Subtype b type 1 iv735 human immunodeficiency viral strain for diagnostic and vaccine preparations

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to a subtype B of a human immunodeficiency viral strain, and can be used in virology, medicine and biotechnology. The presented type 1 IV735 human immunodeficiency viral strain is deposited in the State Collection of Viruses of Federal State Institution Ivanovsky Research Institution of Virology of the Russian Ministry of Healthcare and Social Development, No. 1189. The strain possesses a stable reproductive activity. An infectious titre makes 6 lg 50% tissue cytopathic dose.

EFFECT: strain is a handy natural model for studying an antiviral activity of chemopreparations of the new generation, as well as for creating a vaccine.

1 dwg, 3 tbl, 3 ex

The invention relates to the field of Virology and biotechnology and can be used for diagnostic and experimental vaccines.

HIV-1 of different variety of genetic variants. To date, there are 9 subtypes of HIV-1 and 15 recombinant forms [1]. On the territory of the former Soviet Union in the mid-90s circulated 7 subtypes of HIV-1 (from a to H) [2, 3]. Most widespread in Russia at that period were subtype b, the dominant among gay men [4]. The situation changed dramatically in 1996, when HIV-1 entered on Wednesday practitioners of intravenous administration of psychotropic drugs (IDU), where the rate of transmission is very high. Currently on the territory of the Russian Federation simultaneously circulate 3 genetic variants of HIV-1 subtype a, subtype b and recombinant gagA/envB dominated for most part of the territory of subtype a [5, 6]. It should be noted that variants of HIV-1 subtype B, the currently circulating on the territory of the Russian Federation, among IDUs (injecting drug users) are genetically different from subtype B, which is widespread in Western Europe and America and which is characteristic of men who have sex with men, as well as variants of this virus subtype that dominated at the beginning of the epidemic of HIV infection [7, 8]. Therefore, to enable the development of diagnostic and vaccine preparations is extremely important to use a strain of subtype B, circularise on the territory of the Russian Federation.

The objective of the invention is the obtaining of a strain of human immunodeficiency virus belonging to subtype b, the currently circulating on the territory of the Russian Federation, among IDUs (injecting drug users).

The technical result, which can be obtained by carrying out the invention, is to use it to study the antiviral activity of drugs of new generation and to create a vaccine.

Strain of human immunodeficiency virus I-th type IV subtype In for diagnostic and vaccine preparations is stored in the collection of viruses, NIELS them. Mechnikov RAMS and deposited in the State collection of viruses fsbi " research Institute of Virology. Dijanoveckog the health Ministry of Russia under No. 1189 from 16.01.12 and having the nucleotide sequence shown in Fig. 1.

The virus strain isolated from peripheral blood lymphocytes of a patient AIDS not receiving antiretroviral therapy. Upon receipt of the strain used methods cocultivation lymphocytes of a patient with a blood lymphocytes of a healthy donor, stimulated by the mitogen, as well as with human perelivaniami cell lines.

A reproduction.

The HIV-1 strain HIV has a high reproductive activity and replicates in peripheral blood lymphocytes, as well as in lymphoblastoid the cell cultures MT-4 and Jurkat. Virus reproduction is accompanied by a characteristic cytopathic effect and inititiatives. The strain can be maintained for a long time when passirovannye on cell lines. After 5-6 days after infection of the cells of the vaccinated culture fluid of the infected cell suspension is frozen and after thawing and clarification at 1000 rpm is brought to fresh uninfected cells at a ratio of 1:10.

The infectious titer of the virus was determined by 50% tissue cytopathic dose of the virus on the model above cell cultures in comparison with the strain-analog of HIV-1 LAV, which is the first isolate of HIV-1 isolated from a patient AIDS [9]. Productive activity of the strain is 6.0 lg TCD and comparable with infectious titer of strain-similar (table 1).

Antigenic properties.

HIV-1 belongs to the family Retroviridae, genus Lentivirus. Viruses of this subgroup are enveloped RNA viruses with a particle size of about 100-150 nm. In the composition of the particles find no less than 6 major structural antigens having immunogenic properties that can be detected in infected cells using various immunological and virological methods.

Immunoflourescence.

The study of strain IV method of indirect immunofluorescence with the use of serum is Aulnay AIDS, containing antibodies to HIV-1, showed the presence of antigens of HIV-1 in 50-60% of infected cells.

The immunoblot.

Research in the immunoblot showed that the virus antigenic determinants characteristic of HIV-1: 120/160, 65, 55, 41, 31, 24, 17 KD (table 2).

Subsidirovanie.

Genetic analysis of the region encoded by pol gene, carried out using subtypespecific primers (CCAAAGGTTAAACAATGG, TTAGATTCTTAAATGGCTCC), suitable for the study of variants of HIV-1 circulating in Russia, showed that this strain of the virus belongs to the subtype Century

The possibility of using the invention is illustrated by examples which do not limit the scope and nature of the claims associated with them.

Example 1. A comparative study of infectious activity of strains of HIV-1 LAV and IV for cytopathic effect.

The study of infectious activity of strains of HIV were performed on model lymphoblastoid cells MT-4 and Jurkat in plastic 24-hole panel (Costar, USA). The cells were infected with virus at a dose of 0.01 infectious units per cell. Next incubated cell culture when S° for 1 hour and washed twice. After that, the cell culture was added to culture medium RPMI-1640 with 10% serum of cow embryos (produced by Sigma) and 100 µg/ml gentamicin (final cell concentration of 400,000 cells/ml). Records of the results of the antiviral and the activity produced by the cell viability by staining the cells with dye Trifanova blue on the 6-7 day. The titer of the virus was taking the inverse of its maximum breeding, calling at least twice the excess of the rate of cell death compared with control. The results of the study are presented in table 1.

Comparative analysis showed that the infectious titers of strain IF comparable with infectious titer of strain similar to the LAV, which demonstrates similar activity. This infectious titer can successfully infect lymphoblastoid cell cultures with the aim of further developments infectious material.

Example 2. Diagnosis of antibodies to proteins of HIV-1 immunoblot method.

Material for the study of antibodies to HIV-1 presents the 10 sera obtained from HIV-infected persons and containing anti-HIV antibodies. Sera were pre-okharakterizovany in commercial test system of the firm "BioRad (USA). As the antigen used strain EV and strain-similar to the LAV. Detection of antibodies to HIV-1 was performed using nitrocellulose stripemania membranes (strip) coated with the antigens of HIV-1 firm BioRad (USA). Ready stripemania membrane previously soaked for 5 min in phosphate-buffered saline with tween (FSB-T). The serum of 20 µl were diluted in 1 ml of the FSB-T containing 0.5% BSA (bovine serum albumin), and contributed into the hole with a strip. the donkey incubation for 1 hour at room temperature and washing the FSB-T contributed conjugate, dissolved in 1 ml of the FSB, Then again, incubation was performed for 1 hour at room temperature and after washing the FSB-T was introduced 1 ml of a solution of tetramethylbenzidine (TMB) in citrate-phosphate buffer (CPB (). Then incubated in the dark until clear bands in the control strip. The reaction was stopped by 1 N. sulfuric acid. After washing the strip with distilled water, it was dried at room temperature and visually conducted profitability analysis.

The results are shown in table 2. As a result of the research showed that the antigen strain IV allows to detect antibodies to all of the major structural proteins of HIV-1 and, therefore, can be used to study seroconversion for HIV-1, and to study the antiviral effects of chemotherapy and HIV vaccine.

Example 3. A comparative analysis of the infectious activity of strains of HIV-1 LAV and IV level of virus antigen (P24).

Determining the level of viral antigen in vaccinated fluid was performed using enzyme immunoassay using a commercial ELISA kit company BioRad (USA) in 96-well panels. In wells that had previously been made of the investigated samples was added to the conjugate containing biocriminology polyclonal anti the La to P24 of HIV-1. After incubation for 1 hour at 37°C. the panel was washed Tris-saline buffer and made a streptavidin-peroxidase conjugate. Conducted incubation for 30 min at room temperature, washed panel Tris-saline buffer and then to visualize the reaction was added tetramethylbenzidine (TMB). After incubation for 30 minutes in the dark at room temperature in the wells to stop the reaction was made of 1 n sulfuric acid. The results were taken into account using a photometer "Multiscan" at a wavelength of 630 nm. For the positive control was taken not less than 3 times higher optical density compared with that indicator uninfected cell line.

The results are shown in Table 3. As a result of the research showed that the strain IF not inferior to the level of generation of antigen HIV-1 strain is similar to the LAV and has a high reproductive activity that allows you to successfully infect them lymphoblastoid cell cultures, with the aim of further developments infectious material.

<>

Sources of information

1. Spira, S., M.A. Wainberg, Loemba H. et al. Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance // J. Antimicrob. Chem. - 2003. - V.51. - P.229-240.

2. Leitner T., Korovina G., Marquina, S. et al. Molecular and biological characterization of Russian HIV-1 strains // AIDS Res. Hum. Retroviruses. - 1996. - V.12 - P.1595-1603.

3. Lukashov V, Cornelissen MTE, Goudsmith J. et al. Simultaneous introducrion of distinct HIV-1 subtypes into different risk groups in Russia, Byelorussia and Lithuania // AIDS. - 1995. - V.9. - P.435-439.

4. Bobkov, A., Cheingsong-Popov R, Karasyova N. et al. Sequence analysis of glycoprotein 120 coding region of a new human immunodeficiency virus type 1 subtype G from Russia // AIDS Res. Hum. Retroviruses. - 1996. - V.12. - P.1385-1388.

5. K.A.Ryzhov, M.N.Nossik, V.V.Pokrovsky et al. The genetic diversity of human immunodeficency virus-1 circulating in the territory of Russia // 5^thIAS Conference on HIV Pathogenesis, Treatment and Prevetntion, 19-22 July 2009, Cape Town, South Africa, Fbs. CDAO34

6. Mnesic, Kharisov, Cinquin and other Ways of HIV transmission-infecti is in the North-Western and far Eastern regions of Russia // Russian journal of AIDS, cancer and public health. - 2010. - T. No. 1(29). - P.32-33.

7. Bobkov, A., Cheingsong-Popov R, Selimova L. et al. Genetic heterogeneity of HIV type 1 in Russia: identification of H variants and relationship with epidemiological data // AIDS. - 1996. - V.12. - P.1687-1690.

8. Nabatov A.A., Kravchenko O.N., Lyulchuk M.G. et al. Simultaneous introduction of HIV type 1 subtype A and In viruses into injecting drug users in Southern Ukraine at the beginning of the epidemic in the former Soviet Union // AIDS Res. Hum. Retroviruses. - 2002. - V.18. - P.891-895.

9. Barre-Sinoussi F., Mugeyre M., Dauguet C. Isolation of a T-lymphotropic retroviruses from a patient at risk for AIDS // Science. - 1983. - Vol.220. - P.868-871.

Strain of human immunodeficiency virus I-th type IV subtype In for diagnostic and vaccine preparations deposited in the State collection of viruses fsbi " research Institute of Virology. Dijanoveckog the health Ministry of Russia under No. 1189 and having the nucleotide sequence shown in figure 1.