|
Method of obtaining valid molecular-genetic model for pre-clinical tests of novel anti-epileptic medications |
|||||||||||||||||||||||||||||||||||
![]()
IPC classes for russian patent Method of obtaining valid molecular-genetic model for pre-clinical tests of novel anti-epileptic medications (RU 2502257):
Method for obtaining l-aminoacid using bacterium of enterobacteriaceae family / 2501858
Invention represents bacterium of Escherichia family, which produces L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. With that, bacterium is modified so that expression of bssR gene in the above bacterium is strengthened. The invention also refers to the method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine using the above bacterium.
Method for obtaining l-aminoacid using bacterium of enterobacteriaceae family / 2501857
Invention represents a method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. The method involves growth of bacterium of Enterobacteriaceae family, which is modified so that expression of yeel gene in the above bacterium is strengthened, and extraction of the above L-aminoacid from cultural liquid.
Method for obtaining l-aminoacid using bacterium of enterobacteriaceae family / 2501856
Invention represents a method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. The method involves growth in nutritional medium of bacterium of Escherichia family, which is modified so that expression of ycfR gene in the above bacterium is strengthened, and extraction of the above L-aminoacid from cultural liquid.
Method for obtaining nanosized delivery system of fragments of nucleic acids and their analogues to cells of mammals / 2499045
Invention proposes a production method of a nanosized delivery system of fragments of nucleic acids (FNA) and their analogues to cells of mammals. A suspension of TiO2 nanoparticles with concentration of 1-2 mg/ml in 0.1-0.5 M solution of NaCl is obtained. With that, TiO2 particles have the size of 3-20 nm, and mainly 3-5 nm, and are contained in amorphous or crystalline anatase or brookite form. The obtained TiO2 suspension is mixed with water solution of polylysin with concentration of 20 mg/ml in the ratio of TiO2 to polylysin, which is equal to 1:(0.05-0.8). The mixture is incubated at room temperature during at least 30 minutes. Then, to the obtained suspension of polylysin-containing nanoparticles there added is 5-70 mcL of FNA solution with concentration of 10-4-10-7 M and incubated in 0.1-0.5 M solution of NaCl at room temperature during 20-30 minutes. Nanocomposite TiO2-PL FNA with capacity as per FNA of 0.2-60 nmol/mg is obtained.
Vector plasmids for cloning dna modules and methods of their use / 2497949
Vector plasmids ("docking vectors") are proposed for the synthesis of transgenes (RES), which represent a cloning vector, which is included in the cloning module consisting of four gene joints (GJ 1-4) and three nucleotide sequences (NS 1-3) located between them, where each of GJ comprises from 2 to 4 non-variable rare restriction sites from more than 6 nucleotides, and the nucleotide sequences between GJ include "inserts" which while cloning are replaced in the NS 1 by the promoter module, in the NS 2 by expression module and in NS 3 by 3'-regulatory module. At that, either GJ 1 or GJ 2 independently contain 3-4 non-variable rare restriction sites of more than 6 nucleotides. According to the invention, the variation of connection vector RES is also proposed which is designed for the multiple cloning (MC), and characterised in that at least one of the three NS is the module of multiple cloning with a site of multiple cloning comprising common restriction sites which are unique in the docking vector RES.
Plasmid vector phyp with high segregation stability for expression of recombinant protein, bacterium - producent of precursor of recombinant protein and method to produce recombinant protein / 2496877
Invention is a vector for production of a vector for expression in a bacterial cell of a precursor of a target recombinant protein, fused with an N-end peptide, containing a decahistidine cluster and a site of recognition with proteinase, substantially containing of a section of initiation of replication of pBR322 ori; a gene of a repressor of a lactose operon; a bacterial promotor; an area coding the N-end leader peptide, containing a decahistidine cluster and, not necessarily, a site of recognition with proteinase; a section of cloning (polylinker); a section of termination of transcription functioning in the bacterial cell; a fragment coding a non-genome pair toxin-antitoxin, at the same time the gene of antitoxin is oriented so that the direction of its transcription matches the direction of transcription of the target gene; the gene coding the bacterial marker of selection. The invention also relates to a vector for expression in a bacterial cell of a precursor of a target recombinant protein fused with an N-end peptide, a bacterium containing such vector and the method for production of the recombinant protein using the bacterium.
Recombinant plasmid dna pmaltev-legumain, encoding polypeptide having antigenic properties of protein legumain opisthorchis felineus, and strain e.coli bl 21(de3)plyss-pmaltev-legumain - producent of recombinant polypeptide having antigenic properties of protein legumain opisthorchis felineus / 2496876
Invention is recombinant plasmid DNA pMALTEV-legumain, with molecular weight of 4.78 megadalton and size of 7839 bp, coding a polypeptide having antigenic properties of protein legumain Opisthorchis felineus, and containing a fragment of a vector plasmid pMALTEV, including a Ptac promotor; a lac-operator sequence; a sequence of a gene malE, coding a maltose-binding protein; a combination of terminators of transcription rrnB T1T2 E.coli; a gene of b-lactamase and a section of ori (pBR322) replication initiation; complementary DNA of gene legumain O.felineus without a signal peptide flanked with sites of restriction BamHI and Hindlll; a hybrid promotor Ptac; a lac-operator sequence for amplification of lac-repressor binding; terminators of transcription of gene rrnB E.coli (t1 and t2); as a genetic marker - a gene of B-lactamase (ampR), which determines resistance of E.coli cells transformed with plasmid pMALTEV-legumain to ampicillin antibiotics; a nucleotide sequence, which codes MBP (maltose-binding protein), being a part of a hybrid sequence of a recombinant protein MBP-legumain and making it possible to separate a recombinant polypeptide by methods of affine chromatography; unique sites of endonucleases of restriction, having the following coordinates: BamHI (2668), EcoRI (2675), StuI (2685), Sail (2691), Spel (2704), NotI (2711), Xbal (2725), PstI (2737), Xhol (2740), SphI (2750), Kpnl (2756), Hindlll (2758). The invention also relates to a strain E.coli BL21(DE3)pLysS-pMALTEV-legumain, produced with the help of the recombinant plasmid DNA pMALTEV-legumain, deposited in the collection of microorganism cultures in the Federal Budget Institution of Science State Science Centre of Virusology and Biotechnology "Vector" of Federal Service for Oversight of Consumer Protection and Welfare under the number B-1253. The invention makes it possible to produce a recombinant hybrid polypeptide with antigenic properties of protein legumain O.felineus, providing for high specificity to antibodies of a parasitic infection O.felineus.
Method of laser fusion of blastomeres inside the early preimplantation mammalian embryos without violation of their integrity / 2495932
Method of laser fusion of blastomeres inside the 4-cell mouse embryo without violation of its integrity, comprising demonstration of the embryo on the monitor and exposure with laser pulses of the visually selected point on the line of close contact of blastomeres inside the embryo. Either two blastomeres inside the 4-cell embryo are subjected to fusion to form the embryo of three cells one of which is tetraploid, or two pairs of blastomeres in series to form the embryo of two tetraploid cells, or three blastomeres in series to form the embryo of two cells of different size: hexaploid and intact diploid. Irradiation is carried out with the sequence of femtosecond laser pulses with a wavelength of 800 nm with a repetition rate of 80 MHz with the wattage of 0.06-0.12 W and the sequence duration of 10-30 ms. To find the area of the most close contact of the blastomeres inside the embryo the laser tweezers is used, enabling to move and rotate the embryo on the monitor.
Recombinant plasmid pol-dsred2, coding oct4 and lin28 human proteins and fluorescent protein dsred2, designed to produce induced pluripotent human stem cells / 2495126
Plasmid genetic structure pOL-DsRed2 is produced, being built on the basis of a plasmid vector pIRES (Clontech), where fragments of cDNA of human genes OCT4 and LIN28 are placed, being connected with a nucleotide sequence coding P2A-peptide and gene cDNA, coding fluorescent protein DsRed2.
Recombinant plasmid pok-dsred2, coding oct4 and klf4 human proteins and fluorescent protein dsred2, designed to produce induced pluripotent human stem cells / 2495125
Plasmid genetic structure pOK-DsRed2 is produced, being built on the basis of a plasmid vector pIRES (Clontech), where fragments of cDNA of human genes OCT4 and KLF4 are placed, being connected with a nucleotide sequence coding P2A-peptide and gene cDNA, coding fluorescent protein DsRed2. Transcription of a single mRNA OCT4-F2A-KLF4-IRES-DsRed2 is carried out from constitutive promotor p CMV IE, providing for high level of mRNA lifelength.
Method of selection of cattle in kalmyk breed according to meat productivity / 2498569
Invention relates to the field of genetics and animal breeding. The method of selection of cattle of Kalmyk breed is that at the age of 6-month the presence in blood of erythrocytic antigens-markers of tall-growing type: G2 E'3 R2 are detected. In the presence in the genotype of animals of markers of productivity the selection of animals is carried out.
Young minks performance increase method / 2497371
Invention relates to fur farming field, in particular, to young minks performance increase. The fur animals growing method envisages introduction of biologically active substances (physiological promoters) into the ration of young minks intended for pelt obtainment. The biologically active substances (physiological promoters) are represented by L-carnitine preparation and are introduced in an amount of 30 mg per 1 kg of live weight into the ration in seven days' courses with seven days' intervals between them, once a day in the period of active growth - from June to August inclusive.
Method of evaluation of broiler chickens / 2496315
Invention relates to the field of agriculture, namely, to selection, and can be used in breeding in poultry pedigree farms. Evaluation of broiler chickens is carried out according to the developed scale for fast and slow-fledging lines of broiler strains; the day-old chickens are distributed into three groups: 6-18 hours - late; 19-32 hours - average; 33 and above - early. The calculation of the duration of the embryonic development from laying to hatching chickens is carried out: the time is recorded from the start of incubation till evaluation of the chickens on development of fledging (T1), the age of chickens is subtracted from it, which is set according to a feather (T2), using the formula: T=T1-T2.
Method of assessment of velvet antler yielding capacity of siberian red deers / 2491814
Invention relates to a velvet antler reindeer breeding and can be used to identify the productive qualities of Siberian red deers. The method is characterised in the fact that assessment is carried out according to the level of testosterone and/or estradiol secretion in blood serum in its sampling in any month from December to August inclusively, and Siberian red deers should be considered as highly productive with the following levels of secretion of testosterone in blood serum, nmol/l, and time period of its sampling: 1.67 - January, and/or 7.15 - March, and/or 5.41 - April, and/or 1.27 - June and/or 5.13 - August, not less and/or according to the level of estradiol secretion in blood serum, nmol/l, and time period of its sampling: 2.32 - December, and/or 2.91 - January, and/or 1.06 - March, and/or 1.50 - April, and/or 2.41 - June, and/or 2.68 - July, no more.
Method to determine unfertilised eggs of drosophila / 2487934
Undeveloped eggs are placed for 45-50 minutes in a four percent solution of sodium hypochlorite (NaOCl), and on the basis of the number of dissolved eggs they define the quantity of unfertilised eggs. The proposed method makes it possible to perform mass investigations of quite large samples, to detect specifics at the level of frequency of occurrence of unfertilised eggs, both of genetically dependent factors and stresses of the environment of various nature at the reproductive system of the drosophila. Besides, the proposed method of chorion removal makes it possible to detect a share of parthenogenetically developing eggs, which is specific for certain types of drosophila, and also disturbances in the reproductive system of drosophila males. The method makes it possible to process quite a high quantity (100-200 pcs.) of undeveloped eggs referred to early embryonal parts within a short period of time, makes it possible to identify sterility of males. With the help of this method both for parent and several next generations of drosophila, they determine a prolonging effect of biological exposure of a stress agent at ability to leave posterity.
Method to increase yield of pigs / 2483534
Invention relates to veterinary science and pig breeding. The invention makes it possible to increase yield of pigs by application of a biological agent "Geprim for pigs" and "Gamavit". For this purpose the agent "Geprim for pigs" is injected to pigs once intramuscularly in the dose of 0.19-0.21 ml/kg, and "Gamavit" in the dose of 0.1-0.15 ml/kg per head in the beginning of fattening - on the first, fourth and ninth days.
Method to determine genuineness of strain of animals - objects of agricultural purpose / 2477607
Invention relates to genetics and breeding of farm animals. The method provides for multiplex amplification of 13 loci of microsatellites of cattle (TGLA126, ILSTS005, ETH185, TGLA122, INRA023, ILSTS006, TGLA227, ETH225, ETH10, BM1818, BM1824, SPS115) using a test system for DNA-expertise of animals, building allelic profiles and subsequent calculation of similarity factor Q. At the same time for determination of genuineness of strain it is not required to previously determine allelic profiles of breeds and using reference populations. Those species are of genuine strain, which have similarity factor Q≥0.75.
Method of feeding farm animals / 2467568
Alleged invention relates to agriculture, namely to feeding farm animals. The method of feeding farm animals lies in adding into the animal diet of zeolites, coniferous flour, larvae of synanthropic flies, and the ingredients are added in the diet in the last 14 days of fattening in the amount of grams per head daily: zeolites 250-500, coniferous flour 50-100, larvae of synanthropic flies 20-50.
Method of fixing heterosis of hybrids in subsequent generations / 2465771
Invention relates to the biochemistry of plants. Homozygous individuals are obtained through anther culture, followed by recovery of the gene complexes source hybrid by hybridisation of genotypically contrast range of dihaploid lines. And the hybridisation includes only the most productive dihaploid lines and the contrast range of dihaploid lines is evaluated on a complex of characteristics of morphological, physiological, biochemical, and molecular markers (SSR, SNP, etc.), the contribution of genetic systems in the productivity of the sample, and the totality of all the proposed methods. The method proposed by the authors enables more effectively than using the previously proposed methods to clean the original hybrid genotype, to accelerate the process of accumulation of genes that determine the heterosis effect, to abandon long and very difficult maintenance of the plant viability (during its several ordinary life cycles) of the original hybrid and to avoid problems connected with obtaining rising generation from it.
Method and line of efficient detecting of hunting in identified milk (milch) cows in case of loose housing / 2463996
Group of inventions relates to field of animal breeding. Line of efficient detection of hunting contains device of identification, which consists of sensor in form of chip-emitter in the collar, identification antenna-responder, selection gate, line of zooveterinary treatment and pre-milking site. Slit antenna-responder of directed action is installed on pre-milking site at the height not lower than 1 m 30 cm for registration of signals from sensors in collars of only those cows, which jump at other cows on entire area of pre-milking site. Slit antenna-responder and identification antenna-responder are connected to control unit, which contains units of identification and determination of animal's location, amplification of signals, memory, connection. In computer programme formed is task during re-identification of said cow by identification antenna-responder on drove after milking to direct said cow by means of selection gate into the line of zooveterinary treatment for artificial insemination.
Method for detecting glycogen in extract out of organs and tissues in bees / 2256320
The present innovation deals with boiling an extract, cooling, centrifuging, dissolving a residue, cooling, centrifuging, dissolving a residue, adding sulfuric acid into a tube and 1%-condensate's solution followed by heating, cooling, photometry against the control at wave length being 315 nm, as a condensate one should apply resorcinol.
|
FIELD: medicine. SUBSTANCE: invention relates to field of medicine, neurobiology and pharmacokinetics and deals with method of obtaining valid molecular-genetic model of human absence epilepsy. Claimed method consists in the following: parent individuals P with genotype A1/A1 of gene DRD2 are identified by means of genotyping of Taq 1A DRD2 locus in rats of WAG/Rij line, crossed with each other with obtaining offspring F1, which is grown to reproductive age, after that, nonaudiogenic individuals are identified among offspring F1, after which nonaudiogenic individuals of offspring F1 are crossed with each other to obtain offspring F2, which is then also grown to reproductive age with the following selection of nonaudiogenic individuals among them, crossing and selection being performed repeatedly to obtain homogeneous population of nonaudiogenic rats of WAG/Rij line with genotype A1/A1 of gene DRD2, control of "ПВР" type in selected individuals of offspring F1 for further crossing is carried out by means of encephalographic analysis, which includes morphological control. EFFECT: invention can be used for pre-clinical tests of anti-epileptic medications. 1 dwg, 1 tbl
Epilepsy as the most common neurological disease characterized by life course and high disability population, refers to the socially significant. Development of technologies to reduce losses from socially significant diseases by creating new methods of diagnosis and treatment included in the new list of priority critical technologies, approved by presidential decree of July 7, 2011. About 70% of all forms of epilepsy begins in childhood and the most common among them is the children absansa epilepsy (DAE). Proper diagnosis and well-designed medication DAE determine the prognosis of the disease, the possibility cupping her attacks, and in favorable cases, the deliverance of the sick child from this serious illness. Development of optimal schemes of medication is one of the main problems in epilepsy, because the complexity of the etiopathogenesis of the disease, involving both genetic and environmental factors determines the great variety of its forms. Hopes of epileptologie associated with the development of pharmacogenetics, a new direction that seeks to build a selection of anti-epileptic drugs (AED) on the knowledge of molecular-genetic markers of the genome of a sick person. The success of anticoagulants is the projected Tiki, first of all, in relation to idiopathic epilepsy, i.e. it forms, in which there is no other cause of epilepsy, in addition to genetic predisposition. It was precisely this kind of epilepsy is DAE, in which case play an important role genetic factors. The creation of new departments require their pre-clinical testing, which must be held at valid models. As such models are used in animals suffering from epilepsy, the mechanism of formation of which is identical with the person [Pogodaev SURDS Epileptology and Patagonia brain. - M.: Medicine, 1986. - 288 S., Avakian G.N., Badalyan O.L., Burd YEAR, Avakian GG, Chukanov A.S., Steadfastly M.I., Savenkov A.A., Waldman EA, Voronin ETC, Neronova L.N., Cricova E.V. Experimental and clinical epileptology. Epilepsy. 2010. 4: 41-54]. A widely used model for studying mechanisms absences epilepsy person and testing uptake in rats are lines WAG/Rij [van Luijtelaar E.L., Coenen A.M. Two types of electrocortical paroxysms in an inbred strain of rats. Neurosci. Lett. 1986. 70 (3): 393-397; Coenen, A.M., van Luijtelaar E.L. Genetic animal models for absence epilepsy: a review of the WAG/Rij strain of rats // Behavior Genetics. 2003. 33: 633-655]. These animals have up to hundreds of spontaneously arising in the cortex peak-wave discharges (ISD) day. However, recorded in this line of rats ISD, studies have shown that heterogeneous. It is shown that in 50% of rats of the WAG/Rij, along with typical absences is epilepsie PTS of the first type, register and PTS of the second type [van Luijtelaar E.L., Coenen A.M. Two types of electrocortical paroxysms in an inbred strain of rats. Neurosci. Lett. 1986. 70 (3): 393-397. Midzyanovskaya I.S. Absence and mixed forms of epilepsy in WAGRij rats: characteristics and brain aminergic modulations. Nijmegen: Nijmegen University Press. 2006. P.230]. The PTS of the first and second type have a different localization in the cerebral cortex and are characterized by the features of electrophotographic performance. It is essential that they react differently to the introduction of agonists and antagonists of dopamine receptor type II (DRD2). It is revealed that haloperidol increases the number of PTS of the first type, reducing the interval between their appearance, resulting espectively increases several times. Apomorphine, on the contrary, completely suppressing the PTS bits of the first type, increases the number of PTS of the second type [Kuznetsova G.D., Petrova F.V., Coenen, A.M., van Luijtelaar E.L. Generalized absence epilepsy and catalepsy in rats. Physiol Behav. 1996. 60 (4): 1165-1169; de Bruin N.M., van Luijtelaar E.L., A.R. Cools, B.A. Ellenbroek Dopamine characteristics in rat genotypes with distinct susceptibility to epileptic activity: apomorphine-induced stereotyped gnawing and novelty/amphetamine-induced locomotor stimulation. Behav. Pharmacol. 2001. 12 (6-7): 517-525; Deransart .V., Riban. B. Le. C. Marescaux. A. Depaulis Dopamine in the striatum modulates seizures in a genetic model of absence epilepsy in the rat. // Neuroscience. 2000. 100: 335-344: Midzianovskaia I.S., Kuznetsova G.D., Coenen, A.M.,. Spiridonov, A.M., van Luijtelaar E.L. Electrophysiological and pharmacological characteristics of two types of spike-wave discharges in WAG/Rij rats. Brain Res. 2001. 911(1): 62-70: Birioukova L.M., I.S. Midzyanovskaya. S. Lensu. L. Tuomisto. E. L. van Luijtelaar Distribution of D (1)-like and D (2)-like dopamine in the brain recepors of genetic epileptic WAG/Rij rats // Epilepsv Research. 2005, 63: 89-96]. The presence of ISD different types of rats of the WAG/Rij certainly casts doubt on the validity of this model. To obtain reliable results rats of this line to conduct pharmacological experiments with AEP should be carefully selected, i.e. the work can be taken rats only with the PTS of the first type. and rats, which are registered with the PTS of the second type, should be rejected. This increases the complexity of the experiments, greatly increases their value. The aim of the invention is to develop a method of obtaining a population of rats of the WAG/Rij with genotype A1/A1 locus Taq 1A DRD2with PTS only the first type, which is typical for absences epilepsy - valid molecular-genetic model absences epilepsy person for pre-clinical trials of anti-epileptic drugs. The goal in the proposed method of obtaining valid molecular genetic model for preclinical testing of new anti-epileptic drugs is achieved by using genotyping locus Taq 1A DRD2among the rats of the WAG/Rij identify individuals with genotype And1/A1gene DRD2(parents (P) and crossed with one another with the aim of obtaining offspring F1that grow to a Mature age (6 months), then among poems the VA F 1allocate neaudirovannyj individuals, then neaudirovannyj individuals offspring F1crossed with each other to produce offspring F2which then also dordives to Mature age, among them are selected neaudirovannyj individuals. Thus, crossbreeding and selection is repeated to obtain a homogeneous population neaudirovannyj rats of the WAG/Rij with genotype And1/A1gene DRD2serving models absences epilepsy person for pre-clinical trials of anti-epileptic drugs. Control type PTS in selected individuals offspring F1for the next crossing is made by electroencephalographic (EEG) analysis including morphological control. Breeding rats of the WAG/Rij with genotype And1/A1gene DRD2(selected for posterity only neaudirovannyj individuals in several generations) provides a subpopulation of rats this line, small epileptic seizures which are monomorphic electroencephalographic pattern in the form of peak-wave discharges of the first type, typical absences epilepsy unlike polymorphic spike-wave discharges occurring in the initial population of rats that line. The presence of EEG neaudirovannyj rats of the WAG/Rij with genotype And1/A1on the okusu Taq 1A DRD2 only typical absences epilepsy indicators espectively and optimizes and ensures the reliability of the results of preclinical trials of new antibanner drugs. The method is implemented as follows. Conducted genotyping locus Taq 1A DRD2rats of the WAG/Rij. To do this, from the tail vein of rats in a test tube with preservative, which used gleyzer took the blood volume of 4-5 ml For DNA extraction to 5 ml of blood was added 30 ml of a leading buffer (320 mm sucrose, 1% Triton X-100, 5 mm gl2, 10 mm Tris-HCl, pH 7.6) and centrifuged at 4ºC and 4000 rpm for 20 minutes. The supernatant liquid was decanted, the precipitate was added 20 ml of a leading buffer and centrifuged under the same conditions for 10 minutes. To the obtained precipitate was added 800 μl of buffer Soline EDTA (25 mm EDTA, pH 8.0, 75 mm NaCl). Then resuspendable the obtained solution and transferred it into dvuhmillimetrovy sterile plastic tubes, were added 80 μl of 10% SDS (sodiumdodecyl), 20 ál of proteinase K (10 mg/ml) and incubated at 37°C for 16 hours. Extraction of DNA was performed in three stages: 1) solution buffered phenol (200 µl mercaptoethanol in 50 ml of phenol Tris-HCl, pH 7.8); 2) a mixture of phenol chloroform (1:1) and chloroform (2 ml of isoamyl alcohol in 48 ml of chloroform) in equal volumes (1000 ml) with gentle mixing on a rotator for 10 min; 3) by centrifugation at 6000 rpm for 10 minutes and the selection of the aqueous phase after each step. DNA was besieged from solution in a glass bottomed onionskin flasks with a volume of 50 ml 96% solution of chilled ethanol in the ratio 1:3. Formed DNA was washed with 70% ethanol, dried in air, dissolved in deionized water and stored at -20°C. Selected duodenum were used for polymerase chain reaction of DNA synthesis. Amplification of the locus was performed using the method of polymerase chain reaction (PCR) synthesis DICK on the amplifier "Terzic" production, Pushchino. Used a reaction mixture for amplification volume of 12.5 µl, which consisted of 50 mm Tris-Hcl buffer (pH 8.8, 5 mm MgCl2, 15 mm (NH4)2SO4), 0.1 µg of genomic DNA, dNTP mixture (dATP, dGTP, dCTP dTTP 200 µl each), DNA polymerase Termus aquaticus (the production company "Bioteks", , Moscow) and locusspecific oligonucleotide primers (0.25 μm). To determine nucleotide substitutions used the method of analysis PCR-RFLP (length polymorphism fragments). For locus Taq 1A DRD2 was used primer 5' CTGGGTATCGTCCACCTTCT 3' 5' AACACTGCTACACCTAATCATCCA 3', which was selected by using the program Primer3 (http://frod.wi.edu/primer3). After denaturation (3 min at 94°C) was performed with 35 cycles of amplification as follows: annealing of primers; 1 min at 58°C, DNA synthesis, 1 min at 72°C, denaturation 1 min at 94°C. Then the sample was kept 10 min at 72°C, cooled. For the detection of polymorphism 10 μl of the reaction mixture was treated with 5 units of restrictase TAG 1A. The reaction Allel the And 1, locus TAG 1A, length 295 base pairs remained intact, and2were subjected to enzymatic hydrolysis. The length of the fragments And2were equal to 119 and 176 base pairs. Separation of DNA fragments after amplification and restriction analysis was performed by electrophoresis in 7% polyacrylamide gel (initial ratio of acrylamide and methylenebisacrylamide - 29:1). Electrophoresis was performed in 1×TBE buffer (0,089 M Tris-Hcl : 0,089 M boric acid : a 0.002 M EDTA, pH 8,0) at a voltage of 300 C. Before application to the gel samples were mixed in the ratio 5:1 with buffer containing 0.25% bromophenol blue, 0.25% of xylenecyanol and 15% Pichola. As the molecular weight marker used 2-Log Ladder (0.1 to 10.0 KB. New England Biolabs. USA). After electrophoresis the gel was stained with a solution of ethidium bromide and visualized in passing ultraviolet light. Documentation of the results of electrophoresis was performed using a video "Geldokulant" (France). Thus, among the rats of the WAG/Rij were identified individuals-parents R with genotype And1/A1gene DRD2. Next, the identified parent species R with genotype And1/A1crossed between them and received the offspring of the F1. The resulting offspring have diastyle to Mature age 6 months. Then Mature rats with genotype A1/A1were vergote the effect of sound stimulus to determine predisposition to audiognome convulsive seizure in accordance with the methodology described in GD Kuznetsova [G. Kuznetsova, Midzianovskaia I., Soepa A., van Luijlelaar L., Mixed forms of epilepsy in a sub-population of WAG/Rij rats. I he WAG/Rij rat model of absence epilepsy: ten years of research. Nijmegen: Nijmegen Univ. Press. 2000]. Audiochannel sensitivity of rats was determined in a special chamber (60×60×60 cm)using the jingle of keys ("keys ringing"). Beep had a range 13-85 kHz (maximum range 20-40 kHz) and the average intensity of 50-60 dB with the magnitude of the peaks up to 80-90 dB. Stimuli the stimulus consisted of ultrasonic part and was more efficient to call a great convulsive seizure than the sound of a bell or horn. He was presented for 1.5 minutes. As a result of sound stimulation were identified neaudirovannye individuals and audiogone individuals. For subsequent crosses were selected only neaudirovannye individuals. Among the identified neaudirovannyj individuals offspring F was held control type PTS by electroencephalographic (EEG) analysis. For electroencephalographic (EEG) analysis used a stereotactic method of implanting chronic electrodes. The coordinates of the structures was calculated according to the Atlas of Paxinos rat brain. Watson (1998). Performed the implantation of three active electrodes of coordinates: in the frontal cortex - field 6 (AR +3; L-3); in the parietal cortex - field 2 (AR-0; L-5); in the occipital cortex - box 17 (AP - -6; L-3). On the eighth day after the operation wire is whether the registration of the background EEG. To do this, the animal was placed in a shielded darkened chamber where the animal was free to move. The preparatory period prior to registration lasted on average about half an hour. After this time, the connectors of the electrodes placed on the head of the animal was connected wires to the amplifier. In a previously opened window has introduced a number of rats, the file number. The recording was made in the program EEGView on the electroencephalograph Bioskript BST-2000 (Germany). Frequency EEG was determined in the range from 1 to 25 Hz, sampling frequency (sampling rate) was 128 MS, time constant 0.3 s, a high-pass filter 70 Hz. For each rat was recorded from 4 to 12 files. Registration of EEG in all cases was carried out at the same time and under the same conditions for all experimental animals. Morphological control conducted after the completion of all prescribed treatments to determine the location of the tip of the electrode. After anesthesia was extracted brain and were fixed in neutral 10% formalin. Using freezing table was prepared frontal slices of a thickness of 20-30 μm. Slice on a glass slide was placed in the enlarger and projected the image onto a sheet of photo paper. The pictures showed, recorded and Pancevo. When this use is ovali standard devices, reagents and materials for black-and-white photography. For EEG analysis used only those rats in which the electrodes were located in the primary somatosensory cortex (frontal cortex, the main focus of initiation PTS), parietal and occipital regions of the neocortex. Data EEG were processed using visual analysis and wavelet analysis. Visual analysis allowed us to count the number of single peaks, one peak-wave discharge (ISD), duration PTS (duration of the discharge in seconds from the first peak wavelength to the last), peak wave index expressed in percent (the percentage of time occupied all peak-wave discharges in the registration file, the duration of which was taken as 100%). The number of peak-wave discharges was determined in each of the analyzed file. For analysis of frequency-time characteristics of PTS. necessary to determine the type of digits used the wavelet transform but Morlaix due to its high information content and its modified version proposed by Bosnjakovic and Obukhov [Bosnyakova D., Obukhov Yu. V. Extraction of Dominant Features in Biomedical Signals // Pattern Recognition and Image Analysis. 2005, 15 (2): 513] and Grabovoi and others [gabova AV, Gazdecki CENTURIES, Boshnakova DO, Zharikov A.V., Samotaeva I.S., Y. Obukhov, Kuznetsova HD Frequency-temporal dynamics of discharges peak-wave in patients with absences epilepsy. Technology living with the system. 2008. 5: 72-8], which allows to highlight the dynamics of the frequency of the category. Statistical processing of data was performed using Statistica 6.0. The significance of differences was performed using the parametric student's criterion. The differences were considered statistically significant at p<0,05. In rats with genotype And1/A1spontaneous peak-wave discharges have maximum amplitude in the frontal cortex (figure 1). They are widely generalized in the crust and their duration ranges from four to ten seconds. The results showed that: 1) in rats with genotype And1/A1peak-wave discharges (PTS) are in the nature of the discharges of the first type; 2) rats with genotype And1/A1peak-wave discharges widely generalized in the crust that is typical of DAE. Numerical characteristics of PTS in rats with genotypes And1/A1and a2/A2(control rats with the PTS of the second Tina) are presented in table 1. They show that in rats with genotype And1/A1PTS are formed twice as likely (p<0,001), have a significantly greater duration (p<0,001), which implies that they have large values of peak-wave index(p<0,01).
Quantitative differences, manifested in the expression of the PTS of the first type in rats with genotypes And1/A1and a2/A2that is the result of changes in the modulatory effects of dopamine on the glutamatergic and GABAergic systems in the brain that is associated with the peculiarities of the expression of the short and long isoforms of DRD2, due to the polymorphism of the locus Taq 1A DRD2 [Zhang Y., Bertolino A., Fazio L., Blasi g, Rampino a, Romano R., Mei-Ling T. Lee. Tao Xiao. Papp, A., Wang D., Sadѐe W. Polymorphisms in human dopamine D2 receptor gene affect gene expression, splicing, and neuronal activity during working memory. Proc Natl Acad Sci USA. 2007. 104 (51). 20052-20057; Jocham, G., Klein, T.A., Neumann j, von Cramon D.Y., M. Reuter, M. Ullsperger Dopamine DRD2 polymorphism alters reversal learning and associated neural activity. J Neurosci. 2009. 29 (12): 3695-3704]. Characteristic typical discharges absences epilepsy is the occurrence in the frontal region of the cortex at the beginning of the discharge short bursts of activity with a higher frequency than the rest of the discharge. Only after that other parts of the cortex involved in rhythmic activity. These data agree well with the modern idea of the leading role of the frontal sections of the crust in the formation of PTS with absences epilepsy. Thus, the detected PTS of the first type in rats with genotype And1/A1typical absences epilepsy, they are formed in the structures corticothalamic circle. Further identified neaudirovannye to the ISI crossed with each other to obtain a homogeneous population. Thus, the technical result of the invention is the creation of a valid model of a homogeneous population of rats of the WAG/Rij with genotype And1/A1locus Taq 1A DRD2, PTS with only the first type, typical absences epilepsy, which allows to obtain reliable results when testing anti-epileptic drugs. The presence of established populations of rats with genotype A1/A1 locus Taq 1A DRD2 SOR only the first type (in the absence of the PTS of the second type), identifying the main target of action of the test preparations, will help to objectify the assessment of their effectiveness by analyzing the frequency, duration and peak wave index PTS of the first type, typical absences epilepsy person. This approach will improve the quality of new anti-epileptic drugs, because their score will reflect the ability to affect the main pathogenetic stages of the disease. Introduction received valid model in practice pre-clinical trials will provide a great economic effect with a strong social impact, in particular: 1) you will need fewer rats for the experiment, 2) decrease the time the experimenter, 3) will significantly increase the reliability of the results, and hence the efficiency of passing the test preparations and subsequent treatment, 4) higher is their treatment effectiveness will decrease the frequency of attacks in patients and ensure their ability to work, 5) will contribute to greater security of trophic nervous tissue 6) will reduce the risk of developing a psychotic complications of epilepsy, etc. Because today the world has no equivalent valid molecular-genetic model absences epilepsy humans, and the incidence of disease is high, there is every reason to assume that in the case of obtaining a patent in the future he can gain international status. A method of obtaining a valid molecular genetic model for preclinical testing of new anti-epileptic drugs, namely, that using genotyping locus Taq 1A DRD2among the rats of the WAG/Rij identified parental individuals R with genotype And1/A1gene DRD2, crossed with one another, get offspring F1that grow to a Mature age, then among offspring F1allocate neaudirovannyj individuals, then neaudirovannyj individuals offspring F1crossed with each other to produce offspring F2which then also dordives to Mature age, among them are selected neaudirovannyj individuals, while crossbreeding and selection is repeated to obtain a homogeneous population neaudirovannyj rats of the WAG/Rij with genotype And1/A1gene DRD2the AOC is e, control type PTS in selected individuals offspring F1for the next crossing is made by electroencephalographic analysis including morphological control.
|
||||||||||||||||||||||||||||||||||
| © 2013-2015 Russian business network RussianPatents.com - Special Russian commercial information project for world wide. Foreign filing in English. |