|
RussianPatents.com
|
|
Device in baler for ergonomic loading rolls of wrapping material for bales Invention relates to agricultural machinery industry and can be used in roll balers. The baler comprises a wrapping material feeding mechanism, a housing for storing the wrapping material and a casing partially forming the compression chamber for forming cylindrical bales. The wrapping material feeding mechanism is located in the lower rear area of the casing and comprises a pair of feeding rollers and the support plate located at the rear part of the feeding rollers to maintain the active roll of wrapping material. The feeding rollers are made with the ability to actuate selectively to feed the wrapping material into the compression chamber. The housing for storing the wrapping material comprises at least one compartment for storing rolls of wrapping material and has a raised operating position in which at least one storage compartment is located above the active roll of the wrapping material. At least one storage compartment of rolls is made with the ability of retention of inactive roll in a horizontal position. The connecting means is connected between the lower area of the housing for storing the wrapping material and the casing for providing selective movement of the housing for storing the wrapping material between the raised operating position and the lowered loading position of the housing for storage. |
|
|
Disc plough body comprises a rack with the axis on which on the bearing the spherical disc is mounted, braked by the locking mechanism located in the hub of the plough body, and a mouldboard is rigidly fixed, consisting of a breast and a wing. The spherical disc is braked by the leaf spring rigidly fixed on the rack, and the mouldboard mounted on the cantilever racks in the guide rigidly fixed on the spherical disc, has the ability of adjustment in height. |
|
|
Invention relates to meteorology. The method of forced scattering of atmospheric clouds comprises condensation of vaporous moisture of the upper layer of clouds by touching vaporous moisture of the upper layer of atmospheric clouds by the heated by independent steam temperature of +100÷120°C with the cold atmosphere above the upper cloud layer. At that the independent steam is sprayed inside the upper layer by the moving device equipped with steam generator with electric water heating, producing such steam in sufficient quantity. |
|
|
Milking machine comprises teat cups (1), collector (2), pulsator (3), milk-vacuum hoses, attachment (4). The teat cups have under-teat (5) and intermural (6) chambers. The pulsator housing is axially aligned with the attachment housing and is mounted above it to form the transverse partition (7) common with the attachment. The pulsator is provided with chambers of constant vacuum (8), alternating vacuum (9), constant atmospheric pressure (10) and the control chamber (11). The chamber of alternating vacuum is connected by the channel (12) with the control chamber. The chambers of constant and alternating vacuum are divided by the valve (13). In the housing of control chamber (14) a valve is mounted with axial holes (15), which end surface due to the spring (16) rests on the collar (17). The control chamber of the pulsator is provided with an additional housing (18) forming the working chamber (19) under it. The transverse partition is provided with a central hole (20) with a rod (21) located in it. The rod with its lower end is secured to the thermostatic bellows (22) of the milk chamber (23) of the attachment. In the rod the transverse (28) and longitudinal (29) holes are formed linked to each other. The actuating mechanism in the form of a sucker (30) is located above the additional housing. The thermostatic bellows is mounted on the base (32) movable in an axial direction by means of threaded connection. The housing of the attachment has pipes for feeding (33) the milk in the milk chamber and outlet (34) into the milk-receiver (35). |
|
|
Suspension of concave of section of harvester threshing Group of inventions relates to agricultural machinery industry and can be used in systems of crop threshing. The agricultural harvesting machine comprises a frame and a threshing section supported by the frame. The threshing section comprises a rotating element, a concave and a hydraulic system of supporting the concave, which locates the concave near the rotating element. The concave is made with the ability of movement in the directions to the rotating element and away from it. The hydraulic system of supporting the concave comprises at least one hydraulically driven element made with the ability to move substantially parallel to the said directions to the rotating element and away from it. The hydraulic system of supporting the concave also comprises at least one hydraulic drive and two support beams. The first support beam interacts with the end of the concave and is connected to the end part of the first hydraulic actuator, at that the end part is hydraulically driven element. Other support beam interacts with the opposite end of the concave and is connected to the end part of the second hydraulic drive. |
|
|
Potato harvester comprises a digging working element mounted on the frame and made in the form of a ploughshare over which there is a clod-destructing drum, a separating working element made in the form of a system of shafts with finger discs attached to them in a chequered order, made of elastic material, and a haulm remover. The clod-destructing drum consists of discs of elastic material mounted on the shaft, formed with protrusions along the perimeter. The discs on the shaft of the drum are mounted with a gap relating to each other, and the protrusions of adjacent discs are located chequered order. |
|
|
Dismountable polyethylene pipeline for sprinkler sets Dismountable polyethylene pipeline for sprinkler sets consists of fast-dismountable polyethylene pipes of a distributing pipeline and sprinkler wings. Expandable dismountable clamps with fasteners - hooks with springs and bolts for their tightening on a pipe are installed on the fast-dismountable polyethylene pipes on both ends. A clamp ring on the inner surface has notches, sharp teeth of which are directed towards the pipe end. The ring breadth for each pipe diameter shall satisfy the value B=(0.5…1.0)D, where B - breadth of the clamp ring, D - outer diameter of the polyethylene pipe. |
|
|
Leaf explants isolated from the thirty-day aseptic plants of initial varieties grown in 1 l containers, are placed in Petri dishes with the liquid medium of a certain composition and preliminary incubated, co-cultivated and cultivated on nutrient media of a certain composition. When appearance of regenerants of the size at least 10 mm they are cut and transferred to the nutrient media of a certain composition. The first stage of selection of forms resistant to Phytophthora and Alternaria spot causative agents is carried out, by culturing the cut regenerants on MS medium with 50 ml/L kanamycin sulfate for 30-45 days at 22-25°C and illumination of 6000-10000 lux at 16-hour photoperiod followed by selection of rooted regenerants of potatoes with green leaves and stems. The second stage of selection of forms resistant to Phytophthora and Alternaria spot causative agents is carried out, including checking of rooted plants by PCR method for the presence of target DNA and reproduction of regenerants with confirmed PCR target DNA insert by micrografting. |
|
|
Tool for surface tillage comprises discs curved along the helix line. The discs are located so that the cutting edges of the adjacent discs are located in the same vertical plane in the direction of movement. The discs are mounted on the hubs mounted on the hexagonal shaft. The hexagonal shaft has support bearings with anti-friction liners. The tool is made sectional. To provide the soil contour following the section coverage should be 120-150 cm. The sections are mounted in two. |
|
|
Unit for application of mineral fertilisers to soil Unit comprises a hopper with a metering working element in the form of a screw mounted in it, having a right-hand and left-hand winding of turns and a casing of transport channel of fertilisers having sowing holes. In the hopper a conveyor for feeding fertilisers to the metering working element is mounted. On the outer edge of turns of the screw the brushes are fixed with a height of bristles 1.5÷2 times greater than the maximum particle size of mineral fertilisers. The brushes are connected with the casing of transport channel of fertiliser, which sowing holes are located on the bottom and sidewalls of the casing in chequered order. Dimensions of seeding holes are 1.5÷2 times larger than the particle sizes of mineral fertilisers. Under the metering working element on the hexagonal axis the loosening drum is mounted, consisting of discs with teeth curved in opposite sides from the plane of the disc. The drum is pivotally mounted to the hopper frame through the leashes and to ensure spring-loaded penetration. The casing of transport channel is connected to the loosening drum by the guide shield. At the rear side of the hopper there is a metering valve. The conveyor for feeding fertilisers and the metering working element are driven by a hydraulic motor through the change-speed gear. |
|
|
Method of preparing composition for pre-sowing corn seed treatment Method of preparing the composition for pre-sowing corn seed treatment comprises preparing the solution of a mixture of 2 components. One of the components is salicylic acid, and the other is ragweed, harvested in the flowering stage. For preparing the two-component solution as solvent hot water is used, which is poured into the two-component mixture in the glass jar. The jar is sealed. The resulting solution for pre-sowing treatment of seeds is incubated with 2-3 hours of exposure. The amount of ragweed and salicylic acid in percentage with water is respectively 8-10% and 0.2-0.3%. |
|
|
Anti-mould agent is chlorinated vegetable (rape-seed, mustard, soya bean, camelina) oil with chlorine content of 19-26%. |
|
|
Device for drying flax rolls comprises a hollow cylinder with holes, which are uniformly arranged by height and diameter, a cone for piercing the roll and an air duct for a heat-carrying agent supply. A pin with an external thread, on which a piston is installed on one side, on the inner diameter of which the thread is made, and the pin through the coupling is connected to the electric motor shaft on the opposite side, is installed inside the hollow cylinder over its entire height. In central parts of roll zones at an equal distance from each other, humidity sensors are installed, in this case signals from the humidity sensors and a setting device are delivered to a control unit, electrically coupled to the electric motor. |
|
|
Method of control fertility of season-frozen arable soils Method comprises creation of deep vertical cavities, which enable to connect thawed zone of soil with the atmosphere during the period of its thawing, soil treatment, sowing Raphanus sativus subsp. acanthiformis. At that the grown harvest of the culture is left in the soil under the snowpack. |
|
|
Device for distribution of feed Device comprises a frame (1) with the upper rollers mounted above the feeders with the ability of reciprocating movement, the lower flat element moving along the lower rollers (4), and a transverse conveyor (15). The actuator (5) of movement of the frame (1) is stationarily located above it in the middle of the device. The frame (1) is made of two longitudinal perforated corner plates interconnected by transverse plates (7). The upper rollers of the frame (1) are supported by vertical walls, attached to the supporting racks (9) of the device. The actuator (5) of movement of the frame (1) comprises a shaft with two sprockets (11) engaging with the perforated corner plates. The lower flat element is made in the form of a rigid bottom (3) which is fixed from below the perforated channel (12) which contacts the actuator sprocket (14) of movement of the bottom (3) on the lower rollers (4) mounted on the supporting racks (9) of the device. The vertical walls and the bottom (3) form a chute for movement of the feed. |
|
|
Group of inventions relates to a method for replacement of at least some part of air at least in some part of a building containing an inside room and a floor. The method involves supply of the first air volume from the first station to the inside room of the building or to space interconnected through the first air duct, and/or removal of the second air volume from the room of the building or from the space to the second station through the second air duct. Cross-section of the first air duct is reduced in the direction from the first end of the first air duct to the second end of the first air duct, and/or cross-section of the second air duct is reduced in the direction from the first end of the second air duct to the second end of the second air duct. A system of cubicles includes at least two sections of cubicles. A system of ventilation passages includes the first air duct, the second air duct, the first suction, pumping or blowing device and the second suction, pumping or blowing device. The first end of the first air duct faces to the second end of the second air duct or to the first end of the second air duct. The first and the second air ducts are located at some distance from each other or have a common wall. The system can be used for optimisation of total animal transportation distance so that the shortest possible distance of transportation is provided. |
|
|
Server/mixer comprises a cylindrical hopper mounted on the chassis frame, mounted with the ability to rotate around the longitudinal axis. At the end of the hopper on the frame of the unloading mechanism with the actuator is mounted. On the inner surface of the hopper the helical protrusions are fixed ensuring movement of the feed to the unloading mechanism. The helical protrusions are formed by the rows of plates (12, 14) fixed with lengthwise pitch and with the spaces between the rows. In the hopper wall along the longitudinal line of the space the radial openings (13) are made with the pitch. The helical protrusions in the spaces are formed by the plates (14) with rollers (15) attached to them, which length exceeds the thickness of the hopper wall. The rollers (15) are located in the openings (13) with fixation of their axial movement. On the projecting ends of the rollers (15) the leashes are rigidly placed, interacting with the mechanism of turning and fixation of position of the plates (14). |
|
|
Rodenticide composition "izorat-3" (versions) Rodenticide composition comprises anticoagulant - zoocumarin, gelling agent - xanthan or carrageenan, or a mixture of xanthan and locust gum, or a mixture of carrageenan and locust gum, or a mixture of xanthan and guar gum, dye and water. It additionally comprises sulphaquinoxaline, polyethylene glycol as a stabiliser. The rodenticide composition comprises carmine or carmoisine as dye, or chlorophyll, or methylene blue. Also the rodenticide composition may additionally comprise a preservative-potassium sorbate or sodium benzoate. Also the rodenticide composition additionally comprises an attractant, and as the attractant it may comprise sugar or honey, or vegetable oil - sunflower or corn, or wheat or barley grain, or seeds of sunflowers. |
|
|
Invention relates to the field of agriculture. The method comprises application in autumn of organic and phosphorus-potassium fertilisers, deep autumn ploughing, application of nitrogen fertiliser in spring and carrying out cultivation. In that artichoke is cultivated on the southern lit slope. In autumn organic fertilisers are applied at the rate of 30-60 t/ha, also phosphorus-potassium fertilisers are applied at a dose of P40-90K60-120 on soils with high acidity - lime. After 1-2 days deep autumn ploughing of the site is carried out. In spring to accelerate the melting of snow the darkening agents are thrown on it - ash, phosphorus-potassium fertilisers, peat or loose soil. After snow melting, the nitrogen fertiliser at a dose of rate of application of 60-90 kg/ha are applied, and harrowing soil is carried out twice cross-diagonally to a depth of 5-7 cm with the help of tooth harrows on the hitches. After 2-5 days cultivation is carried out at a depth of 10-15 cm. The presowing treatment of seeding material of early varieties of artichoke of tuber purpose is carried out in advance, the healthy not affected by disease tubers are selected, they are decontaminated against infection in an aqueous solution of potassium permanganate in a concentration of 1:10000, germinated in the nutrient medium of humus half with sawdust or peat. The seed tubers are laid in one layer inside the nutrient substrate placed a layer of 6-10 cm, and kept moistened constantly at 15-20°C for 1-2 weeks until emergence of buds and start of emergence of sprouts, then the temperature is lowered to 8-10°C for formation of 1-2 cm sprouts and roots. The identified diseased tubers are removed, then the germinated tubers with the nutrient medium are transplanted into the soil warmed up to 3-5°C in wells and covered with the opaque film. Small tubers weighing 20-30 g are placed on the scheme 40×40 cm, the middle - weighing 40-60 g - on the scheme 50×50 cm, and the tubers are located in chequered order. Over the tubers location the cross-shaped cuts are made with the size of 5×5 cm. |
|
|
Invention relates to agricultural machinery industry, in particular to devices for separation of coarse heap on grain combine harvesters. The grain combine harvester comprises one threshing machine, a straw rack, primary and additional shaking boards, the upper and lower sieves. The additional shaking board is mounted inside the front part of each key of the straw rack and is inclined towards the threshing machine. Reduction of the load on the upper sieve is provided in threshing grain mass of low humidity. |
|
|
Method and system of concave suspension control of threshing section of harvester Group of inventions relates to agricultural machinery industry and can be used in thrashing systems of harvesters. The method of location of the concave in the threshing section of agricultural machine comprises the stages of selection and maintaining. At the stage of selection the predetermined pressure is selected, the minimal distance between the concave and the rotary element and the maximum distance between the concave and the rotary element. At the stage of maintaining the hydraulic fluid pressure is maintained in the hydraulic system of maintaining the concave, substantially at the predetermined pressure, when the concave is located between a minimal distance and the maximum distance during transportation of the collected material between the concave and the rotary element. |
|
|
In this method the sand is fixed by planting large-sized seedlings of eurotia using the side-scenes from cane fibre boards. The work is carried out on the open sands using grey eurotia as sand binding culture. Forage Kochia, Siberian wheatgrass are seeded under protection against pouring the side-scenes from eurotia. At that the large-sized eurotia seedlings are planted by planter along the axes of the tapes. Then to protect the grey eurotia seedlings against pouring with sand the cane fibre boards are used, stacked with support on each other along the rows. |
|
|
Folding frame for device (versions) Device comprises two first lateral tool bars, having the first and second end, two second side tool bars, two first side tool frames, two second side tool frames and two folding frame sections. The first end of the first bar is pivotally coupled to a towing rod assembly. Each of two side tool bars is coupled to the second end of the respective first side tool bar. Each of two first side tool frames is coupled to the respective first side tool bar. Each first side tool frame is designed with a possibility to rotate upwards from the working position into the transport position. Each of two second side tool frames is coupled to the respective second side tool bar. Each second side tool frame is designed with a possibility to rotate upwards from the working position into the transport position. Each of two folding frame sections is located between the respective first and second side tool frames, coupled with a possibility of rotation with the respective first side tool frame and made with a possibility of rotation out of plane, formed by the respective first and second side tool frames, so that there is a gap between the first side tool frame and the second side tool frame in order to avoid contact between the respective first side tool frame and the respective second side tool frame during transportation. According to the second design version, the device includes the first side tool bar, the first side tool frame, the second side tool bar, the second side tool frame and a folding frame section. The first side tool bar is designed with a possibility of stowing backward relative to the direction of motion. The first side tool frame is coupled with a possibility of rotation to the first side tool bar and is designed with a possibility of supporting various seed sections and stowing upwards of the first side tool bar around the longitudinal axis. According to the second design version, the second side tool bar is pivotally coupled to the first side tool bar by a connection made to provide rotation of the second side tool bar relative to the first side tool bar during transportation. The second side tool frame is coupled with a possibility of rotation to the second side tool bar and is designed with a possibility of supporting various seed sections and stowing upwards of the second side tool bar around the longitudinal axis. The folding frame section is disposed between the first side tool frame and the second side tool frame and is made with a possibility of supporting various seed sections and rotation out of the plane, formed by the first and second side tool frames, before transportation for formation of a gap between the first side tool frame and the second side tool frame and to avoid contact between the respective first side tool frame and the respective second side tool frame during transportation. |
|
|
Sunflower sterility/fertility identification method Invention relates to biochemistry, particularly a method for molecular-genetic identification of sterility/fertility of sunflower pollen. The method includes analysis of the complete DNA of analysed samples for presence/absence of the mitochondrial gene orfH522 and marker sequence of the nuclear gene Rf1 via a multiplex polymerase chain reaction using a first pair of primers: agtagcccgttccgtgtttatgga and ctttctatttgggtcatcgccgga, which identifies the orfH522 gene of cytoplasmic male sterility of pollen (CMS PET1), and a second pair of primers: ggcatgatcaagtacataagcacagtc and tatgtacgggaatgagctccggtt, which identifies the marker sequence of the Rf1 gene - fertility restorer of pollen CMS PET1, wherein a sample is defined as fertile if a) both orfH522 and the Rf1 gene marker are present, b) orfH522 is absent and the Rf1 gene marker are present, c) both orfH522 and the Rf1 gene marker are absent, and a sample is defined as sterile if orfH522 is present and the Rf1 gene marker is absent. Disclosed is a diagnostic set, which includes primers, for molecular-genetic identification of sterility/fertility of sunflower pollen using said method, as well as use of said method in plant selection. |
|
|
Tiller comprises a frame with milling drum fixed on it. The milling drum consists of sections with cutting knives. Behind the milling drum the sieving grid is mounted. The tiller is equipped with an additional milling drum with sections of ripping chisel blades. The additional milling drum is mounted in front of the main milling drum. The tiller is equipped with a smooth roller-compactor mounted behind the main milling drum. The main milling drum sections are formed with L-shaped long and short blades. The blades of additional milling drum sections are placed evenly in chequered order under acute differently directed angle to the horizontal plane in the vertical-transverse plane to the surface of the field. |
|
|
Method of growing echinacea purpurea in protected ground In this method the seeding is carried out at a depth of 1.5-2.0 cm, in specially prepared vegetative pots filled with expanded clay, soil substrate with the addition of biopack: high peat - 30%, soddy podzolic soil - 23%, river sand - 10%, biohumus - 37%, followed by water irrigation, surface leveling and further maintaining the substrate humidity of 60-70%, air temperature of 22-25°C, soil temperature of 20-23°C, air humidity of 70-80%, illumination of not less than 4500 lux. |
|
|
Milking room and method of its operation Group of inventions relates to dairy farming. The proposed milking room (1) milking animal (7) comprises at least first and second robots-manipulators (100, 200) and a plurality of milking stalls (5) provided on the platform (3) movable about the robots-manipulators (100, 200). The robots-manipulators (100, 200) are located so that they are able to serve simultaneously the neighbouring milking stalls (5) on the platform (3). Each of the robots-manipulators (100, 200) is made with the ability to attach to one animal (7) in the milking stall (5) of the subset of the total required amount of teat cups (21) to be attached to the teats of the said animal (7) in the milking stall (5), so that in each specific animal the teat cups (21) are attached to its teats by at least two robots-manipulators. The proposed solution discloses also the method of operation of the described milking room (1). |
|
|
Method of wrapping flax tapes comprises its picking up, transportation with simultaneous tumbling by 180° and spreading out on the preliminary compacted surface of flax. Before spreading out the tape is sealed and compacting in the contact area of the wrapped tape with flax is carried out with a gap. Compacting is carried out to form a wavy surface. |
|
|
Method of presowing treatment of seeds of grain varieties Method of presowing treatment of seeds is that the seeds of grain varieties are treated by their soaking in aqueous solution of sodium selenate at a concentration of 0.1% with an exposure of 0.5-1 hours, after which the seeds are enveloped by inoculant based on the strain of root nodule bacteria Galegae isolated from nodules Galegae orientalis Lam (galega) of Nesterka variety, mixed with soil taken from rhizosphere of galega with the ration of 1:2. The treated seeds were sown in soil. |
|
|
Method for modifying biotissue for prosthetic repair Before enzymatic treatment, a biotissue is placed into a hypertonic saline and exposed to ultrasound for 20-300 minutes. That is followed by terrilytin treatment in the concentration of 0.1-10 Production Units per 1g of the tissue, washing in an acetic acid solution and sodium hydrocarbonate, keeping in multiply changed glutaric dialdehyde solutions of the increasing concentrations, and sterilisation. |
|
|
Front lifting device for tractor Invention relates to the field of agricultural machinery industry, in particular to the front lifting device of the tractor. The front lifting device comprises the chassis fixed on the bearing structure of the tractor, two lower rods with mounting feet pivotally connected to the chassis. The lower rods are attached with the ability to move by means of the coaxially located working hydraulic cylinder and the second hydraulic cylinder. The working hydraulic cylinder provides movement of the rods between a lower position and a raised position. The second hydraulic cylinder is held by the valves in the extended state at normal operating mode and is transferred into the retracted state to transfer the rods into the retracted position. Transferring of the rods s carried out without any manual effort. |
|
|
Device for subsurface tillage in garden inter-row spacing Device comprises a frame with systems of hinging and adjusting the depth of processing, working elements. The working elements are made in the form of chisel and hingedly fixed A-hoes on the racks. The device has pipeline connected to each other of feeding the fertiliser with check valves, a manifold, a dispenser with the container. The container is connected with the compressor of the tractor and has a pressure reducing valve. The upper part of the chisel is formed wavelike with the channels inside having outlet to the vertex of each wave, at that the fastening of the working element to the frame is made with the ability to move, and in the lower part of the rack the channel is made connected to the channel of the chisel and through the pipeline to the check valve - the compressor and dispenser with the container. |
|
|
Herbicidal composition (versions) According to one embodiment, the herbicidal composition comprises the following components, wt %: C5-C10 ester of 2,4-dichlorophenoxyacetic acid 0-10, trialkylamine or oxyethylated alkylamine salt of 2,4-D acid 50-70, trialkylamine or oxyethylated alkylamine salt of florasulam 1-3, the surfactant of nonionic type 25-40, solvent 0-6. According to the second embodiment, the herbicidal composition comprises the following components, wt %: C5-C10 ester of 2,4-dichlorophenoxyacetic acid 0-10, trialkylamine or oxyethylated alkylamine salt of 2,4-dichlorophenoxyacetic acid 50-70, trialkylamine or oxyethylated alkylamine salt of florasulam 1-3, the surfactant of nonionic type 25-40, solvent 0-6. |
|
|
Invention relates to agriculture and can be used when harvesting grain crops. The rotary windrower comprises a platform and a cutting machine. On the platform the windrow-forming conveyor is mounted with drive mechanism. The windrower comprises a device for collecting fallen grain, comprising screening sieve sift with a set of funnels mounted under it and a hopper with a fan. The setoff funnels is connected to the hopper through the connecting hose. For unloading grain the hose of pneumatic loading is mounted on the hopper. |
|
|
Method of sowing spring spiked cereals Method comprises soil treatment, pre-sowing treatment of seeds and sowing in spring. The pre-sowing treatment of seeds is carried out by their moisture, bringing the moisture content of the seeds to 45-50% of their mass. The seeds are kept at a temperature of +5°÷+10°C for 20 days, then the seeds are packed and stored till sowing at a temperature below 0°C, and sowing is carried out at the seeding rate of 100-150 kg/ha. The pre-sowing treatment of seeds is started with selection of germinable seeds. |
|
|
Head of timber harvesting machine Invention relates to a head of timber harvesting machine, which comprises a frame of the head of timber harvesting machine, to be connected with the end of the lifting boom of the machine for work in the forest, a feeding device for moving a tree trunk, a front knife and/or the upper knives for limbing in front of the feeding device, a transverse cutting device for cutting trunks after the feeding device, and the lower knife for limbing between the feeding device and the transverse cutting device mounted on the side of the transverse cutting device on the frame of the head of the timber harvesting machine. In the head of the timber harvesting machine the lower knife for limbing is made with the ability of turning to a position for limbing around the tree trunk and the position of saving space between the outer surface of the tree trunk and the frame of the head of timber harvesting machine in the direction from the path of the tree trunk. In the position of saving space the lower knife for limbing is located between the outer surface of the tree trunk and the frame of the head of timber harvesting machine so that its end points in the direction of the head frame of the timber harvesting machine, at that at least its part extends above the path of the tree trunk. The lower knife for limbing is located after the feeding devices on the head frame in the recess so that it can be rotated in the recess substantially imperceptible from the side of the front knife and the upper knives for limbing. The lower knife for limbing is made with the ability to move by the hydraulic cylinder. |
|
|
Device includes an electrode connected to an electric power source. An electrode is made in the form of a coaxial cable, the central strand of which is earthed. Connection of the electrode to the electric power source is performed along an external electrically conducting cover. The cover is separated from the central strand with a dielectric gasket. |
|
|
Device for contour trimming of bushes Invention relates to devices for contour trimming bushes and can be used in forestry, agricultural and community facilities. The device comprises a housing with a knife-divider and a shaft mounted in it to transmit torque to flywheel closed with the protective casing. The holders are fixed through the axes on the flywheel. In the slots of the holders the movable knives are inserted, pressed from the bottom by conical bushings. The bushings rest on the knives by the collars by means of bolts and washers, pressed by the upper clamps. On the upper planes of the peripheral parts of the holders the torsion springs are mounted coaxially to the upper clamps. The torsion springs are made in the form of an open ring and have rectilinear peripherally projecting free end. The holders are connected by the tension spring, and are limited in rotation around the axes by the stops with buffers mounted in them. |
|
|
Trolley-type device of power transmission tower protection from birds Device features long housing 1 out of flexible dielectric material with arched cross-section, with pairs of opposed holes 3 in housing side walls 2, and dielectric housing mounting elements in the form of clamps 4 passing through each pair of opposed holes 3. |
|
|
Method of propagation of cymbidium in vitro Invention is a method of propagation of cymbidium in vitro, comprising introduction of sterile explants in culture in vitro, micropropagation by separating the pseudobulbs from explant and planting on the Murashige and Skoog nutrient medium, rooting of pseudobulbs in the ground, where, after the introduction in the culture in vitro the formed pseudobulbs are separated from the explant and transferred to the Murashige and Skoog agarised nutrient medium containing 30 g/l sucrose and epibrassinolide preparation solution in a concentration of 0.001 mg/l, then the pseudobulbs having root-shoots are separated from the explants, treated with the indoleacetic acid solution in a concentration of 1.0 mg/l for 15 minutes and rooted under ex vitro conditions in the ground with addition of moss and wood bark. |
|
|
Invention relates to agricultural machinery industry. The roll baling machine comprises a chamber for formation of rolls, at least one driving roller and a driving endless flexible pressing means. The driving roller is fixed on the movable holder and limits one part of the chamber for the formation of rolls. The endless flexible pressing means limits another part of the perimeter of the chamber for compression of rolls and is adjacent to the first and second rotating elements. The first rotating element is located on the holder. The second rotating element is connected with the holder through the drive connection and is preliminary tensioned by the means providing tensioning brought into the drive connection between the holder and the second rotating element. |
|
|
Synergic antimicrobial composition Invention relates to biocides. A synergic antimicrobial composition contains: (a) hydroxymethyl-substituted phosphorus-containing compound, which represents tetrakis(hydroxymethyl)phosphonium salt; and (b) cis-1-(3-chloroallyl)-3,5,7-triaza-1-azonium-adamantane chloride. A weight ratio of (a) and (b) in the composition constitutes from 15:1 to 1:15. To inhibit growth of microorganisms in a medium, which has a temperature at least 60°C and content of sulphides at least 4 ppm, the said composition is added. |
|
|
Method of sowing winter spiked cereals Method of sowing seeds of winter spiked cereals comprises pre-sowing treatment of seeds, for which the viable seeds are selected first. Then the seeds are moisturised, bringing the moisture content of seeds to 45-50% of their weight. Then the seeds are kept at a temperature of +4°…+6°C for 2.5-3 days. Then the seeds are kept at a temperature in the range of -3°…-5°C for 35-50 days, allowing short-term periods to 12 hours of temperature fluctuation in the range of +5° … to -30°C. Then the seeds are kept before sowing at a temperature below 0°C. Sowing is carried out in spring in time of sowing spring spiked cereals on the area of the fields, allotted for the winter and spring spiked cereals with a seeding rate of 100-200 kg/ha. |
|
|
Method and device of improved accelerated fixing of identified cows Method comprises separation and direction of animals to the fixing machines of the veterinary line having a chest bar with anatomically and physiologically reasonable optimal construction parameters. After passing the cows in the system of fixing machines the control system of hydraulic jacks is actuated, lifting the rear half of the metal floor of the veterinary line at an angle of 7-12° to the surface of the entire floor of the machines and the cow hind legs are raised by 30-45 cm. The device comprises fixing machines having a chest bar, hydraulic jacks with the control system for lifting the rear half of the floor of the machines of the veterinary line. The rear half of the floor is made movable and is a metal panel, rising slowly to 30-45 cm above the floor level, forming an inclined plane at an angle of 7-12 degrees to the front half of the horizontal and stationary floor of the machines of the veterinary line. |
|
|
Platform for manual harvesting strawberries and other low growing crops Platform consists of the sectional frame (2) with support wheels (4). On the frame the seats for operators (3), the wheel drive mechanisms, and platforms for containers are mounted. The platform is equipped with side stands made with the ability to fix on them of low-volume replacement containers. The stands are mounted on the frame of the section on both sides below the main sites. The side stands are made with the ability to adjust the inclination angle relative to the horizon. |
|
|
Herbicidal composition (versions) Herbicidal composition comprises trialkylamine salt of 2-methoxy-3,6-dichlorobenzoic acid containing in alkyl radicals from 1 to 20 carbon atoms optionally solvent, C7-C9 ether of 2-methoxy-3,6-dichlorobenzoic acid and surfactant of nonionic type. The herbicidal composition in another embodiment comprises 2-methoxy-3,6-dichlorobenzoic acid, trialkylamine containing in alkyl radicals from 1 to 20 carbon atoms, optionally solvent, C7-C9 ether of 2-methoxy-3,6-dichlorobenzoic acid and surfactant of nonionic type. |
|
|
Herbicidal composition (versions) Herbicidal composition comprises glyphosate in the form of trialkylamine salt, comprising the alkyl radicals with the number of carbon atoms of from 1 to 20, the surfactant, water, glycol and glyphosate in the form of monoethanolamine salt. The herbicidal composition in another embodiment comprises glyphosate, a trialkylamine, in which the alkyl radicals comprise from 1 to 20 carbon atoms, monoethanolamine, surfactant, glycol and water. |
|
|
Draw hook of hitch attachment, mainly for draft arms of three-point hitch attachment of tractor Draw hook of a hitch attachment comprises a casing including an opening for receiving and fitting a draft support of an implement, coaxial through holes for a blocking pin installation, and a cavity. A locking mechanism in the form of a catch which is spring-loaded to the direction of the opening is mounted in the cavity. The catch is coupled with a handle and set pivotally able of turning between supporting surfaces made in the upper part of the said cavity. The locking mechanism is fitted with upper and lower lugs which are set in a telescope manner, are pivotally attached to the catch and the hook casing respectively. The catch is made solid with the handle. The coaxial through holes are set in the zone of the handle movement, and the spring is installed between the said lugs and coaxial to them. The hinge of the upper lug is set on the catch so that when the draw hook is in the closed position, the spring axis is set between the opening and the plane passing through the lower lug hinge axis and the catch hinge axis, and when the draw hook is in the open position, the spring axis is set between the said plane and the handle. |
|
|
Trolley-type device of power transmission line protection from birds Device includes plate 1 out of flexible dielectric material in the cross form with four perpendicular shortened beams 2, 3, 4, symmetric against an axis passing through two opposite beams 3, 4, one of which is shorter and thinner than the other. Plate 1 features at least ten orifices 5, 6, four of which are made in beam 3, located in two pairs adjoining its sides, and six other orifices are adjoining protruding angles of other beams 2, 4. In addition, device includes dielectric fixation elements 10 for plate 1, passing through each pair of orifices 5, 6 opposing each other when the plate 1 is folded by the said symmetry axis. |
|
|
Method of forming water reservoir on piedmont plains Invention relates to the field of ecology, environment protection and rational nature management and can be used for purification of river water, climate regulation in drought and also contributes to creation of a reserve of fresh water for the economic and social needs of the population. The essence of the technical solution is that the water reservoirs with the depth of 2.5-3 m, the width of 120-150 m, the length of 250-280 m, the surface area of water of 3-3.5 ha are formed in interstream areas on the river banks at a distance of 150-200 m from the mainstream. The water reservoirs are connected to the river bed by input and take-out channels. At the bottom of the water reservoirs the zeolite-containing clay - irlites are placed with the layer of 10-15 cm. |
Another patent 2513951.
| © 2013-2014 Russian business network RussianPatents.com - Special Russian commercial information project for world wide. Foreign filing in English. |