|
![]() |
Set for testing sperm in spots on analysed sample Invention relates to field of forensic medical examination, namely to test sets, and makes it possible to carry out testing sperm in spots on analysed sample. Set contains two test strips of filter paper, containing: citrate buffer of 50 mmol/l concentration - 10 ml, α-naphthyl phosphate of 10 mmol/l concentration - 26.5 mg, fast red TR of 1.5 mmol/l concentration - 3.9 mg; and the other strip is soaked with solution, containing: sodium tartarate of 2 mmol/l concentration - 10 ml, α-naphthyl phosphate of 10 mmol/l concentration - 26.5 mg, fast red TR of 1.5 mmol/l concentration - 3.9 mg; distilled water for obtaining water extract of tested sample and reservoir for carrying out test. Sensitivity of strips to sperm constitutes not less than 0.00625 mg/ml. |
![]() |
Method of diagnosing brain tumours Invention relates to medicine and can be used for the diagnostics of brain tumours (BT). For this purpose the optic density of the patient's blood plasma is measured in the visual and ultraviolet spectrum area by means of electronic phenomenological spectroscopy. The preliminarily measurement of the blood plasma optic density in a group of donors with diagnosed BT and a group of donors who do not have the said diagnosis is realised. An integral power of oscillators in the visual (IPO vis) and ultraviolet (IPO uv) spectrum areas is calculated for each donor. A graph of IPO vis dependence on IPO uv for both groups and the fixation of resulting straight lines of the said dependences on both graphs are carried out. Diagnostics is realised by measuring the distance of the particular patient's index in the graph of IPO vis dependence on IPO uv to the resulting straight lines of the donors with BT diagnosis (d1) and the donors who do not have such a diagnosis (d2), and if d1<d2, a conclusion about a probability of BT presence is made. |
Method for prediction of endometrial receptivity in in vitro fertilisation cycles Determined and measured are an optical expression density of the leukaemia inhibitory factor (LIF) in the germinal and glandular epithelium during an implantation window in the cycle preceding the in vitro fertilisation procedure and the cervical mucus vascular endothelial growth factor (VEGF) on the day of the transvaginal follicular puncture, a systolic-diastolic ratio (S/D) and a spiral artery resistance index (IR) on the day of the trigger shot; that is followed by calculating a regression function (Z) by formula. If Z>0, the endometrium is predicted to be receptive, whereas Z<0 shows the non-receptive endometrium. |
|
Method includes the extraction of the total native DNA from skin and hair, specific amplification of the gene 5.8S pPHK Trichophyton verrucosum fragment with the application of primers of the following structure: 5' CCACGATAGGGATCAGCGTT 3', 5' GAAAGTTTTAACTGATTTTGCTTG 3'. Then in case of the electrophoretic detection of the amplification product with the size of 231 bp the presence of a causative agent is determined. |
|
![]() |
Method comprises the study of ezrin expression and the process of methylation of genes in the endometrium. In case of increased expression of ezrin in cell cytoplasm from 4 to 6 points and reduction of the process of methylation of genes under the influence of O6- methylguanil-DNA of methyltransferase (MGMT) to the level of no more than 2 points the possibility is determined of malignant pathological process and occurrence of endometrioid adenocarcinoma. |
Diagnostic technique for active ulcerative colitis Blood serum immune status is examined; circulating immune complexes are measured; if the circulating immune complexes C1q increase to 60.8 unit/ml or more, the circulating immune complexes C3d increase to 39.0 unit/ml or more, whereas C-reactive protein increases to 10.2 mg/l, active ulcerative colitis is diagnosed. |
|
Predicting anaemic syndrome in the second trimester of gestation requires determining an anti-influenza A A(H3N2)virus antibody titre in paired blood serums (the antibody titre in the second serum is used as a characteristic) (A), blood erythrocyte 2,3-diphosphoglycerate concentration (mcmole/l) (B) and seromucoid content (optical density units) (C). A discriminator equation is used to predict anaemic syndrome in the second trimester of pregnancy: D=+0.007×A+1.435×B+209.281×C, wherein D is the discriminator equation with a limit value equal to +35.31. If D is less than the limit value of the discriminator equation, the absence of anaemic syndrome accompanying exacerbation of chronic obstructive bronchitis in the females suffered influenza A (33H2) in the first trimester of pregnancy is predicted, and if D is equal to or more than the limit value, developing anaemic syndrome in the females with exacerbation of chronic obstructive bronchitis in the females suffered influenza A (33H2) in the first trimester of pregnancy is predicted. |
|
![]() |
Diagnostic technique for severity of discirculatory encephalopathy in males High-density lipoproteins are measured, and Cirs and Kaplan-Feistein comorbidity factors are derived. Neurological cerebellar syndromes are detected; thrombin clotting time is measured; any obsessive habits and occupational hazards are stated; higher cerebral dysfunctions are assessed; pain syndrome accompanying somatic motor system disorders and somatic motor system syndromes, as well as V-VII pairs of cranial nerves involvements are diagnosed. A discriminator function is calculated by a specific formula. |
![]() |
Invention concerns methods for prediction of complete morphological regressions (CMR) in the patients with triple-negative resectable breast cancer. The immunohistological analysis of tumour tissue is conducted. A regression equation Y is determined by formula: Y=7.0-4.1X1-0.15X2+1.8X3-4.8X4+1.78X5+0.56X6, wherein: X1 is a size of a primary tumour node: 1 - less than 30 mm, 2 - 30 mm and more; X2 is the state of the regional lymphatic apparatus: 0 - the absence of a metastatic lesion of the lymph nodes, 1 - the lesion involving up to 4 lymph nodes, 2 - the lesion involving 4-9 lymph nodes, 3 - the lesion involving 10 lymph nodes and more; X3 is the chemotherapy regimen: 1 - FAC, 2 - CAX, X4 is the EGFR1 expression level in the biopsy material of the tumour tissue: 1 - less than 10%, 2 - 10% and more; X5 is the Ki-67 expression level in the biopsy material of the tumour tissue: 1 - less than 20%, 2 - 20% and more; X5 is the VEGFR-2 expression level in the biopsy material of the tumour tissue: 1 - less than 70%, 2 - 70% and more. A probability of CMR is calculated by formula: P=eY/(1+eY). If P<0.5, the low probability is predicted, whereas P>0.5 shows the high probability of CMR. |
![]() |
Method of monitoring patient's condition after organ transplantation Invention relates to medicine, namely to transplantology, and can be applied for monitoring the patient's condition after organ transplantation. For this purpose, after transplantation monitoring of the redox potential (RP) of the patient's blood plasma is carried out. RP of the patient's blood plasma is daily determined by a platinum electrode relative to a silver chloride electrode. The platinum electrode is preliminarily processed by means of cathode-anode scanning in a solution of an inorganic reducing agent in a cyclic potential-dynamic mode. Daily monitoring of RP value of the patient's blood plasma is carried out and changes of RP values in one direction within a day or some days are identified. If the change of RP of more than 25 mV per day or several days is determined, a conclusion about the presence of transplant dysfunction or a high risk of development of a transplant rejection crisis is made. In case of detection of the RP value change less than 25 mV, a conclusion about the normal condition of the patient is made. |
![]() |
Method of predicting non-developing pregnancy Invention represents method of predicting non-developing pregnancy due to detection of risk factors in blood serum by means of immunosorbent assay and further processing of obtained results by method of binary logistic regression. |
![]() |
Agent for diagnostics of bovine leukaemia and method of its application Agent for diagnostics of bovine leukaemia comprises a water soluble protein fraction of the cell line of porcine embryonic kidney, contaminated with oncornaviruses C and D, and obtained by culturing under anaerobic conditions, having a molecular weight of from 75 to 82 kD in an amount of 0.49-0.52 wt % and characterized by the presence of peaks at the wavelength of 214 nm in the ultraviolet spectral range, and additionally comprises phosphate-buffered saline. The method consists in sampling of animal blood, preparing suspension of citrated blood of 0.25-0.5% concentration, mixing the suspension with the agent for diagnostics with the ratio of the agent and the suspension of 1:4-6, maintaining the mixture at a temperature of 4-8°C for 12-15 hours, and recording the results of the reaction by the nature of the interaction of the citrated blood suspension with the agent for diagnostics, at that the presence of leukaemia is determined based on the positive reaction of the citrated blood suspension with the agent. |
![]() |
Invention describes a method for evaluating a surgical risk in the patients with atherosclerotic occlusion of a femoropopliteal tibial segment involved in critical ischemia, involving making a point assessment of cardiovascular comorbidities, wherein each risk factor is assigned with a fixed score as follows: age of over 70 years old - 1 point, acute cerebrovascular accident or transient ischemic attack in the past medical history - 2 points, postinfarction cardiosclerosis - 1 point, left ventricular ejection fraction of 46% to 50% - 2 points, left ventricular ejection fraction of 41% to 45% - 4 points, left ventricular ejection fraction of 40% or less - 6 points, ischemic heart disease: chronic coronary insufficiency of 1st functional class - 1 point, ischemic heart disease: chronic coronary insufficiency of 2nd functional class - 2 points, ischemic heart disease: chronic coronary insufficiency of 3rd functional class - 7 points, paroxysmal atrial fibrillation/flutter, ectopic rhythm, frequent (>5 a minute) auricular extrasystole - 3 points, persistent atrial fibrillation/flutter - 2 points, ventricular extrasystole >30 an hour - 1 point; the total score is derived; a surgical risk level is evaluated; if the total score is 8 or more, the high surgical risk is stated, and an endovascular intervention is recommended; if the total score falls from 0 to 3, the low surgical risk is observed requiring a bypass surgery, whereas the total score ranging from 4 to 7 means the moderate surgical risk, wherein both techniques of arterial repair are possible. |
![]() |
Device for sampling liquid, contained in elastic container Claimed invention relates to sampling liquid which us in elastic closed container, for instance, in container for urine or blood collection. Device for sampling liquid, contained in elastic container (13, 14), contains first section (20), which has basic surface (21), and element (22) for perforation of film, projecting from basic surface (21). Device additionally contains second section (23), which has basic surface (24), which surrounds cavity (25), adapted for uptake of element (22) for perforation of film, which is part of first section (20). First section (20) has adhesive surface, surrounding element (22) for film perforation, and second section (23) has adhesive surface, surrounding cavity (25). In addition, one of two sections (20, 23) contains hole (26) in basic surface within the limits of adhesive surface (21). |
![]() |
Set for detecting spores, originating from mycobacteria Invention relates to the field of microbiology, namely to a set for the detection of spores, originating from mycobacteria in a sample. The set contains an antibody, which specifically binds a spore-related mycobacteria peptide, where the spore-related mycobacteria peptide is selected from the group, consisting of CotA, CotD, CotT, SpoVK, CotSA, YrbC, SpoVE, Soj, SpoIIIE and SEQ ID NO: 2, 4, 6, 8, 10, 12, 16, 18, 20, 22, 24 and 26, where the said antibody is obtained by the immunisation of a human or a non-human organism, with the said peptide, related to the spores. The set additionally contains a molecule, specifically binding a complex between the said antibody and the said spore-related mycobacteria peptide. |
![]() |
Invention refers to protein analysis tools and can find its application in clinical and biological laboratories. A biochip carrier according to the present invention is made of glass-based chalcogenide glass and has a functional coating of an inorganic material. As the functional coating of the inorganic material, the carrier comprises a metal nanoparticle layer max 200 nm thick. The nanoparticles are max 50 nm in size and consist of an inert metal or a mixture of several inert metals specified in a group containing gold, silver, platinum. |
![]() |
Patient is examined to detect predictors of the mycobacterium tuberculosis resistance to fluoroquinolones, and if any are detected, the predictors are assigned with respective numerical values. The presence of infiltrative-degenerative changes in the lung in a combination with dissemination stands for +15 points. If observing the inoculation of solid media with more than 100 M. tuberculosis colonies growing or a positive direct microscopic test of the Ziehl-Neelsen stained diagnostic material stained, +17 points are assigned. The presence of the initial mycobacterium tuberculosis (MTB) resistance to aminoglycosides and/or capreomycin is evaluated as +7 points. If the patient is diagnosed with a comorbid renal disorder, +3 points are added, whereas alcohol and/or drug dependence is associated with +6 points. If the course of the multiple resistant TB polychemotherapy has been terminated for 2 weeks or more, +38 points are assigned. Provided fluoroquinolone has been prescribed in a daily dose, which is below a recommended intake, +5 points are assigned. Prescribing individual regimens of the multiple resistant TB polychemotherapy including less than 5 anti-tuberculosis drugs with preserved MBT sensitivity requires +8 points to be added. Using resection-based surgical approaches stands for -3 points. The total risk score is further calculated. That is followed by identifying a probability or a degree of the risk of the mycobacterium tuberculosis resistance to fluoroquinolones. The degree of the risk is predicted by either an interval scale, or calculating the precise probability by formula: p=1/1+e-0.055x-2.964, wherein e is a base of the natural logarithm, a constant value equal to 2.718…, x is an absolute value of the total risk score. In the event that the interval scale is supposed to be applied with the total risk score of < 30, the degree of the risk is considered to be low with the probability (p) of 0.0-0.2. The total risk score ranging within 30-50 points, the degree of the risk is stated as moderate with p>0.2-0.5. If the total risk score is 50-70 points, the degree of the risk is high with p>0.5-0.7. The total risk score being >70 points shows the very high degree of the risk with p>0.7-0.9. |
![]() |
Method for prediction of risk of endometriosis DNA is recovered from peripheral venous blood; combinations of genetic versions of polymorphous markers of interleukin 6 (-174 G/C IL-6), interleukin 1B (-511 C/T IL-1B), interleukin 10 (-592 C/A IL-10) cytokine genes, stromal cell factor (-801 G/A SDF1) chemokine genes, macrophage inflammatory protein -1β (+1931 A/T MIP 1β), T-cell normal expression and secretion activity regulator (-403 G/A RANTES), interferon-inducible T-cell chemoattractant (A/G I-TAC) are typed and analysed. A high risk of isolated endometriosis is predicted if observing combinations of -174 C IL-6, -801 A SDF1, +1931 A MIP1β, -592 C IL-10 alleles, -801 A SDF1, -403 G RANTES, +1931 A MIP1β, -592 C IL-10 alleles, -801 A SDF1, -403 G RANTES, -511 C IL-1B, -592 C IL-10 alleles, -801 A SDF1, +1931 A MIP1β, -592 C IL-10 alleles, -174 C IL-6, -801 A SDF1, -403 G RANTES, -592 C IL-10 alleles, -801 A SDF1, A I-TAC, -511 CC IL-1B alleles. |
Method of early diagnosis of respiratory diseases in calves Method comprises sampling of blood in calves. In the calves aged from 20 days to 8 months the level of urea erythrocyte hemolysis is determined before and after the introduction of modifiers of adrenaline and adrenergic blocker in blood samples. Then the coefficient of modification of membranes is calculated by formula KMA=Eaw/Ebl-as, where Eaw - extinction of the sample at a wavelength of 541 nm with adrenaline; Ebl-as - extinction of sample at a wavelength of 541 nm, on which the blocker was initially applied, and then - the active substance. At that KMA in healthy calves is within 0.98 to 1.2, and in the case of excess the level of 1.2 the initial stage of respiratory disease is diagnosed. |
|
Method of differential diagnostics of nonspecific ulcerative colitis and crohn's disease in children Saliva of affected child is analysed by method of infrared spectroscopy, value of ratio of peak height with maximum at 1070 cm-1 to peak height with maximum 1025 cm-1 is calculated. If value of ratio is in range from 1.1 to 1.9 nonspecific ulcerative colitis is diagnosed, and if value of said ratio is from 2.0 to 4.6 Crohn's disease is diagnosed. |
|
Laboratory method of diagnosing bipolar affective disorder Invention relates to medicine, namely to a method of diagnosing bipolar affective disorder. The essence of the method consists in the fact that reliable differences in the spectrum of protein distribution in blood serum without proteins albumin, immunoglobulin G, immunoglobulin A, antitrypsin, transferin and haploglobin in patients with endogenic psychosis. If protein spots are detected on electrophoretic gel in areas with the molecular weight of 200, 84, 75, 49, 40 kDa in the patient with endogenic psychosis, bipolar affective disorder is diagnosed. |
|
Method for determining female serum cytotoxicity to male monoclear cells Method involves determining female serum cytotoxicity to male lymphocytes, including a combined culture with reference male and analysed female serum in a 96-well tray in the presence of the nutrient medium RPMI 1640 in a CO2 incubator. One day later, lymphocytes are counted in the well in a Goryaev's chamber with the male (reference) and female (analysed) serum. That is followed by determining a cytotoxic index (CI), which represents a quotient of the analysed cell count and the reference cell count. The normal cytotoxic index makes approximately 0.7 and less. |
|
![]() |
High-sensitivity method for measuring number of components recovered from medicinal herbs Invention refers to a high-sensitivity method for measuring the amount of individual's blood plasma glycyrrhizin, glycyrrhetinic acid and their pharmaceutically acceptable salts. The high-sensitivity method for measuring the amount of glycyrrhizin, glycyrrhetinic acid and their pharmaceutically acceptable salts is characterised by the fact that a mixture of individual's blood plasma with methanol or ammonia water in the specific concentration is introduced into a solid phase having the reverse-phase distribution function and the anion exchange function; the solid phase is then washed with a cleaning fluid that is a single-component fluid or a mixed fluid of at least two components specified in a group containing water, alkali, alcohol and acetonitrile. That is followed by elution from the solid phase in acid alcohol specified in formic acid - methanol or formic acid - ethanol; that is followed by the stage of measuring glycyrrhizin, glycyrrhetinic acid and their pharmaceutically acceptable salts by liquid chromatography - mass spectrometry or liquid chromatography - mass spectrometry/mass spectrometry. |
Method comprises selection of only living, mature females of Trichuris vulpis from colon, blind gut of wild and/or domestic carnivorous animals infected spontaneously with whipworms in the study with helminthological methods when autopsy, into separate tubes with officinal isotonic solution (0.9%) of sodium chloride (solutio Natrii chlorati isotonica) and the exposure of the tubes with the females of Trichuris vulpis at t = 37.5-39°C for 5 hours under conditions of a thermostat. |
|
![]() |
Patient's peripheral venous blood is recovered to analyse genetic polymorphisms of coagulation factors VII 10976G/A FVII. A birth weight of a newborn of a woman delivering not for the first time in the stage of 37 and more weeks of pregnancy is determined by equation: y=6123.431-25.579x1+0.267x2+205.739x3, wherein y is an anticipated newborn's weight, x1 is a female's height in centimetres; x2 is an infant's weight at the previous delivery in grams, x3 is a genetic version of 10976G/A FVII locus with x3=1 for 10976 GG FVII genetic type, x3=2 for 10976 GA and 10976 AA FVII genetic types. A birth weight of a newborn of a woman delivering for the first time in the stage of 37 and more weeks of pregnancy is determined by equation: y=6278.037-21.739x1+232.170x2, wherein x1 is a female's height in centimetres; x2 is a genetic version of 10976G/A FVII locus with x2=1 for 10976 GG FVII locus, x2=2 for 10976 GA and 10976 AA FVII genetic types. |
Method for pre-operative detection of operation extent in patients with diffuse toxic goiter Pre-operative fasting venous blood 1 ml is sampled at room temperature 20-24°C into an anticoagulant-free vacuum system (test tube). The test tubes are delivered in a sealed container at temperature 2-8°C for 2 hours to a laboratory for immunoenzyme assay and analysed to determine anti-thyroid stimulating hormone receptor antibodies. If the antibody level is 1.5 units/l or more, a thyroidectomy is performed, whereas the antibody level of less than 1.5 units/l requires performing a subtotal thyroid resection according to standard techniques. |
|
![]() |
Invention refers to medicine, namely to a method for the prediction of a risk of early microvascular complications in the children suffering from type 1 diabetes mellitus. The substance of the method consists in defining a duration of the diseases in years, the patient's age in years, a desquamated endothelial cell count, high-density lipoprotein cholesterol, total cholesterol, triglycerides, atherogenic index, glycohaemoglobin, average daily glycaemic level; making a linear regression analysis and calculating a risk ratio (R) of early microvascular complications in the children suffering from type 1 diabetes mellitus by formula. If the risk ratio is ≥1, the high risk of early microvascular complications during one year is predicted; the ratio < 1 shows the low risk of microvascular complications during one year. |
![]() |
Method for automatic adjustment of time-varying parameter warning Group of inventions refers to medicine and can be used for patient's status monitoring. A method for setting a time-varying physiological parameter warning signal involves patient's controlled parameter monitoring, comparing the controlled parameter to an initial cut-off criterion, varying the cut-off criterion temporarily by a cut-off criterion of deterioration after the therapy, and then after a certain period of time, by the cut-off criterion after the administration. The time allowed involves comparing the controlled parameter to the cut-off criterion of deterioration, and after the time allowed - to the cut-off criterion after the administration. The warning signal is initiated in response to the controlled parameter of one or more initial cut-off criteria, the cut-off criterion of deterioration and the cut-off criterion after the administration. The group of inventions also refers to a machine-readable carrier with software for implementing the method and to a system for user warning on the controlled parameter variation. |
![]() |
Invention can be used for the purpose of the early prediction of cystic periventricular leukomalacia (PVL) in the newborns with very low (VLBW) or extremely low body weight (ELBW). Substance of the method: the newborns with VLBW and ELBW on the 3rd-7th day of life are examined to assess the perinatal medical history, namely the presence of chorioamnionitis and amniotic fluid nature, 5th minute Apgar score, the absence of prolonged artificial pulmonary ventilation, a severity of respiratory distress syndrome, the presence of pneumonia, sepsis, convulsive disorder, anaemia, laboratory signs of the systemic inflammatory reaction, average values of carbon dioxide, anionic bicarbonate and base deficiency in capillary blood, interleukine-6 and receptor interleukine-1 antagonist in venous blood serum. Each sign is assigned with a prognostic coefficient (PC). That is followed by determining total PC, and it is expected cystic PVL that is decided for if total PC is at least (+)9.5, whereas no cystic PVL is expected if total PC is (-)9.5 or less. |
Method for predicting antiviral treatment response in chronic hepatitis c Interferon is measured in plasmocytoid dendrite cells at week 12 of the treatment. Its gain in adults and children twenty times as much as compared to the pre-treatment initial level, or 2.6×102 times as much in adults, and 1.2×102 as much as compared to the normal values, the stable positive antiviral treatment response is predicted. |
|
![]() |
Invention represents a method for assessing the mucosal immunity state of open cavities accompanying the prediction of the clinical course of infectious-inflammatory processes, characterised by the fact that having a pathogenetic factor established, degrees of microbiocoenosis disturbances of a specific biotope are recorded with the use of a complex of methods for estimating colonisation resistance factors, namely normal microflora, opportunistic microflora, immunoglobulins G, M, A, secretory immunoglobulin A and sc component; the mucosal immunity state is assessed according to the degree of microbiocoenosis disturbance, and the favourable outcome implying agent eradication or chronisation with agent persistence is predicted. The invention also refers to a method for correcting the infectious-inflammatory processes with the Kipferon® immunomodulator added. |
![]() |
Method for laboratory control of physical load level on athlete's-volleyball player's organism Content of calcium and protein in oral liquid is determined before and after physical load, as well as a day after physical load. Recovery of content of calcium ions and protein in oral liquid after physical load to initial values is considered to be a criterion of total recovery of athlete's-volleyball player's organism, with evaluating time interval, required for said process. |
Invention relates to the field of veterinary and can be used to diagnose the presence of a pathological effect of iron dextran on the piglets' liver. The essence of the method consists in carrying out the morphological systemic step-by-step analysis of histological liver cuts with the description of its histological structure, measurement of the average quantity of binucleate hepatocytes, apoptotic bodies and cells of the mononuclear-macrophage system. If the complex of pathognomonic morphological changes, including the presence of blood filling of sinus capillaries, oedema of the Disse's space; swelling of the vascular endothelium, granular dystrophy of hepatocytes, increase of the average quantity of cells of the mononuclear-macrophage system, including haemosiderophages by two times and more, as well as an increase of the quantity of binucleate hepatocytes and apoptotic bodies by 2 times and more, the effect of iron dextran on the piglets' liver condition is considered to be pathological. |
|
After thymomegalia has been excluded, tissue specimens of three-day-old mature newborns are studied to evaluate areas of inflammation changes in points in the placental umbilical cord (A), in the foetal placenta (B), in the maternal placenta (C), in extraplacental membranes (D); then thymomegalia is predicted by a discriminant equation: DE=-0.350×A-1.176×B-1.690×C-1.203×D, wherein DE is a discriminator function with a threshold equal to - 15.00. If DE is equal to or more than the threshold, the absence of thymomegalia is predicted; if D is less than the threshold, thymomegalia is predicted, whereas the score is taken at: (A) - 1 point - no inflammation, 2 points - amnionitis, 3 points - leukocytic infiltration in the Wharton's jelly, 4 points - phlebitis, 5 points - arteriitis, 6 points - a combination of two or more areas of inflammation: in blood vessels or in vessels and in the Wharton's jelly, (B) - 1 point - no inflammation, 2 points - chorioamnionitis, 3 points - villusitis, 4 points - vasculitis, 5 points - intervillesitis, 6 points - a combination of two or more areas of inflammation, (C) - 1 point - no inflammation, 2 points - villusitis, 3 points - vasculitis, 4 points - intervillesitis, 5 points - deciduitis, 6 points - a combination of two or more areas of inflammation, (D) - 1 point - no inflammation, 2 points - amnionitis, 3 points - chorioamnionitis, 4 points - deciduitis, 5 points - choriodeciduitis, 6 points - a combination of two or more areas of inflammation. |
|
![]() |
Method of determining of copper content in muscle tissue of fish Method consists in determining in the scales of concentration of Mn and/or Cu by the method of atomic-emission spectrometry. The regression equation is calculated, and on the content of Mn and/or Cu in the scales a copper concentration is determined. |
Method of morphometric estimation of prognosis of course of aplastic anaemia after splenectomy After the ablation of the spleen, its weight is determined, the average area of a marginal zone of the spleen in histological cuts with coloration with hematoxylin and eosin is measured morphometrically. The obtained values are used to calculate the weight of the marginal zone and, if its values are ≤1.9 g, a favourable prognosis for the course of aplastic anaemia is made, if its value is >1.9 g, an unfavourable course of the disease is predicted. |
|
![]() |
Method for selecting therapeutic approach to female patients with oligomenorrhea and obesity Blood serum fasting adiponectin and leptin concentrations are measured in the morning in the female adolescents diagnosed with oligomenorrhea and obesity. An adiponectin/leptin ratio is derived. If the ratio is 0.6 or less, insulin resistance is stated in the female patients suffering oligomenorrhea and obesity, and the therapy is started with prescribing metformin, an insulin sensitiser. The adiponectin/leptin ratio of more than 0.3 enables diagnosing the absence of insulin resistance and prescribing hormonal contraceptives with drospirenone. |
![]() |
Method for measuring gastric content ph and estimating efficacy of antisecretory preparations Gastric content pH is dynamically estimated with the use of a nasogastric tube; the total gastric content pH is measured and the efficacy of the antisecretory preparations is estimated for one day, or a longer period of time if needed, every 3 hours. The pH value is measured by means of an analogue display unit on an analogue scale at a pitch of 1.0 within 1.0 to 12.0 for 15 s as shown by discolouration, with matching to the analogue scale. The acid production suppression is considered to be effective at pH of more than 4.0 after planned surgeries, and more than 6.0 after emergency surgeries. If the acid production suppression is found to be ineffective, the antisecretory preparation is supposed to be changed or increased in dose. |
![]() |
Analyser comprises a body with a case having a compartment for diagnostic strips or test strips used for the analysis and having a zone for a biological fluid, and contact elements for transmitting a signal to a processor of an analysing unit. The analysing unit comprises a slot-like receiver for the diagnostic or test strip used. The analyser also comprises an indicator unit displaying at least one analysis result. The case or diagnostic or test strips in the case have electronic elements including lot identification and calibration parameters data. The body comprises a responder reading out the above parameters from the electronic elements and transmitting them to the processor of the analysing unit. The case is configured as a covered drop of the back wall of the body forming a flat surface with projections separating the flat drop surface on compartments for the diagnostic strips or test strips arranged in parallel as at least a single row. The case can be configured as a parallelepipedic box attached to the drop surface of the back wall of the body or to the back part of the body. The covered box has some projections separating the box bottom on the compartments for the diagnostic strips or test strips arranged in parallel as at least a single row. The case can be also presented as a parallelepipedic box integrated into a cavity provided in the body and having a loading port connected to the side or back wall and covered. This box has some projections separating the box bottom on the compartments for the diagnostic strips or test strips. The body comprises a short-range transmitter/receiver unit capable to receive signals from the responder and the processor of the analysing unit to transmit and receive the data in the wireless mode to the medical equipment provided with a transmitter/receiver unit or a computer-assisted system, or a mobile communication device, or a mobile phone. |
Method for prediction of placental insufficiency in second trimester of pregnancy Invention represents a method for the prediction of placental insufficiency in the second trimester of pregnancy by the enzyme immunoassay of pregnant women's blood, differing by the fact that a known ultrasound procedure is used to determine the foetus's gender; pregnant women's venous blood angiogenic factors and cytokines are measured; if observing an increase of IL-12 of more than 3.2 pg/ml, the epidermal growth factor of more than 310 pg/ml, a decrease of the placental growth factor of less than 40.0 pg/ml in the pregnant women carrying the male foetuses, and an increase of ET-1 of more than 0.42 pg/ml, IL-1β of more than 17.6 pg/ml, TNF-α of more than 6.5 pg/ml in the pregnant women carrying the female foetuses, the above pregnant women are predicted to develop placental insufficiency. |
|
![]() |
Menstrual discharge supernatant in an amount of 0.2 ml is applied drop-shaped on the slide surface, covered with a cover glass, dried at a room temperature; the produced samples are microscopically analysed; if observing parallel structures therein, fast-growing hysteromyoma is diagnosed, whereas transient forms show simple hysteromyoma. The invention simplifies the differential diagnosis of simple and fast-growing hysteromyoma with normal endometrial structure, over a short period of time with using small amounts of biological fluids and minimum material inputs. |
![]() |
Method of estimating local cold injury in early reactive period Invention represents method of estimating degree of local cold injury in early reactive period, including separation of peripheral blood lymphocytes, estimation of expression of injury of plasma membrane of lymphocytes in state of blebbing by means of phase-contrast microscopy counted per 100 cells, calculation of index of lymphocyte blebbing ILB by formula: I L B = terminal blebbing × 100 initial + terminal blebbing ( % ) , obtained ILB index is multiplied by level of aspartate aminotransferase - AST, measured in mmol//h*l, with obtaining frostbite degree coefficient FDC, if FDC values are from 3.96 to 7.7 conv. units, II degree of local cold injury is diagnosed from 7.7 to 17.4 conv. units - III degree, higher than 17.4 conv. units - IV degree. |
![]() |
Spontaneous glow, an induction period and a fast flash amplitude over a period of 5 minutes of recording are measured, and an adaptation risk ratio (ARR) is calculated by formula: ARR=Cn-A/π, wherein: ARR is the adaptation risk ratio; Cn is the spontaneous glow; A is the fast flash amplitude; π is the induction period. If the ARR is 0.066-3.85 standard units, the adaptation is considered to be satisfactory, or compensated; the ARR falling within the range of 3.88-6.5 standard units stands for an adaptation tension; provided the ARR ranges 6.6-9.5 standard units, the adaptation is stated as unsatisfactory, whereas the ARR of 9.6 standard units and more shows an adaptation failure. |
![]() |
Method of neurosyphilis diagnostics Method of neurosyphilis diagnostics includes the microscopic analysis of cerebrospinal fluid samples, with carrying out edge dehydration of the cerebrospinal fluid samples, and their microscopic analysis being carried out in a polarised light; in case of the detection of anisotropic structures in the form of dendrites or spherulites inside which oval-shaped formations, containing lipids, are located, an early form of neurosyphilis is diagnosed; and in case of the detection of a multitude of ovals, aggregated in the form of balls, included in the anisotropic structures and/or located separately, late meningovascular neurosyphilis is diagnosed. The invention task is to obtain objective criteria for the diagnostics of neurosyphilis, provision of early, including pre-clinical diagnostics of the disease, reduction of the terms for obtaining data, reduction of costs for carrying out analyses. |
![]() |
Method for predicting acquired myopia in school children Invention refers to medicine, namely to a method for the prediction of acquired myopia in school children. The substance of the method consists in measuring blood haemoglobin concentrations in 6-8-year-old school children to detect haemoglobin deficiency as shown by the difference of an optimum haemoglobin concentration specific for the above age and an actual haemoglobin concentration in a child. If observing no haemoglobin deficiency at the age of 6-8 years old, a low risk of acquired myopia is predicted. The haemoglobin deficiency to 1.7 g/l enables predicting a risk of acquired low myopia. If the haemoglobin deficiency is 1.7 g/l and more, a high risk of progressive myopia to be developed into moderate or high myopia is predicted. |
![]() |
Invention represents a method for determining a probability of preserving the myocardium following infarction by creating an admission examination-based data array of 7 peripheral blood parameters, 11 biochemical analysis parameters and 6 parameters of standard 12-lead electrocardiogram in 200 patients with the Q-myocardial infarction and 200 patients without the myocardial infarction. The parameters are stratified with respect to 7 intervals, wherein values related to the probability of preserving the myocardium following infarction are derived by calculating a ratio of the patients without myocardial infarction to all the patients with acute coronary syndrome. The probability is evaluated in a specific patient by analysing the above parameters, searching the respective intervals and values related to the probability of preserving the myocardium in the data array. Summing up the derived values enables calculating an integrated index, which is normalised, and a dimension from 0 to 100% is reduced. |
![]() |
Capillary-action analytical device and manufacture thereof Group of inventions relates to surface hydrophilisation and immobilisation of antibodies on the surface of a cycloolefin copolymer. Disclosed method of making a capillary-action analytical device, which includes steps of: a) providing a capillary substrate, b) changing the hydrophilic property of the surface, c) mixing a matrix and immobilised molecules in solution form to obtain a solution which includes immobilised molecules covalently bonded to the matrix, and d) depositing the solution on a well defined region in at least one storage area. Also a capillary-action analytical device made using said method is described. |
![]() |
Method for determining degree of severity of infantile cerebral paralysis in infants Invention refers to medicine, namely to a method for determining a degree of severity of infantile cerebral paralysis in infants. The method consists in measuring clinical signs of the disease; the infant's peripheral blood is analysed for erythrocytes with micronuclei; the clinical signs of the diseases are rated according to the Rivermead scale; an enzyme immunoassay is used to measure the tumour necrosis factor (TNF-α) in the infant's peripheral blood serum in the infants suffering from infantile cerebral paralysis, measured to the clinical signs; if the measured erythrocytes with micronuclei are found in the number of 0.55±0.14%, whereas serum TNF-α increases to 6.14±3.025 pg/ml, a moderate degree of severity is stated, while the measured count of erythrocytes with micronuclei is 1.27±0.47% and more with the serum TNF-α of 9.58±0.39 pg/ml and more shows a severe degree. |
![]() |
Method of obtaining overall fraction of extracellular nucleic acids from blood Method includes collecting blood in an anticoagulant solution, adding an equal volume of an elution buffer containing 1 M NaCl, 0.2 M NaHCO3 (pH 9.3), 20 mM EDTA or a buffer containing 1 M NaCl, 20 mM EDTA. The obtained mixture is incubated at room temperature for 4-6 minutes while stirring, followed by separating the collected blood into plasma and a blood cell fraction by centrifuging and collecting the supernatant fluid, from which the overall fraction of extracellular nucleic acids (exNA) is extracted. |
Clinical anamnestic parameters are determined in the patients with hyperplastic processes in the endometrium, and a hysteroscopy with an endometrial biopsy is performed. The activity of calpains, total activity of proteasomes, and activity of 20S proteasomes are determined. Age-dependent discriminator functions Y1 and Y2 are determined by formulas. If Y1>Y2, the patient is referred to a group of low risk of endometrial cancer development. If Y1<Y2, the patient is referred to a group of high risk of endometrial cancer development. |
Another patent 2551047.
© 2013-2015 Russian business network RussianPatents.com - Special Russian commercial information project for world wide. Foreign filing in English. |