Analysis method of eml4-alk translocations associated with sensitivity of lung cancer to antitumour target therapy

FIELD: biotechnologies.

SUBSTANCE: proposed method involves the following: obtaining EML4-ALK cDNA by means of a polymerase chain reaction with reverse transcription (RT-PCR) on RNA matrix of EML4-ALK gene using specific primers; amplification of fragments of EML4-ALK gene by means of a multiplex PCR method on cDNA matrix obtained at the first stage of RT-PCR by means of high-specific primers; obtaining fluorescent-marked PCR-product at the second stage of RT-PCR; creation of a biochip for analysis of EML4-ALK translocations, which contains a set of immobilised probes; hybridisation of fluorescent-marked PCR-product with probes in gel cells on a plastic substrate of the biochip; recording and interpretation of hybridisation results. The method provides for use of a technology of DNA biochips designed for the purpose of determining 6 versions of EML4-ALK translocations (V2, V3, V5, V4, V7, V1).

EFFECT: method has high sensitivity and specificity; it is general-purpose, and its implementation is possible with operating material and tumour tissue enclosed in paraffin units; recording of results is performed on a single occasion at the end of the investigation; the method's implementation lasts for less than 24 hours.

3 dwg, 3 tbl, 3 cl

 

The invention relates to medicine, namely to genetics, molecular biology, Oncology, and relates to a method of determining the sensitivity of lung cancer to anticancer targeted therapies, modern methods of treatment with drugs aimed at receptors of tumor cells.

There is a method of analysis of translocations EML4-ALK using a primer set that allows you to amplify the studied fragment and analyze the results using polymerase chain reaction (PCR) in real time, capillary or conventional gel electrophoresis and a set of antibodies for immunohistochemical analysis, allowing to identify mutant proteins (international patent application WO 2011087709).

The disadvantages of the method: this method has limited application because of the expensive reagents and equipment for its implementation.

There is a method of analysis of translocations ALK gene, including the inversion of EML4-ALK, using fluorescent in situ hybridization (FISH) and real-time PCR (international patent application WO 2011087709).

The disadvantages of the method: the use of expensive reagents specific and expensive equipment, the study takes more than 24 hours.

There is a method of analysis of translocation EML4-ALK for the diagnosis and therapy of non-small cell lung cancer with the use of shall is dinoi PCR with reverse transcription (RT-PCR) and antibodies to the chimeric protein (international patent application WO 2011095894).

The disadvantages of the method: the implementation of this method requires expensive reagents and equipment.

Closest to the claimed method (prototype) is a method of analysis of the translocation of the gene ALK, including EML4-ALK, using fluorescent hybridization with biochips. The prototype includes the following techniques: isolation of the RNA matrix of the biological material; a two-step standard RT-PCR; manufacture of probes representing amplificatoare DNA sequences complementary to the analyzed portion of a gene; the hybridization of fluorescently-labeled product obtained by RT-PCR with a probe on the biochip; analysis of hybridization results using a scanner and special computer programs (international patent application WO 2010132888).

The disadvantages of the method: for this method, use of expensive test system; analysis of genetic changes takes more than a day, it is possible nonspecific hybridization of the PCR product with the probe, which reduces the sensitivity and accuracy of the method; requires non-fixed in formalin biological material.

The task of the invention is to create a new, more accurate, simple, less expensive and takes less time way analysis of translocations EML4-ALK associated with the sensitivity of the aka easy target for anticancer therapy.

The technical result. The inventive method is simple in execution, is economically justified, is carried out without the use of special expensive equipment; has a high sensitivity and specificity, universal, its implementation is possible with operational material and tumor tissue enclosed in paraffin blocks, the registration results produced once at the end of the study, the method takes less than 24 hours.

The essence of the proposed method lies in the analysis of translocations EML4-ALK associated with sensitivity of lung cancer to targeted anticancer therapy, using the technology of multiplex RT-PCR and subsequent hybridization of fluorescently-labeled PCR product with biological microarray (biochip), in the cell which is applied a highly specific probes for differentiation of hybridization signals. Analysis of the hybridization results by using the detecting system of the detection of fluorescent signal portable analyzer biochips, equipped with a CCD camera with special software.

The inventive method of analysis is based on the definition of the 6 options translocations EML4-ALK (V2, V3, V5, V4, V7, V1) using multiplex RT-PCR and biochip containing a set of immobilized differentiating probes for GI is realizatsii with PCR products.

The method is illustrated by figures 1-3 and tables 1-3.

Figure 1 shows the diagram of a biochip for the analysis of translocations EML4-ALK.

Figure 2 presents a picture of hybridization of the experimental sample of the tumor, not carrying translocations EML4-ALK.

Figure 3 - picture of a tumour sample, carrier variant translocation EML4-ALK V3.

In table 1 presents selected sequences of forward and reverse primers for RT-PCR.

Table 2 presents the sequence of the primers for the first stage multiplex PCR (SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 18).

In table 3 presents the sequence of a set of 11 probes used for the manufacture of a biochip (SEQ ID NO: 21-31).

The inventive method includes the following techniques: obtaining cDNA EML4-ALK using RT-PCR on the RNA matrix gene EML4-ALK using specific primers; the amplification of fragments of the gene EML4-ALK by multiplex PCR on the matrix cDNA, obtained at the first stage RT-PCR using a set of highly specific primers; the production of fluorescently-labeled PCR product from the second stage RT-PCR; the creation of a biochip for the analysis of translocations EML4-ALK containing a set of immobilized probes, hybridization of a fluorescently-labeled PCR product probes in gel cells on a plastic substrate of the biochip; registration and interpretation of hybridization results.

The inventive method is sudestada as follows. The first step was taken biological material - tumor tissue, frozen in liquid nitrogen or enclosed in paraffin blocks. Fragments of tumor tissue were crushed or removed with a sterile scalpel from glasses by Microdissection, suspended and isolated total RNA using a kit RNeasy FFPE Kit.

Analyzed the sequence of the gene EML4-ALK amplified using RT-PCR. For amplification of the gene EML4-ALK (V3a) the primers used were SEQ ID NO: 11, 15. PCR-mixture of the first stage of a total volume of 25 μl contained 1 × PCR buffer (Tris-Hcl - 67 mm, pH 8.6, (NH4)2SO4- 166 mm, 0,01% Triton X-100), MgCl2- 1.5 mm, dNTP - 0.2 mm, 2.5 U Taq polymerase, primers, 0.2 μm (SEQ ID NO: 11, 15) and 20 ng DNA. Amplification was performed as follows: denaturation at t=94°C for 3 min 30 s and then 35 cycles of amplification at t=94°C for 30 s, at t=62°C for 20 s, at t=72°C for 10 s, and elongation at t=72°C for 3 minutes

The mixture of the second stage PCR differed in composition, concentration, temperature, annealing of primers, and contained a direct primer - 0.2 μm (SEQ ID NO: 12)reverse primer - 2 μm (SEQ ID NO: 16). For fluorescent labeling of PCR product from the second stage to the mixture was added fluorescently-labeled dUTP-Su - 0.2 nm, which was built in the circuit in the amplification process. For this standard, the reaction mixture was added an excess of one of the pair is rymarov and fluorescent labels (deoxynucleotidase Su-dUTP), received excess fluorescently-labeled single-stranded PCR product amplicon capable of hybridization with allele-specific probes immobilized in the cells of the biochip.

Obtained at the first stage RT-PCR cDNA was used as matrix and amplification was performed according to the scheme: denaturation at t=94°C for 3 min 30 s, then 35 cycles of amplification at t=94°C for 30 s, at t=56°C for 20 s, at t=72°C for 10 s, then the elongation at t=72°C for 3 minutes

Primers and probes were synthesized using phospholidine method for automated DNA/RNA synthesizer. In table 1 presents selected sequences of forward and reverse primers for RT-PCR. Modified probes for the introduction of active groups was carried out as in automatic mode during the synthesis using a wide range of commercial modifiers, and after synthesis, in manual mode. In the synthesis of probes with 3'-Amino-Modifier C7 CPG 500 3'-end was attached sequence-spacer with a free amino group for further immobilization of the probe in the cell biochip.

Table 2 presents the sequence of the primers for the first stage multiplex PCR (SEQ ID NO: 3, 5, 7, 9, 11, 13, 15, 17, 18). In the second stage, the primers used were SEQ ID NO: 4, 6, 8, 10, 12, 14, 16, 19, 20. To optimize PCR used only primers that are not formed between the high is kinergetics internal structures such as hairpins and duplexes, and ensure specific amplification of the necessary quantity of the product. Annealing of primers was carried out at the same temperature. Optimized these parameters PCR, as the concentration of MgCl2and primers in the PCR mixture, the ratio of forward and reverse primers, the number of cycles of amplification, elongation time, denaturation and annealing of the primers in the first and second stages of the PCR.

Probes to be immobilized on the biochip and the primers were selected to identify all selected for analysis translocation EML4-ALK variants. Then there was the hybridization of fluorescently-labeled PCR products obtained after the second step RT-PCR with immobilized cells in gel probes - plots of the gene EML4-ALK, complementary to the gene sequence of a wild type or mutant gene.

Amplicons were denaturiruet by heating of the hybridization mixture at t=95°C for 5 min followed by rapid cooling on ice for 2 min and then held hybridization SSPE buffer 1X. The composition of the buffer 20 X: NaCl - 174 g, Na3C6H5O7- 88,2 g deionized H2About 800 ml, EDTA - 7,4 g, brought the pH to 7.0 with 1 ON NaOH solution (6.5 ml), then the volume of the buffer was brought H2About up to 1 l and sterilized by autoclaving. Duration hybridization was 12-14 h at t=37°C.

Analysis of genotypes and alleles in the sample wire is whether taking into account the location of the probes on the biochip, scheme of which point to variant translocation. If you have a stable of perfect duplexes between the PCR product and the probe was obtained fluorescence signal. In the absence of complementarity between the PCR product and the probe fluorescence signal was absent.

Biochips made by sequential deposition of cells acrylamide gel on a plastic substrate matrix with immobilization of the probes in the appropriate cells. For immobilization of the used probes, carrying the 5'- or 3'-end of the active group. In table 3 presents the sequence of a set of 11 probes used for the manufacture of a biochip (SEQ ID NO: 21-31). Discrimination of perfect and imperfect duplexes was performed after washing the biochip, comparing the intensity of the fluorescent signals in the respective cells of the biochip. For this purpose, the biochip was washed in buffer and salt: 20X SSC: NaCl - 175, 3 g, Na3C6H5O7- 88,2 g and deionized H2About 800 ml, brought the pH to 7.0 with 10 N NaOH and the volume to 1 l, then autoclaved. Then analyzed the resulting fluorescent picture by using the detecting system of the detection of a fluorescent signal - portable analyzer biochips, equipped with a CCD camera and special software produced by LLC "Biochip-MPI" (Russia), and made a conclusion about the genotype is the tumor in the sample.

The presence of the translocation was associated with a sensitivity of lung cancer target for anticancer therapy. Diagram of a biochip for the analysis of translocations EML4-ALK presented in figure 1. The primers in the first two cells in the top row correspond to the control sequence. In the cells of the bottom row caused the primers corresponding to the gene ALK, in the first, second and third row primers corresponding to various translocations EML4-ALK. Picture hybridization sample of the tumor, not carrying translocations EML4-ALK presented in figure 2. Fluorescent signal is observed only in cells of the biochip with primers, control for RT-PCR, therefore, analyzed the sample does not contain translocate EML4-ALK. Picture of a tumour sample, carrier variant translocation EML4-ALK V3, presented on figure 3. Fluorescent signal was observed in cells with primers corresponding to the translocation EML4-ALK (V3a), the analyzed sample contains this variant translocation. When comparing paintings hybridization samples of tumors without translocations and samples of tumors with translocations shown that the sensitivity and specificity of the proposed method is less than 1% of the cells with the mutation, translocation AML4-ALK) 99% of cells carrying the translocation.

Table 1
The method of analysis of translocations EML4-ALK,associated with the sensitivity of lung cancer to anticancer targeted therapies
NameSEQSequenceLengthTSize
primersID NO:5'-3'base pairsannealing,°Cthe amplicon, base pairs
EML4-RT1GCTGCCCTCTTCAC1440-
ALK-RT2CGAATGAGGGTGATG1542-

EML15-1
Table 2
The method of analysis of translocations EML4-ALK,associated with the sensitivity of lung cancer to anticancer targeted therapies
Option NameSEQSequenceLengthTSize
primersID NO:5'-3'base pairsannealing, °Cthe amplicon, base pairs
V1EML13-13GCCAAAATTTGTGCAGTGTTT2163249
EML13-24GTGGAGTCATGCTTATATGG2058137
V2EML20-15CACACACCTTGACTGGTCC1962195
EML20-26CTAACTCGGGAGACTATGAATTG2358101
V47GGGATGTTATTAACTGGAGGA2162167
EML15-28ATCTGAATCCTGAAAGAGAAG215759
V7EML15-19GGGATGTTATTAACTGGAGGA2163191
EML15-210ATCTGAATCCTGAAAGAGAAAT225883
V3EML6-111CACATAATTCTTGGGAAAATTCA2362250
EML6-212CACCCAAATTAATACCAAAAGT2257137
V5EML2-113 GCTGATGTTTTGAGGCGTCTTG2262197
EML2-214GAAGATCATGTGGCCTCAG1957114
ALKALKR-115CAAAGCAGTAGTTGGGGTTGT2162
ALKR-216GCTCAGCTTGTACTCAGGGC2062
EML4K23F117CCCTGCTCCAAAGCAAAG1864349
K23R118CACTTGGCTCCACAGTTTGTT2163
K23F219GGTGGAAAAGACATGAGCA19 56194
K23R220CTTATTCTACTTTCCTCTTCAG2056

Table 3
The method of analysis of translocations EML4-ALK,associated with the sensitivity of lung cancer to anticancer targeted therapies
OptionSEQSequence probeLength
mergeID NO:5'-3'BP
VI21CTACTGTAGAGCCCACACCT20
V222ATGAAATATTGTACTTGTAC20
V423AAATAGAGATATGCTGGATG20
V724CACACTTTGTCAGATGAGAA20
V325GTTACCAAAACTGCAGAC (V3a)18
26CCAAGCAAAAATGTCAACT (V3b)19
V527GAAAAAATCAGTCTCAAGTA20
ALK28AGCCATGCAGATGGA15
29CAGGAGCTGCAAGCC15
EML4K30TGAGACTGTAGCGGATAC18
31CACTGAAAGTGTCATCCAAT20

1. The method of analysis of translocations EML4-ALK,associated with the sensitivity of lung cancer to targeted anticancer therapy includes: obtaining cDNA EML4-ALKwithby using a PCR reaction with reverse transcription (RT-PCR) on RNA matrix EML4-ALKwith specific primers (SEQ ID nos: 1-2); the amplification of fragments of the gene EML4-ALKby multiplex PCR on the matrix cDNA with specific sets of primers (SEQ ID NO: 3-20); receipt of the fluorescently-labeled PCR product from the second stage RT-PCR; the creation of a biochip for the analysis of 6 options translocations EML4-ALK(V2, V3, V5, V4, V7, V1), containing a set of immobilized differentiating probes (SEQ ID NO: 21-31); hybridization of fluorescently-labeled PCR product with the probes in the cells of the biochip; registration and interpretation of hybridization results.

2. The method according to claim 1, wherein to identify translocations EML4-ALK,amplified using a set of specific primers, using the biochip, representing a plastic substrate with gel cells containing a set of immobilized probes, complementary to the analyzed sections of the gene EML4-ALK.

3. The method according to claim 1, in which the registration of the results of hybridization is performed using a portable device, registering and recording the fluorescence signals.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention proposes a method involving stages of preliminary extraction of genomic RNA, extraction of a specific fraction of single-stranded G-overhanges of telomeric RNA and further amplification of their negative chain with duplex-specific analysis; besides, amplification stages include modification of 3'-ends of telomeric overhangs by means of terminal deoxynucleotidyl transferase and are implemented using a set of primers SEQ ID NO: 1-5. The duplex-specific analysis is based on hybridisation of minus chains of overhangs with a set of specific fluorescent marked probes SEQ ID NO: 6-11, which correspond to six possible versions of nucleotide endings of G-chain of telomeric human RNA. A buildup degree of probes in presence of a ferment of duplex-specific nuclease serves as a criterion of presence of the corresponding version of the nucleotide ending and a measure of its quantitative content. Obtained profiles of terminal nucleotides of G-chain of telomeric RNA serve as proliferative markers pointing at an activation degree of cell fission and determining time duration of a cellular cycle.

EFFECT: invention is a new kind of RNA diagnostics, intended for detection of changes of nucleotide endings of RNA of telomeric areas of chromosomes, which occur in the cellular cycle process, and can be used in medicine for diagnostics and treatment of cancer, in immunology, transplantology, cosmetology, dermatology, gerontology, cellular biotechnology and other areas involved in evaluation of a proliferative state of a cell and methods of its directed control.

15 cl, 9 dwg, 8 tbl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: invention refers to a method of species identification of L.casei/paracasei, L.fermentum, L.plantarum, L.rhamnosus lactobacilli. The proposed method involves performance of a PNR reaction with species-specific primers; besides, primers are built, which are specific to the first gene of operon FIFO ATP of synthase (a gene of subunit a) and a gene of uracylphosphoribosyltransferase, which precedes it, for L.casei/paracasei and L.rhamnosus and a gene of uracyltransport protein for L.plantarum and L. fermentum.

EFFECT: proposed solution can be used for identification of kinds of lactobacilli in different specimens of human and animal organisms, in pharmaceutical preparations and in food products.

2 cl, 1 dwg, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: method for determination of foetus Edwards syndrome, where from pregnant women plasma extracted is extracellular DNA, it is subjected to disulfide conversion succeeded by polymerase chain reaction and further mass parallel sequenation of differential methylated sites; as control of differential methylated sites used are sites with various levels of methylation of a mother and a foetus, data are analysed by determination of relation of reading quantities obtained by sequenation of differential methylated sites of DNA on purpose and control chromosomes, where in case of trisomyunder constant quantity of foetus DNA readings, charted on differential methylated sites of chromosomes there will be observed quantity of readings charted on purpose chromosome to quantity of readings on control chromosomes equal to 3/2, while as a norm this relation will be constant equal to 1.

EFFECT: method may be used in medicine for prenatal diagnostics of foetus transmittable diseases.

3 cl, 1 tbl

FIELD: biotechnologies.

SUBSTANCE: invention refers to markers system presenting a group of micro-RNA genes: miR-129-2, miR-125bl, miR-137 and miR-375 for diagnostics of non-small-cell lung cancer including epidermoid cancer and adenocarcinoma. Detection of methylation of at least one marker from this system serves as a diagnostic feature.

EFFECT: markers system allows detection of non-small-cell lung cancer at early clinical states of disease with high clinical sensitivity and specificity.

4 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to laboratory diagnostics, medical virology, molecular biology and epidemiology. The invention aims at detecting and identifying the eleven groups of intestinal viruses (enteroviruses (EV), polioviruses (PV), rotaviruses A and C (RVA and RVB respectively), adenoviruses (ADV), noroviruses (NV), sapoviruses (SV), hepatitis A and E viruses (HAV and HEV, respectively), astroviruses (AV), ortorheoviruses (ORV) in clinical samples and eluates prepared by water concentration in the presence of internal positive control (IPC) by real-time multiplex PCR.

EFFECT: approach enables improving the PCR procedure for the purpose of diagnosing acute intestinal infections (AIIs) and can find application in preventative disinfection departments for the purpose of monitoring of the epidemiologic situation and fast interpretation of the AII breakouts.

7 cl, 4 tbl, 6 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and particularly to a method and diagnostic kit for diagnosing whooping cough and determining avirulent mutants of the whooping cough causative agent. The method involves carrying out a real-time polymerase chain reaction and detecting amplification products using hybridisation with fluorescent specific DNA probes. Polymerase chain reaction (PCR) is carried out using a PCR reaction mixture which comprises two pairs of primers that are suitable for amplification of fragments of sequences 1S481 and IS1002, a pair of primers for amplifying a sequence formed from insertion of IS481 and IS1002 into the cctagg site of the operon bvgAS B.pertussis, two fluorescent probes that are specific for the sequences IS481, IS1002 and the sequences formed from insertion of IS481 and IS1002 into the cctagg site of the operon bvgAS B.pertussis. The number of bacterial genones in the sample is determined from presence of sequences IS481 and IS1002 in the chromosome of B.pertussis bacteria, and the number of avirulent mutants of the causative agent is determined from presence of the insertion of IS481 and IS1002 into the cctagg site of the operon bvgAS B.pertussis. The diagnostic set comprises PCR reaction mixture, which comprises two pairs of primers that are suitable for amplification of fragments of sequences 1S481 and IS1002, a pair of primers for amplifying a sequence formed from insertion of IS481 and IS1002 into the cctagg site of the operon bvgAS B.pertussis, two fluorescent probes that are specific for the sequences IS481, IS1002 and the sequences formed from insertion of IS481 and IS1002 into the cctagg site of the operon bvg.

EFFECT: invention enables to diagnose whooping cough and determine avirulent mutants of the whooping cough causative agent.

5 cl, 1 dwg, 2 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a method of producing novel diad compounds (I) having two different chromophoric fragments that are not coupled to each other and contain azo groups and ferrocene residues, and use thereof to extinguish fluorescence of fluorophores (I) where Fc is ferrocenyl; R1-H or Fc;R2 is H or ortho- or para-hydroxy-; R3 is ortho- or meta-, or para-nitro-, or ortho- or meta-, or para-nitrophenylazo-, or para-N,N-dimethylamino-, or para-carboxy-; L is para-carbamoyl vinylidene acetophenone or para-carboxamidovinylidene acetophenone, or para-N-(2-carbamoylethyl)-carboxamidovinylidene acetophenone, or para-(4-[methylamino] butoxy)-vinylidene acetophenone, or N,N-di[4{1-(para-vinylidene acetophenylamino)-methyl-1,2,3-triazolyl}butyl]amino group. The method of producing (I) involves aldol-crotonic condensation of ferrocene aldehyde with para-substituted acetophenone and reacting the obtained ferrocenylidene acetophenone (2) with an azo compound, or adding to (2) reactive groups and azo coupling with a diazo salt. Effectiveness of (I) in extinguishing fluorophores in a solution and in a composition of nucleic acids in a wide spectral range is shown, which enables to use (I) to label biological macromolecules and design oligonucleotide hybridisation probes for molecular diagnosis methods.

EFFECT: diad compounds (I) have high molar extinction coefficients, a wide absorption spectrum and electroactivity; also described is a method of extinguishing fluorescence of fluorophores in double-stranded structures of nucleic acids using (I).

2 cl, 8 dwg, 2 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: there proposed is the method, composition and application of polar aprotic solvent with cyclic main structure for hybridisation of nucleic acid sequences.

EFFECT: invention can be used in hybridisation analysis.

19 cl, 25 tbl, 1 dwg, 22 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents method for revealing c.-53-2A>G mutation in SLC26A5 gene accompanied with the development of non-syndrome-based autsomal-recessive deafness. Method includes DNA separation from lymphocytes of peripheral blood by method of phenolic-chloroform extraction. There performed is a polymerase chain reaction with the possibility to perform fluorescence analysis at final point. Two areas of SLC26A5 gene are simultaneously amplificated in mixture of two pairs of sequences of oligonucleotides with fluorescent mark: CACCACAAAGAAGAGATG, TCAGCATGATCCATAGTAC, FAM- agtgtCacTagGggaaaa-BHQ-1, VIC-agtgtCacCagGggaaaa-BHQ-2, flanking the area with possible mutation of c.-53-2A>G in SLC26A5 gene.

EFFECT: invention allows obtaining accurate, objective clinical diagnosis of genetic autsomal-recessive deafness.

1 dwg, 2 tbl, 2 ex

FIELD: biotechnologies.

SUBSTANCE: methods, compositions and sets for diagnostics of osteoarthritis at cat family are disclosed. According to the invention, the methods involve detection of differential expression at least of one marker in a sample of an organism, preferably in blood sample, where biomarker is differentially expressed at osteoarthritis.

EFFECT: improving diagnostics accuracy.

23 cl, 4 dwg, 7 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention refers to creation of recombinant plasmids providing expression of poly-epitopic tumour-associated antigens in dendritic cells capable of stimulation of specific cytocidal cells, and it may be used in medicine. Recombinant plasmid DNA pCI-UB-POLYEPI contains 11 epitopes of tumour-associated antigens of colorectal cancer, its size is 6 355 n. p. and it expresses the following amino acid sequence: DYKDDDDK-LLGVGTFVV-ADRIW-GLKAGVIAV-AAYARY-VLAFGLLLA-ADRIW-YQLDPKFITSI-AAYARY-IMIGVLVGV-ADRIW-YLSGADLNL-AAYARY-CGIQNSVSA-AAYARY-LLLLTVLTV-ADRIW-QYIKANSKFIGlTEL-ANIY-SIINFEKL-ARY-SASFDGWATVSVIAL-ARY-SERVRTYWIIIELKHKARE-ARY-IQNDTGFYTLHVIKSDLVNEE. Mature dendritic cells obtained by adding to immature dendritic cells of pro-inflammatory TNF-α (tumour necrosis factor) cytokine are transfected by constructed plasmid DNA pCl-UB-POLYEPI thus activating them. Then activated dendritic cells are cultured together with peripheral mononuclear blood cells of people sick with colorectal cancer for generation of antigen-specific antitumour cytocidal cells.

EFFECT: invention allows efficient generation of antigen-specific cytocidal cell with antitumour activity in vitro, required for immune response by the 1-st type T-helper to colorectal cancer antigens.

2 cl, 1 dwg, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents plasmide determining synthesis of α-galactosidase α-PsGal, which includes Ncol/Sall - fragment of plasmid pET-40b(+) (Novagen) and DNA fragment, with the size of 2142 pairs of bases, which contains a chimeric gen consisting of structural part of gene α-PsGal, which is adapted on N-end for expression in E. coli cells, and a nucleotide coding a specific sequence for enteropeptidase. The invention also refers to strain E. coli Rosetta (DE3) transformed with the above plasmid - producer of chimeric protein containing amino-acid sequence of recombinant α-galactosidase α-PsGal and sequence specific for enteropeptidase. The invention also refers to a method for obtaining recombinant α-galactosidase α-PsGal, which involves the following stages: incubation of the above strain-producer in liquid nutritional medium LB during 12 hours at 16°C, deposition of bacterial cells by centrifugation, disintegration of a suspension of cells in a buffer, centrifugation of an extract, chromatography of above-deposit liquid on a column with metal affine resin, elution of protein, concentration of active fractions by means of ion-exchange resin, incubation with enteropeptidase and separation of a target product by gel-filtration.

EFFECT: invention allows obtaining more active and stable recombinant alpha-galactosidase with high efficiency degree.

3 cl, 1 dwg, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention describes polynucleotide, expression vector, host cell and production method of humanised antibody together with their use, as well as medical preparation against rheumatoid arthritis, prophylaxis or treatment method of rheumatoid arthritis and use of humanised antibody at production of pharmaceutical preparation for prophylaxis or treatment of rheumatoid arthritis. This invention can be used in therapy of human diseases associated with α9 integrin.

EFFECT: improved activity and thermal stability.

14 cl, 6 dwg, 6 tbl, 11 ex

FIELD: biotechnologies.

SUBSTANCE: expression vector includes: (a) replication origin OriP obtained from Epstein-Barr virus (EBV), where replication origin contains: 1) symmetry element of the second order (DS); and 2) duplication section (FR) that contains fixation point EBNA; (b) replication origin SV40; (c) insertion section for inserting a gene of concern; (d) promoter EF-1b functionally bound to the insertion section; (e) poly-A signal; (f) bacterial replication origin; (g) selected marker; and unnecessarily containing (h) sequence of nucleic acid, which codes constant area of heavy or light chain of antibody, which is functionally bound to the insertion section. With that, replication origin OriP is bound to an initiation factor of replication EBNA 1, which acts from outside and is not coded with an expression vector.

EFFECT: use of an expression vector in an extracted host cell, a set and a method for obtaining recombinant protein provides production of abundant protein expression.

26 cl, 25 dwg, 3 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, neurobiology and pharmacokinetics and deals with method of obtaining valid molecular-genetic model of human absence epilepsy. Claimed method consists in the following: parent individuals P with genotype A1/A1 of gene DRD2 are identified by means of genotyping of Taq 1A DRD2 locus in rats of WAG/Rij line, crossed with each other with obtaining offspring F1, which is grown to reproductive age, after that, nonaudiogenic individuals are identified among offspring F1, after which nonaudiogenic individualsof offspringF1 are crossed with each other to obtain offspring F2, which is then also grown to reproductive age with the following selection of nonaudiogenic individuals among them, crossing and selection being performed repeatedly to obtain homogeneous population of nonaudiogenic rats of WAG/Rij line with genotype A1/A1 of gene DRD2, control of "ПВР" type in selected individuals of offspring F1 for further crossing is carried out by means of encephalographic analysis, which includes morphological control.

EFFECT: invention can be used for pre-clinical tests of anti-epileptic medications.

1 dwg, 1 tbl

FIELD: biotechnologies.

SUBSTANCE: invention represents bacterium of Escherichia family, which produces L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. With that, bacterium is modified so that expression of bssR gene in the above bacterium is strengthened. The invention also refers to the method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine using the above bacterium.

EFFECT: invention allows obtaining aminoacids with high efficiency degree.

4 cl, 2 tbl, 14 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. The method involves growth of bacterium of Enterobacteriaceae family, which is modified so that expression of yeel gene in the above bacterium is strengthened, and extraction of the above L-aminoacid from cultural liquid.

EFFECT: invention allows obtaining L-aminoacids with high efficiency degree.

5 cl, 2 tbl, 14 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. The method involves growth in nutritional medium of bacterium of Escherichia family, which is modified so that expression of ycfR gene in the above bacterium is strengthened, and extraction of the above L-aminoacid from cultural liquid.

EFFECT: invention allows obtaining L-aminoacid with high efficiency degree.

4 cl, 2 dwg, 14 tbl

FIELD: biotechnologies.

SUBSTANCE: invention proposes a production method of a nanosized delivery system of fragments of nucleic acids (FNA) and their analogues to cells of mammals. A suspension of TiO2 nanoparticles with concentration of 1-2 mg/ml in 0.1-0.5 M solution of NaCl is obtained. With that, TiO2 particles have the size of 3-20 nm, and mainly 3-5 nm, and are contained in amorphous or crystalline anatase or brookite form. The obtained TiO2 suspension is mixed with water solution of polylysin with concentration of 20 mg/ml in the ratio of TiO2 to polylysin, which is equal to 1:(0.05-0.8). The mixture is incubated at room temperature during at least 30 minutes. Then, to the obtained suspension of polylysin-containing nanoparticles there added is 5-70 mcL of FNA solution with concentration of 10-4-10-7 M and incubated in 0.1-0.5 M solution of NaCl at room temperature during 20-30 minutes. Nanocomposite TiO2-PL FNA with capacity as per FNA of 0.2-60 nmol/mg is obtained.

EFFECT: invention allows simplifying a production method of FNA delivery system and shortening its duration.

4 cl, 3 dwg, 14 ex

FIELD: biotechnology.

SUBSTANCE: vector plasmids ("docking vectors") are proposed for the synthesis of transgenes (RES), which represent a cloning vector, which is included in the cloning module consisting of four gene joints (GJ 1-4) and three nucleotide sequences (NS 1-3) located between them, where each of GJ comprises from 2 to 4 non-variable rare restriction sites from more than 6 nucleotides, and the nucleotide sequences between GJ include "inserts" which while cloning are replaced in the NS 1 by the promoter module, in the NS 2 by expression module and in NS 3 by 3'-regulatory module. At that, either GJ 1 or GJ 2 independently contain 3-4 non-variable rare restriction sites of more than 6 nucleotides. According to the invention, the variation of connection vector RES is also proposed which is designed for the multiple cloning (MC), and characterised in that at least one of the three NS is the module of multiple cloning with a site of multiple cloning comprising common restriction sites which are unique in the docking vector RES.

EFFECT: improvement of the method.

6 cl, 21 dwg

FIELD: molecular biology.

SUBSTANCE: the suggested innovation deals with the fact that nucleic acids should be isolated directly out of the sample without pipetting stage but with the help of interconnected reservoirs being prepared beforehand. The above-mentioned vessels should be applied either separately or being interconnected according to standard microtitrating format. The sample should be mixed with a lyzing buffer and nucleic acids are bound with matrix in closed system including, at least, two interconnected reservoirs. Forced movement of sample's mixture and buffer back and forth from one reservoir into another one for several times through narrow passage provides their thorough intermixing. The method provides quick and safe isolation of nucleic acids.

EFFECT: higher efficiency.

44 cl, 4 dwg, 1 ex

Up!