Chimeric porcine circovirus pcv2gen-1rep of and its application

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology. Described is molecule of chimeric nucleic acid of porcine circovirus (PCV2Gen-1Rep), which includes molecule of nucleic acid, coding porcine circovirus of type II (PCV2), which contains sequence of nucleic acid, coding protein Rep of porcine circovirus of type 1 (PCV1). Chimeric molecule of nucleic acid is constructed by replacement of gene Rep ORF1 PCV2 with gene Rep ORF1 PCV1. Invention also includes biologically functional plasmid or viral vector, which contain unique molecules of chimeric nucleic acids, suitable host cells, transformed by plasmid or vector, infectious chimeric porcine circoviruses, which produce suitable host cells, method of obtaining immunogenic polypeptide product with application of novel chimera, viral vaccines, protecting pig against viral infection or syndrome of postweaning multisystem wasting syndrome (PMWS), caused by PCV2, methods of protecting pigs against viral infection or postweaning multisystem wasting syndrome (PMWS), caused by PCV2, methods of obtaining unique chimera PCV2Gen-1Rep and the like. Invention can be applied in veterinary.

EFFECT: invention additionally includes novel method of increasing level of replication and PCV2 titre in cell culture.

21 cl, 2 dwg, 6 ex

 

Cross-reference to related applications

This application claims priority under 35 U.S.C. § 119(e) of the provisional application U.S. No. 61/124383 filed April 16, 2008. Earlier application is incorporated herein by reference in full.

Background of the invention

The scope of the invention

The present invention relates to unique the chimeric swine circovirus (PCV2Gen-1Rep), in which the sequence of a nucleic acid encoding a protein of PCV1 Rep is inserted into the genomic frame PCV2, and its use as an antigen in the new killed (inactivated) or attenuated chimeric vaccine to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by PCV2.

Description related field

All patents and publications cited in this description, enabled, thus, as a reference in full.

The swine circovirus type 1 (PCV1) was originally identified in 1974 as an impurity, is constantly present in the cell line PK-15 ATCC CCL-33 (I. Tischeret al., "Characterization of papovavirus - and picornavirus-like particles in permanent pig kidney cell lines", Zentralbl. Bakteriol. Hyg. Otg. A. 226(2):153-167 (1974)). After his identity was determined that PCV1 is a common virus of pigs, which does not cause them any disease (G. M. Allanet al., "Pahogenesis of porcine circovirus; experimental infections of colostrum deprived piglets and examination of pig foetal material", Vet. Environ. 44:49-64 (1995); G. C. Dulac and A. By, "Porcine circovirus antigens in PK-15 cell line (ATCC CCL-33) and evidence of antibodies to circovirus in Canadian pigs", Can. J. Vet. Res. 53:431-433 (1989); S. Edwards and J. J. Sands, "Evidence of circovirus infection in British pigs", Vet. Rec. 134:680-681 (1994); I. Tischeret al., Studies on epidemiology and pathogenicity of porcine circovirus", Arch. Virol. 91:271-276 (1986)). While PCV1 does not cause pigs of any disease, was later determined that the swine circovirus type 2 is pathogenic. In 1991, in Canada, in pigs for the first time discovered a variant strain of PCV, designated as the swine circovirus type 2 (PCV2) and found that it is associated with Multisystem syndrome paleochannel depletion (PMWS) (G. M. Allanet al., "Isolation of porcine circovirus-like viruses from pigs with a wasting disease in the USA and Europe", J. Vet. Diagn. Invest. 10:3-10 (1998); I. Morozovet al., "Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome", J. Clin. Environ. 36:2535-2541 (1998)).

PCV1 and PCV2 have genomic organization with two main open reading frames (ORFS): ORF1 encodes the viral Rep protein included in viral replication, and ORF2 encodes the viral capsid protein. In General, PCV1 and PCV2 in its full genome have 68-76% identity to the nucleotide sequence, whereas the strains within each genotype are more than 90% identity (A.K. Cheung, "The essential and nonessential reduced units for viral protein synthesis and DNA replication of porcine circovirus type 2", Virology 313:452-9 (2003)). PCV1 and PCV2 similar genomic organization with two main open reading frames (ORF) (A.K. Cheung, "Identification of the essential and non-essential reduced units for protein synthesis, DNA replication and infectious virus production of porcine circovirus type 1", Arch. Virol. 149(5):975-88 (2004); A. K. Cheung, "Transcriptional analysis of porcine circovirus type 2", Virology 305(1):168-180 (2003); A. Mankertzet al., "Identification of a protein essential for replication of porcine circovirus", J. Gen. Virol. 79(Pt 2):381-384 (1998); P. Nawagitgulet al., "Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein", J. Gen. Virol. 81:2281-2287 (2000)). In both virus ORF1 is responsible for viral replication and undergoes alternative splicing to education 2 basic functional proteins, Rep and Rep' (A.K. Cheung, "Identification of the essential and non-essential reduced units for protein synthesis, DNA replication and infectious virus production of porcine circovirus type 1", Arch. Virol. 149(5):975-88 (2004); A. K. Cheung, "Transcriptional analysis of porcine circovirus type 2", Virology 305(1):168-180 (2003); A. Mankertz and B. Hillenbrand, "Replication of porcine circovirus type 1 requires two proteins encoded by the viral rep gene", Virology 279:429-38 (2001); A. Mankertzet al., "Identification of a protein essential for replication of porcine circovirus", J. Gen. Virol. 79(Pt 2):381-384 (1998); A. Mankertzet al., "Mapping and characterization of the origin of DNA replication of porcine circovirus", J. Virol. 71:2562-6 (1997)). ORF1 highly conservative, with about 83% identity of nucleotide sequences and 86% identity of amino acid sequences between PCV1 and PCV2 (I. Morozovet al., "Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome", J. Clin. Environ. 36:2535-2541 (1998)). In both virus ORF2 encodes immunogenic viral capsid protein (P. Nawagitgulet al., "Open reading frame 2 of porcine circovirus type 2 encodes a major capsid protein", J. Gen. Virol. 81:2281-2287 (2000)), and is more variable than protein Rep, about 67% identity of nucleotide sequences and 65% identity of amino acid sequences between PCV1 and PCV2 (I. Morozovet al., "Detection of a novel strain of porcine circovirus in pigs with postweaning multisystemic wasting syndrome", J. Clin. Environ. 36:2535-2541 (1998)). Recently in PCV2, but not in PCV1, found a third ORF, ORF3 and reportedly, she is involved in apoptosis (J. Liuet al., "Characterization of a previously unidentified viral protein in porcine circovirus type 2-infected cells and its role in virus-induced apoptosis", J. Virol. 79:8262-74 (2005)).

Previously, in U.S. patent No. 7279166 B2, U.S. patent No. 7276353 B2, M. Fenauxet al., "A chimeric porcine circovirus (PCV) with the immunogenic capsid gene of the pathogenic PCV type 2 (PCV2) cloned into the genomic backbone of the nonpathogenic PCV1 dosage protective immunity against PCV2 infection in pigs", J. Virol. 78:6297-303 (2004) and M. Fenauxet al., "Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCVI in weanling pigs", J. Virol. 77:11232-243 (2003) described the construction of the chimeric virus, designated PCV1-2, in which PCV2 ORF clone in the frame of the PCV1 genome. In publications describe a permutation of the gene ORF2 capsid, including intergenic sequences of PCV2 in PCV1, instead of ORF2, and additionally describe infectious reciprocal chimeric molecule of nucleic acid PCV2-1, containing a nucleic acid molecule encoding a PCV2, which has, instead of the ORF2 gene of pathogenic molecules PCV2 nucleic acid, gene immunogenic ORF2 product of Nepal is ogandaga PCV1. While chimeric molecule PCV1-2 was provided by the natural property of avirulence, reciprocal chimeric molecule of nucleic acid PCV2-1, which received only as an experimental model, without any commercial advantages over the parent PCV2, except for research purposes, to compare viral characteristics with PCV1, retain virulence. None of the above patents or articles does not open or enables the creation of any other reciprocal chimeric viruses using genomic frame pathogenic PCV2 and certainly none involves the replacement of alternative open reading frames, other than specified and described gene immunogenic ORF2 capsid.

Additionally, chimeric PCV1 virus-2 is replicated to the characteristics of the title, similar to the indicators of PCV2 titer in cells, PK-15 (M. Fenauxet al., "Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs", J. Virol. 77:11232-243 (2003)). On the other hand, PCV1 is better adapted for growth in cells, PK-15 and the PCV1 virus, adapted to the culture of cells, PK-15, grows better than PCV2, replication, at least approximately titer of 1-log greater than PCV2 titer in cells, PK-15 (M. Fenauxet al., "Two amino acid mutations in the capsid protein of type 2 porcine circovirus (PCV2) enhanced PCV2 replication in vitro and attenuated virusin vivo", J. Virol. 78:13440-6 (2004); M. Fenauxet al., "Immunogenicity and pathogenicity of chimeric infectious DNA clones of pathogenic porcine circovirus type 2 (PCV2) and nonpathogenic PCV1 in weanling pigs", J. Virol. 77:11232-243 (2003)). This enhanced ability to PCV1 replication in cells, PK-15 is probably a consequence of the fact that PCV1 source was isolated from the cell line PK-15 as an impurity, is constantly present in the cell culture PCV1 and, thus, adapted to growth in cells, PK-15. However, the strains of the pathogenic PCV2 not have the ability to replicate similar PCV1 that, due to the relatively low titer of the pathogen in cells, PK-15, creates a major problem associated with receipt of the vaccine on the basis of PCV2. Thus, achieving effective acquisition of vaccines based on PCV2, such as inactivated whole PCV2, from the avirulent nature of chimeric PCV 1-2 (based on genomic frame whose source is PCV1), recombinant capsid proteins PCV2, etc. is the main problem and challenge for the industrial production of vaccines.

Previously, in the study of intergenic sequences in PCV2, PCV2 was detected sequence (GAAANNGAAA), similar to item response stimulated by interferon-α (ISRE), which can activate transcription of a gene in response to IFN-α, similarly known in the field of activity of the ISRE element (J.E. Darnell, Jr.,et al., "Jak-STAT pathways and transcriptional activation in response to IFNs and other increasing interest among signalig proteins", Science 264:1415-21 (1994)). It is shown that the herpes virus associated with Kaposi's sarcoma, expressed viral genes that interact with the encoded virus sequence that is similar to the ISRE, which is responsible for activating viral gene (J. Zhang, "Kaposi's sarcoma-associated herpesvirus/human herpesvirus 8 replication and reduced activator regulates viral and cellular genes via interferon-stimulated response elements," J. Virol. 79:5640-52 (2005)). Meertset al. have recently shown that cells of the kidneys of the pig (PK-15), and monocytic cells pigs (3D4/31), treated with IFN-α, after PCV2 inoculation contained an increased number of infected cells, up to 529% and 308%, respectively (P. Meertset al., "Enhancement of porcine circovirus 2 replication in porcine cell lines by IFN-gamma before and after treatment and by IFN-alpha after treatment", J. Interferon Cytokine Res 25(11):684-93 (November 2005)). It is noteworthy that cells PK-15 treated with IFN-α to inoculation of PCV2, had reduced the number of infected cells (69%) (id.). In addition to IFN-α, as in the cells of PK-15 and in cells 3D4/31 also evaluated the effect of IFN-γ on PCV2 infection. Revealed that the treatment of IFN-γ after infection with PCV2 resulted in a greater number of infected cells in the cells, PK-15, 691%, and the addition of IFN-γ to PCV2 inoculation increased the number of cells positive for PCV2 antigen, 706% in cells 3D4/31 due to enhanced internalization of the virus into cells (id.). It is possible that the factor transcri the tion, responsive to the action of IFN-γ present in the promoter region sequence PCV2, but, at the moment, all this is speculation and has not yet been proven. Many viruses do not only react to the action of IFN, but also control the expression of IFN through a number of transcription signal transduction pathways, in order to avoid response cellular response to IFN (S. Goodbourn, "Interferons: cell signalling, immune modulation, antiviral response and virus countermeasures", J. Gen. Virol. 81:2341-64 (2000)). The combined effect of IFN-α and IFN-γ for the infection of cell cultures with virus PCV2 and part of a sequence that is similar to the ISRE, in the regulation of responses to IFN-α and IFN-γ has not yet been studied. However, as shown by previous research, adding interferon to stimulate growth PCV2 resulted in contradictory results. Because interferon can be given to pigs, interest would be the approximate level of dose based on interferon finished product PCV2, because interferon can cause adverse reactions and side effects, specifically, to harm the liver. It would be more desirable to strengthen the ability to replicate the PCV2 using natural ingredients that you can enter the pigs without harm to their health.

Thus, there is a problem known in the field associated with insufficient quantities of antigen production is in the production of vaccines on the basis of PCV2, the present invention solves the problem by developing new Chimera on the basis of swine circovirus, which allows to significantly improve the low titer and replicative ability of the virus that allows the production of chimeric vaccines larger than obtained previously by the parties.

Thus, an important aim of the present invention is the provision of a unique combination of PCV1 and PCV2, which preserves, to call a sufficient immune response, antigenic property of the pathogenic PCV2, but reaches, innovative way, excellent properties of rising titer of PCV1.

An additional important objective of the present invention is the creation of enhanced product - chimeric vaccine based on PCV2, to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by PCV2, where the improvement includes enhanced, compared with the parent PCV2 replication.

Additional objectives of the present invention will be clear as the description.

The objectives mentioned above, reach, creating a new chimeric PCV2 virus containing the gene of PCV1 Rep in genomic frame PCV2, as described in this document.

The invention

The present invention relates to unique the chimeric swine circovirus, in which the sequence of nuclei the OIC acid, protein-coding or replication protein Rep swine circovirus type 1 (PCV1)is inserted into the genomic frame of swine circovirus type 2 (PCV2). The most preferred embodiment of the invention relates to the design of chimeras PCV2Gen-1Rep, in which the Rep gene open reading frame 1 (ORF1) of PCV1 virus replaces gene ORF1 Rep in PCV2 in genomic frame PCV2. The invention also relates to biologically functional plasmids, viral vectors, etc. that contain new chimeric nucleic acid molecules described herein, a suitable cell host, transfetsirovannyh plasmids or vectors containing chimeric DNA and methods for producing chimeric structures. Additionally, the scope of the present invention include an attenuated or inactivated vaccines containing, for example, chimeric DNA, a plasmid containing a chimeric DNA chimeric virus, etc. and new ways of protecting pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by PCV2, where the methods include the introduction of the pig that needs such protection immunologically effective amount of attenuated or inactivated vaccines. Unexpectedly and helpful, the chimeric swine circovirus according to this invention provides significantly elevated levels of replication and title, regarding parents is skogo virus PCV2 and thus, an additional variant embodiment of the invention is used for a new way to increase the levels of replication of PCV2 titer in cell culture.

Brief description of drawings

Background of the invention and its contrast to the prior art will be further described herein below, with reference to the accompanying drawings, where:

Figure 1 shows that the clone chimeric DNA SDM-C6 (with the gene of PCV1 Rep, cloned in frame of PCV2 genome is infectious when transfection in cells, PK-15. Panels A and A are illustrated cells, PK-15, transfetsirovannyh forming concatemer chimeric genome SDM-C6; panels B and b is illustrated cells, PK-15, transfetsirovannyh one copy of the linearized chimeric genome SDM-C6; and on panels C and c as negative controls illustrated reagents for transfection and MEM. On the left panel presents the results of the IFA, obtained by staining with monoclonal antibody to the product PCV2 ORF2; whereas the right panel presents the monolayers of cells, PK-15, superimposed on the results of the IFA.

Figure 2 illustrates the characterization of the growth of the PCV1 virus (♦), PCV2 (■) and chimeric SDM-C6 (Δ) cells, PK-15 through single-stage growth curve. Cells, PK-15 in 6-12-hole tablets were inoculable, duplication, each of the viruses from the calculation of the multiplicity, and then is 0,1. Infected cells of the two duplicated wells were collected every 12 hours and by the IFA has determined the titers of viruses.

Detailed description of the invention

According to the present invention, to create a unique molecule chimeric infectious nucleic acids of swine circovirus (PCV2Gen-1Rep), live chimeric viruses derived from the chimeric molecule of nucleic acid and veterinary vaccine to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by swine circovirus type 2 (PCV2). Specifically, the invention relates to the design and characterization of the chimeric nucleic acid molecule of swine circovirus (PCV2Gen-1Rep)in vitroin which the nucleic acid molecule, which encodes PCV2, contains a nucleic acid sequence encoding a replication protein (Rep) of swine circovirus type 1 (PCV1). For the purposes of incorporation of the nucleic acid molecules in PCV2, the sequence of a nucleic acid encoding a Rep protein may represent one or more functional nucleotide sequences that encode one or more proteins of replication, which are necessary for viral replication non-pathogenic strain of swine circovirus. It is desirable to use the full gene open reading frame (ORF), which is th encodes the protein of PCV1 Rep and it is preferable to use gene ORF1 Rep PCV1 for inclusion in genomic frame PCV2. For optimum properties of the chimeras even more preferably, the gene ORF1 Rep in PCV1 has taken the place of the open reading frame PCV2-specific, gene ORF1 Rep in PCV2 in genomic frame PCV2.

Another variant of implementation of the present invention includes a new method of producing chimeric molecule of nucleic acid PCV2Gen-1Rep, as described herein, which includes the following stages:

(a) removing from a nucleic acid molecule that encodes a PCV1, nucleic acid sequence which encodes a Rep protein;

(b) embedding in a nucleic acid molecule that encodes a PCV2, nucleic acid sequence which encodes a Rep protein PCV 1; and

(c) isolation of the chimeric nucleic acid molecule.

The method can be modified as useful for constructing variants of chimeric virus of the present invention, where stage (a) may include the removal of nucleic acid sequence containing the gene open reading frame (ORF)that encodes a protein of PCV1 Rep or, more specifically, to enable the removal of nucleic acid sequence containing a gene ORF1 Rep in PCV1. As an alternative implementation of this invention, step (b) may further comprise removing the ORF1 gene of PCV2 and PEFC is blowing embedding nucleic acid sequence, containing the gene ORF1 Rep from PCV1 in the plot ORF1 gene in a nucleic acid molecule that encodes a PCV2.

New the chimeric swine circovirus according to this invention is preferably designed in such a way as to ensure the ability of the virus to significantly enhanced replication and elevated, compared with the parent virus, PCV2, titles. Typical Chimera design below, in the examples of the present invention and refer to "SDM-C6". Sample chimeric virus SDM-C6 is infectiousin vitrowhen transfection of cells, PK-15, which shows that the Rep gene is interchangeable between PCV1 and PCV2.

The characteristic of chimeric virus SDM-C6 - reinforced describe growth through single-stage growth curve, which allows you to compare the growth characteristics of chimeric virus and virus wild-type PCV1 and PCV2. Surprisingly, the results show that in cell cultures, virus-Chimera is replicated on 1-log higher and more effective than its parent virus PCV2. Although chimeric virus replicates to the same title, and non-pathogenic PCV1, further research is unexpectedly showed that transfection (i.e. infection or inoculation) cells, PK-15, chimeric PCV2Gen-1Rep according to the invention is replicated with greater speed than both of its parent virus PCV1 and PCV2.

Because this was problematic growing CV2 to a higher titer, necessary for the proper production of vaccines in industrial scale - where even the increase in titer of 1-log consider important - the present invention provides a significant progress in the field of veterinary medicine that is important for the development of vaccines based on PCV2. Although the difference 1-log may not be significant for other viruses, the increase in titer of 1-log for PCV2 is of great importance in the production of vaccines on the basis of PCV2, i.e. higher titers will lead to a decrease in the volume of vaccine per dose, which will increase the efficiency of the finished product and the efficiency of the entire production process. Preferably, the application of a new chimeras PCV2Gen-1Rep the present invention relates to the process of obtaining vaccines on the basis of PCV2, significantly superior than could be achieved previously in the past. Also, because the Chimera PCV2Gen-1Rep uniquely based on genomic frame originating from PCV2, this leads to the presence of the magnificent antigenic substance in a vaccine to protect pigs against viral infection or PMWS caused by PCV2, due to the presence, within chimeric constructs, gene immunogenic ORF2 capsid PCV2, which is important for invoking an immune response in inoculated pigs.

One of the biggest differences that distinguishes chimeric virus SDM-C6 according to the present invention from chimeric Viru is and PCV 1-2, previously described in U.S. patent No. 7279166 B2 and # 7276353 B2 are the nucleic acid sequence: genomic sequence of the chimeric virus PCV2Gen-1Rep according to the present invention (SDM-C6) comes from a pathogenic PCV2, as previously described chimeric virus PCV 1-2 comes from the non-pathogenic PCV1. In the published literature that the intergenic sequence between genes Cap and Rep two viruses (PCV1 and PCV2) can play an important role in regulating the replication of PCV (A. K. Cheung, "Detection of rampant nucleotide reversion at the origin of DNA replication of porcine circovirus type 1", Virology 333:22-30 (2005); A. K. Cheung, "Identification of an octanucleotide motif sequence essential for viral protein, DNA, and progeny virus biosynthesis at the origin of DNA replication of porcine circovirus type 2", Virology 324:28-36 (2004); A. Mankertz et al., "New reporter gene-based replication assay reveals exchangeability of replication factors of porcine circovirus types 1 and 2", J. Virol. 77:9885-93 (2003)). As the transformation strain of PCV2 is the introduction to the location of the Rep gene in the DNA sequence of PCV2 Rep gene of PCV1, with the aim of constructing chimeric virus SDM-C6, we can assume that the Rep gene of PCV1 can increase the ability to replicate. However, up until really will not create the design and test it in the research aimed at studying the growth, such assumptions will be just a guess, specifically due to the fact that non-pathogenic and pathogenic PCV1 PCV2 in their full genomes have only 68-76 homology of the nucleotide sequence. The gene of PCV1 Rep may not be broadcast in the functional codes of PCV2 genome or to provide the best ability to replicate within another nucleotide sequence that encodes a PCV2. Thus, the current observation in relation to the present invention that the chimeric virus SDM-C6 replicated to the same title that PCV1 is an unexpected result. As another unexpected properties, the virus SDM-C6 also replicated faster than both the parental strain PCV1 and PCV2, which shows that the mechanism's ability to enhanced replication of the chimeric virus PCV2Gen-1Rep the present invention yet to be determined.

Previous message about enabling gene of PCV1 Rep within genomic frame pathogenic PCV2 and getting infectious pathogen with properties for enhanced compared to both parental strains, replication, as described herein, up to this time was not. Because of the ability to enhanced replication of a new chimeric virus PCV2Gen-1Rep, an additional variant embodiment of the invention relates thus to a new way of enhancing replication of PCV2 titer in cell culture, where the method comprises the following stages:

(a) constructing chimeric virus PCV2Gen-1Rep, in which the gene Rep PCV2 ORF1 replace gene ORF1 Rep PCV1;

(b) inoculation of a suitable cell line is a Chimera PCV2Gen-1Rep;

(c) culturing chimeras PCV2Gen-1Rep in a suitable medium for the cultivation of the virus in the standard conditions for a sufficient amount of time for the induction of viral products; and

(d) isolation of the chimeric virus.

In the method above examples of suitable cell lines would be a cell line kidney pig without pork antigen (cells, PK-15), cell line pig testes (ST) and similar cell lines, providing a growing circoviruses pigs or adapted specifically for growing circoviruses pigs.

Also included in the scope of the present invention are biologically functional plasmids, viral vectors, etc. that contain new chimeric nucleic acid molecules described herein, a suitable cell host, transfetsirovannyh these plasmids or vectors and live the chimeric swine circovirus produced by cells of the host. The invention additionally encompasses a method of obtaining immunogenic polypeptide product, which includes the cultivation, in a suitable medium, prokaryotic or eukaryotic host cells, transfected with the chimeric nucleic acid molecule of swine circovirus (PCV2Gen-1Rep), as described herein, by the way, ensuring the expression of the specified polypep the underwater product and secretion of the desired polypeptide product of the expression of the chimeric molecule.

Suitable attenuated or inactivated (i.e. killed) vaccines chimeric viral molecules and DNA molecules and methods for their use are also included in the scope of the present invention. Inoculated pigs protect from severe viral infection and PMWS caused by PCV2. A new way protects pigs need protection from viral infection or PMWS, through the introduction of the pig immunologically effective amount of the vaccine according to the invention, such as, for example, the vaccine containing the immunogenic amount of a chimeric DNA sequence that encodes a PCV2Gen-1Rep, the cloned virus is a Chimera, a plasmid or viral vector containing a chimeric DNA molecules, recombinant DNA sequence PCV2Gen-1Rep etc. Other antigens, such as PRRSV, PPV, other infectious and immune-boosting tools for pigs, you can give a pig at the same time, to provide broad-spectrum protection against viral infections.

Vaccines include, for example, the chimeric molecule of nucleic acid PCV2Gen-1Rep cloned chimeric gene in suitable plasmids or vectors, such as, for example, the vector pSK killed (inactivated) or attenuated chimeric virus, etc. in combination with a nontoxic, physiologically acceptable carrier and, optionally, one or more standard adjuvants. Preferably, the vaccine is the quality of the antigen used killed chimeric virus.

Adjuvant, which can be introduced in combination with the vaccine of the present invention, is a tool that enhances the immune response of pigs in response to the introduction of the vaccine. Adjuvant can be entered at the same time and in the same place as the vaccine, or at another time, for example, in the form of booster injections. Mainly, adjuvants, you can also enter the pig is a way of doing or the place of administration different from the method or place of introduction of the vaccine. Suitable adjuvants known to experts in the field of veterinary medicine, include as non-limiting examples of aluminum hydroxide (alum), immunostimulating complexes (ISCOMS), non-ionic block polymers or copolymers, cytokines (such as IL-1, IL-2, IL-7, IFN-α, IFN-β, IFN-γ, etc.), saponins, monophosphoryl lipid A (MLA), muramyl-dipeptide (MDP), etc. Other suitable adjuvants include, for example, aluminum sulfate, potassium, thermo-labile or heat-stable enterotoxin isolated fromEscherichia coli, cholera toxin or subunit B, diphtheria toxin, tetanus toxin, pertussis toxin, part-time or full beta-blockers, etc. Adjuvants based on toxins, such as diphtheria toxin, tetanus toxin and pertussis toxin can be inactivated before use, for example, by treatment with formaldehyde.

The vaccine can further comprise additional Antiga is s to enhance the immunological activity of chimeric virus or DNA of the present invention, such antigens such as virus reproductive and respiratory syndrome swine (PRRSV), swine parvovirus (PPV), other infectious funds and Immunostimulants for pigs.

New vaccines according to this invention is not limited to any particular form or method of obtaining. Vaccines from cloned virus include as non-limiting examples of vaccines based on the infectious DNA (i.e. with the use of plasmids, vectors or other traditional media for direct introduction of DNA pigs), attenuated vaccine, inactivated (killed) vaccine, the vaccine created by means of genetic engineering, etc. Vaccines get accepted, well-known in this field means.

As antigenic agent in the vaccine according to this invention is based on the pathogenic PCV2 strain, the active tool must first be attenuative or inactivated suitable method known in this field. To obtain vaccines based on inactivated virus, for example, carry out the cultivation of the virus from the infectious clone DNA by methods known or described herein. Then optimize sequential inactivation of the virus by the protocols, as a rule, well-known experts in this field.

Inactivated viral vaccines can floor the AMB, processing of chimeric virus derived from cloned DNA, inactivating means, such as formalin or hydrophobic solvents, acids, etc. by irradiation with ultraviolet light or x-rays, heat, etc. Inactivation carried out by the method known in this field. For example, in chemical inactivation, suitable viral sample or a serum sample containing the virus is usually treated for a sufficient period of time sufficient quantity or concentration of the inactivating means at a sufficiently high temperature or pH, for inactivation of the virus (or low, depending on the inactivating means). Inactivation by heating, as a rule, carried out at a temperature and for a period of time sufficient to inactivate the virus. Inaktivirovanie irradiation is often performed using light with a specific wavelength or other source of energy during a period of time sufficient to inactivate the virus. As a rule, the term "inactivated", "dead" or "dead" are used interchangeably in relation to viral vaccines to refer to vaccines containing viruses are inactivated. The virus is considered as a vaccine, if it is not capable of infecting the cells susceptible to infection.

the La receiving attenuated vaccines of pathogenic clones, tissue culture-adapted, live, pathogenic PCV2Gen-1Rep first Attenborough (transferred to non-pathogenic or harmless state) by methods known in this field, as a rule, through serial passages in cell cultures. Attenboroughii pathogenic clones can also be performed using deletions of genes or mutations in viral genes.

Additionally, it is possible to determine the nucleotide sequences in the viral genome responsible for virulence, and genetic engineering avirulent virus by, for example, site-specific mutagenesis. When site-specific mutagenesis possible insertion, deletion or substitution of one or more nucleotides (see, for example, Zolleret al., DNA 3:479-488, 1984). Synthesize oligonucleotide containing the desired mutation, and are annealed with a plot of single-stranded viral DNA. A hybrid molecule that is formed by this method is used for transformation of bacteria. Then the selected double-stranded DNA containing a suitable mutation, is used to produce full-length DNA by ligating with the last restriction fragment, then transferout in a suitable cell culture. Ligation of the genome into a suitable vector for transfer can be performed by any standard method, swetnam specialists in this field. Transfection of the vector into the cells-the hosts for the production of viral generation can be performed using any conservative methods, such as transfection mediated by calcium-phosphate method or mediated by DEAE-dextran, electroporation, fusion of protoplasts, and other well-known methods (for example, Sambrooket al., "Molecular Cloning: A Laboratory Manual", Cold Spring Harbor Laboratory Press, 1989). The cloned virus then shows the desired mutation. Alternatively, it is possible to synthesize two of the oligonucleotide, which contains a suitable mutation. They can be subjected to annealing with the formation of double-stranded DNA that can be embedded in the viral DNA to obtain the full-length DNA.

Cell line insect (like HI-FIVE) can be transformed vector to transfer containing molecules of nucleic acid derived from a virus or replicated viral genome that encodes one or more immunodominant proteins of the virus. Vector for transferring includes, for example, linearized baculovirus DNA and a plasmid containing immunogenic polynucleotide. To generate recombinant baculovirus cell line host can be subjected to joint transfection with linearized baculovirus DNA and the plasmid. Alternatively, live vectors, such as poxvirus or adenovirus, you can use the ü as a vaccine in combination with Chimera according to the invention.

Immunologically effective amount of the vaccine of the present invention is administered to the pig that needs to be protected from viral infection or PMWS. Immunologically effective amount or an immunogenic amount that inoculant pig, you can easily determine or praticality through conventional testing. The effective amount is the amount at which with the introduction of the vaccine reaches immune response sufficient to protect pigs exposed to the virus that causes PMWS. Preferably, the pig protect to the extent in which from one to all adverse physiological symptoms or effects of a viral disease significantly reduce, improves or completely prevent their occurrence.

The vaccine can be administered as a single dose or multiple doses. The dosage may vary, for example, from about 1 micrograms to about 1000 micrograms of DNA plasmid containing the genome of infectious chimeric DNA (depending on the concentrations of immunoactive tools vaccines), preferably from 100 to 200 micrograms clone chimeric DNA PCV2Gen-1Rep. Methods for determining or titration of suitable dosages of the active antigenic means to determine the minimum effective dose, depending on the weight of the pig, is concentratie antigen and other typical factors known in this field.

Preferably, the vaccine is administered to the pig, which had not been exposed to the virus PCV. A vaccine containing antigenic tool, you can conveniently enter intranasal, transdermal (i.e. applied to the skin surface or in the surface of the skin for systemic absorption), parenteral, etc. Parenteral administration includes, as non-limiting examples, intramuscular, intravenous, intraperitoneal, intradermal (i.e. injected or introduced under the skin in another way), subcutaneous methods, etc. as intramuscular and intradermal route of inoculation successful in other studies, using clones of viral infectious DNA (E.E. Spargeret al., Infection of cats by injection with DNA of feline immunodeficiency virus molecular clone", Virology 238:157-160 (1997); L. Willemset al., "In vivo transfection of bovine leukemia provirus into sheep", Virology 189:775-777 (1992)), this route of administration is preferable, in addition to practical intranasal route of administration. Although less convenient, also suggest that the vaccine is administered to the pig through vnutripoliticheskoi method of inoculation.

With the introduction of liquid, this vaccine can be obtained in the form of an aqueous solution, syrup, elixir, extract, etc. Such compositions are known in this field and, as a rule, obtained by dissolution of the antigen and other typical who's adjuvants in suitable systems carrier or solvent. Suitable carriers or diluents include, as non-limiting examples, water, saline, ethanol, ethylene glycol, glycerol, etc. Typical auxiliary means are, for example, certified colors, flavors, sweeteners and antimicrobial preservatives, such as thimerosal (utilitysimilar sodium). Such solutions can be stabilized, for example, the addition of partially hydrolyzed gelatin, sorbitol or cell media for culturing and you can buffer the conventional methods using reagents known in this field, such as secondary acidic sodium phosphate, monopotassium phosphate, secondary acid potassium phosphate, monopotassium phosphate, potassium, blend, etc.

Liquid formulations can also include suspensions and emulsions, which contain a suspension or emulsifiers in combination with other standard co-formulants. These kinds of liquid compositions can be obtained by traditional methods. Suspension, for example, can be obtained by using a colloidal mill. Emulsions, for example, can be obtained by using a homogenizer.

Parenteral formulations, designed for injection into the body of liquid systems require proper isotonicity and buffer capacity pH, corresponding to the levels in body fluids pig is. Isotonicity can appropriately be adjusted with sodium chloride and, as necessary, other salts. Suitable solvents, such as ethanol or propylene glycol, can be used to increase the solubility of the ingredients in the composition and stability of liquid drug. Additional supporting tools that can be used in the vaccine of the present invention, include, as non-limiting examples, dextrose, traditional antioxidants and chelating agents such as ethylenediaminetetraacetic acid (EDTA). Parenteral dosage forms prior to use must be sterilized.

The following examples illustrate some aspects of the present invention. However, it should be understood that these examples are presented for illustration only and does not imply full compliance with the terms and scope of this invention. It should be clear that when carrying out the reaction under standard conditions (e.g., temperature, reaction time and so on), it is also possible, although generally less convenient to use conditions and above and below the specified limits. The examples run at room temperature (approximately 23°C to about 28°C) and at atmospheric pressure. All share and percentages referred to herein are by weight, and the e values of the temperature expressed in degrees Celsius, if not stated otherwise.

Additional understanding of the invention can be achieved from the non-limiting examples of which are listed below.

Example 1

Construction of chimeric PCV2Gen-1Rep

Throughout the experimentsin vitrolisted below , used cells PK-15 without PCV. These cells have previously received through the end of breeding (M. Fenauxet al., "Cloned genomic DNA of type 2 porcine circovirus is infectious when injected directly into the liver and lymph nodes of pigs: characterization of clinical disease, virus distribution, and pathologic lesions", J. Virol. 76:541-51 (2002)). Construction of single copies of PCV2 and PCV1 and clones infectious DNA dimeric tandem repeat previously described (id.).

To construct chimeric PCV2Gen-1Rep gene ORF1 Rep from PCV1, the replacement gene ORF1 Rep PCV2 in the frame of the PCV2 genome (including intergenic sequence), a clone with a single copy of the genome of infectious PCV1 DNA in pBluescript II SK+vector amplified by PCR with primers PCV1REPF (5' CAACTGGCCAAGCAAGAAAAG 3' (which corresponds to SEQ ID NO:1)) and PCV1REPR (5' AACCATTACGATGTGATCAAAAAGACTCAGTAATTTATTTTATATGGGA AAAGGG 3' (which corresponds to SEQ ID NO:2)) to obtain a fragment of the gene PCV1Rep designed with the recognition sites of restriction enzymesBalIandBclIat both ends. PCR reaction containing 45 μl of Platinum PCR SuperMix High Fidelity (Invitrogen, Carlsbad, CA), 20 PM of primer PCV1REPR, 20 PM of primer PCV1REPF and 1 µl clone with a single copy infects the Onna PCV1 DNA. Reaction in thermal cycler consisted of initial denaturation for 2 min at 94°C and 35 cycles of denaturation at 94°C for 30 s, annealing at 55°C for 30 s and extension at 68°C for 30 s, followed a final incubation at 68°C for 7 min Fragment PCV1Rep were separated in the gel with 1% agarose and purified using the Geneclean kit II (Qbiogene, Irvine, CA). Fragment PCV1Rep then splitBalIandBclIseparate and fragment resulting from cleavage were separated in the gel with 1% agarose and purified using the Geneclean kit II.

The genomic fragment of the frame without PCV2 Rep gene amplified from clone PCV2 single copy of infectious DNA in pBluescript vector by PCR using the primers PCV2GENF (5' CTTTTTGATCACTTCGTAATGGTTTTTA 3' (which corresponds to SEQ ID NO:3)) and PCV2GENR (5' GCTTACCATGTTGCTGCTGAGGT 3' (which corresponds to SEQ ID NO:4)). The recognition sites of restriction enzymesBfrBIandBclIembedded in both ends of the fragment. The PCR reaction contained 20 PM primer PCV2GENF, 20 PM of primer PCV2GENR, 40 mm dNTP (Fisher Scientific, Pittsburgh, PA), 200 mm MgCl210 μl 10X buffer for PCR, 72 ál dH2O, 5 units of AmpliTaq (Applied Biosystems, Foster City, CA) and 1 µl clone PCV2 single copy of infectious DNA. Reaction in thermal cycler consisted of initial denaturation at 94°C for 10 min, 38 cycles of denaturation at 94°C for 1 min, annealing at 50°C for 1 min and extension at 72°C for 45 s, followed finished the second incubation at 72°C for 7 minutes The genomic fragment frame PCV2 (without Rep gene), fragment PCV2Gen, were separated in the gel with 1% agarose and purified using the Geneclean kit II. Fragment PCV2Gen then splitBfrBIandBclI, separately, were separated in the gel with 1% agarose and purified using the Geneclean kit II.

To create a clone PCV chimeric infectious DNA, performed ligation of fragments PCV1 Rep and PCV2Gen during the night, using the set for ligating DNA Stratagene (LaJolla, CA). Mixture for ligation was used to transform TOP 10 cells (Invitrogen), according to the Protocol of the manufacturer. Selected white colonies were cultured overnight and plasmids were isolated using the set of Sigma''s GenElute Plasmid Miniprep (St. Louis, MO). Plasmids were subjected to cleavage by the restriction enzymeKpnI and were separated in the gel with 1% agarose to determine the appropriate plasmids with 2 strips of about 1.7 TPN (PCV2Gen-1Rep) and 2.9 TPN (pBluescript II SK+vector).

Example 2

Testing the viability of the clone with chimeric DNA PCV2Gen-1Rep

Testing the viability of the clone with chimeric DNA PCV2Gen-1Rep was carried out by transfection of cells, PK-15. The restriction enzymeClonedused for cutting chimeric genome PCV2Gen-1Rep from pBluescript II SK+plasmid vector. Chimeric genome PCV2Gen-1Rep were separated in the gel with 1% agarose, purified using GeneClean II, and then carried out the formation of concatemers using T4 DNA ligase, using, basically, the previously described conventional methods (M. Fenauxet al., 2002, above). Cells, PK-15, with approximately 70% confluentes growth on object-glass Lab-Tek was transfusional concatenation genomic DNA PCV2Gen-1Rep using lipofectamine and Plus Reagent according to the manufacturer's Protocol (Invitrogen). Three days after transfection was performed by indirect immunofluorescence assay (IFA) using polyclonal antibodies specific for PCV2 ORF2, as described previously (id.), to determine the infective ability. For additional analysis of the infective ability of chimeric genome PCV2Gen-1Rep cells, PK-15 when 70% confluent growth in flasks T-25 was transfusional approximately 12 µg concatenation chimeric genome in a bottle, as described previously (id.). Viral strain was collected 3 days after transfection and was titrated by IFA with a polyclonal antibody specific for PCV2 ORF2, as described previously (id.).

Example 3

DNA sequencing to confirm the chimeric genome

Primers Rep830F (5' GGTGTCTTCTTCTGCGGTAACG 3' (which corresponds to SEQ ID NO:5)) and Rep830R (5' GTTCTACCCTCTTCCAAACCTTCC 3' (which corresponds to SEQ ID NO:6)) was used for amplification plot connection between the 3' fragment PCV2Gen and 5' fragment PCV1Rep. Primers Rep10F (5' GGAAGACTGCTGGAGAACAATCC 3' (which corresponds to SEQ ID NO:7)) and Rep10R (5' CGTTACTTCACACCCAAACCTG 3' (which corresponds to SEQ ID NO:8)) BL is arranged to amplify a section of the connection between the 5' fragment PCV1Rep and 3' fragment PCV2Gen. For amplified PCR products sequencing was performed for both chains.

Example 4

Site-specific mutagenesis

The initial clone chimeric DNA PCV2Gen-1Rep was not infectious, as transfitsirovannykh in cells, PK-15. After sequence analysis of chimeric genome, after the start codon ATG of the gene ORF1 Rep PCV1 has detected the insertion of 6 nucleotides (GTAAGC). To resolve this error and junk insertion, introduced by PCR and stages of cloning primers MVTF (5' CTCAGCAGCAACATGCCAAGCAAGAAAAGCGG 3' (which corresponds to SEQ ID NO:9)) and MVTR (5' CCGCTTTTCTTGCTTGGCATGTTGC TGCTGAG 3' (which corresponds to SEQ ID NO:10)) was used to remove the insertion of 6 nucleotides, using the set for site-specific mutagenesis QuikChange II (Stratagene). The TOP10 cells according to the Protocol of the manufacturer (Invitrogen) transformed with the product, subject to site-specific mutagenesis. White colonies were selected and cultured overnight. To clone SDM-C6 doing the sowing stroke on the tablet with LB agar containing ampicillin and grown overnight at 37°C. Four colonies were selected and cultured overnight. Of these plasmids were isolated and sequenced using primers Rep830F and Rep830R, in order to ensure that the 6 built-nucleotides removed from the chimeric genome.

Found that the insertion of 6 nucleotides (GTAAGC) provided there is no the of the infectivity of the chimeric clone, and the junk box was successfully removed by site-specific mutagenesis. After subsequent transfection into cells PK-15 found that the new chimeric clone, SDM-C6, is infectious.

Example 5

Getting viral strain ofIn Vitro

Characterization of chimeric virus

Viral strains PCV1 and PCV2 were obtained from infectious DNA clones PCV1 and PCV2, respectively, through transfection of cells, PK-15 in accordance with generally accepted methods described previously (M. Fenauxet al., 2002, above). Infectious titer for each virus strain was determined by IFA with an antibody specific to the product PCV2 ORF2 (id.)

Chimeric genome SDM-C6 containing the gene of PCV1 Rep in the frame of the PCV2 genome was excised from pBluescript II SK+plasmid using the restriction enzymeClonedand purified using the GeneClean kit II. Approximately 40 μg of chimeric genome SDM-C6 subjected concatemeric using T4 DNA ligase and used for transfection 4 bottles (10 μg per vial) cells, PK-15, with approximately 70% of confluences using lipofectamine and Plus Reagent as described previously (id.). Three days after transfection, the chimeric virus SDM-C6 collected through three freeze and thaw transfected cells and infectious titer recombinant virus strain SDM-C6 was determined by IFA with a monoclonal antibody to the product is the PCV2 ORF2 (Rural Technologies Inc., Brookings, SD) at a dilution of 1:1000 in phosphate-buffered saline (10X, pH of 7.4) (Invitrogen). Viral strain SDM-C6 possessed excellent viral infectious titer of 0.5×105,5TCID50/ml. Cells, PK-15, transfetsirovannyh as concatenation and linearized genome SDM-C6, was clearly positive in IFA (figure 1), which proves that the chimeric gene SDM-C6 with the gene of PCV1 Rep, cloned in frame of PCV2 genome is infectiousin vitro.

Example 6

Single-stage growth curve

To describe the growth characteristics of chimeric virus and comparison with wild-type viruses PCV1 and PCV2, investigated single-stage growth curve. Cells, PK-15 were cultured in eight holes of six 12-well plates. Upon reaching approximately 70% of confluently, each well was washed with 2 ml of MEM. Each of the eight holes in the second tablets were inoculable PCV1, PCV2 and SDM-C6 with a multiplicity of infection of 0.1 (MOI). After 1 hour of incubation, the inoculum was removed. Cell monolayers then washed three times each with 2 ml of PBS to remove any excess amount of viral supernatant. Two ml of MEM with 2% FBS and 1X antibiotic-antimycotic agent was added to each well and the tablets continuously incubated at 37°C with 5% CO2. In 0, 12, 24, 36, 48, 60, 72, 84 and 96 hours after inoculation (hpi), the cells in each well of each duplicated tablet is collected by scraping in the supernatant. The collected cells were frozen and thawed three times and stored at -80°C until titration. In each hpi was determined by infectious titer in the 8-hole cover glass Lab-Tek II (Nalge Nunc International, Rochester, NY)using serially diluted inoculum, followed by IFA with a monoclonal antibody to the product of ORF2 PCV2 using the method of Spearman-Karber (M. Fenauxet al., 2002, above).

The data showed that the chimeric virus SDM-C6 multiplied, just as the PCV1 virus (figure 2) to the value of the titer equal to 2.2×104,0TCID50/ml at 96 hpi, whereas PCV2 multiplied only up to 2,20×103,0TCID50/ml at 96 hpi. At 12 hpi, chimeric virus SDM-C6 multiplied to titer equal to 6.95×102,0TCID50/ml, whereas both virus PCV1 and PCV2 showed undetectable values of credits, which allows to conclude that the chimeric virus replicates faster than the parent virus. PCV1 had determined the titer of the virus in an 8.70×102,0TCID50/ml at 24 hpi, whereas PCV2 showed no evidence of the designated title until 48 hpi (to $ 7.91×101,0TCID50/ml). Thus, it showed that the chimeric virus SDM-C6 and the PCV1 virus to grow the same title, which represented a value of approximately 1-log higher than the titers of the parent virus PCV2.

Above we presented a detailed description of specific embodiments of the present invention for the purpose of illustration and not for limitation. is required to understand all other modifications, results and equivalents obvious to those who have professional knowledge in this field, based on this description, understood as included within the scope of the invention covered by the claims.

1. The chimeric molecule of nucleic acid circovirus pigs (PCV2Gen-1Rep) to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by swine circovirus type 2 (PCV2), or for the production of a viral vaccine to protect pigs against viral infection or PMWS caused by PCV2, containing a nucleic acid molecule encoding the swine circovirus type 2 (PCV2), which contains the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 1 (PCV1), which replaces the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 2 (PCV2), and insert GTAAGC removed, in case of its presence after the start codon ATG nucleic acid sequence that encodes a protein of PCV1 Rep.

2. The chimeric molecule of nucleic acid according to claim 1, in which the sequence of a nucleic acid encoding a Rep proteins PCV1 and PCV2, is a gene open reading frame (ORF).

3. The chimeric molecule of nucleic acid according to claim 2, in which the gene Rep ORF represents ORF1.

4. The plasmid and the viral vector to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS), caused by swine circovirus type 2 (PCV2), design PCV2Gen-1Rep or for the production of a viral vaccine to protect pigs against viral infection or PMWS caused by PCV2, where the vector contains a chimeric molecule of nucleic acid according to any one of claims 1 to 3.

5. A host cell to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by swine circovirus type 2 (PCV2), design PCV2Gen-1Rep or for the production of a viral vaccine to protect pigs against viral infection or PMWS caused by PCV2, where a host cell transliterowany a plasmid or vector according to claim 4.

6. The chimeric swine circovirus for the protection of pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by swine circovirus type 2 (PCV2) or for the production of a viral vaccine to protect pigs against viral infection or PMWS caused by PCV2, chimeric where the circovirus pigs produced by cells of the host according to claim 5.

7. The method of obtaining immunogenic polypeptide product encoded by the nucleic acid molecule according to any one of paragraphs. 1-3, including: cultivation, in a suitable medium, eukaryotic host cells, transfected with a chimeric molecule nucleic acid of swine circovirus according to any one of claims 1 to 3 by the way, ensuring the expression of the specified polyp is pignolo product, and secretion of the desired polypeptide product of the expression of the chimeric molecule.

8. Viral vaccine which protects a pig against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by PCV2, where the vaccine contains non-toxic, physiologically acceptable carrier and an immunogenic amount of a suitable attenuated or inactivated element selected from the group consisting of:
(a) the molecules of the chimeric nucleic acid of swine circovirus (PCV2Gen-1Rep)containing the nucleic acid molecule encoding the swine circovirus type 2 (PCV2), which contains the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 1 (PCV1), which replaces the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 2 (PCV2);
(b) plasmid or viral vector containing the chimeric molecule of nucleic acid circovirus pigs (PCV2Gen-1Rep), which contains a nucleic acid molecule encoding a PCV2, which contains the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 1 (PCV1), which replaces the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 2 (PCV2); and
(c) chimeric swine circovirus, based on the molecules of the chimeric nucleic acid of swine circovirus (PCV2Gn-1Rep), containing a nucleic acid molecule encoding a PCV2, which contains the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 1 (PCV1), which replaces the sequence of a nucleic acid encoding a Rep protein of swine circovirus type 2 (PCV2),
and insert GTAAGC removed, in case of its presence after the start codon ATG nucleic acid sequence that encodes a protein of PCV1 Rep, the molecules of the chimeric nucleic acid.

9. The vaccine of claim 8, where the chimeric molecule of nucleic acid contains a nucleic acid sequence encoding a protein Rep PCV1 and PCV2, which contains the gene open reading frame (ORF).

10. The vaccine according to claim 9, where the chimeric molecule of nucleic acid contains a gene ORF1 Rep PCV1.

11. The way to protect pigs against viral infection or syndrome Multisystem paleochannel depletion (PMWS)caused by PCV2, comprising the introduction of a pig that needs this immunologically effective amount of the vaccine according to any one of p-10.

12. The method according to claim 11, which includes the introduction of vaccines pig parenterally, intranasally, intradermally, or transdermal.

13. The method of obtaining the molecules of the chimeric nucleic acid PCV2Gen-1Rep according to claim 1, which includes the following stages:
(a) providing the nucleic acid molecule, which encodes PCV2;
(b) removal after which outermost nucleic acid, which encodes the Rep protein from a nucleic acid molecule that encodes a PCV2;
(c) the inclusion of a nucleic acid sequence which encodes a protein of PCV1 Rep in a nucleic acid molecule encoding a PCV2 to obtain the chimeric nucleic acid molecule PCV2Gen-1Rep;
(d) removing the insert GTAAGC, in case of its presence after the start codon ATG nucleic acid sequence that encodes a protein of PCV1 Rep;
(e) removing molecules of the chimeric nucleic acid.

14. The method according to item 13, where stage (b) includes removing nucleic acid sequence containing the gene open reading frame (ORF)that encodes a protein of PCV2 Rep.

15. The method according to 14, where the genome ORF, which encodes a protein of PCV2 Rep is Rep gene PCV2 ORF1.

16. The method according to 14, where stage (C) includes replacement remote nucleic acid sequence stage (b) the sequence of nucleic acid containing the gene ORF, which encodes a protein of PCV1 Rep.

17. The method according to clause 16, where the genome ORF, which encodes a protein of PCV1 Rep is Rep gene ORF1 PCV1.

18. The method according to 17, where the remote sequence nucleic acid stage (b) includes the gene open reading frame (ORF)that encodes a protein of PCV2 Rep.

19. The method according to p, where gene ORF, which encodes a protein of PCV2 Rep is Rep gene PCV2 ORF1.

20. The way to increase the levels of replication of PCV2 titer in eukaryotes the th cell culture which includes the following stages:
(a) constructing chimeric virus PCV2Gen-1Rep, in which the gene Rep PCV2 ORF1 replaced by gene ORF1 Rep PCV1;
(b) inoculation of a suitable cell line with Chimera PCV2Gen-1Rep;
(c) culturing chimeras PCV2Gen-1Rep in a suitable medium for the cultivation of viruses in standard conditions, within the number of time sufficient for the induction of viral products; and
(d) collection of chimeric virus.

21. The method according to claim 20, where appropriate cell line is a cell line kidney pig, not containing pork antigen (cells, PK-15), or cell line swine testis (ST).



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: pox virus of variolovaccine is proposed, which includes a defect F2L gene and a suicide gene. Pox virus has oncolytic activity. Besides, a reproduction method of such pox virus and its use for treatment of proliferative diseases or diseases with increased activity of osteoclasts is proposed.

EFFECT: improving compound application efficiency.

31 cl, 12 dwg, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: created is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype containing expressing cassette with haemagglutinin gene of influenza virus being included. As a haemagglutinin gene of influenza virus of B/Brisbane/60/2008 strain haemagglutinin gene with pre-optimised for expression in human being cells nucleotide sequence was used providing overexpression of haemagglutinin gene of influenza virus of B/Brisbane/60/2008 strain. Haemagglutinin gene of influenza virus of B/Brisbane/60/2008 strain with optimised nucleotide sequence was cloned in expressing cassette under promoter control and contains polyadenylation signal. Promoter is cytomegalovirus promoter, and polyadenylation signal is SV40. Expressing cassette is located in zone of E1 deletion of human being adenovirus genome of the 5-th serotype. Also method of use of recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype for induction of specific immunity to influenza virus B.

EFFECT: possibility of use in pharmaceutical industry for production of vaccine preparations.

6 cl, 9 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: characterised is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype and method of its use. Provided particle contains expressing cassette with haemagglutinin gene of influenza virus being included. As a haemagglutinin gene of influenza virus, haemagglutinin gene of A/Perth/16/2009(H3N2) strain with pre-optimised for expression in human being cells nucleotide sequence presented in SEQ ID NO:2. The specified haemagglutinin gene of influenza virus of A/Perth/16/2009(H3N2) strain is cloned in expressing cassette containing polyadenylation signal SV40 under control of cytomegalovirus promoter. Presented invention may be used for induction of specific immunity to influenza virus A of H3N2 subtype during injection in efficient quantity.

EFFECT: providing intense expression of recombinant haemagglutinin of the specified influenza virus.

6 cl, 9 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: characterised is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype and method of its use as a component for production of vaccine for influenza virus A of H1N1 subtype. Presented recombinant particle contains expressing cassette including SV40 polyadenylation signal and cytomegalovirus promoter with influenza virus haemagglutinin gene being included. As influenza virus haemagglutinin gene, haemagglutinin gene of strain A/California/07/2009(H1N1) is used with pre-optimised for expression in human being cells nucleotide sequence provided in SEQ NO:2. These inventions allow raising specific immunity to influenza virus A of H1N1 subtype by provision of overexpression of haemagglutinin gene of influenza virus A/California/07/2009(H1N1).

EFFECT: improvement of the method.

6 cl, 9 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: poxvirus includes defective gene I4L and/or F4L and target nucleic acid containing suicide gene. Besides, a composition containing such a poxvirus, its use for obtaining medical preparation and a treatment method of proliferative disease or disease with increased activity of osteoclasts with its application are described. The proposed group of inventions can be used in medicine.

EFFECT: poxvirus of variolovaccine has oncolytic activity.

34 cl, 18 dwg, 5 tbl

FIELD: medicine.

SUBSTANCE: there are presented two recombinant plasmid DNA pFastBac 1 -G2R-dSECRET and pQE-60-TNFR-CrmB-Ind-67 coding TNF-binding CrmB protein domain. Said recombinant plasmid DNA pQE-60-TNFR-CrmB-Ind-67 is designed for transformation in cells of the strain E.coli SG13009[pRep4] - a producer of TNF-binding CrmB BHO protein domain.

EFFECT: presented group of inventions is applicable for preparing drugs used in therapy of severe human diseases caused by hyperproduction of tumour necrosis factor and may be used in medicine.

3 cl, 3 dwg, 12 ex

FIELD: medicine.

SUBSTANCE: chimeric flavivirus contains at least one mutation in a coat protein of chimeric flavivirus, and one or more mutations in (i) 3'-untranslated region (3'-UTR) of a chimeric flavivirus genome and/or (ii) a capside protein of chimeric flavivirus.

EFFECT: chimeric flavivirus shows reduced viscerotropism as compared to mutation-free chimeric flavovirus; virus is completely attenuated.

32 cl, 8 dwg, 7 tbl

FIELD: chemistry.

SUBSTANCE: displayed polypeptides include at least one unnatural aryl-azide amino acid such as, for example, para-azido-L-phenylalanine, which is incorporated into the phage-displayed hybrid polypeptide at a selected position by using an in vivo orthogonal translation system comprising a suitable orthogonal aminoacyl-tRNA synthetase and a suitable orthogonal tRNA.

EFFECT: invention enables to modify protein in physiological conditions in which phage activity and survival is maintained.

19 cl, 16 dwg, 9 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, virology and veterinary. An attenuated recombinant classical swine fever virus (CSFV) is described. Modification is carried out by progressively mutating a portion of the E2 gene of the highly pathogenic strain Brescia. As a result, two to six amino acids on the section 829-837 are replaced with two to six amino acids which are characteristic for the heterologous E2 glycoprotein of the Bovine Viral Diarrhea Virus (BVDV). A classical swine fever vaccine is also obtained based on the obtained attenuated CSFV. The invention can be used in veterinary.

EFFECT: classical swine fever vaccine is obtained.

7 cl, 7 dwg, 4 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to biotechnology and genetic engineering. The method of producing a target virus or one or more target proteins different from adenovirus involves culturing an expression spinal cell and extracting the end product. The cell is a spinal cell containing a gene which is stably integrated into its genome, where said gene codes PIX adenovirus or its functional version, as heterologous regulatory protein. The cell stably expresses said regulatory protein or its functional version via a target virus which is not adenovirus or via a vector carrying nucleic acid sequences which code said virus or via a vector carrying nucleic acid sequences which code said one or more target proteins.

EFFECT: disclosed method enables to increase output of the end product.

24 cl, 18 dwg, 15 ex

Fused rage proteins // 2513695

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biochemistry. Claimed is fused protein for treating diseases, mediated by advanced glycation end products (AGE), consisting of a fragment of a version of human receptor of advanced glycation end products (RAGE), which has two point mutations H217R and R221H, and a fragment of constant domain of human immunoglobulin IgG4, joined with linker if necessary. In addition, considered are: nucleic acid and recombinant host cell for obtaining fused protein, as well as pharmaceutical composition for treatment of AGE-mediated diseases, which contain fused protein.

EFFECT: invention ensures lower aggregation of fused protein.

13 cl, 19 dwg, 3 ex, 9 tbl

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biotechnology, in particular to novel peptide analogue of insulin-like growth factor-1 (IGF-1), which contains amino acid substitution of methionine in position 59 on Asn, Leu, Nle, Ile, Arg, A6c, Glu, Trp or Tyr, as well as other additional substitutions, inserts and deletions. Said peptide or its pharmaceutically acceptable salt is used in composition of pharmaceutical composition for treatment of IGF-1-mediated diseases, as well as in method of treating dwarfism.

EFFECT: invention makes it possible to obtain IGF-1 analogue-agonist, possessing higher biological activity with respect to native IGF-1.

17 cl, 2 tbl

FIELD: medicine.

SUBSTANCE: present group of inventions relates to biotechnology. What is presented is a humanised anti-CD79b antibody and its antigen-binding fragment produced of murine antibody MA79b and CD79b having a substantially analogous binding affinity thereto. A polynucleotide, a vector, a host cell and a method for producing the anti-CD79b antibody according to the invention; immunoconjugates, compositions and methods for cell growth inhibition, a method of treating an individual suffering cancer, a method of treating a proliferative disease and tumour in a mammal, a method for B-cell proliferation inhibition; a method for detecting the presence of CD79b in a sample and method for binding the antibody to the CD79b expressing cell are also disclosed.

EFFECT: given invention can find further application in therapy of the CD79b associated diseases.

86 cl, 20 tbl, 9 ex, 51 dwg

Anti-mif antibodies // 2509777

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and immunology. Invention discloses a monoclonal antibody and its antigen-binding parts which specifically bind the C-end or central part of the macrophage migration inhibitory factor (MIF). The anti-MIF antibody and its antigen-binding part further inhibit biological function of the human MIF. The invention also describes an isolated heavy and light chain of immunoglobulins obtained from anti-MIF antibodies, and molecules of nucleic acids which encode such immunoglobulins.

EFFECT: disclosed is a method of identifying anti-MIF antibodies, pharmaceutical compositions containing said antibodies and a method of using said antibodies and compositions for treating diseases associated with MIF.

22 cl, 14 dwg, 16 ex

FIELD: biotechnologies.

SUBSTANCE: invention refers to creation of recombinant plasmids providing expression of poly-epitopic tumour-associated antigens in dendritic cells capable of stimulation of specific cytocidal cells, and it may be used in medicine. Recombinant plasmid DNA pCI-UB-POLYEPI contains 11 epitopes of tumour-associated antigens of colorectal cancer, its size is 6 355 n. p. and it expresses the following amino acid sequence: DYKDDDDK-LLGVGTFVV-ADRIW-GLKAGVIAV-AAYARY-VLAFGLLLA-ADRIW-YQLDPKFITSI-AAYARY-IMIGVLVGV-ADRIW-YLSGADLNL-AAYARY-CGIQNSVSA-AAYARY-LLLLTVLTV-ADRIW-QYIKANSKFIGlTEL-ANIY-SIINFEKL-ARY-SASFDGWATVSVIAL-ARY-SERVRTYWIIIELKHKARE-ARY-IQNDTGFYTLHVIKSDLVNEE. Mature dendritic cells obtained by adding to immature dendritic cells of pro-inflammatory TNF-α (tumour necrosis factor) cytokine are transfected by constructed plasmid DNA pCl-UB-POLYEPI thus activating them. Then activated dendritic cells are cultured together with peripheral mononuclear blood cells of people sick with colorectal cancer for generation of antigen-specific antitumour cytocidal cells.

EFFECT: invention allows efficient generation of antigen-specific cytocidal cell with antitumour activity in vitro, required for immune response by the 1-st type T-helper to colorectal cancer antigens.

2 cl, 1 dwg, 4 ex

Anti-axl antibodies // 2506276

FIELD: chemistry.

SUBSTANCE: present invention relates to immunology. Disclosed are monoclonal antibodies which bind to the extracellular domain of receptor tyrosine kinase AXL and which at least partially inhibit AXL activity, as well as antigen-binding fragments. Also provided is an isolated nucleic acid molecule, a host cell and a method of producing a monoclonal antibody and an antigen-binding fragment thereof, as well as use of the monoclonal antibody or antigen-binding fragment thereof to produce a drug, pharmaceutical compositions, a method of diagnosing and a method of preventing or treating a condition associated with expression, overexpression and/or hyperactivity of AXL.

EFFECT: invention can be used in therapy and diagnosis of diseases associated with AXL.

23 cl, 20 dwg, 24 ex, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically binds heparin-binding EGF-like growth factor (HB-EGF) and its antigen-binding fragment. Invention describes a nucleic acid molecule, an expressing vector, a host cell and a method for obtaining an antibody or its antigen-binding fragment, as well as use of antibody or its antigen-binding fragment for obtaining pharmaceutical composition for diagnostics, prevention or treatment of hyperproliferation disease, methods and sets for diagnostics and prevention or treatment of the state associated with HB-EGF expression. This invention can be further found in therapy of diseases determined with or related to HB-EGF expression.

EFFECT: improving efficiency of composition and treatment method.

34 cl, 43 dwg, 28 ex, 12 tbl

FIELD: biotechnologies.

SUBSTANCE: invention describes polynucleotide, expression vector, host cell and production method of humanised antibody together with their use, as well as medical preparation against rheumatoid arthritis, prophylaxis or treatment method of rheumatoid arthritis and use of humanised antibody at production of pharmaceutical preparation for prophylaxis or treatment of rheumatoid arthritis. This invention can be used in therapy of human diseases associated with α9 integrin.

EFFECT: improved activity and thermal stability.

14 cl, 6 dwg, 6 tbl, 11 ex

Organic compounds // 2502802

FIELD: biotechnologies.

SUBSTANCE: invention refers to eucariotic vector for expression of target recombinant product in a mammal cell and to its use, to a mammal cell for production of target recombinant product and to a method for its production, a method of a mammal cell selection and a method for obtaining a target recombinant product. Vector includes the first polynucleotide coding a functional folate receptor bound to a membrane as a selective marker and the second polynucleotide coding the target product that is expressed in a recombinant manner. Target product represents a pharmaceutically active, therapeutically active or diagnostic polypeptide. Functional folate receptor bound to the membrane and target product are expressed from the above expression vector. Sampling system is based on introduction of a gene of exogenic functional folate receptor bound to the membrane to a mammal cell.

EFFECT: invention allows effective selection of transformed cells and high yield of target product.

26 cl, 3 tbl, 2 ex

FIELD: biotechnologies.

SUBSTANCE: expression vector includes: (a) replication origin OriP obtained from Epstein-Barr virus (EBV), where replication origin contains: 1) symmetry element of the second order (DS); and 2) duplication section (FR) that contains fixation point EBNA; (b) replication origin SV40; (c) insertion section for inserting a gene of concern; (d) promoter EF-1b functionally bound to the insertion section; (e) poly-A signal; (f) bacterial replication origin; (g) selected marker; and unnecessarily containing (h) sequence of nucleic acid, which codes constant area of heavy or light chain of antibody, which is functionally bound to the insertion section. With that, replication origin OriP is bound to an initiation factor of replication EBNA 1, which acts from outside and is not coded with an expression vector.

EFFECT: use of an expression vector in an extracted host cell, a set and a method for obtaining recombinant protein provides production of abundant protein expression.

26 cl, 25 dwg, 3 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology. Claimed is separated chimeric polynucleotide for amplification of production of heterologous protein of interest, which contains polynucleotide sequence of promoter SigA or SigH, functionally connected with polynucleotide, coding protein YmaH, with chimeric polynucleotide connecting sequence, which by, at least, 90% is identical to SEQ ID NO: 1, 2, 3 or 13. Also described are: expression vector, containing claimed nucleotide structure, and host cell Bacillus for production of heterologous protein of interest, which contains said vector. Claimed is method of obtaining modified Bacillus cell, including transformation of host cell of Bacillus-producent of heterologous protein of interest with said vector; and growing said modified cell in optimal conditions. Described is method of obtaining protein of interest in modified Bacillus cell, where method includes cultivation of said host cell; and growing said modified Bacillus cell in optimal conditions. Also described is method of amplification of expression of heterologous protein from Bacillus of interest includes obtaining said modified Bacillus cell; growing modified Bacillus cell in optimal conditions; and expression of said protein of interest in modified Bacillus cell, where expression of said heterologous protein of interest in modified Bacillus cell is amplified in comparison with expression of said protein of interest in said parent Bacillus host-cell.

EFFECT: invention makes it possible to increase output of target protein due to superexpression of protein YmaH.

30 cl, 4 dwg, 3 ex

Up!