| 2540100 - 2540149 2540150 - 2540199 2540200 - 2540249 2540250 - 2540299 |
 |
Method for production of sugar for long storage Method envisages syrup condensation in the vacuum apparatus till the supersaturation coefficient value is 1.25-1.27, crystals formation, crystals growing with constant or periodic intake of syrup till crystals content in the fillmass is 50-55%, the fillmass centrifugation and sugar drying and packing. When crystals content in the fillmass is 30-35%, one performs the fillmass intermediate output and centrifugation with separation of sugar crystals and inter-crystal solution. The produced crystals are mixed with syrup with purity equal to 97-99.4% and with dry substances content equal to 82-84% at a temperature of 80-82°C till the supersaturation coefficient value is 1.05-1.1. The produced fillmass is replaced into the vacuum apparatus for final growing of crystals at a temperature of 72-75°C. The replenishing solution during constant or periodic intake is represented by sugar syrup with purity equal to 97-99.4% and with dry substances content equal to 67-69%. Alternatively, the final growing of crystals is performed in the mixer-crystallisers by way of crystallisation by cooling with the temperature reduction to 45-48°C at a rate of 0.1-0.15°C/min. According to the preferable version, before packing produced sugar is subjected to conditioning in three steps. |
 |
Method and device for opening ore Invention relates to a method and device for opening ore. To create cracks or splits of ore, the device for opening ore is located at a distance from it. Ore is at least once exposed to radiation from the device of at least one alternating field or radiation and at least one alternating field. The device generates coherent radiation of near infrared spectral band, incoherent radiation of near infrared spectral band, at least one alternating electric field with frequency above 300 GHz, at least one variable magnetic field with frequency above 300 GHz, at least one variable electromagnetic field with frequency above 300 GHz, or a combination thereof. Ore mineral, ore minerals, absorbent components or ore mineral and absorbent components of ore absorbs or absorb the energy of the radiation, alternating field or the radiation and the alternating field. Gangue does not absorb this energy at all or absorbs only in small amounts. |
 |
Joint for connection of fluid pipelines Invention relates to joint (12) between vehicle pipes and mounted tools. Joint (8) comprises first and second connection components (10, 11). Component (10) is connected with vehicle (1). Component (11) can be connected to first component (10). Component (10) has shutoff device (15). Component (11) has at least one lock pin (24) to be engaged with lock (15). At connection of first and second components (10, 11), at least one lock pin (24) is fitted in curved guide (23) of lock (15) and released therefrom at lock position (18). |
 |
Tangerine compote production method Method involves preliminary heating of fruits with 80°C hot water during 2 minutes with subsequent water replacement with 95°C syrup, sealing and sterilisation in 120°C air flow at a rate of 8-9 m/s during 8 minutes. Then one performs maintenance during 20 minutes at a temperature of 95°C, then - cooling in 20-25°C air flow at a rate of 7-8 m/sec during 12 minutes. During the heat treatment process the jars are subjected to interrupted 2-3-minutes' turning upside down with a frequency equal to 0.1 sec-1 with a 2-3 minutes' interval. |
 |
Six-phase thyratron inductor motor with concentric windings controlled by three-phase sine current According to the invention the result is achieved at the expense of ratios of angular sizes of rotor poles with claw-like ledges, concentric windings and frequent - current method control. Six-phase high-speed thyratron inductor motor with concentric windings of stator, controlled by three-phase sine current, contains a stator with twelve poles and rotor with two poles. The motor stator is fitted with three-phase concentric windings. Windings of each of three phases cover simultaneously three poles and one stator pole placed in the middle of the three poles. Number of turns covering three poles of the stator is related to number of turns covering one pole of the stator, approximately as 1/0.73. The rotor is fitted with claw-like ledges. The control is performed using a frequent current method. |
 |
Method for sterilisation of peach in peach juice with pulp Invention relates to food industry. The method involves three-stage heating of preserves in 60, 80 and 100°C water during 5, 5 and 15-20 minutes, respectively, with subsequent three-stage cooling in water during 5, 5 and 7 minutes; heating and cooling at water temperature equal to 60 and 80°C are performed in the same baths. During the whole heat treatment process the jars are subjected to interrupted 2-3-minutes' turning upside down with a frequency equal to 0.166 sec-1 with a 2-3 minutes' interval. |
 |
Device for scaring birds using sound vibrations Invention relates to the field of scaring birds. The device for scaring birds affects the area of space with ultrasonic and close to ultrasonic vibrations. The device comprises a housing with several surfaces of radiation. In the surfaces, the cylindrical recesses are formed as resonating spaces. Through the housing with a cylindrical inner space the axis passes. The fixed, non-rotating axis is divided into two parts. The first part is formed by the outer support flange and the inner support flange with the stay bolts screwed between them. Between the both support flanges the electric motor and reduction gear is located. The second part of the non-rotating axis is formed by the pot-shaped sleeve. On the sleeve the contact ring is fixed. The contact ring is adjacent slidably to the current collector. The current collector is connected to the rotating housing. From the current collector the wires pass through the hole to the resonator space. |
|
Bakery product is produced with usage of a flour/starch component containing flour exposed to wet thermal treatment and is gluten-free. Flour exposed to wet thermal treatment is represented by tapioca flour. The proposed bakery product is in a greater degree similar to a traditional one, containing wheat flour in comparison with other gluten-free products. |
|
 |
Method for electronic jamming of radio communication system Invention relates to radio engineering and can be used to jam shipborne and airborne radio communication equipment. The method for electronic jamming of a radio communication system is based on receiving a probing information signal a jammed system, reproducing the carrier frequency of the signal, generating an interfering signal, amplifying and emitting the signal towards the jammed equipment. The method includes continuously measuring coordinates of carriers of the transmitter and receiver of the jammed system; the carrier of the jamming system used is an aircraft, wherein said carrier is held at a point in space on the "transmitter - receiver" line with the shortest possible distance from the receiver; upon detecting, in the received probing information signal of the transmitter, information radio pulses of a phase-shift keyed signal with carrier frequency which abruptly varies from pulse to pulse according to a random law, the duration, repetition period and carrier frequencies of said pulses are measured; if the measurement results match catalogue values of parameters of the probing information signal of the jammed system, interfering signals are generated, which are radio pulses with the same duration, repetition period and carrier frequency as the received probing information pulses, but delayed by about 0.2 mcs relative to the received pulses and without phase-shift keying, wherein each of the interference pulses are generated in form of a non-modulated radio pulse of the same duration as the received probing information radio pulses. |
 |
Determination of ore crushing degree in crusher Invention relates to grinding and can be used for determination of ore grinding degree. Ore (120) is crushed in crusher (100) with drum (110) driven be magnetic drive (130) with at least one genetic segment (131/1). Proposed method consists in intermittent determination of voltage (Uind,I) induced in coil (133/1) of magnetic segment, to make the conclusion on crushing degree. System to this end comprises measuring device (134/1) for intermittent determination of voltage (Uind,I) induced in coil (133/1) of magnetic segment (133/1) and data processing unit (170), which allows to derive crushing degree from determined induced voltage (Uind, I). |
 |
Reversible frequency converter Invention pertains to the sphere of electric engineering and conversion equipment, in particular to reversible static converters of electric energy designed as per the circuit of indirect electrical converters. To the circuit of the electrical converter auxiliary rectifying circuits are added; the latter contain a diode and a thyristor (a monitoring key) turned on in antiparallel way and coupled in series with circuits of the active rectifier arm. |
|
Quail eggs preservation method Quail eggs preservation method involves boiling, shelling, pouring with a brine, hot eggs packing into jars and maintenance before marketing. After boiling, eggs are cooled in ice water. The brine composition includes sugar, culinary salt, vinegar essence, ground pepper, garlic, mushrooms and vegetables as well as a natural antioxidant represented by rosemary extract. Before pouring, brine is subjected to discharge-pulse treatment. Maintenance before marketing is performed during no less than 3 days. |
|
 |
Body of a water-diversion ditch comprises two substantially identically formed surface blocks, namely: a bottom block and a substantially identically formed cover block, which with the help of spacing elements are connected to each other at the mounting distance. Surface blocks are proposed to be made substantially as capable of engagement when laid into stacks, so that the mounting distance of the surface blocks is considerably more than their distance when laid into a stack. Spacing elements are substantially shaped in the form of a truncated cone or a truncated pyramid, with a limited surface of the cross section, which with increased distance from the surface blocks becomes less. The first alternative version may include placement of the spacing elements on the surface units so that bottom blocks and bottom covers are laid as overlapping each other according to the type of stonework tying. The second alternative version may provide for overlapping connection of the bottom blocks and the cover blocks to each other according to the type of stonework tying. |
 |
Invention relates to the agricultural industry, in particular to devices for processing of field crops with solutions of fertilizers and pesticides. The spray boom comprises the middle and side parts, hinge-bearing units, thrusts and hitch attachment. The middle and side parts are pivotally interconnected. The hitch attachment is made parallelogram-pendulum. The parallelogram part is made in the form of a rocker. The ends of the rocker are connected through the thrusts with the hinge-bearing units. The thrusts have the variable length. The pendulum part is made in the form of an eye bar. One side of the eye bar is connected by the bearing unit to the centre of the rocker. The other side of the eye bar is rigidly connected to the rack of the upper support of the hitch attachment. |
 |
Electromagnetic drive with two steady states for medium voltage automatic switch Electromagnetic drive (5) with two steady states contains at least one electric coil (7) for switching of a ferromagnetic armature (6) between the first end position and the second end position under the electromagnetic field action, and at least one permanent magnet (8) for holding of the armature (6) in one of two end positions corresponding to open or closed position of switching of an automatic switch which is mechanically connected to it. The armature (6) contains a top plunger (9) supported by the ferromagnetic core (10) of one electric coil (7) for static holding of the armature (6) in the first end position, connected to the plunger rod (12) passing through the ferromagnetic core (10) and through the permanent magnet (8) for mechanical connection of the drive (5) with the automatic switch. The armature (6) also contains the bottom plunger (13) through detachable connector installed on the opposite side of the plunger rod (12) with an axial gap with reference to the core (10) and with a possibility of movement with reference to the core (10) for the shifting of the armature (6) to the second end position at decrease of the magnetic flux passing through the top plunger (9). |
 |
Network based control of report messages in wireless communication network Invention relates to a cellular wireless communication system and particularly discloses methods and platforms for network based control of report messages comprising logged measurements in a wireless communication network. In accordance with some exemplary versions, UE (30) storing logged data i.e. logged measurements that are bigger than a single transmission packet, i.e. report message, segments the logged measurements and sends only a portion of the logged measurements that fits into a single report message. The UE (30) also indicates to a network node (28) that additional logged measurements exist in the UE buffer (44). |
 |
Etomidate analogues with improved pharmacokinetic and pharmacodynamic properties Invention refers to organic chemistry, namely to benzimidazole derivatives of general formula |
|
Described is universal cleaning substance in form of enriched finely disperse activated glauconite with fraction size from 0.01 to 100 mcm, with glauconite being activated by UHF-radiation at frequency 2450 MHz, with power from 0.5 to 2500 W. |
|
 |
Inter-frequency measurements for observed difference of time of arrival of signals Method includes steps receiving from a location server at a mobile user node a request to perform inter-frequency reference signal time difference measurements; receiving from a serving access node a measurement gap configuration; performing the requested inter-frequency reference signal time difference measurements during the assigned measurement gaps; and reporting the results of the inter-frequency reference signal time difference measurements to the location server. |
|
Method of obtaining polyallylamine Described is method of obtaining polyallylamine by reaction of interaction of polyvinylacetic acid amide with mixture of sodium hypochloride and sodium hydroxide with their molar ratio polyvinylacetic acid amide : sodium hypochloride : sodium hydroxide respectively 1:1.13:1.05 at temperature 40-80°C for 6-8 hours. |
|
 |
Electric installation unit for hidden wiring with braces Electric installation unit for hidden wiring includes a supporting plate (2) for placing an insert (1). The supporting plate (2) is equipped with brace fixtures (3) in order to fix/install two opposite braces (8, 17, 21), and each brace is made of electrically insulating polymer material and consists of the base plate (9) with two braced flanges (12, 13) moulded at it under right angle. The base plate (9) is equipped with a depression (10) surrounded by peripheral reinforcing rib (11) to introduce a setting screw (6). |
 |
Method of light hydrocarbons treatment from carbonyl sulphide Invention is related to the sphere of hydrocarbons treatment from sulphur compounds and may be used in oil, gas and petrochemical industries. The invention is related to the method of light hydrocarbons treatment from carbonyl sulphide by its decomposition in hydrocarbon by an alkaline agent with further stripping of the alkaline agent saturated with sulphur compounds and its oxidising recovery by treatment of air oxygen in presence of the catalyst oxidising sulphur compounds. The promoter containing alkali water (NaOH, KOH) and water-soluble polar organic compounds formed during treatment of products of alkalis and acid impurities of hydrocarbon fractions interaction in presence of the polymer-based catalyst is used as the alkaline agent. Oxidising recovery of the alkaline agent saturated with sulphur content is made by air oxygen at temperature of 30-80°C and pressure of 3.0 MPa in presence of polymer-based catalysts, at that the above alkaline agent (promoter) has total alkalinity not less than 5 wt % and content of water-soluble polar compounds and acid impurities in it is not less than 1.7 wt %. |
 |
Method of heating thin metal films Method of heating thin metal films, implemented using a Mach-Zehnder interferometer scheme, which includes one highly reflective and two semitransparent mirrors, a mirror with phase modulation, as well as a solid-state laser, polarisers for controlling wave amplitude, is characterised by that the surface of the heated metal sample is placed at an angle α to the incident p-polarised laser beam, and said angle is read from the normal to the surface of the sample and has a value at which reflection for a selected material is minimal. |
 |
Cable includes at least one current-carrying conductor coated with insulation from polyvinylchloride compound and an external cover from polyvinylchloride compound, which differs by the fact that insulation and the external cover are made from polyvinylchloride compound containing suspended polyvinyl chloride 100, C8-10-alkyl phthalate plasticising agent 30-70, C8-10-alkyl-aryl phosphate plasticising agent 0-20, lead complex or CaZn-stabilising agent 5-9, phenolic antioxidant 0-0.5, epoxidated vegetable oil 0-5, antimony oxide 0-5, zinc oxide 2-10, zinc borate 0-10, finished aluminium or magnesium hydroxide, or their mixture 50-200, finished calcium carbonate, or calcium-magnesium carbonate, or their mixture 50-300, calcium or magnesium silicate 0-20. Additionally, the cable includes filler, belt insulation, which can be made from polyvinylchloride compound of reduced fire hazard, for example of Lousgran grade. In particular cases, the cable is provided with armour and shield. |
 |
System for generating neutron beam Present invention relates to nuclear physics and medicine and can be used for neutron capture therapy of malignant tumours using a neutron source based on a charged particle accelerator. In the disclosed system for generating an orthogonal beam of neutrons, neutrons are generated from interaction of a beam of charged particles, e.g., a beam of protons, with a target placed in a vacuum chamber. The beam generating system includes a moderator, a reflector and an absorber and forms at the output a beam of epithermal neutrons, which is orthogonal to the direction of propagation of the beam of charged particles. The invention enables to turn the beam generating system or a part thereof comprising the moderator, relative to the axis of propagation of the beam of charged particles, owing to the presence of a rotary system mounted outside the vacuum chamber. |
 |
Invention relates to mining and can be used in coal and ore pits in excavation at drilling-and-blasting. Proposed method comprises drilling wells, close in pairs, in spacings between three larger-diameter compensation wells. Note here that triangular lengthwise compensation cut-outs - strain compensators are made in said wells, close in pairs directed towards compensation wells. |
 |
Method for spatial monitoring of electromagnetic radiation sources Invention relates to passive radio monitoring systems and can be used in radio-frequency source positioning systems. The technical result achieved is shorter time for identifying the location of a radio-frequency source with a limited region in space. The method includes performing space- and time-synchronous direction-finding of a radio-frequency source followed by correction processing of the stream of signals from each direction-finder to detect signals from radio-frequency sources whose coordinates belong to a predetermined scanned region in space. |
 |
Cooling tower with air control devices Evaporative cooling tower includes a stack at the base of which there are air inlet openings with turning flow control shields with a horizontal rotation axis and air guide shields with a vertical rotation axis, which are located at the air inlet openings. The cooling tower includes turning air guide shields with the horizontal rotation axis, which are installed at an angle to horizon inside the stack at the base of the air inlet openings. The turning flow control shields with the horizontal rotation axis and the air guide shields with the vertical rotation axis are made in the form of a single structure installed in all air inlet openings and consisting of three shields with a horizontal rotation axis, which are located in the centre, and two shields with a vertical rotation axis, which are located on edges. The invention allows controlling intensity and uniform distribution of an airflow in winter time as a result of combined use of turning shields with horizontal and vertical rotation axes. |
 |
Fabrication of tubular section from mineral cotton and tubular section made thereby Invention relates to fabrication of tubular section from mineral cotton. Proposed process comprises the steps that follow. Thin strip 1 is sawn from green board of mineral cotton and said strip is cut in length in compliance with preset wall depth of section being fabricated. Said strip is wound on rod 2 to get multilayer cylinder. Said rod with wound cylinder is placed in forming device and processed therein. Prior to winding of strip 1 on rod 2 and/or at winding said strip on rod, granulated material 3 of high heat insulation properties is applied on said rod between plies of mineral cotton. |
 |
Cellular element for offgas toxicity reduction system Invention relates to cellular element for offgas toxicity reduction. Proposed cellular element (1) has channels (2), main axial direction (3), flat front surface (4), flat end surface (5) and circular lateral surface (6). The latter is located parallel with the main axial direction (3), front surface (4) or end surface (5) inclined thereto. Said element is composed by two sections (9). Each said section has at least one flat end surface (10) perpendicular axial main direction (3). Perpendicular end surfaces (10) face each other. Invention covers the cellular element fabrication process, exhaust pipe section with said cellular element and vehicle with exhaust gas system (18) with discharge pipe (19) including said cellular element. |
 |
Jacket of cylinder liner of liquid-cooled internal combustion engine Jacket of cylinder liner (1) of liquid-cooled internal combustion engine has an annular cavity (2) between the external surface of cylinder liner (1) and the walls (3) of the cylinder block, through which the cooling fluid circulates. In the cavity (2) a corrugated housing (4), forming with the external surface of the cylinder liner (1) a sealed camera (5), filled with heat-transfer fluid is located, the boiling temperature of which is higher, than the boiling temperature of the cooling fluid. The corrugated housing (4) is designed using the material with the shape memory effect. |
 |
Method for removal of sand and mechanical impurities in flow of oil, water and gas Invention is referred to the sphere of operation of multipurpose wells, mainly to sandy oil wells, and is intended for treatment of the formation fluid from sand and mechanical impurities. The method for removal of sand and mechanical impurities in a flow of oil, water and gas includes catchment of sand from a flow of oil, water and gas, accumulation of sand and mechanical impurities in receiving hoppers. Catchment of sand and mechanical impurities from a flow of oil, water and gas is implemented mechanically due to reduced pressure and shock losses based on Bord effect intensified by Coanda effect and assumes installation in a flow of oil, water and gas the device design consisting of sand and mechanical impurities receiving hopper and pressure differentiator, which mechanical specifications allow maximum development of the above effects. The device may be installed in a pumped flow or a flow moved by own pressure both upwards and downwards any pumping mechanisms, at that it is envisaged to install one or several in series devices for complete treatment of a flow of oil, water and gas from sand and mechanical impurities. |
 |
Device for control of operation of cluster bit of submerged-type hammers Invention relates to mechanisms and equipment used in construction of load-bearing foundation piles for soil drilling. A drilling unit includes a cluster bit of submerged-type impact hammers, which consists of two or more submerged-type impact hammers, each of which is equipped with a drilling head; a distributor for distribution of compressed air or liquid under pressure from two or more independent sources for supply to the cluster bit of submerged-type impact hammers and a swinging head to provide an angular rotation speed and torque for the unit. The distributor is connected to the cluster bit of submerged-type impact hammers. The swinging head is connected to the distributor, in which at least two impact hammers are equipped with compressed air or liquid under pressure from two independent supply sources. |
 |
Proposed system comprises shooting mechanism, on-back parachute pack, reinforcements and fasteners required for pilot fit and fixation in cabin. Parachute pack is reinforced at top and on sides by rigid frame with its bottom edge is in flight jointed with aircraft so that its top edge in catapulting destructs the cockpit canopy glazing. Parachute pack is provided with stiff plates to fix the pack shape in flight and ejection. |
 |
Natural gas odoriser (versions) Invention relates to automatic control of gaseous medium consumption and can be used during odorisation of natural gas, including at low gas flow rates. A natural gas odoriser includes a temperature-controlled holding tank of odorising liquid with a supercharging branch pipe, a natural gas flow sensor with an air output signal, an odorant supply channel interconnected through a control valve and a bubble flow meter - dosing unit with a low pressure line. The bubble flow meter - dosing unit represents a bottle filled with liquid, in the lower part of which there installed is a gaseous odorant supply jet nozzle and a trap - calibrator providing formation of bubbles of equal volume, a bubble counter, and a bottle liquid column control system. |
 |
System comprises a first component - combiner, mounted at an angle to the optical axis of the system, a second component comprising a first biconvex lens and a second convex-concave lens, which are decentralised and inclined relative to the optical axis of the system, an emitting microdisplay mounted at an angle to the optical axis of the system, and an electronic information processing unit. The surfaces of the first component are biconical. In the second component, the second lens is divergent and there are additional third and fourth biconvex lenses. The first and second components are placed such that an intermediate image forms in between. |
 |
Instrument comprises an inlet optical system with a lens, in the focal plane of which there is a radiation receiver installed, placed on the inner frame of suspension, as well as the outer frame of suspension, and a unit of information processing, the first inlet of which is connected to the outlet, and the first control outlet - to the control inlet of the radiation receiver. Inner and outer frames of suspension are equipped by drives, inlets of which are connected accordingly to the second and third control outlets of the information processing unit, and meters of a rotation angle. Increased accuracy of angular measurements is achieved due to increased speed of information processing when using high-accuracy highly informative devices. |
 |
Optical unit for laser probing of cloud atmosphere Optical unit comprises an objective lens and a semiconductor pulsed laser placed at the focus of said lens, the lens and the laser being placed in front of a mirror lens in line with said mirror lens, a first photodetector placed at the focus of the mirror lens, comprising a main mirror and a secondary mirror, a semitransparent flat mirror placed in the centre opening of the main mirror. A second photodetector is placed in line with the first photodetector behind the additional focal surface of the mirror lens formed by the semitransparent flat mirror. The unit comprises a photoelectric signal processing unit with two inputs and one output, one input of which is interfaced with the semiconductor pulsed laser and the second with the first photodetector, and a photoelectric signal adder with two inputs and one output, the output of which is connected to the second input of the photoelectric signal processing unit, and the first and second inputs are connected to outputs of the first and second photodetectors, respectively. |
 |
Cassette for pre-assembly of truss frames In a cassette block for pre-assembly of truss frames, comprising a body made of a cruciform base, vertical stands with braces, a table and clamping devices, the body is made as dismountable, and clamping devices are installed as capable of displacement on vertical stands at the level of their upper and lower belts of assembled truss frames. Each clamping device is made in the form of a roller, connected by means of a spring and a stem via a mounting block with a rope of gap control between the roller and the vertical stand, besides, the mounting block is fixed on a vertical stand with the help of a pin, the table is equipped with an additional roller, and height of vertical stands is made by 0.5 m higher than the maximum height of truss frames. |
 |
Pavement board with inbuilt information medium Pavement board with an inbuilt information medium, such as a QR-code, comprises a base from concrete reinforced with a polymer net, onto which a layer of primer is applied from epoxide material, on top of which a layer of white colour is applied from epoxide material, on top of which there is a transparent layer applied from epoxide material, comprising a light-generating luminescent material as an additive with long afterglow, onto which a contrast information layer is applied with a varnish of ultraviolet hardening, at the same time a transparent protective layer of epoxide material is applied on top of the information layer. |
 |
Plasma accelerator is designed to generate traction when moving space objects and for producing composite powders, sputtering and processing materials. Sections of the anode of the accelerator are made from flat pipes with outlets for feeding a working medium through the anode. The pipes are arranged with the width in a radial plane with a gap between each other and are directed along an axis. The outlets are directed an angle of less than 90° to the axis of the accelerator. The working surface of the anode is formed by ends of the outlets with openings. The bases of the pipes are hermetically connected to a collector. The collector and the inlet of the working medium are mounted on a current lead. The distance from the face of the cathode to the outlets is greater than half the diameter of the anode. A neutral shield is mounted outside the anode. |
|
"tomatoes, tofu and onion salad" preserves preparation method Method envisages recipe components preparation, tomatoes and bulb onions cutting and blanching, cilantro greens cutting and freezing, tofu grating, walnut kernels crushing, ground pumpkin seeds extraction cake pouring with drinking water and maintenance for swelling, the listed components mixing with lemon juice and salt, the produced mixture and mayonnaise packing, sealing and sterilisation. |
|
 |
Invention refers to veterinary virology. What is described is a method for recognizing genome RNA of the Ibaraki disease virus (IDV) by the real-time PCR with detecting amplification products by using oligonucleotide primers and a probe complementary to segment 10 of the IDV genome coding non-structural proteins NS3 and NS3a. The method is implemented by using the real-time PCR under the following temperature conditions: 1) 5 min of cDNA pre-denaturation at 94°C; 2) 5 reaction cycles (denaturation at 94°C for 15 sec, primer annealing at 62°C for 15 sec, elongation at 72°C for 15 sec); 3) 35 reaction cycles with detecting at the stage of primer annealing (denaturation at 94°C for 15 sec, primer annealing at 62°C for 15 sec, elongation at 72°C for 20 sec). The reaction results are taken into account by analysing fluorescent signal accumulation curves for each test. What is presented is a nucleotide composition of the following primers and probe: IbarF 5'-GATCAAACCATTTTGCGCTT-3' IbarR5'-CTCATCCTCACCGCCTCATTG-3' IbarZ 5'-[HEX] TCTTGTATGGTCAATCCGCTGGCT [BH2J-3'. |
 |
Invention relates to dairy industry. The method involves fluidisation with gas with boiling layer formation with usage of dry milk and fat water emulsion for formation of agglomerated particles containing dry milk and dry emulsified fat. In the boiling layer particles are partly or completely coated with the first bonding medium containing 10-50 wt % of dissolved carbohydrate. According to the other version, the method involves fluidisation with gas with boiling layer formation with usage of dry powdery emulsified fat, optionally, combined with one dry product chosen from dry milk, whey protein isolates, cocoa carbohydrates, dry glucose syrups, starches, oligosaccharides and dry milk or the listed components combination for agglomerated particles formation. In the boiling layer particles are partly or completely coated with the first bonding medium containing 10-50 wt % of dissolved carbohydrate. The granules have mean diameter equal to 10 - 10000 mcm. The produced granules may be coated in the boiling layer with the second bonding medium containing carbohydrate. |
 |
Method for obtaining anatoxin bordetella pertussis Method involves cultivation of pertussis bacteria in liquid growth medium, separation of supernatant from microbial mass by centrifugation, separation of pertussis toxin from it, its detoxification with formalin in presence of saccharose in a thermostat, and sorption of anatoxin on an aluminium hydroxide gel. Strain Bordetella pertussis No. 287 is used as a producer of pertussis toxin. Detoxification of the above toxin Bordetella pertussis is performed during 19-20 days. The obtained anatoxin is combined with anatoxins of vaccine strains No. 203 and No. 305; they are taken in the ratio of 1:0.5:0.5 respectively; a physiological solution with a phosphate buffer is added to the mixture, and the mixture of anatoxins is absorbed on the aluminium hydroxide gel. |
 |
Method of determining biological activity of embryonated eggs of trichuris Invention deals with method of determining biological activity of embryonated eggs of Trichuris. Characterised method includes realisation of at least 3 analyses, selected from: evaluation and/or confirmation of stage of embryonated development of eggs by means of method of quantitative PCR with application of suitable marker sequences for determination of quantity of genome DNA copies, evaluation of metabolic activity of embryonated eggs by means of biochemical and/or molecular-chemical methods, evaluation of inducibility of gene expression in embryonated eggs, evaluation of mobility of Trichurs larvae by means of microscope for long periods of observation after preliminary incubation at higher temperatures and/or evaluation of coefficient of hatchability of Trichurs larvae in organism of laboratory animal. |
 |
Compositions of recombinant antibodies from epidermal growth factor receptor Invention relates to biochemistry and represents composition of antibodies for application in method of treatment of malignant neoplasm in a subject who had preceding course of treatment with application of antibody against human EGFR or malignant neoplasm, resistant or partially resistant to treatment with, at least, one other antibody against human EGFR, selected from the group, consisting of cetuximab, panitumumab, zalutumumab, nimotuzumab, ICR62, mAb806, matuzumab and antibodies, capable of binding the same epitope as any other of mentioned antibodies, with said composition of antibodies containing at least first molecule of antibody against human EGFR and second molecule of antibody against human EGFR and its application. |
 |
Group of inventions refers to medicine. A device comprises an individual blood sampler, an analyser for determining and presenting the blood characteristics in the form a blood analysis result, an execution unit connected to the individually backward feeder and configured to transfer a substance to the individual through the backward feeder. The execution unit comprises a container unit accumulating the substances. The container unit is provided together with a dosage package, which takes the blood analysis results into account to select the substances or to prepare a mixture thereof. The device also accommodates an assessment and control unit configured to share information with the analysis unit and the dosage package, and to generate control signals to control the dosage package. When implementing the method, individual's blood is sampled and analysed. Taking into account the blood analysis result and assessment criteria, the substances or mixture thereof are typed and quantified. The dosed substances or mixture thereof are mixed to the sampled blood to produce the modified blood, which is used for reperfusion into the individual or used as a perfusion solution instead of the sampled blood for a reperfusion into the individual. |
|
Method of production of propionylcholinesterase Ganglia of cephalopods are homogenised by double sonication. The obtained homogenate is diluted with distilled water, the mixture is filtered, centrifuged and the supernatant is passed through a chromatography column, where the sorbent is used as concanavalin A-sepharose (Con-A-sepharose), and dried, and prior to drying the propionylcholinesterase the solution of polyethylene glycol is added to the enzyme solution. The enzyme solution is sublimated at a temperature of final drying not exceeding 30°C. |
|
 |
System and method for quantitative measurement of self-ventilating individual's lung compliance Group of inventions refers to medicine. A lung compliance is measured in an individual who is at least partially self-ventilating. The quantitative measurement of the lung compliance can represent an assessment, a measurement and/or a rough measurement. The quantitative measurement of the lung compliance can be suspended over common methods and/or systems for the quantitative measurement of the self-ventilating individual's lung compliance; the lung compliance can be quantitatively measured relatively exactly without the use of a force measurement rope or any other external sensing device, which measures a diaphragm muscle pressure directly; the procedure does not require the individual to monitor the diaphragm muscle pressure manually. |
Another patent 2551122.