC) at speed, maximally approximated to conditions of industrial application of ionites. Filtrate after column is returned back into reservoir at the same speed constantly and in forced way, and filtered model solution in reservoir is heated with temperature of solution being supported in the ranges of passport limitations of ionites by thermal stability. In the process of filtration microvolumes of model solution samples are periodically taken from reservoir and concentration of TM in them is determined. Then, time of filtration beginning and current time of uptake of microvolume of model solution samples from reservoirs are registered. After that, graph of transition metal concentration change is equilibrium solution in reservoir depending on filtration time is built, and filtration is stopped when concentration of transition metal in reservoir stops decreasing and stabilises, or starts to increase. Then, final minimal concentration of transition metal of equilibrium solution in reservoir (C2) is registered and estimation of sorption capacity is performed by equation: DSCM=[(C1-C2)×VS]/VC. Obtained DSCM value corresponds to chemical composition of model solution, equilibrium pH value of solution in vessel after finish of filtration and specified filtration speed.

EFFECT: possibility to determine dynamic sorption capacity of complex-forming ionites by ions of TM at speeds of filtration, satisfying conditions of industrial application of ionites, and with lower time consumption.

2 dwg, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biology and toxicological chemistry and can be used in practice of sanitary and epidemiological stations, chemical-toxicological, forensic and veterinary laboratories. A biological material, containing substituted 2-methoxyhydroxybenzene, is two times (each time for 30 minutes) infused with ethylacetate with mixing, separate extracts are separated from solid particles of the biological material, combined, ethylacetate is evaporated in an air flow at 18-22°C, residue is repeatedly processed with acetone, acetone extracts are separated, combined, dehydrated, evaporated in an air flow at 18-22°C, and then in a nitrogen flow until a solvent is completely removed, residue is dissolved in hexane, extracted with a buffer solution with pH 12-13, a water-alkaline extraction is separated, acidified to pH 2-3, saturated with sodium sulphate, extracted with diethyl ether, the ether extract is separated, dehydrated, evaporated in an air flow at 18-22°C, and then - in a nitrogen flow until the solvent is completely removed, residue is dissolved in a mixture of solvents hexane-dioxane-propanol-2, taken in a ratio of 20:5:1 by volume, chromatographed in macrocolumn with silicagel KSS No 3 80/120 mcm with the application of a mobile phase hexane-dioxane-propanol-2 in a ratio of 20:5:1 by volume, eluate fractions, containing the analysed substance, are combined, the eluent is evaporated first in an air flow at a temperature of 18-22°C, and then in a nitrogen flow until the solvent is completely removed, residue is dissolved in dichloromethane, processed for 20 minutes with N-tert-butyl-dimethylsilyl-N-methyltrifluoroacetamide under conditions of heating at a temperature of 60°C with carrying out determination by a chromatography-mass spectrometry method with the application of a capillary column 25 m long with an internal diameter of 0.2 mm with an immobile phase (5%-phenyl)-methylpolysiloxane, with the application of a mass-selective detector, working in an electron impact mode, an initial temperature of the column thermostat constitutes 70°C, the said temperature is kept for 3 minutes, further the temperature is programmed from 70°C to 290°C at a rate of 20°C per minute, the final column temperature is kept for 10 minutes, the injector temperature constitutes 250°C, the quadrupole temperature is 150°C, the temperature of a ion source is 230°C, the temperature of the detector interface is 300°C, intensity of a signal, conditioned by charged particles, formed in the bombardment of the analysed substance, leaving the capillary column and getting into the ion source, with a ionising beam of electrons with the energy of 70 eV, is registered, the mass-spectrum by the complete ion flow is registered and an amount of substituted 2-methoxyhydroxybenzene is calculated by the area of a chromatographic peak of its trimethylsilyl derivative.

EFFECT: achievement of an increased analysis sensitivity.

4 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention is used to identify unknown components of complex mixtures of natural and man-made substances in different industries: chemical, gas, oil, medicine, environmental, food, perfume etc. In the method, the analysed mixture is fed into a two-phase system consisting of immiscible liquids - hexane and acetonitrile. Gas chromatography is then used to determine percentage content of components in each phase and the logarithms of the distribution constant thereof, expressed in form of indices, as well as retention indices of non-polar phase components with linear programming of column temperature, and the difference between retention indices and indices of the distribution constant logarithm is used to determine indices of molecular weight and boiling point.

EFFECT: high accuracy of determining molecular weight and boiling point.

2 tbl

FIELD: medicine.

SUBSTANCE: method for acquiring samples for the spectral biochemical blood analysis involving preparing and drying blood serum and extracting for the chromatographic examination differs by the fact that a process of a dry matter of blood serum obtaining is performed with stirring constantly at a temperature of 50-60°C for 21-27 hours to produce the dry matter in the form of a plug compacted in the centre and coated with a superficial film; the plug is perforated with a sterile and chemically intact object; 85% methanol is added to a test tube containing the dry matter. The prepared mixture is placed into the stirring device again at a temperature of 48-52°C for 21-27 hours and compacted in a centrifuge at an acceleration of 11500-12500 g. The prepared sample is added to an auto-sampler test tube of a liquid chromatograph in an amount of 3/4 - 2/3 volumes of the test tube.

EFFECT: using the present invention enables producing chromatograms with a low-error reproducibility within one sample that is adequate to provide the analysis result reliability with the use of t liquid chromatography.

FIELD: chemistry.

SUBSTANCE: method includes the following stages: interaction of eluate 68Ge/68Ga generator with a cation-exchange resin, washing the cation-exchange resin with a mixture of hydrochloric acid and ethanol, eluting 68Ga from the cation-exchange resin with the mixture of hydrochloric acid and ethanol, interaction of the obtained eluate with an anion-exchange resin, washing the anion-exchange resin with ethyl alcohol, drying the anion-exchange resin with air or inert gas and eluting 68Ga from the anion-exchange resin with a water solution of hydrochloric acid.

EFFECT: increased output of the process.

2 tbl, 2 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: method involves blood sampling, 2,4-dichlorophenol extraction by an organic extractant from the above sample and measurement by gas chromatography analysis with using a calibration curve; before extraction, the blood sample is acidified with an oxalic acid solution to pH 2-3; the organic extractant for the extraction is presented by toluene; further, the prepared extract is added with a bromating agent and a water-thinned sulphuric acid in volume ratio of water : concentrated sulphuric acid as 3:1 respectively; the extract is brominated for 5 minutes that is followed by neutralising a bromine excess with sodium sulphite; the prepared brominated extract is centrifuged to separate toluene, and acetylated with trifluoroacetic anhydride in the pyridine medium for 5 minutes; the blood sample, the organic extractant toluene, the bromating agent, trifluoroacetic anhydride and pyridine are taken in the following volume ratio of 1:0.5:0.4:0.02:0.02 respectively.

EFFECT: simplifying the sample preparation stage in a combination with higher sensitivity.

5 cl, 6 tbl, 1 ex

FIELD: chemical engineering; medical engineering.

SUBSTANCE: method involves plotting two chromatograms one of which is based on radioactivity (No 1) and the other one on ultraviolet absorption (No 2) or on radioactivity (No 1) and on fluorescence (No 2) and chromatogram specific relative to ultraviolet absorption (No 3) or relative to fluorescence (No 3). Material quality is estimated to be the more high the more close studied labeled compound peak shape is to trapezoid shape on the third chromatogram.

EFFECT: high accuracy of the method.

8 dwg

Up!