|
Human immunodeficiency virus strain type 1 iv741 subtype ae for diagnostic and vaccine preparations Invention relates to virology and biotechnology. The human immunodeficiency virus strain type 1 IV741 is isolated on the territory of the Russian Federation from a patient who has not received ARV therapy. The strain is deposited in the State Collection of Viruses of the D. I. Ivanovsky Research Institute of Virology of the Ministry of Health and Social Development of Russia under number N1186. The strain belongs to HIV subtype AE. The strain has stable reproductive activity. The infectious titre is 5-6 lg TCD50. |
|
|
Subtype b type 1 iv735 human immunodeficiency viral strain for diagnostic and vaccine preparations Invention refers to a subtype B of a human immunodeficiency viral strain, and can be used in virology, medicine and biotechnology. The presented type 1 IV735 human immunodeficiency viral strain is deposited in the State Collection of Viruses of Federal State Institution Ivanovsky Research Institution of Virology of the Russian Ministry of Healthcare and Social Development, No. 1189. The strain possesses a stable reproductive activity. An infectious titre makes 6 lg 50% tissue cytopathic dose. |
|
|
Self-inactivated helper adenoviruses for preparing high-capacity recombinant adenoviruses Invention refers to biotechnology. What is presented is an adenovirus helper vector for preparing a high-capacity recombinant adenovirus. The invention can be used in cell technology. |
|
|
Phage φ-mru polynucleotides and polypeptides and their application Invention relates to the field of biochemistry, in particular to polypeptides, which are the inhibitors of methanogen cell and biological markers for detection of φmru phage, as well as polynucleotides, which code the said polypeptides. Disclosed are expression vectors and cloning vectors, which contain the said polynucleotides and host cells, containing the said vectors. Described are conjugated or fused molecules, which are the inhibitors of the methanogen cell and biological markers for detection of φmru phage, as well as antibodies, binding with the said polypeptides. Also disclosed is φmru phage, isolated with application of the described polypeptides. The invention also relates to pharmaceutical compositions and methods of inhibiting the methanogen cell with application of the described polypeptides, conjugated or fused molecules. |
|
|
Pharmaceutical composition for treatment and prophylaxis of bacterial infection Pharmaceutical composition includes bacteriophages obtained by cultivation on nutritional medium containing glucose, sodium chloride, twice-substituted sodium phosphate, liquid autolysed yeast and clean water in the specified ratio, and dried and having a filler without lyophilisation, in the form of pills with a gastral-resistant coating. |
|
|
Flu virus, capable of infecting canidae and its application Invention relates to the field of biotechnology and virology. Claimed are isolated strains of the flu virus, capable of infecting canidae and cause respiratory diseases in canidae. Compositions and methods for inducing immune response against the flu virus in canidae are also described. |
|
|
Antibacterial composition, strain of bacteriophage escherichia coli, used for obtaining thereof Invention relates to field of food industry, biotechnology and deals with antibacterial composition and strain of bacteriophage Escherichia coli, used for obtaining said composition. Characterised composition includes filtrate of Escherichia coli phage lysate, obtained with application of strain of bacteriophage Escherichia coli, deposited in collection of museum of microorganisms of Federal Budget Institution of Science "State Research Centre for Applied Microbiology and Biotechnology" of the Federal Service on Customers' Rights Protection and Human Well-being Surveillance (FBIS SRC AMB of Rospotrebnadzor) under number Ph 64, filtrate of Escherichia coli phage lysate, containing coli bacteriophage, filtrate of staphylococcus phage lysate, filtrate of salmonella phage lysate, filtrate of Listeria monocyctogenes phage lysate and target additives in amount 1.0÷95.0 wt % of composition weight. |
|
|
Strain of diploid cells of fetal lung of cattle for reproduction of viruses Strain of diploid cells of fetal lung of cattle is isolated from bovine fetal lung and is deposited in the Specialised Collection of passaged somatic cell cultures of farm and game animals of Russian Collection of vertebrate cell cultures (farm animals of Russian Academy of Agricultural Sciences) at the All-Russian Research Institute of Experimental Veterinary Medicine n.a. Ya.R.Kovalenko (ARIEV) under number 83. The strain is cultivated on medium Igla MEM and GLA of 1:1 with 10% fetal serum of cattle, free from viral, mycoplasmal and bacterial contamination. |
|
|
Agent for neutralising smallpox virus Invention represents an agent for neutralising smallpox virus representing an artificial single-chain human 1A antibody having an amino acid sequence presented in the claim material, and exposed on a surface of the filamentous phage M13. |
|
Chimeric porcine circovirus pcv2gen-1rep of and its application Invention relates to field of biotechnology. Described is molecule of chimeric nucleic acid of porcine circovirus (PCV2Gen-1Rep), which includes molecule of nucleic acid, coding porcine circovirus of type II (PCV2), which contains sequence of nucleic acid, coding protein Rep of porcine circovirus of type 1 (PCV1). Chimeric molecule of nucleic acid is constructed by replacement of gene Rep ORF1 PCV2 with gene Rep ORF1 PCV1. Invention also includes biologically functional plasmid or viral vector, which contain unique molecules of chimeric nucleic acids, suitable host cells, transformed by plasmid or vector, infectious chimeric porcine circoviruses, which produce suitable host cells, method of obtaining immunogenic polypeptide product with application of novel chimera, viral vaccines, protecting pig against viral infection or syndrome of postweaning multisystem wasting syndrome (PMWS), caused by PCV2, methods of protecting pigs against viral infection or postweaning multisystem wasting syndrome (PMWS), caused by PCV2, methods of obtaining unique chimera PCV2Gen-1Rep and the like. Invention can be applied in veterinary. |
|
Associated inactivated emulsion bovine viral diarrhoea, rotavirus and coronavirus infections vaccine Invention refers to veterinary virology and biotechnology, and concerns a bovine viral diarrhoea, rotavirus and coronavirus infections vaccine. The described vaccine contains an active substance and a target additive. As the active substance, the vaccine contains a mixture of an avirulent purified antigen material of the strain NADL-VNIIZZh-DEP of bovine viral diarrhoea of the family Flaviviridae, of the genus Pestivirus, an avirulent purified antigen material of the strain 101 VNIIZZh-DEP of bovine rotavirus of the family Reoviridae, of the genus Rotavirus, and an avirulent purified antigen material of the strain VNIIZZh-DEP of bovine coronavirus of the family Coronaviridae, of the genus Coronaivirus deposited in the Russian National Collection of Microorganism Strains used in veterinary science and animal industry. The strains are taken in the relation of 1:1:1 in the amounts to provide the protective immune activity of each antigen in an animal's body after the target preparation is introduced. |
|
|
Subtype a type 1 iv742 human immunodeficiency viral strain for diagnostic and vaccine preparations Invention refers to a subtype A human immunodeficiency viral strain, and can be used in virology, medicine and biotechnology. The presented type 1 IV742 human immunodeficiency viral strain is deposited in the State Collection of Viruses of Federal State Institution Ivanovsky Research Institution of Virology of the Ministry of Healthcare and Social Development of the Russian Federation, No. 1187. The strain possesses a stable reproductive activity. An infectious titre makes 6 lg 50% tissue cytopathic dose. |
|
Invention refers to a subtype A human immunodeficiency viral strain, and can be used in virology, medicine and biotechnology. The presented type 1 IV710 human immunodeficiency viral strain is deposited in the State Collection of Viruses of Federal State Institution Ivanovsky Research Institution of Virology of the Ministry of Healthcare and Social Development of the Russian Federation, No. 1188. The strain possesses a stable reproductive activity. An infectious titre makes 3.5-4.0 lg 50% tissue cytopathic dose. |
|
Method of quantitative determination of fixed rabies virus "moskva 3253" Invention relates to field of biotechnology and deals with method of quantitative determination of fixed rabies virus strain "Moskva 3253". Method includes decontamination and separation of RNA from virus-containing material, carrying out reaction of reverse transcription and polymerase chain reaction with hybridization-fluorescence account of results in "real time" mode with application of specific primers RV5-5'-GTTGGGCACTGAAACTGCTA-3', RV6-5'-GAATCTCCGGGTTCAAGAGT-3' and probe RV7-5'-ROX-AATCCTCCTTGAACTCCATGCGACAGA-BHQ2. Quantitative assessment of virus is determined on the basis of registration of signal of analysed sample fluorescence and its comparison with signal of fluorescence of PCR-standards, which contain different quantities of DNA-targets. Claimed method makes it possible to determine quantitative content of virus in rabies antigen of organ-tissue and culture origin. |
|
Invention refers to medical biotechnology, and concerns influenza virus strains What is presented is the influenza virus strain A/Hongkong/1/68/162/35 (H3N2) deposited in the State Collection of Viruses of Ivanovskiy Scientific and Research Institution of Virology of Russian Academy of Medical Sciences, No.2442, that is a donor of internal genes for producing reassortant strains and prepared by passaging an agent through chicken embryos. The presented attenuation donor is used to produce the reassortant stains: A/SPb/GK/09 (H1N1) and A/HK/Astana/6:2/2010 (H5N1) deposited in the in the State Collection of Viruses of Ivanovskiy Scientific and Research Institution of Virology of Russian Academy of Medical Sciences, Nos. 2627 and 2626, respectively that inherit high reproductivity (9,5 lg) and an attenuation phenotype (ca) and thermal sensitivity (ts) respectively from the donor. |
|
Invention relates to field of biotechnology and deals with set, which includes oligodeoxyribonucleotide primers and fluorescently labelled probe for identification of DNA of adenovirus of serotypes 3, 4, 7, 14, 21 by method of hybridization-fluorescence polymerase chain reaction in real time mode. Claimed primers and probe have the following structure: external primer 5'→3' 5'-AATGTARTTGGGTCTGTTRGGCAT-3' internal primers 5'→3' 5'-CCCWTCGATGMTGCCCC-3' 5'-TCMACGGGYACRAAGCGCA-3' probe 5'→3' ROX-CCTGTCCGGCGATGTGCAT-BHQ2. |
|
Strain of virus of nuclear polyhedrosis of cotton budworm Helicoverpa armigera Hbn has high antiviral activity in relation to cotton budworm. It is deposited in the State collection of the Federal Service for Consumer Rights Protection and Human Welfare of causative pathogens of viral infections, rickettsial diseases of Federal Budget Institution of Science of State Science Centre of virology and biotechnology "Vector" under the registration number V-607, and can be used in the production of biological insecticides for agriculture. |
|
Method for preparing cattle parainfluenza-3 vaccine Invention relates to veterinary microbiology and concerns a method for preparing a cattle parainfluenza-3 vaccine. The presented method involves preparing a virus-containing material of a cattle parainfluenza-3 virus strain, infecting a continuous cell culture with the virus-containing material, culturing the cattle parainfluenza-3 virus, collecting a virus-containing fluid, inactivating it and preparing a liquid end product with the virus-containing fluid inactivated in an oxidant solution prepared by electrolysis of 10.0-20.0% sodium chloride to achieve pH values 7.0-8.0, the oxidant concentration of 0.7-0.9% and an oxidantion-reduction potential of +1000±50 mV and an inactivation agent consumption of 4.5-5.0 cm3 per 0.8-1.0 l of the virus-containing fluid with the virus-containing fluid inactivation being one-staged in the content of available chlorine Cax=250-500 mg/l for 60-70 min and at temperature 37-38°C at pH 7.2-7.4. |
|
|
Pox virus of variolovaccine is proposed, which includes a defect F2L gene and a suicide gene. Pox virus has oncolytic activity. Besides, a reproduction method of such pox virus and its use for treatment of proliferative diseases or diseases with increased activity of osteoclasts is proposed. |
|
Created is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype containing expressing cassette with haemagglutinin gene of influenza virus being included. As a haemagglutinin gene of influenza virus of B/Brisbane/60/2008 strain haemagglutinin gene with pre-optimised for expression in human being cells nucleotide sequence was used providing overexpression of haemagglutinin gene of influenza virus of B/Brisbane/60/2008 strain. Haemagglutinin gene of influenza virus of B/Brisbane/60/2008 strain with optimised nucleotide sequence was cloned in expressing cassette under promoter control and contains polyadenylation signal. Promoter is cytomegalovirus promoter, and polyadenylation signal is SV40. Expressing cassette is located in zone of E1 deletion of human being adenovirus genome of the 5-th serotype. Also method of use of recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype for induction of specific immunity to influenza virus B. |
|
Characterised is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype and method of its use. Provided particle contains expressing cassette with haemagglutinin gene of influenza virus being included. As a haemagglutinin gene of influenza virus, haemagglutinin gene of A/Perth/16/2009(H3N2) strain with pre-optimised for expression in human being cells nucleotide sequence presented in SEQ ID NO:2. The specified haemagglutinin gene of influenza virus of A/Perth/16/2009(H3N2) strain is cloned in expressing cassette containing polyadenylation signal SV40 under control of cytomegalovirus promoter. Presented invention may be used for induction of specific immunity to influenza virus A of H3N2 subtype during injection in efficient quantity. |
|
Characterised is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype and method of its use as a component for production of vaccine for influenza virus A of H1N1 subtype. Presented recombinant particle contains expressing cassette including SV40 polyadenylation signal and cytomegalovirus promoter with influenza virus haemagglutinin gene being included. As influenza virus haemagglutinin gene, haemagglutinin gene of strain A/California/07/2009(H1N1) is used with pre-optimised for expression in human being cells nucleotide sequence provided in SEQ NO:2. These inventions allow raising specific immunity to influenza virus A of H1N1 subtype by provision of overexpression of haemagglutinin gene of influenza virus A/California/07/2009(H1N1). |
|
Vaccine strain for influenza virus A/17/mallard/Netherlands/00/95(H7N3) is proposed. Strain A/17/mallard/Netherlands/00/95(H7N3) is harmless for laboratory animals. Strain A/17/mallard/Netherlands/00/95(H7M3) has antigenic actuality and attenuation thus meeting the requirements to vaccine strains included in influenza live vaccine, and may be used for production of influenza live and inactivated intranasal vaccine in health care service for influenza prevention. |
|
|
Method of virus treatment by ultracentrifugation in sugar concentration gradient (versions) Treatment methods of inactivated virus or fragmented virus (versions) are proposed. Methods involve addition of virus preparation to sugar gradient and further centrifugation to obtain peak fraction. Then, peak fraction is extracted to obtain cleaned virus. With that, sugar gradient is obtained by continuous ultracentrifugation of the first and the second buffer sugar solution. Besides, the first buffer sugar solution includes the first physiological buffer, and the second buffer sugar solution includes the second physiological buffer that is the same or different from the first physiological buffer. As per one version, sugar concentration in the first buffer solution is equivalent to saccharose concentration of 35 to 50 wt %, and sugar concentration in the second buffer solution is equivalent to saccharose concentration of 50 to 65 wt %. Besides, the second buffer sugar solution has higher density in comparison to that of the first one. As per the other method version, density of the first buffer sugar solution is 1.15 kg/l to 1.23 kg/l, and density of the second one is 1.23 kg/l to 1.32 kg/l. |
|
Method for preparative extraction of viruses of plants Homogenisation of tissues of an infected plant is performed in neutral buffer solution based on 2-[4-(2-hydroxyethyl)piperazin-1-il]ethanesulphonic acid (HEPES) in concentration of 0.02-0.03 M with addition of inhibitors of plant ferments of iodine-sodium acetate and phenilmethylsulfonyl fluoride. Saccharose is added. Obtained extract is clarified. Clarified extract is treated with 4 - 6% Triton X-100 to separate viral particles from cell components. Viral particles are separated from clarified extract by differential centrifugation or ultracentrifugation. |
|
Poxvirus includes defective gene I4L and/or F4L and target nucleic acid containing suicide gene. Besides, a composition containing such a poxvirus, its use for obtaining medical preparation and a treatment method of proliferative disease or disease with increased activity of osteoclasts with its application are described. The proposed group of inventions can be used in medicine. |
|
Strain is deposited under number Ph 62 in GKPM-Obolensk collection. Strain can be used for development of complex medical and disinfective preparations against infections caused with Staphylococcus aureus, as well as preparations for sanitation of food products against Staphylococcus aureus. |
|
Extracted polynucleotide molecule coding torque teno virus, rna molecule and expression vector Group of inventions refers to biotechnology and deals with new nucleotide sequences of Torque teno virus (TTV) and vectors containing such sequences. Extracted polynucleotide molecule contains polynucleotide sequence chosen from the group consisting of SEQ ID NO:4, sequence complementary to SEQ ID NO:4 and polynucleotide that is at least 95% identical to SEQ ID NO:4. |
|
Method for preparing cattle viral diarrhoea vaccine Invention refers to veterinary virology, microbiology and biotechnology and may be used in developing the agents for specific prevention, particularly for preparing cattle viral diarrhoea vaccine. To improve the quality of an end product by using an oxidant solution as an inactivating agent prepared by the electrolysis of sodium chloride solution, as well as to activate the method for preparing the cattle viral diarrhoea vaccine involving preparing a virus-containing material of the cattle viral diarrhoea vaccine strain, infecting a continuous cell culture with the virus-containing material, culturing the cattle viral diarrhoea virus, collecting a virus-containing fluid, inactivating and preparing the end product in the liquid form, with the cattle viral diarrhoea virus being inactivated by the oxidant solution prepared by electrolysis of 10.0-20.0% sodium chloride with the electrolysis carried out to pH 7.0-8.0, oxidant concentration 0.7-0.9% and redox potential +1000±50 mV; the processing is one-staged with the active chlorine content Cax=400-600 mg/l for 60-70 min with inactivating agent consumption 4.5-5.0 cm3 per 0.8-1.0 l of the virus-containing fluid. |
|
|
Invention proposes recombinant classical swine fever virus (1111) that contains deletion of at least one amino-acid in TAVSPTTLR domain of protein E2, which corresponds to positions 829-837 of parent polyprotein CSFV, as well as the corresponding vaccine, kDNA molecule, a protection method of an animal against CSFV and a differentiation method of CSFV-infected animals. |
|
Nanocomposites made of nanoparticles of titanium dioxide in amorphous or crystalline (anatase, brookite) form, immobilised polylysine derivatives of oligonucleotides (PL-oligo) and photoactivated arylazide groups introduced in amino groups of polylysine. All components of the nanocomposite perform a certain function: TiO2-nanoparticles support transfection of cells; polylysine helps to immobilise oligonucleotide onto the surface of nanoparticles and adds functional groups (NH2), which make it possible to add additional reaction-capable groups; oligonucleotides of certain sequence forward the composite towards the target sections of the virus RNA; the photoactivated perfluoroarylazide group after irradiation with light may damage nucleic acids. |
|
Invention relates to a strain of the bacteriophage Escherichia coli ECD4. The strain of the bacteriophage Escherichia coli ECD4 is isolated from faeces of broiler chickens on the culture of the bacteria of the strain Escherichia coli O104.H4 RK1No.112027 and is deposited in the State Collection of Pathogenic Microorganisms and Cell Cultures "GKPM-Obolensk" under the number Ph63. The proposed strain of the bacteriophage has lytic activity in respect to the bacteria of the strain Escherichia coli O104:H4 RKINo.112027, lyses Escherichia of the serotype 0157:H7, does not suppress growth of cells Escherichia coli M-17, has lytic activity in respect to several other clinically significant serotypes of Escherichia, and also to several types of Shigella. The strain of the bacteriophage Escherichia coli ECD4 propagates on the laboratory non-pathogenic strain Escherichia coli K-12 C600F. |
|
Strain of enterovirus coxsackie b6 selectively infecting and lysing tumorous human cells in vitro Described strain is produced by performance of a series of adaptation passages of a parent strain of the virus ZhEV-15 Coxsackie B6 on the culture of cells HEK293 highly sensitive to this virus and the neoplastic cell line C33A (HPV-negative carcinoma of human uterine neck), with production of a new strain ZhEV-15L of the virus Coxsackie B6. The strain selectively infects and lyses tumorous human cells and has a fragment of a genome sequence represented in the dwg. 2, being its marker criterion. The strain is deposited in the State Collection of the Federal Service for Oversight of Consumer Protection and Welfare of agents of viral infections and rickettsial diseases of the Federal Budget Institution of Science State Science Centre of Virusology and Biotechnology "Vector" under the registration number V-576. |
|
Invention relates to the field of microbiology and relates to the strain of flu virus of H16N3-subtype. The strain of bird flu virus A/common gull/Altai/804/2011/H16N3-subtype is described, deposited in the State Collection of Viral Infectons and Rickettsial diseases of the Federal Budget Institution of Science State Science Centre of Virusology and Biotechnology "Vector" under the registration number V-583. The strain was isolated from a common gull (Larus canus). The strain may be used to produce a polyclonal serum to determine affinity of the flu virus to H16-subtype, and also may be used as a control reference sample when assessing specificity of test systems on the basis of PCR. |
|
|
Method for producing preparation containing viral antigens and using preparation Invention refers to molecular biology, genetic engineering and virology. What is presented is a method for producing a preparation containing the viral antigens, involving a) cell inoculation with an infectious in the fluid, b) reproduction of the above virus in the above cells, c) collection of the above reproduced virus, d) inactivation of the above collected virus, and e) treatment of the above inactivated virus with a detergent to produce the preparation containing the viral antigens. |
|
Genes coding major capsid protein l1 of human papilloma virus, and using them Invention refers to biotechnology and virology. The present invention discloses a codon-optimised gene coding the major capsid protein L1 of human papilloma virus which is able for effective expression of the major capsid protein L1 of human papilloma virus after transducing into a yeast cell. What is also described is an immunogenic macromolecule which is preferentially formed by the expression of the above codon-optimising gene coding the major capsid protein L1 of human papilloma virus in the yeast cell. What is also disclosed is using the above immunogenic macromolecule and composition containing the above immunogenic macromolecule. |
|
Method for influenza virus purification Invention refers to biotechnology and describes a method for preparing a purified concentrate of influenza virus; the method involves microfiltration of a virus-containing allantoic fluid in filter elements of the size of 0.1-0.2 mcm and further diafiltration in a phosphate buffer solution containing sodium chloride 0.25-0.5 M, EDTA or sodium citrate, concentration of influenza virus on membranes with a cuttoff threshold of 300-500 kDa and further diafiltration in a phosphate buffer solution containing sodium chloride 0.25-0.5 M, EDTA or sodium citrate, an anionic detergent 0.02-0.002%, and ultra-centrifugation in a density gradient of saccharose prepared in a phosphate buffer solution containing sodium chloride 0.25-0.5 M, EDTA or sodium citrate, and an anionic detergent 0.02-0.002%. |
|
Methods and compositions for immunisation of pigs against porcine circovirus Nucleic acids are described, which code genomes of two new strains of porcine circovirus of type 2B. These two new strains of porcine circovirus may be used to produce a vaccine or an immunogenic composition for immunisation of pigs against porcine multisystemic wasting syndrome (PMWS). |
|
New strain "KEM-7" of the fowlpox virus is produced by multiple passages of mother virus on developing chicken embryos. The strain is deposited into the collection of FSBI VGNKI under the registration number (reference) - strain "KEM-7" - DEP of fowlpox virus. The strain is genetically authentic by the sequence of nucleotides of the gene 241ext. It is adapted to the organism of developing chicken embryos. It is immunogenic, moderately reactogenic and harmless for birds in case of an intradermal injection. It preserves the attenuated phenotype during passages both in the cultivation system and on a naturally receptive bird. |
|
Rubella virus strain "orlov" (u) for obtaining medicinal immuno-biological preparations (mibp) Strain was deposited under number V-1 in the collection "SCPM-Obolensk". The strain may be used to produce monovalent rubella vaccine, associated combined vaccines comprising the vaccine strain of rubella virus, as well as for production of diagnostic products. |
|
|
New method for recovery and viral load test in pancreatine sample Invention refers to biotechnology. The method for viral load recovery from a pancreatine sample provides: preparation of a pancreatine test sample, low-speed centrifugation, separation of a solid deposit, first ultracentrifugation, separation of a first target fraction, second ultracentrifugation and viral load recovery. The low-speed centrifugation is performed at relative centrifugal force 8000-15000 x g. The first ultracentrifugation follows at relative centrifugal force 50000-150000 x g, and relative centrifugal force for the second ultracentrifugation is 150000-300000 x g. |
|
|
Cytomegalovirus vaccine and method for preparing it Invention refers to vaccinology and cell biology. |
|
Method of replication of influenza virus in culture Invention relates to field of biotechnology and virology. Method of selecting human influenza virus for growing on tissue culture cells by method of limiting dilution cloning. Method includes dilution of influenza virus, its mixing with tripsin, contact with cells of tissue cultures, growing and harvesting of virus. Said stages are performed 2-3 times. Also described is method of obtaining vaccine against human influenza virus with application of claimed method of selecting influenza virus. |
|
Method to determine virulent and pathogenic forms of flu viruses Method to determine virulent and pathogenic forms of flue viruses is based on collection of an initial sample of a tissue/physiological fluid from patients who are possibly sick with flu, extraction and treatment of RNA preparations from the initial sample, synthesis of cDNA on the RNA matrix, analysis of a nucleotide sequence of the produced cDNA with the purpose to identify the mutation status of specific positions of flu virus segments, and calculation of two scoring-factors, by the value of which they decide on extent of virulence and pathogenicity of a flu virus. |
|
Strain is extracted from liver of spontaneously ill broiler chickens and is deposited in the State Virus Collection of the Virosology Institute named after D.I. Ivanovskiy under the number No. 2722. The strain relates to the family of Circoviridae, variety of Circovirus, has intense infectious and antigene activity. |
|
|
Method to produce pox viruses and compositions of pox viruses Method is disclosed for production of a wild type of an attenuated or recombinant pox virus, without detected infectitious specificity. The method provides for preparation of a culture of packing cells, contamination with pox virus and cultivation of infected cells. Further EEV particles are extracted from a culture supernatant and from packing cells, treatment of a mixture of pox virus particles, concentration of a treated mixture of pox virus particles and diafiltration of a concentrated mixture of pox virus particles. |
|
Presented cell line is produced from primarily trypsinized tissue of Siberial sturgeon fins by means of long-term passivation in the medium 199 with Hanks salts with 10% embryonal serum and is deposited in the Russian Academy of Agricultural Sciences (agricultural animals) under the No.76. The line may be used in laboratory research in production of virus vaccines and diagnostic preparations for extraction, accumulation, titration and study of a virus haemorrhagic septicemia virus (VHSV) of salmon fishes, infectious haemopoetic necrosis (IHNV) of salmon fish tissue, spring viremia of carps (SVCV), carp iridovirus (CCIV) and herpes of sturgeon virus (SbSHV). |
|
|
Invention relates to a set of oligonucleotide primers and fluorescent-marked probes for type-specific express-identification of the Ebola-Zaire virus by the method of polymerase chain reaction in real time. The set includes sequences that are type-specific for the Ebola-Zaire virus: external: 5'→' 5' CCACTTTTCTCAACCAAAATTATTAGTGA 3' 3'←5' 5'TTCTCTAAATCAGTTACAAARCTACTCCC 3' internal: 5'→3' 5'TGGGATCCAGTHTIYGARCC 3' 3'←5' 5' ACTACCATCATATTGCTAGGAAATGCTT 3' probe: FAM - TACTACCACAATATCGGAACTTTTCTTTCTCATTGAA - BHQ1. |
|
Strain of a flu virus A/IIV-Anadyr/177-ma/2009 (H1N1) pdm09 is proposed, which is adapted to tissues of light laboratory rodents. The strain is produced by means of multiple passage of a parent strain A/IIV-Anadyr/177/2009 (H1N1) on models of developing hen embryos, infected into the allantoic cavity, and pedigreeless laboratory white mice infected intranasally. The strain may be actively reproduced in tissues of light laboratory rodents, casing lethal pneumonia in them. The strain is deposited into the state collection of viruses of the Scientific and Research Institute of Virology named after D. I. Ivanovskiy under the No.2721. |
|
Invention relates to the field of biotechnology and is related to the set oligonucleotide primers and fluorescent-labeled probes for species-specific express-identification the virus Ebola-Sudan by the method of polymerase chain reaction in real time. The set comprises sequences species-specific for the virus Ebola-Sudan: external: 5'→3' 5' CCGTTATTCTCYACRAAGRTSATTAGTGA 3' 3'←5' 5' TTCTCTAGGTCTGTGACAAAACTACTCCC 3' internal: 5'→3' 5' TGGGATGCAGTHTTYGARCC 3' 3'←5' 5' ACAACCATCATRTTGCTTGGAAAGGCTT 3' probe: FAM - TATTGCCCCAGAATCGAAATTTTTCTTTTTCATTGAA-BHQ1. |
Another patent 2513537.