Subtype a type 1 iv742 human immunodeficiency viral strain for diagnostic and vaccine preparations. RU patent 2513693.

IPC classes for russian patent Subtype a type 1 iv742 human immunodeficiency viral strain for diagnostic and vaccine preparations. RU patent 2513693. (RU 2513693):

G01N33/569 -

C12N7/00 - Viruses, e.g. bacteriophages; Compositions thereof; Preparation or purification thereof (medicinal preparations containing viruses A61K0035760000; preparing medicinal viral antigen or antibody compositions, e.g. virus vaccines, A61K0039000000)

A61K35/76 - Viruses

Another patents in same IPC classes:

Subtype a type 1 iv710 human immunodeficiency viral strain resistant to antiretroviral preparations for diagnostic and vaccine preparations / 2513692
Invention refers to a subtype A human immunodeficiency viral strain, and can be used in virology, medicine and biotechnology. The presented type 1 IV710 human immunodeficiency viral strain is deposited in the State Collection of Viruses of Federal State Institution Ivanovsky Research Institution of Virology of the Ministry of Healthcare and Social Development of the Russian Federation, No. 1188. The strain possesses a stable reproductive activity. An infectious titre makes 3.5-4.0 lg 50% tissue cytopathic dose.

Strain of diploid cells of lamb synovial membrane ovis aries used for virological investigations / 2507255
Strain of diploid cells of lamb synovial membrane is obtained by culture method of growing tissular explants in DMEM nutritional medium with 10% of fetal bovine serum (FBS). Strain of lamb synovial membrane cells is sensitive to lentiviruses of small-size ruminants (goat arthritis-encephalitis virus and visna-maedi virus). Strain of lamb synovial membrane cells is stored in cell culture collection of All-Russian Research Institute of Veterinary Virology and Microbiology under number 64 and is deposited in Specialised collection of transferred somatic cell cultures of agricultural and field animals in All-Russian Research Institute of experimental veterinary named after Ya. R. Kovalenko under number 82.

Strain of diploid cells of synovial membrane of young pig sus scrofa, used for virology research / 2506310
Invention relates to virology, particularly to culturing cells and tissue for producing and studying viruses. The strain of cells of the synovial membrane of a young pig is obtained by cultivating growing tissue explants of the synovial membrane of a young pig in a DMEM culture medium with 10% fetal bovine serum (FBS). The cell culture of the synovial membrane of a young pig is sensitive to viruses of classical swine fever, African swine fever, Aujeszky's disease and can be used to study viruses as well as in diagnostic studies. The strain of the synovial membrane of a young pig is stored in the collection of cell cultures of the National Research Institute for Veterinary Virology and Microbiology of Russia under No.65 and is deposited in the Special Collection of Grafted Somatic Cell Cultures of Agricultural and Industrial Animals RKKK(P) (SKHZH RASKHN) of the Y.R. Kovalenko National Research Institute for Experimental Veterinary (VIEV) under No.81.

Method for polymer immunoglobulin diagnosticum engineering for detecting serogroup 1, 3 and 6 legionella pneumophila (versions) / 2505819
Invention describes a method for polymer immunoglobulin diagnosticum engineering for detecting serogroup 1, 3 and 6 Legionella pneumophila, including preparing rabbit immune serums and sensitising them on a polymer carrier in the form of microspheres for the purpose of detecting the strains L. pneumophila in a slide agglutination test; the antibody polymer carrier is polyacrolein which at the stage of polymerisation is processed in safranin T; the microspheres have the diameter of 1 mcm and contain aldehyde groups 0.4 mcmole/g. Then, the carrier is additionally processed in 5% aqueous tannin at 37-40°C for three hours and kept for 15 hours at room temperature, washed in water by centrifugation until a negative reaction on FeCb and phenols is observed in a supernatant. Thereafter, the microspheres are sensitised with the rabbit Legionella serum; the carrier 25 mg is suspended in physiological solution 0.9 ml and added with the diluted (1:40) serum 0.1 ml; the prepared suspension is agitated for 2 hours at room temperature, then for 15 hour at 4°C, washed in sodium chloride and suspended in the same solution 1 ml with 1% gelatose; the prepared diagnosticum is preserved and poured out in 5 ml containers for use and storage.

Method for mycobacterium leprae antibody test / 2500423
Invention refers to biotechnology, namely to a method for Mycobacterium leprae antibody test. The method involves the immunoenzyme blood serum test for Mycobacterium leprae antibodies. A test antigen in the immunoenzyme test is an aqueous suspension of Mycobacterium lufu cultured in a thermostate on the Lowenstein-Jensen medium for 7 days at temperature 37°C, heated at 100°C for 1.5 hours on a water bath.

Method for estimating clinical effectiveness in chronic tonsillitis / 2495435
Method for estimating the clinical effectiveness in chronic tonsillitis involves the microbiological study of the tonsillar lacunae content to type the microorganisms and the concentration thereof; the microbiological study is performed on the 5th-7th day from the beginning of treatment. If the mucosal microflora appears to contain the microorganisms S. viridans and/or coagulase negative staphylococci (CNS) in the concentration of >105 CFU/tampon, while the concentration of the other opportunistic microorganisms is <103 CFU/tampon, the therapy is considered to be effective.

Method of production of r-brucellar erythrocytic antigen for indirect hemagglutination test (iht) / 2491553
Method of production of R-brucellar erythrocytic antigen for indirect hemagglutination test (IHA) includes production of formalinised red blood cells of sheep, their sensibilisation with sensitine obtained by growing bacterial mass of brucella, its washing-off with the hypertonic solution of sodium chloride, inactivation, extraction and separation of sensitine by centrifugation. At that the antigen is taken out from the strain B.abortus 16/4 by acting on the bacterial cells with 0.5% concentration of sodium dodecyl sulfate at the temperature of 68-70°C for 60 minutes.

Immunoenzymometric test system for serologic diagnosis of reovirus infection in cattle and monitoring of post-vaccination immunity level / 2488117
Invention relates to immunoenzymometric test system for serologic diagnosis of reovirus infection in cattle and the monitoring of post-vaccination immunity level. The presented immunoenzymometric test system comprises a specific antigen of the strain "Reo 1 Lang-DEP" of reovirus of type I, inactivated by 0.08% solution of 1,2-aminoethylaziridine representing a specific protein in a concentration of 5-10 mkg/cm3 adsorbed on the surface of polystyrene cavities in carbonate-bicarbonate buffer with merthiolate in a final concentration of 0.1-0.2 mg/cm3, a control positive serum obtained to the antigen of reovirus of type I with the activity in IFA 1:3200-1:6400, control negative serum, anti-species conjugate, potassium dihydrogen phosphate, potassium phosphate dibasic, sodium chloride, a chromogen (ortho-phenylenediamine), hydrogen peroxide, stop reagent and panels for carrying out reaction of the immunoenzymatic assay.

Method to detect ability to persistence in staphylococcus aureus / 2487929
Invention discloses the method to detect ability to persistence in Staphylococcus aureus, by definition of biological properties, in particular, ability to synthesise substances that are immunologically similar to leptin and/or soluble receptor of leptin in a daily liquid culture of staphylococci. If there is synthesis of the specified devices, they determine ability of staphylococcus to persistence.

Method to produce erythrocytic antigen for reaction of indirect hemagglutination in case of brucellosis / 2484481
Method to produce erythocytic antigen for reaction of indirect hemagglutination in case of brucellosis includes preparation of formalinised erythrocytes of sheep and their sensibilisation with sensitin produced by growth of bacterial brucella mass, its washout with hypertonic solution of sodium chloride, inactivation, extraction and separation of sensitin by centrifugation. At the same time formalinised erythrocytes of sheep are sensibilised with antigen made by exposure of the inactivated bacterial mass of the strain B.abortus 19 in the dose of 40-50 billion microbial cells per 1 ml of sodium dodecyl sulfate in 1% concentration at 70-72°C for 45 minutes, with further loading of erythrocytes with sensitin in terms of 0.2-0.4 ml of antigen per 1 ml of 5% suspension of erythrocytes.

Method of quantitative determination of fixed rabies virus "moskva 3253" / 2511440
Invention relates to field of biotechnology and deals with method of quantitative determination of fixed rabies virus strain "Moskva 3253". Method includes decontamination and separation of RNA from virus-containing material, carrying out reaction of reverse transcription and polymerase chain reaction with hybridization-fluorescence account of results in "real time" mode with application of specific primers RV5-5'-GTTGGGCACTGAAACTGCTA-3', RV6-5'-GAATCTCCGGGTTCAAGAGT-3' and probe RV7-5'-ROX-AATCCTCCTTGAACTCCATGCGACAGA-BHQ2. Quantitative assessment of virus is determined on the basis of registration of signal of analysed sample fluorescence and its comparison with signal of fluorescence of PCR-standards, which contain different quantities of DNA-targets. Claimed method makes it possible to determine quantitative content of virus in rabies antigen of organ-tissue and culture origin.

Influenza virus strain a/hongkong/1/68/162/35 (h3n2) - universal donor of internal genes for reassortants, and reassortant strains a/spb/gk/09 (h1n1) and a/hk/astana/6:2/2010 (h5n1) prepared thereof / 2511431
Invention refers to medical biotechnology, and concerns influenza virus strains What is presented is the influenza virus strain A/Hongkong/1/68/162/35 (H3N2) deposited in the State Collection of Viruses of Ivanovskiy Scientific and Research Institution of Virology of Russian Academy of Medical Sciences, No.2442, that is a donor of internal genes for producing reassortant strains and prepared by passaging an agent through chicken embryos. The presented attenuation donor is used to produce the reassortant stains: A/SPb/GK/09 (H1N1) and A/HK/Astana/6:2/2010 (H5N1) deposited in the in the State Collection of Viruses of Ivanovskiy Scientific and Research Institution of Virology of Russian Academy of Medical Sciences, Nos. 2627 and 2626, respectively that inherit high reproductivity (9,5 lg) and an attenuation phenotype (ca) and thermal sensitivity (ts) respectively from the donor.

Set of oligodeoxyribonucleotide primers and fluorescently labelled probe for identification of dna of adenoviruses of serotypes 3, 4, 7, 14, 21 by method of hybridisation-fluorescence polymerase chain reaction / 2511043
Invention relates to field of biotechnology and deals with set, which includes oligodeoxyribonucleotide primers and fluorescently labelled probe for identification of DNA of adenovirus of serotypes 3, 4, 7, 14, 21 by method of hybridization-fluorescence polymerase chain reaction in real time mode. Claimed primers and probe have the following structure: external primer 5'→3' 5'-AATGTARTTGGGTCTGTTRGGCAT-3' internal primers 5'→3' 5'-CCCWTCGATGMTGCCCC-3' 5'-TCMACGGGYACRAAGCGCA-3' probe 5'→3' ROX-CCTGTCCGGCGATGTGCAT-BHQ2.

Strain of xh-18 virus of nuclear polyhedrosis of cotton budworm helicoverpa armigera hbn, used to obtain insecticide preparation / 2511042
Strain of virus of nuclear polyhedrosis of cotton budworm Helicoverpa armigera Hbn has high antiviral activity in relation to cotton budworm. It is deposited in the State collection of the Federal Service for Consumer Rights Protection and Human Welfare of causative pathogens of viral infections, rickettsial diseases of Federal Budget Institution of Science of State Science Centre of virology and biotechnology "Vector" under the registration number V-607, and can be used in the production of biological insecticides for agriculture.

Method for preparing cattle parainfluenza-3 vaccine / 2509571
Invention relates to veterinary microbiology and concerns a method for preparing a cattle parainfluenza-3 vaccine. The presented method involves preparing a virus-containing material of a cattle parainfluenza-3 virus strain, infecting a continuous cell culture with the virus-containing material, culturing the cattle parainfluenza-3 virus, collecting a virus-containing fluid, inactivating it and preparing a liquid end product with the virus-containing fluid inactivated in an oxidant solution prepared by electrolysis of 10.0-20.0% sodium chloride to achieve pH values 7.0-8.0, the oxidant concentration of 0.7-0.9% and an oxidantion-reduction potential of +1000±50 mV and an inactivation agent consumption of 4.5-5.0 cm3 per 0.8-1.0 l of the virus-containing fluid with the virus-containing fluid inactivation being one-staged in the content of available chlorine Cax=250-500 mg/l for 60-70 min and at temperature 37-38°C at pH 7.2-7.4.

Strain of influenza virus a/17/mallard/netherlands/00/95(h7n3) for production of live and inactivated influenza vaccines / 2507256
Vaccine strain for influenza virus A/17/mallard/Netherlands/00/95(H7N3) is proposed. Strain A/17/mallard/Netherlands/00/95(H7N3) is harmless for laboratory animals. Strain A/17/mallard/Netherlands/00/95(H7M3) has antigenic actuality and attenuation thus meeting the requirements to vaccine strains included in influenza live vaccine, and may be used for production of influenza live and inactivated intranasal vaccine in health care service for influenza prevention.

Species-specific bacteriophage strain having lytic activity in relation to staphylococcus aureus, including multi-drug resistant strains / 2503716
Strain is deposited under number Ph 62 in GKPM-Obolensk collection. Strain can be used for development of complex medical and disinfective preparations against infections caused with Staphylococcus aureus, as well as preparations for sanitation of food products against Staphylococcus aureus.

Extracted polynucleotide molecule coding torque teno virus, rna molecule and expression vector / 2502801
Group of inventions refers to biotechnology and deals with new nucleotide sequences of Torque teno virus (TTV) and vectors containing such sequences. Extracted polynucleotide molecule contains polynucleotide sequence chosen from the group consisting of SEQ ID NO:4, sequence complementary to SEQ ID NO:4 and polynucleotide that is at least 95% identical to SEQ ID NO:4.

Method for preparing cattle viral diarrhoea vaccine / 2502522
Invention refers to veterinary virology, microbiology and biotechnology and may be used in developing the agents for specific prevention, particularly for preparing cattle viral diarrhoea vaccine. To improve the quality of an end product by using an oxidant solution as an inactivating agent prepared by the electrolysis of sodium chloride solution, as well as to activate the method for preparing the cattle viral diarrhoea vaccine involving preparing a virus-containing material of the cattle viral diarrhoea vaccine strain, infecting a continuous cell culture with the virus-containing material, culturing the cattle viral diarrhoea virus, collecting a virus-containing fluid, inactivating and preparing the end product in the liquid form, with the cattle viral diarrhoea virus being inactivated by the oxidant solution prepared by electrolysis of 10.0-20.0% sodium chloride with the electrolysis carried out to pH 7.0-8.0, oxidant concentration 0.7-0.9% and redox potential +1000±50 mV; the processing is one-staged with the active chlorine content Cax=400-600 mg/l for 60-70 min with inactivating agent consumption 4.5-5.0 cm3 per 0.8-1.0 l of the virus-containing fluid.

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to a subtype A human immunodeficiency viral strain, and can be used in virology, medicine and biotechnology. The presented type 1 IV742 human immunodeficiency viral strain is deposited in the State Collection of Viruses of Federal State Institution Ivanovsky Research Institution of Virology of the Ministry of Healthcare and Social Development of the Russian Federation, No. 1187. The strain possesses a stable reproductive activity. An infectious titre makes 6 lg 50% tissue cytopathic dose.

EFFECT: strain is a model for studying an antiviral activity of chemopreparations of new generation, as well as for creating vaccine preparations.

1 dwg, 3 tbl, 3 ex

The invention relates to the field of Virology and biotechnology and may be used for diagnostic and experimental vaccines.

The problem of HIV infection still remains one of the serious global problems. Millions of people in the world are already infected with HIV, and every minute is a new virus. In our country this problem, unfortunately, is also relevant. Over 80% of HIV-infected persons are persons from 30 to 40 years, we are talking about disability huge number of persons of working age [1]. Eventually this problem from the category of medical fall into the category of social. In this regard, the creation of a vaccine against human immunodeficiency virus (HIV) is the actual problem. Currently, in a number of countries are tested vaccines, created on the basis of isolates of HIV-1, ranged from the subtype E, dominant on the African continent and Asia, and on the basis of isolates of HIV subtype B, dominant in Europe and North America [2, 3]. However, for the territory of the Russian Federation typical variant of HIV-related subtype And, therefore, to develop diagnostics and vaccines and study of chemotherapy drugs of new generation, you must use the HIV-1 strain of the given subtype [4, 5].

The objective of the invention is getting strains of human immunodeficiency virus, belonging to the subtype a, dominant currently, most of the territory of the Russian Federation.

The technical result, which can be obtained by carrying out the invention, is to use it to study the antiviral action of chemotherapy drugs of new generation and to create a vaccine.

The strain of human immunodeficiency virus I-th type IV subtype And for diagnostics and vaccines that are deposited in the State collection of viruses Petersburg research Institute of Virology them. Dieveniskes Ministry of Russia under number 1187 from 01.07.11 and having a nucleotide sequence, shown in figure 1, is stored in the collection of viruses, NIELS them. After i.i.metchnikov RAMS.

The strain of the virus isolated from peripheral blood lymphocytes of a patient AIDS, who did not receive antiretroviral therapy. Upon receipt of the strain used methods of cocultivation lymphocytes of a patient with blood lymphocytes of healthy donors, mitogen-stimulated, as well as with transplantable human cell lines.

Reproduction

Strain HIV-1 IV-742 has a high reproductive activity and is replicated in peripheral blood lymphocytes, lymphoblastoid cell cultures MT-4 and Jurkat. The reproduction of the virus, characterized by cytopathic action and sinzitialnaya. The strain can be maintained for a long time at passirovannye on cell lines. After 5-6 days after infection of cells of vaccinated culture fluid infected cell suspension is frozen and after thawing and clarification at 1000 rpm is paid to fresh uninfected cells in the ratio 1:10.

The infectious titre of the virus was identified in 50% tissue cytopathic dose of the virus on the model of the above-mentioned cell cultures in comparison with the strain is similar to HIV-1 LAV, which is the first isolate HIV-1 isolated from a patient with AIDS [6]. Productive activity of the strain is 6.0 Ig TCD and comparable with infectious titre strain-similar (table 1).

Antigenic properties

HIV-1 belongs to the family Retroviridae, genus Lentivirus. Viruses of this subgroup are enveloped RNA viruses with a particle size of about 100-150 nm. Of particle find at least 6 major structural antigens with immunogenic properties that can be detected in infected cells using various immunological and virological methods.

Immunoflourescence. A study by the method of indirect immunofluorescence using the AIDS patient serum containing antibodies to HIV-1, showed the presence of antigen of HIV-1 in 45-50% of infected cells.

The immunoblot. A study in the immunoblot showed that the virus antigenic determinants characteristic of HIV-1: 120/160, 65, 55, 41, 31, 24, 17 KD (table 2).

Sublimirovanny. Genetic analysis of the region coded genome ro conducted using subtypisation primers (CCAAAGGTTAAACAATGG, TTAGATTCTTAAATGGCTCC) suitable for studying variants of HIV-1 circulating in Russia, showed that this strain of the virus belongs to the subtype A.

The opportunity of use of the invention is illustrated by examples that do not limit the scope and nature of the claims associated with them.

Example 1. A comparative study of infectious activity of strains of HIV-1 LAV and IV by cytopathic action

The study of infectious activity of HIV strains was performed on the model of lymphoblastoid cells MT-4 and Jurkat in plastic 24-hole panel (Costar, USA). Cells infected with the virus in a dose of 0,01 infectious units per cell. Then incubated cell culture at 37 C for 1 hour and double-laundered. After that the cell culture was added nutrient medium RPMI-1640 with 10% whey embryos cows (produced by Sigma) and 100 mcg/ml gentamicin (final concentration of cells 400,000 cells/ml). Records of the results of antiviral activity produced by cell viability by staining cells dye Tipanova blue on 6-7 day. The titre of the virus took the reciprocal of its maximum breeding, calling at least twice exceeding the rate of cell death compared with control. The research results are presented in table 1.

Comparative analysis showed that the infectious title strain IV comparable with infectious titre strain similar to the LAV, showing their similar activity. This infectious titre allows to successfully infect lymphoblastoid cell culture with the aim of further developments of infectious material.

Example 2. Diagnosis of antibodies to HIV-1 by the method of immunoblot

The material for the study of antibodies to HIV-1 presents 8 sera obtained from HIV-infected persons and containing anti-HIV antibodies. Sera were previously described in commercial test-systems company "BioRad" (USA). As antigen strain used IV and strain-similar to the LAV. Detection of antibodies to HIV-1 was performed using nitrocellulose schipovnik membranes (strip) coated with the antigen of HIV-1 by "BioRad" (USA). Ready Stepovoy membrane pre-soak for 5 min in phosphate-buffered saline with tween (FSB-T). Serum in the amount of 20 ml dissolved in 1 ml of the FSB-T, containing 0.5% BSA (bovine serum albumin), and brought in well with the strip. After incubation for 1 hour at room temperature and cleaning of the FSB-1 was made by conjugate, dissolved in 1 ml of the FSB is So Forth again were incubated for 1 hour at room temperature and after washing the FSB-T contributed 1 ml solution tetramethylbenzidine (TMB) in citrate-phosphate buffer (CPB (). Then incubated in the dark until a clear strips in the control strip. The reaction was stopped 1 N. sulfuric acid. After washing, the strip of distilled water was dried at room temperature and visually conducted analysis.

The research results are presented in table 2. In research has established that the antigen strain IV allows to detect antibodies to all the major structural proteins of HIV-1 and, therefore, can be used to study seroconversion for HIV-1, as well as for the study of antiviral action the chemotherapy drugs and HIV vaccine.

Example 3. Comparative analysis of the infectious activity of strains of HIV-1 LAV and IF the level of virus antigen (P24)

Determination of the level of viral antigen in vaccinated liquid was performed using enzyme immunoassay using commercial ELISA kit firm BioRad (USA) in 96-well panels. The wells, which previously was included analyzed samples, added conjugate containing Biotechnologie polyclonal antibodies to P24 HIV-1. After incubation for 1 hour at 37 C panel laundered Tris-salt buffer and made streptavidin-peroxidase conjugate. Were incubated for 30 min at room temperature laundered panel Tris-salt buffer and then to render reactions were added tetramethylbenzidine (TMB). After incubation for 30 minutes in the dark at room temperature, the wells to stop reaction made 1 N. sulfuric acid. The results were taken into account using the photometer "Multiscan" at a wavelength of 630 nm. For the positive control took not less than 3-fold excess of the optical density compared with that indicator uninfected cell lines.

The research results presented in Table 3. In result of studies it is established that the strain YVES 742 not inferior to the level production of antigen of HIV-1 strain-analogue LAV and has a high reproductive activity that allows you to successfully infect them lymphoblastoid cell culture with the aim of further developments of infectious material.

Sources of information

1. The decision of 13.02.2012 №6 "On urgent measures for combating the spread of HIV-infection in the Russian Federation".

2. Spira S., Wainberg M.A., Loemba H. et al. Impact of clade diversity on HIV-1 virulence, antiretroviral drug sensitivity and drug resistance // J. Antimicrob. Chem. - 2003. - V.5L. - P.229-240.

3. Kathy Stover. "In Thailand Clinical Study, HIV Vaccine Regimen Demonstrates Modest Preventive Effect." Medical News Today. MediLexicon, Intl., 25 Sep. 2009. Web. 22 Jun. 2012. http://www.medicalnewstoday.com/releases/165277.php

4. Bobkov A.F., Kazennova E.V., Selimova L.M. et al. Temporal trends in the HIV-1 epidemic in Russia: predominance of subtype A // J. Med. Virol. - 2004. - V.74. - P.191-196.

5. Nosik M., K. Ryzhov, Kravtchenko A. et al. Genotypic Analyses of HIV in antiretroviral drug-naive patients from Moscow and Moscow Region, Russia // 6th IAS Conference on HIV Pathogenesis, Treatment and Prevention, 17-20 July 2011, Rome, Italy, Abs.CDA002.

6. Barre-Sinoussi F, Mugeyre M., Dauguet C. Isolation of a T-lymphotropic retroviruses from a patient at risk for AIDS // Science. - 1983. - Vol.220. - P.868-871.

The strain of human immunodeficiency virus I-th type IV subtype And for diagnostics and vaccines that are deposited in the State collection of viruses Petersburg research Institute of Virology them. Dieveniskes Ministry of Russia under number 1187 and having a nucleotide sequence, shown in figure 1.