Method of obtaining valid molecular-genetic model for pre-clinical tests of novel anti-epileptic medications

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, neurobiology and pharmacokinetics and deals with method of obtaining valid molecular-genetic model of human absence epilepsy. Claimed method consists in the following: parent individuals P with genotype A₁/A₁ of gene DRD₂ are identified by means of genotyping of Taq 1A DRD₂ locus in rats of WAG/Rij line, crossed with each other with obtaining offspring F₁, which is grown to reproductive age, after that, nonaudiogenic individuals are identified among offspring F_1, after which nonaudiogenic individuals of offspring F₁ are crossed with each other to obtain offspring F₂, which is then also grown to reproductive age with the following selection of nonaudiogenic individuals among them, crossing and selection being performed repeatedly to obtain homogeneous population of nonaudiogenic rats of WAG/Rij line with genotype A₁/A₁ of gene DRD₂, control of "ПВР" type in selected individuals of offspring F₁ for further crossing is carried out by means of encephalographic analysis, which includes morphological control.

EFFECT: invention can be used for pre-clinical tests of anti-epileptic medications.

1 dwg, 1 tbl

Epilepsy as the most common neurological disease characterized by life course and high disability population, refers to the socially significant. Development of technologies to reduce losses from socially significant diseases by creating new methods of diagnosis and treatment included in the new list of priority critical technologies, approved by presidential decree of July 7, 2011.

About 70% of all forms of epilepsy begins in childhood and the most common among them is the children absansa epilepsy (DAE). Proper diagnosis and well-designed medication DAE determine the prognosis of the disease, the possibility cupping her attacks, and in favorable cases, the deliverance of the sick child from this serious illness.

Development of optimal schemes of medication is one of the main problems in epilepsy, because the complexity of the etiopathogenesis of the disease, involving both genetic and environmental factors determines the great variety of its forms. Hopes of epileptologie associated with the development of pharmacogenetics, a new direction that seeks to build a selection of anti-epileptic drugs (AED) on the knowledge of molecular-genetic markers of the genome of a sick person. The success of anticoagulants is the projected Tiki, first of all, in relation to idiopathic epilepsy, i.e. it forms, in which there is no other cause of epilepsy, in addition to genetic predisposition. It was precisely this kind of epilepsy is DAE, in which case play an important role genetic factors.

The creation of new departments require their pre-clinical testing, which must be held at valid models. As such models are used in animals suffering from epilepsy, the mechanism of formation of which is identical with the person [Pogodaev SURDS Epileptology and Patagonia brain. - M.: Medicine, 1986. - 288 S., Avakian G.N., Badalyan O.L., Burd YEAR, Avakian GG, Chukanov A.S., Steadfastly M.I., Savenkov A.A., Waldman EA, Voronin ETC, Neronova L.N., Cricova E.V. Experimental and clinical epileptology. Epilepsy. 2010. 4: 41-54].

A widely used model for studying mechanisms absences epilepsy person and testing uptake in rats are lines WAG/Rij [van Luijtelaar E.L., Coenen A.M. Two types of electrocortical paroxysms in an inbred strain of rats. Neurosci. Lett. 1986. 70 (3): 393-397; Coenen, A.M., van Luijtelaar E.L. Genetic animal models for absence epilepsy: a review of the WAG/Rij strain of rats // Behavior Genetics. 2003. 33: 633-655]. These animals have up to hundreds of spontaneously arising in the cortex peak-wave discharges (ISD) day. However, recorded in this line of rats ISD, studies have shown that heterogeneous. It is shown that in 50% of rats of the WAG/Rij, along with typical absences is epilepsie PTS of the first type, register and PTS of the second type [van Luijtelaar E.L., Coenen A.M. Two types of electrocortical paroxysms in an inbred strain of rats. Neurosci. Lett. 1986. 70 (3): 393-397. Midzyanovskaya I.S. Absence and mixed forms of epilepsy in WAGRij rats: characteristics and brain aminergic modulations. Nijmegen: Nijmegen University Press. 2006. P.230]. The PTS of the first and second type have a different localization in the cerebral cortex and are characterized by the features of electrophotographic performance. It is essential that they react differently to the introduction of agonists and antagonists of dopamine receptor type II (DRD₂). It is revealed that haloperidol increases the number of PTS of the first type, reducing the interval between their appearance, resulting espectively increases several times. Apomorphine, on the contrary, completely suppressing the PTS bits of the first type, increases the number of PTS of the second type [Kuznetsova G.D., Petrova F.V., Coenen, A.M., van Luijtelaar E.L. Generalized absence epilepsy and catalepsy in rats. Physiol Behav. 1996. 60 (4): 1165-1169; de Bruin N.M., van Luijtelaar E.L., A.R. Cools, B.A. Ellenbroek Dopamine characteristics in rat genotypes with distinct susceptibility to epileptic activity: apomorphine-induced stereotyped gnawing and novelty/amphetamine-induced locomotor stimulation. Behav. Pharmacol. 2001. 12 (6-7): 517-525; Deransart .V., Riban. B. Le. C. Marescaux. A. Depaulis Dopamine in the striatum modulates seizures in a genetic model of absence epilepsy in the rat. // Neuroscience. 2000. 100: 335-344: Midzianovskaia I.S., Kuznetsova G.D., Coenen, A.M.,. Spiridonov, A.M., van Luijtelaar E.L. Electrophysiological and pharmacological characteristics of two types of spike-wave discharges in WAG/Rij rats. Brain Res. 2001. 911(1): 62-70: Birioukova L.M., I.S. Midzyanovskaya. S. Lensu. L. Tuomisto. E. L. van Luijtelaar Distribution of D (1)-like and D (2)-like dopamine in the brain recepors of genetic epileptic WAG/Rij rats // Epilepsv Research. 2005, 63: 89-96]. The presence of ISD different types of rats of the WAG/Rij certainly casts doubt on the validity of this model. To obtain reliable results rats of this line to conduct pharmacological experiments with AEP should be carefully selected, i.e. the work can be taken rats only with the PTS of the first type. and rats, which are registered with the PTS of the second type, should be rejected. This increases the complexity of the experiments, greatly increases their value.

The aim of the invention is to develop a method of obtaining a population of rats of the WAG/Rij with genotype A1/A1 locus Taq 1A DRD₂with PTS only the first type, which is typical for absences epilepsy - valid molecular-genetic model absences epilepsy person for pre-clinical trials of anti-epileptic drugs.

The goal in the proposed method of obtaining valid molecular genetic model for preclinical testing of new anti-epileptic drugs is achieved by using genotyping locus Taq 1A DRD₂among the rats of the WAG/Rij identify individuals with genotype And₁/A₁gene DRD₂(parents (P) and crossed with one another with the aim of obtaining offspring F₁that grow to a Mature age (6 months), then among poems the VA F ₁allocate neaudirovannyj individuals, then neaudirovannyj individuals offspring F₁crossed with each other to produce offspring F₂which then also dordives to Mature age, among them are selected neaudirovannyj individuals. Thus, crossbreeding and selection is repeated to obtain a homogeneous population neaudirovannyj rats of the WAG/Rij with genotype And₁/A₁gene DRD₂serving models absences epilepsy person for pre-clinical trials of anti-epileptic drugs.

Control type PTS in selected individuals offspring F₁for the next crossing is made by electroencephalographic (EEG) analysis including morphological control.

Breeding rats of the WAG/Rij with genotype And₁/A₁gene DRD₂(selected for posterity only neaudirovannyj individuals in several generations) provides a subpopulation of rats this line, small epileptic seizures which are monomorphic electroencephalographic pattern in the form of peak-wave discharges of the first type, typical absences epilepsy unlike polymorphic spike-wave discharges occurring in the initial population of rats that line. The presence of EEG neaudirovannyj rats of the WAG/Rij with genotype And₁/A₁on the okusu Taq 1A DRD2 only typical absences epilepsy indicators espectively and optimizes and ensures the reliability of the results of preclinical trials of new antibanner drugs.

The method is implemented as follows.

Conducted genotyping locus Taq 1A DRD₂rats of the WAG/Rij. To do this, from the tail vein of rats in a test tube with preservative, which used gleyzer took the blood volume of 4-5 ml For DNA extraction to 5 ml of blood was added 30 ml of a leading buffer (320 mm sucrose, 1% Triton X-100, 5 mm gl₂, 10 mm Tris-HCl, pH 7.6) and centrifuged at 4^ºC and 4000 rpm for 20 minutes. The supernatant liquid was decanted, the precipitate was added 20 ml of a leading buffer and centrifuged under the same conditions for 10 minutes. To the obtained precipitate was added 800 μl of buffer Soline EDTA (25 mm EDTA, pH 8.0, 75 mm NaCl). Then resuspendable the obtained solution and transferred it into dvuhmillimetrovy sterile plastic tubes, were added 80 μl of 10% SDS (sodiumdodecyl), 20 ál of proteinase K (10 mg/ml) and incubated at 37°C for 16 hours.

Extraction of DNA was performed in three stages: 1) solution buffered phenol (200 µl mercaptoethanol in 50 ml of phenol Tris-HCl, pH 7.8); 2) a mixture of phenol chloroform (1:1) and chloroform (2 ml of isoamyl alcohol in 48 ml of chloroform) in equal volumes (1000 ml) with gentle mixing on a rotator for 10 min; 3) by centrifugation at 6000 rpm for 10 minutes and the selection of the aqueous phase after each step.

DNA was besieged from solution in a glass bottomed onionskin flasks with a volume of 50 ml 96% solution of chilled ethanol in the ratio 1:3. Formed DNA was washed with 70% ethanol, dried in air, dissolved in deionized water and stored at -20°C. Selected duodenum were used for polymerase chain reaction of DNA synthesis.

Amplification of the locus was performed using the method of polymerase chain reaction (PCR) synthesis DICK on the amplifier "Terzic" production, Pushchino. Used a reaction mixture for amplification volume of 12.5 µl, which consisted of 50 mm Tris-Hcl buffer (pH 8.8, 5 mm MgCl₂, 15 mm (NH₄)₂SO₄), 0.1 µg of genomic DNA, dNTP mixture (dATP, dGTP, dCTP dTTP 200 µl each), DNA polymerase Termus aquaticus (the production company "Bioteks", , Moscow) and locusspecific oligonucleotide primers (0.25 μm). To determine nucleotide substitutions used the method of analysis PCR-RFLP (length polymorphism fragments).

For locus Taq 1A DRD2 was used primer

5' CTGGGTATCGTCCACCTTCT 3'

5' AACACTGCTACACCTAATCATCCA 3', which was selected by using the program Primer3 (http://frod.wi.edu/primer3).

After denaturation (3 min at 94°C) was performed with 35 cycles of amplification as follows: annealing of primers; 1 min at 58°C, DNA synthesis, 1 min at 72°C, denaturation 1 min at 94°C. Then the sample was kept 10 min at 72°C, cooled. For the detection of polymorphism 10 μl of the reaction mixture was treated with 5 units of restrictase TAG 1A. The reaction Allel the And ₁, locus TAG 1A, length 295 base pairs remained intact, and₂were subjected to enzymatic hydrolysis. The length of the fragments And₂were equal to 119 and 176 base pairs.

Separation of DNA fragments after amplification and restriction analysis was performed by electrophoresis in 7% polyacrylamide gel (initial ratio of acrylamide and methylenebisacrylamide - 29:1). Electrophoresis was performed in 1×TBE buffer (0,089 M Tris-Hcl : 0,089 M boric acid : a 0.002 M EDTA, pH 8,0) at a voltage of 300 C. Before application to the gel samples were mixed in the ratio 5:1 with buffer containing 0.25% bromophenol blue, 0.25% of xylenecyanol and 15% Pichola. As the molecular weight marker used 2-Log Ladder (0.1 to 10.0 KB. New England Biolabs. USA). After electrophoresis the gel was stained with a solution of ethidium bromide and visualized in passing ultraviolet light. Documentation of the results of electrophoresis was performed using a video "Geldokulant" (France).

Thus, among the rats of the WAG/Rij were identified individuals-parents R with genotype And₁/A₁gene DRD₂.

Next, the identified parent species R with genotype And₁/A₁crossed between them and received the offspring of the F₁. The resulting offspring have diastyle to Mature age 6 months. Then Mature rats with genotype A₁/A₁were vergote the effect of sound stimulus to determine predisposition to audiognome convulsive seizure in accordance with the methodology described in GD Kuznetsova [G. Kuznetsova, Midzianovskaia I., Soepa A., van Luijlelaar L., Mixed forms of epilepsy in a sub-population of WAG/Rij rats. I he WAG/Rij rat model of absence epilepsy: ten years of research. Nijmegen: Nijmegen Univ. Press. 2000]. Audiochannel sensitivity of rats was determined in a special chamber (60×60×60 cm)using the jingle of keys ("keys ringing"). Beep had a range 13-85 kHz (maximum range 20-40 kHz) and the average intensity of 50-60 dB with the magnitude of the peaks up to 80-90 dB. Stimuli the stimulus consisted of ultrasonic part and was more efficient to call a great convulsive seizure than the sound of a bell or horn. He was presented for 1.5 minutes.

As a result of sound stimulation were identified neaudirovannye individuals and audiogone individuals. For subsequent crosses were selected only neaudirovannye individuals.

Among the identified neaudirovannyj individuals offspring F was held control type PTS by electroencephalographic (EEG) analysis.

For electroencephalographic (EEG) analysis used a stereotactic method of implanting chronic electrodes. The coordinates of the structures was calculated according to the Atlas of Paxinos rat brain. Watson (1998). Performed the implantation of three active electrodes of coordinates: in the frontal cortex - field 6 (AR +3; L-3); in the parietal cortex - field 2 (AR-0; L-5); in the occipital cortex - box 17 (AP - -6; L-3).

On the eighth day after the operation wire is whether the registration of the background EEG. To do this, the animal was placed in a shielded darkened chamber where the animal was free to move. The preparatory period prior to registration lasted on average about half an hour. After this time, the connectors of the electrodes placed on the head of the animal was connected wires to the amplifier. In a previously opened window has introduced a number of rats, the file number. The recording was made in the program EEGView on the electroencephalograph Bioskript BST-2000 (Germany). Frequency EEG was determined in the range from 1 to 25 Hz, sampling frequency (sampling rate) was 128 MS, time constant 0.3 s, a high-pass filter 70 Hz. For each rat was recorded from 4 to 12 files. Registration of EEG in all cases was carried out at the same time and under the same conditions for all experimental animals.

Morphological control conducted after the completion of all prescribed treatments to determine the location of the tip of the electrode. After anesthesia was extracted brain and were fixed in neutral 10% formalin. Using freezing table was prepared frontal slices of a thickness of 20-30 μm. Slice on a glass slide was placed in the enlarger and projected the image onto a sheet of photo paper. The pictures showed, recorded and Pancevo. When this use is ovali standard devices, reagents and materials for black-and-white photography. For EEG analysis used only those rats in which the electrodes were located in the primary somatosensory cortex (frontal cortex, the main focus of initiation PTS), parietal and occipital regions of the neocortex.

Data EEG were processed using visual analysis and wavelet analysis. Visual analysis allowed us to count the number of single peaks, one peak-wave discharge (ISD), duration PTS (duration of the discharge in seconds from the first peak wavelength to the last), peak wave index expressed in percent (the percentage of time occupied all peak-wave discharges in the registration file, the duration of which was taken as 100%). The number of peak-wave discharges was determined in each of the analyzed file.

For analysis of frequency-time characteristics of PTS. necessary to determine the type of digits used the wavelet transform but Morlaix due to its high information content and its modified version proposed by Bosnjakovic and Obukhov [Bosnyakova D., Obukhov Yu. V. Extraction of Dominant Features in Biomedical Signals // Pattern Recognition and Image Analysis. 2005, 15 (2): 513] and Grabovoi and others [gabova AV, Gazdecki CENTURIES, Boshnakova DO, Zharikov A.V., Samotaeva I.S., Y. Obukhov, Kuznetsova HD Frequency-temporal dynamics of discharges peak-wave in patients with absences epilepsy. Technology living with the system. 2008. 5: 72-8], which allows to highlight the dynamics of the frequency of the category.

Statistical processing of data was performed using Statistica 6.0. The significance of differences was performed using the parametric student's criterion. The differences were considered statistically significant at p<0,05.

In rats with genotype And₁/A₁spontaneous peak-wave discharges have maximum amplitude in the frontal cortex (figure 1).

They are widely generalized in the crust and their duration ranges from four to ten seconds.

The results showed that: 1) in rats with genotype And₁/A₁peak-wave discharges (PTS) are in the nature of the discharges of the first type; 2) rats with genotype And₁/A₁peak-wave discharges widely generalized in the crust that is typical of DAE. Numerical characteristics of PTS in rats with genotypes And₁/A₁and a₂/A₂(control rats with the PTS of the second Tina) are presented in table 1. They show that in rats with genotype And₁/A₁PTS are formed twice as likely (p<0,001), have a significantly greater duration (p<0,001), which implies that they have large values of peak-wave index(p<0,01).

Quantitative differences, manifested in the expression of the PTS of the first type in rats with genotypes And₁/A₁and a₂/A₂that is the result of changes in the modulatory effects of dopamine on the glutamatergic and GABAergic systems in the brain that is associated with the peculiarities of the expression of the short and long isoforms of DRD2, due to the polymorphism of the locus Taq 1A DRD2 [Zhang Y., Bertolino A., Fazio L., Blasi g, Rampino a, Romano R., Mei-Ling T. Lee. Tao Xiao. Papp, A., Wang D., Sadѐe W. Polymorphisms in human dopamine D2 receptor gene affect gene expression, splicing, and neuronal activity during working memory. Proc Natl Acad Sci USA. 2007. 104 (51). 20052-20057; Jocham, G., Klein, T.A., Neumann j, von Cramon D.Y., M. Reuter, M. Ullsperger Dopamine DRD2 polymorphism alters reversal learning and associated neural activity. J Neurosci. 2009. 29 (12): 3695-3704].

Characteristic typical discharges absences epilepsy is the occurrence in the frontal region of the cortex at the beginning of the discharge short bursts of activity with a higher frequency than the rest of the discharge. Only after that other parts of the cortex involved in rhythmic activity. These data agree well with the modern idea of the leading role of the frontal sections of the crust in the formation of PTS with absences epilepsy.

Thus, the detected PTS of the first type in rats with genotype And₁/A₁typical absences epilepsy, they are formed in the structures corticothalamic circle.

Further identified neaudirovannye to the ISI crossed with each other to obtain a homogeneous population.

Thus, the technical result of the invention is the creation of a valid model of a homogeneous population of rats of the WAG/Rij with genotype And₁/A₁locus Taq 1A DRD2, PTS with only the first type, typical absences epilepsy, which allows to obtain reliable results when testing anti-epileptic drugs. The presence of established populations of rats with genotype A1/A1 locus Taq 1A DRD2 SOR only the first type (in the absence of the PTS of the second type), identifying the main target of action of the test preparations, will help to objectify the assessment of their effectiveness by analyzing the frequency, duration and peak wave index PTS of the first type, typical absences epilepsy person. This approach will improve the quality of new anti-epileptic drugs, because their score will reflect the ability to affect the main pathogenetic stages of the disease.

Introduction received valid model in practice pre-clinical trials will provide a great economic effect with a strong social impact, in particular:

1) you will need fewer rats for the experiment,

2) decrease the time the experimenter,

3) will significantly increase the reliability of the results, and hence the efficiency of passing the test preparations and subsequent treatment,

4) higher is their treatment effectiveness will decrease the frequency of attacks in patients and ensure their ability to work,

5) will contribute to greater security of trophic nervous tissue

6) will reduce the risk of developing a psychotic complications of epilepsy, etc.

Because today the world has no equivalent valid molecular-genetic model absences epilepsy humans, and the incidence of disease is high, there is every reason to assume that in the case of obtaining a patent in the future he can gain international status.

A method of obtaining a valid molecular genetic model for preclinical testing of new anti-epileptic drugs, namely, that using genotyping locus Taq 1A DRD₂among the rats of the WAG/Rij identified parental individuals R with genotype And₁/A₁gene DRD₂, crossed with one another, get offspring F₁that grow to a Mature age, then among offspring F₁allocate neaudirovannyj individuals, then neaudirovannyj individuals offspring F₁crossed with each other to produce offspring F₂which then also dordives to Mature age, among them are selected neaudirovannyj individuals, while crossbreeding and selection is repeated to obtain a homogeneous population neaudirovannyj rats of the WAG/Rij with genotype And₁/A₁gene DRD₂the AOC is e, control type PTS in selected individuals offspring F₁for the next crossing is made by electroencephalographic analysis including morphological control.