|
RussianPatents.com
|
|
Polycationic triviron compound and method for production thereof Method for synthesis of a 1,5-bis-(4-tetradecyl-1,4-diazoniabicyclo[2.2.2]octan-1-yl)pentane tetrabromide (C47H100Br4N4) derivative includes dissolving 1-tetradecyl-4-aza-1-azoniabicyclo[2.2.2]octane bromide in methanol while heating to temperature of 55°C, while stirring, adding two portions 1,5-dibromomethane to the obtained solution until a reaction mixture is obtained, which is then stirred and cooled to temperature of 18-22°C, after which 20 ml acetonitrile is added to the obtained mixture, followed by separation of the precipitate from the mother solution, wherein the precipitate is filtered out and dried in a vacuum and the obtained mother solution is evaporated to obtain a viscous syrup-like residue to which 40 ml acetonitrile is added and stirred while boiling with a reflux condenser to obtain a suspension which is then cooled to temperature of 18-22°C and the precipitate formed is filtered out, dried in a vacuum and mixed with the previously obtained precipitate to obtain the end product. |
|
|
Method for inducing stem cell migration in fatty tissue Invention refers to molecular biology, biochemistry and medicine. What is presented is a composition for inducing stem cell migration in fatty tissue of adults which contains human mesenchymal stem cells from a fatty tissue of adults in an amount of 1x107 to 1x1010 as an active ingredient which express a chemokine or growth factor receptor on a cell surface, or a secretory product of the above stem cells contain the chemokine or growth factor receptor; wherein the secretory product of the stem cells of the fatty tissue of adults represents adiponectin; and wherein the human stem cells of the fatty tissue of adults are first treated with a mixture containing chemokine or growth factor. |
|
|
Invention is recombinant plasmid DNA encoding hybrid polypeptides with the properties of red fluorescent protein mCherry. The recombinant plasmid DNA pChFN3 encodes the hybrid protein ChFN3 which has the properties of red fluorescent protein mCherry and 10 domain of human fibronectin of type III, and the recombinant plasmid DNA pChTNF encodes the hybrid protein ChTNF which has the properties of red fluorescent protein mCherry and TNF. The present invention provides efficient production of hybrid proteins pChFN3 and ChTNF with the properties of red fluorescent protein mCherry in the strain E.coli BL21 (DE3). |
|
|
Invention refers to molecular biology and medicine. What is presented is a genetic construct on a basis of the vector plasmid pEGFP-N1 with a neomycin resistance gene, containing human glial cell-derived neurotrophic factor (GDNF) gene with heat shock elements (HSE) 4-8 and green fluorescent protein (GFP) gene controlled by a thermally regulated promoter of heat shock protein hsp70 gene of Drosophila melanogaster. The invention can be used in therapy of neurodegenerative disorders, traumatic adromia, as well as in cerebral ischemic stroke in mammals (including in humans), as a decrease of temperature activation threshold (39 to 42 degrees Celsius) of GDNF therapeutic gene expression enables reducing a negative effect of high temperatures on human body when using the construct containing the GDNF therapeutic gene for treating the neurodegenerative disorders that is ensured by using hsp 70 of Drosophila melanogaster. |
|
|
Attenuated recombinant parvovirus applicable for dog protection against parvovirus infection Group of inventions refers to viral vaccines for the dog protection against parvovirus infection, preparing and using them. More specifically, the invention refers to an attenuated recombinant parvovirus containing a DNA sequence of type 2 first attenuated parvovirus with the DNA coding a capsid protein of the first parvovirus is substituted by a capsid protein of type 2c parvovirus. The vaccine on the basis of the above virus is able to induce higher titres of the protective antibodies against a risk of type 2c parvovirus infection, preserving at the same time a good immunity against type 2 parvovirus. The strains of the recombinant virus also have been found to remain attenuated. |
|
|
Nutrient medium for growing filamentous fungi-dermatophytes from clinical material Nutrient medium for growing filamentous fungi-dermatophytes from clinical material comprises glucose, bacteriological agar, meat peptone, casein hydrolyzate, yeast extract, sodium chloride, sodium carbonate, L-cysteine, thioglycolic acid and distilled water in a predetermined ratio of components. |
|
|
Invention refers to biotechnology and concerns cDNA coding human dysferlin, a genetically engineered construct wherein such cDNA is cloned, a recombinant adenovirus and a pharmaceutical composition. The described genetically engineered construct comprises an expression plasmid adenovirus vector pAd/CMV/V5-DEST, wherein the codon-optimised cDNA having a sequence presented in SEQ ID NO: 1 and coding human dysferlin is cloned according to recombination sites attB1 and attB2. The recombinant replication defect adenovirus serotype 5 is prepared with using such genetically engineered construct and included into the pharmaceutical composition in an effective amount. |
|
|
Method of species and strain identification of bifidobacteria of phylotype bifidobacterium longum Invention relates to field of biotechnology and deals with species and strain identification of bifidobacteria of phylotype Bifidobacterium longum. Claimed method is based on combination and polymorphism of genes of toxin-antitoxin of RelBE superfamily and is characterised by the fact that for identification amplification with genome DNA is performed with application of set of species- and strain-specific oligonucleotides, PCR products are analysed in agarose gel, and size of obtained fragment is determined by means of DNA-marker. Analysed strains are related to certain species and/or strain in case of accumulation of fragments with application of certain oligonucleotides. |
|
|
Combined graft (CG) represents a dermal matrix (DM) prepared of a donor layer with self-specific multipotent mesenchymal stromal cells (MMSC) colonised on the surface thereof to the number of not less than 750-1500 thousand per 1 cm2. The group of inventions also refers to a method for preparing the combined graft involving bone marrow sampling from the patient, preparing a MMSC culture, applying a MMSC suspension in the concentration of not less than 1 million/ml on the DM surface at 1 million MMSC per 5 cm2 of the DM. |
|
|
Bacterial strain lactobacillus acidophilus having high resistance to t-2 toxin Invention can be used for development of antitoxic preparations and feed additives for prevention of mycotoxicosis in farm animals and poultry. The bacterial strain Lactobacillus acidophilus is deposited in the Russian Collection of Microorganisms under the registration number RCM B-2794D. The strain has resistance to T-2 toxin and capacity to destroy it metabolically in the habitat of bacteria. The resistance to the strain T-2 toxin is up to 77%, and the ability to destroy T-2 toxin is 1.8Ч10-12 nmol/CFU. |
|
|
Method for identifying lactic acid bacilli Invention refers to biotechnology and concerns a method for identifying lactic acid bacilli. The presented method is based on a combination and a polymorphism of toxin-antitoxin RelBE and MazEF gene superfamilies and characterised by the fact that identifying is ensured by genome DNA amplification with using a set of oligonucleotides of certain structure; PCR products are analysed in agarose gel, while a size of the produced fragment is determined by means of a DNA marker. The analysed strain is referred to a specific group, species or strain in case of producing fragments when using certain oligonucleotides. |
|
|
Method for improving immunosuppressive properties of mesenchymal stromal cells of fatty tissue Invention refers to medicine and biotechnology. What is presented is a method for improving the immunosuppressive properties of mesenchymal stromal cells of fatty tissues involving human mesenchymal stromal cell culture in DMEM/F12 medium containing penicillin 100 unit/ml and streptomycin 100 unit/ml, glutamine 2 mM, sodium pyruvate 1 mM, 10% foetal bovine serum in the presence of anti-inflammatory TNF-α factor in the concentration of 20 ng/ml and IFN-γ factor in the concentration of 30 ng/ml characterised by the fact that the culture process is carried out in the environment consisting of CO2 5% and air 95% at temperature 37°C for 48 hours. |
|
|
Inactivated sorbent type a foot-and-mouth disease vaccine Invention refers to veterinary virology and biotechnology and concerns a type A foot-and-mouth disease vaccine. The vaccine contains an avirulent and purified antigen material of the viral strain Aphtae epizooticae, of the family Picornaviridae, of the genus Aphtovirus, of the serotype A, deposited in the collection of FGU VGNKI (Federal State Institution Russian National Centre for Quality and Standartisation of Drugs and Feed for Animals), registration No. 2045/Kirghizia/2007-DEPA No. 2045/Kirghizia/2007-DEP prepared in a passaged cell culture VNK-21, representing s suspension containing preferentially the immunogenic viral components 146S and 75S of foot-and-mouth disease, the adjuvants aluminium hydroxide with saponin and a supporting medium in effective proportions. |
|
|
Respiratory syncytial virus (rsv) anti-g protein antibodies Invention refers to biotechnology and immunology. What is presented is an isolated monoclonal antibody or its immunoreactive fragment binding to the respiratory syncytial virus (RSV) G protein epitope of the strain A2. There are also described a nucleic acid molecule coding it, a host cell containing this nucleic acid molecule, a method for producing the antibody and a pharmaceutical composition containing this antibody. |
|
|
Ts23 alpha-amylase versions with altered properties Invention relates to biotechnology and provides an improved version of parent AmyTS23 alpha-amylase having the sequence SEQ ID NO:1, having alpha-amylase activity. Said version has a truncation of the C-end and an amino acid sequence with at least 90% identity to the sequence SEQ ID NO:2, and contains a S243Q mutation and a deletion of residues R180 and S181, where the numbering of said amino acid residues is presented relative to SEQ ID NO:1. |
|
|
Method of producing nanomaterial based on recombinant archaeal halobacterium salinarum flagella Invention concerns biotechnology and nanotechnology. The method includes transforming archaeal cells with a recombinant plasmid, growing cells, selecting flagella and modifying the surface of the flagella. The plasmid structure contains recombinant genes for synthesis of flagellins A1 and A2 which form flagella, wherein the sequence of flagellin A1 or flagellin A2 or sequences of flagellin A and flagellin A2 contain at least one peptide insert for selective binding of metal ions or nanoparticles. The point of the peptide insert in flagellin A1 is defined in the region between first and second glycosylation sites located between position 86 and position 96 of SEQ ID NO:2, and the point of the peptide insert in flagellin A2 is defined in the region between first and second glycosylation sites located between position 82 and position 92 of SEQ ID NO:3, where the length of the peptide insert is 5 to 60 amino acids. The method includes selecting archaeal flagella containing peptide inserts for non-covalent bonding with metal ions, performing fragmentation of flagella into fragments and modifying the surface of flagella by binding peptide inserts with metal ions and oxidising metals, washing, drying and packing the obtained nano-structured material. |
|
|
Cell-penetrating peptides and polypeptides for microorganism cells Invention refers to genetic engineering and can be used for methane-producing cell permeability control. What is prepared is a polypeptide able to permeate into a methane-producing cell and to increase its permeability, characterised by an amino acid sequence SEQ ID NO:117, 118 or 119 or being at least 90% identical to the above sequence, or at least 15 sequential amino acids of the above sequence. What is also prepared is a polynucleotide coding the above polypeptide cloning and expressing vectors used for producing host cells producing the polypeptide or used for the vector replication. The polypeptide can contain a fluorescent tag on an N-terminal amino acid residue. |
|
|
Method of evaluation of antivariolic activity of therapeutic and prophylactic preparations Method of evaluation of antivariolic activity of therapeutic and prophylactic preparations comprises administering to the body of the animal model of control and test groups in a predetermined scheme of suspension of investigational antiviral preparation. Their intranasal infection is carried out with the strain of monkeypox virus, followed by incubation of the virus in animal bodies. The concentration of virus in the lungs of animals is determined, followed by the calculation of estimated indicators. The animal model is used as ordinary steppe heterosexual marmots Marmota bobak of 1-2-year-old age. The strain of monkeypox virus the strain of monkeypox virus V79-1-005 is used, deposited in the State collection of causative agents of viral infections and rickettsial diseases of the Federal budget institution of science State Research Centre of Virology and Biotechnology "Vector" under the registration number V-309. |
|
|
Invention is a set of synthetic oligonucleotides for species identification of roseroot (Rhodiola quadrifida (Pall.) Fisch. et Mey). The set comprises species-specific areas to create a forward, reverse primers and a destructible probe, namely forward primer - CGGCAACGGATATCTCGGCT-3', the reverse primer - 5'-GGCCTCGCAACCACCACTTGTC-3', the destructible probe - (fluorescent label)-5'-CCGTGAACCATCGAGTTTTT-3'-(quencher). |
|
|
Method for staphylococcus aureus genotyping Invention concerns a method for Staphylococcus aureus genotyping. The presented method involves preparing a pure culture on a solid nutrient medium with DNA purification and amplification by multiplex polymerase chain reaction (PCR) and result detection by agarose gel electrophoresis. The multiplex PCR involves using four pairs of primers complementary to extracellular thermonuclease (nuc) gene, Panton-Valentine leukocidin (pvl) gene, toxic shock protein (tst) gene and methicillin resistance (mecA) gene sites. Staphylococcus aureus is genotyped by the presence or absence of pvl and tst virulence genes and mecA methicillin resistance genes or combinations thereof. |
|
|
Strain Rhodotorula sp. 51-18-2P is deposited in the Russian National Collection of Microorganisms of the Institute of Biochemistry and Physiology of Microorganisms n.a. GK Scriabin of RAS under the registration number RNCM Y-2993D. The strain is capable to destroy crude oil and petroleum products in contaminated water or soil. |
|
|
Method of removing human immunodeficiency virus from male's sperm Method includes separation of mobile spermatozoa from sperm plasma and accompanying cells by centrifugation and further incubation in a special media in order to sample a supernatant, which contains "washed" spermatozoa for performing fertilisation. The application of the claimed method makes it possible to remove the HIV from ejaculate and minimise a risk of infecting the healthy spouse. |
|
|
Strain of yeast saccharomyces cerevisiae for production of champagne Strain of yeast Saccharomyces cerevisiae DZIV-12 has high biochemical and technological properties. It is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number of Saccharomyces cerevisiae RNCIM Y-3980 and can be used in production of champagne. |
|
|
Methods relating to modified glycans Invention relates to a method for determination and quantitative estimation of unusually modified glycans, which can be used in analysing glycans. The disclosed method includes the following steps: a) providing a glycan preparation containing unusually modified glycans selected from a group containing sulphated glycans, phosphorylated glycans, polyacetylated sialylated glycans and combinations thereof, where said unusually modified glycans are negatively charged and where said glycan preparation is obtained by separating glycans and sialic acids from a therapeutic glycoprotein composition, where the sialic acids are separated by exposing the therapeutic glycoprotein composition to at least one agent which splits sialic acid residues in conditions which facilitate splitting of sialic acids; b) subjecting the glycan preparation to a chromatographic separation method which separates glycans based on the charge-to-mass ratio, thereby separating said unusually modified glycans; and c) quantitative determination of at least one separated unusually modified glycan using at least one quantitative estimation standard. |
|
|
Invention relates to recombinant plasmid DNA pEst877 determining expression of the polypeptide with the activity of esterase P. cryohalolentis K5T on the cell surface with the molar weight of 3.64 Md (5.519 kb) consisting of NcoI/XhoI - DNA fragment of plasmid pET20b(+) with length of 3.654 kb, comprising a promoter T7lac, the bacteriophage T7 transcription terminator, the gene of bla β-lactamase which determines the stability of the cells transformed with the plasmid pEst877 to ampicillin, the site ori of replication initiation, signal sequence pelB of pectate lyase B Erwinia carotovora; and NcoI/XhoI-fragment of DNA with the size of 1.865 kb containing fusion gene Est877 encoding the amino acid sequences of esterase P. cryohalolentis K5T with an additional amino acid residue of aspartic acid after the site of cleavage of signal peptide and auto-transporter P. cryohalolentis K5T in a single reading frame. The invention also relates to the bacterial strain E. coli BL21(DE3)pLysS/pEst877 - producer of polypeptide with the activity of esterase P. cryohalolentis K5T on the cell surface. |
|
|
Invention deals with a set of oligonucleotide primers and a fluorescently labelled probe for species-specific express-identification of RNA of the Junin virus by a method of a polymerase chain reaction in real time. The claimed set includes sequences of oligonucleotides, species-specific for the Junin virus and having the following structure: external: 5'→3' 5' TCTTCTTCCCCCYTTTTAGTCTTTCT 3' internal: 5'→3' 5' CGCACAGTGGATCCTAGGCA 3' probe: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1. |
|
|
Invention deals with a set of oligonucleotide primers and a fluorescently labelled probe for species-specific express-identification of RNA of the Machupo virus by a method of polymerase chain reaction in real time. The claimed set includes sequences of oligonucleotides, species-specific for the Machupo virus and having the following structure: external: 5'→3' 5' TCCTCYTCACCCCTTTTGTTCTTTCT 3' internal: 5'→3' 5' CGCACAGTGGATCCTAGGCA 3' probe: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1. |
|
|
Method for preparing cartridge genetic constructs expressing several rna hairpins Invention refers to molecular biology and gene therapy. The method provides carrying out the following procedures: cartridge construct designing, synthesis of oligonucleotides; pair-wise annealing and setting of partially complementary oligonucleotides; precipitation and restriction of the cartridge fragments with applicable restriction nucleases; simultaneous ligation of separate cartridge fragments into one linear molecule; two PCR amplifications, electrophoresis in agarose miniature gel and electroelution; ligation into pGemT-easy vector; transformation and selection of positive clones by means of colony-hybridisation; sequence analysis of a DNA of plasmid clones; re-cloning of the cartridges into an expression vector. |
|
|
Novel mutation involved in increased tolerance to imidazolinone herbicides in plants Invention relates to biochemistry, particularly to a plant, having high resistance to an AHAS-inhibiting herbicide, which includes at least one Shiloh-8 IMI nucleic acid, parts thereof, a plant cell and seeds. Described is a nucleic acid which encodes a polypeptide which increases herbicide resistance of a plant. Disclosed are an expression cassette and a plant transformation vector which include said nucleic acid. Described are methods of controlling weeds growing near a plant having high resistance to an AHAS-inhibiting herbicide. Disclosed is a method of producing a plant having high resistance to an AHAS-inhibiting herbicide, as well as a method of increasing AHAS activity in a plant. Described is a method of selecting a cell transformed by a vector containing IMI nucleic acid. Also disclosed is a method of increasing resistance to an AHAS-inhibiting herbicide and a weed control method which includes treatment with an AHAS-inhibiting herbicide. |
|
|
Bacterial strain Bacillus vallismortis RNCIM B-11017 is grown and a suspension is made of it, which is applied in cryogenic soil and the water environment. It is exposed under the specified parameters from 7 to 60 days and the quantitative content of crude oil and petroleum products in the cryogenic soil and water environment is determined. |
|
|
Method for creating transgenic animals with stable and high target protein expression in milk Invention refers to biotechnology, particularly to methods for preparing next generation drug preparations and biologically active additives in bioreactors on the basis of transgenic producing mammals. The method for creating transgenic animals producing a protein with stable and high expression in milk, involves producing transgenic mammals with using a vector containing a reporter gene coding a target protein that is a goat beta-casein gene promoter, a bovine growth factor terminator and effective two-fold transcription terminators. The terminators surround an expression cartridge and possess an ability to break genome transcripts effectively in a mammalian genome by the effective protection of transgene expression in the mammalian genome against further repression. The effective two-fold terminators represent any mammalian genome site fulfilling the following conditions: 3'-sites of the two simultaneously expressing and opposite genes containing a site of the second-to-last exon, the last intervening sequence, the last exon and a polyadenylation signal, a space of two polyadenylation signals at different DNA strands is no more than 100 base pairs. |
|
|
Method of identifying nosocomial strains of microorganisms Invention relates to biotechnology. The method is intended for the identification of nosocomial strains of microorganisms in carrying out epidemiological monitoring. Water-alcohol solutions of 3-4 aniline dyes are prepared. A standardised suspension of the studied microbial culture is added, incubated; the obtained results are estimated and the identity of strains is determined. In case of the identity of sensitivity indices of the separated and studied microbial cultures to each corresponding aniline dye the identification of nosocomial strain is stated. |
|
|
Invention represents the plasmid 40NaGal, which determines synthesis of α-acetylhalactosaminidase α-AlNaGal, which includes a NcoI/SalI-fragment of the plasmid pET-40b(+) (Novagen) and a fragment of DNA with a size of 1299 base pairs, which contains a chimeric gene, consisting of a structural part of the gene α-AlNaGal, adapted by the N-end for the expression in cells of E.coli, and nucleotides, coding a specific sequence for the protease TEV. The invention also relates to strain of E.coli Rosetta(DE3), transformed by the claimed plasmid, - producent of a chimeric protein, which includes an aminoacid sequence of recombinant α-N-acetylhalactosaminidase α-AlNaGal. Also claimed is a method of obtaining recombinant α-N-acetylhalactosaminidase α-AlNaGal with the application of strain according to the invention. |
|
|
Detergent composition containing version of family 44 xyloglucanase Invention relates to biotechnology. Disclosed is a detergent composition containing an isolated mutant version of a parent xyloglucanase, 2-50 wt % surfactant and an auxiliary ingredient, where the version of the parent xyloglucanase contains one of the groups of alterations presented in the description; the parent xyloglucanase is xyloglucanase having at least 90% identity to the amino acid sequence SEQ ID NO:3, presented in the description; and the version has xyloglucanase activity. Disclosed is use of said composition for endowing cotton with dirt-repellent properties during subsequent washing. |
|
|
New strain of hybrid cultured animal cells Mus musculus 2F9 - producer of monoclonal antibodies specific for lysostaphin inhibiting its lytic activity and suitable for its quantitation is proposed. High-affinity monoclonal antibodies (mAb) of hybridoma 2F9 enables to determine lysostaphin in the samples to the concentrations of 0.8 ng/ml. The mAb of hybridoma 2F9 can be used to study the structural and functional properties of lysostaphin and quality control of preparations based on lysostaphin. |
|
|
Nanoscale enzyme biocatalyst for in vivo detoxification of organophosphorous compounds Invention refers to biotechnology. What is presented is an enzyme biocatalyst in the form of nanoscale particles for in vivo detoxification of organophosphorous compounds. The biocatalyst represents non-covalent polyelectrolyte complexes. The given complexes consist of a polyhistidine-containing polypeptide with the properties of organophosphosphorous hydrolase and polyethylene glycol-polyglutamic acid block copolymer in a charge relation of enzyme:block copolymer falling within the range of 2:1 to 1:5. |
|
|
Nutrient medium for cultivation of listeriosis causative agent Invention relates to biotechnology, in particular to obtaining nutrient media for cultivation of a listeriosis causative agent. A nutrient medium contains fermentative hydrolysate of soya beans, fermentative hydrolysate from an activated embryo-egg mass of quails, sodium chloride, potassium phosphate 2-substituted 3-aqueous, sodium phosphate 2-substituted 12-aqueous, microbiological agar and distilled water in a specified component ratio. |
|
|
Vaccine composition for animal immunisation against coccidiosis and method for using it Present invention refers to a vaccine composition for an animal immunisation against coccidiosis and a method for the animal immunisation. The characterised vaccine contains from approximately 10 to approximately 1,000 oocysts of the first strain Eimeria and from approximately 100 to approximately 10,000 oocysts of the second strain of the above species; the first and second strains have asynchronous endogenous period, and the first strain represents the nonattenuated strain Eimeria, and the second strain represents the early strain Eimeria. |
|
|
Constructions and methods for production and secretion of cell wall-cleaving enzymes Invention relates to field of molecular biology and biochemistry. Claimed is polynucleic acid, coding cross-linked protein to provide secretion of cell wall-cleaving enzyme, in microorganism of class Clostridia, as well as respective recombinant microorganism and method of production and secretion of said protein. |
|
|
What is presented is a method for cord blood mononuclear cells (cbMNC) expansion ex vivo in the presence of multipotent mesenchymal stromal cells (MMSCs) involving culturing MMSCs from the stromal vascular fraction of fatty tissue to reach a monolayer at the concentration of O2 in the medium of 5%, adding a cbMNC suspension to the MMSCs monolayer, culturing for 72 hours at the concentration of O2 in the medium of 5%, selecting the unattached cbMNCs and replacing the medium, continuing the MMSCs culturing with the attached cbMNCs for 7 days at the concentration of O2 in the medium of 5%. |
|
|
Method of production of bacteriophage Method of production of bacteriophage comprises: inoculation with the bacterial culture of the host strain in the titre of 108-109 CFU/ml in the vessel for culturing on the slant having a layer thickness from 10 mm to 25 mm, culturing for 3-3.5 hours at optimum temperature for growth of the host strain culture, then on the resulting lawn of culture of the host strain the stock bacteriophage is inoculated in the titre 105-106 CFU/ml and cultured for 13-15 hours at the optimum temperature and the thickness of the air layer over the surface of the solid medium of 25 mm to 40 mm. the phage lysate is prepared and sucked into a sterile container, chloroform is added, incubated for 30-45 minutes with continuous shuttling. The supernatant is centrifuged and sterilised by filtration through the filter with a pore diameter of 0.2-0.22 microns. |
|
|
Group of inventions relates to biotechnology and can be applied in creation of analytic methods with application of peroxidases. Method includes preparation of substrate mixture, introduction of peroxidases in substrate mixture with the following registration of intensity of formed luminescence. Substrate mixture includes the following components, given in final concentrations: buffer solution 10-125 mM, luminol 0.05-8 mM, hydrogen peroxide 0.05-8 mM, 4-aminopyridines 0.1-10 mM, N-carboxyphenothiazine, or N-(carboxymethyl)phenothiazine, or N-(2-carboxyethyl)phenothiazine 0.1-10 mM. And pH of buffer solution constitutes 7.9-9.0. |
|
|
Method of producing preparative quantities of phloem-restricted viral antigens Invention relates to biochemistry, particularly a method of producing preparative quantities of a viral antigen - potato leaf roll virus (PLRV) protein, in chimeric viral particles imitating PLRV virions, the method comprising producing recombinant DNA containing cDNA of turnip vein-clearing virus (TVCV) which belongs to tobamoviruses, where the TVCV cDNA is under the control of a plant promoter and there is a transcription terminator at its end, and the TVCV coat protein gene is substituted with a PLRV major coat protein gene, which includes producing agrobacterial vector (plasmid) pCambia 1300, which is capable of being embedded into the host-plant gene and cause system infection, transferring the formed recombinant DNA into the agrobacterial vector pCambia, transforming a Nicotiana benthamian host-plant with the agrobacterial vector pCambia, reproduction of the chimeric virus, consisting of viral DNA, in the Nicotiana benthamian host-plant, separating the chimeric virus containing TVCV cDNA, the coat gene of which is substituted with the a PLRV major coat protein gene, from infected leaves of the Nicotiana benthamian host-plant. Disclosed is a method of producing antiserum against PLRV capsid protein, which includes immunising animals with viral particles obtained using said method. |
|
|
Invention relates to field of immunology, medicine and biotechnology. Claimed are versions of anti-EPHA2 antibodies. Claimed antibodies are bound with polypeptide, consisting of amino acids 426-534 in SEQ ID NO:8. Also described are hybridomes, which produce such antibodies, and pharmaceutical compositions and methods of application of said antibodies and compositions. |
|
|
Invention refers to biotechnology and concerns a kit for detecting Q fever by RT PCR. The characterised kit contains synthetic oligonucleotides limiting a fragment of groEL gene: GroEL F 5' CTTCTACTGTTATGACGCCTTCTTTGC 3'; GroEL R 5' CGCAAGTAGGCACCATTTCTGC 3', and a fluorescent probe: GroEL Probe 5' FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3'. |
|
|
Method of restoring sensitive layer of biosensor Invention relates to biotechnology. The method involves treating the sensitive layer of a biosensor with solution of a common fraction of protease of hepatopancreas of king crab in a buffer comprising tris-HCl 50 mM, CaCl2 3 mM, NaCl 100 mM, pH 8.0 at solution temperature of 35-40°C. The process is carried out in multiple successive steps with a solution of a solution of a common fraction of protease of hepatopancreas of king crab in said solvent at temperature of 35-40°C followed by exposure. The sensitive layer of the biosensor is successively washed with dodecyl sulphate dissolved in the same buffer in concentration of 0.1% and then with water at each step. The treatment process is carried out three times. |
|
|
Immobilised biocatalyst for microbial biotransformation of steroid compounds Immobilised biocatalyst for microbial biotransformation of steroid compounds comprises cells of a microorganism having 1,2-dehydrogenase activity, included in the polyvinyl alcohol cryogel matrix. As cell having 1,2-dehydrogenase activity the immobilised biocatalyst comprises biomass of actinobacteria Pimelobacter simplex. The ratio of components in the biocatalyst is (wt %): actinobacteria cells Pimelobacter simplex - 1-5 (in dry substance), polyvinyl alcohol - 7-20, the aqueous phase - up to 100. |
|
|
Invention relates to molecular biology and oncology and may be used for diagnostics of terminal mutations in gene RET, associated with genetic predisposition to cancer of thyroid (CT). The set of sequences of oligonucleotides has the following nucleotide composition: 5'-CATGGCCACTCCCAGTGC-3', 5'-CACAGGGACTCCTCAGCAC-3', 5'-CACCCCCACCCACAG-3',5'-GAGATGGGTGGCTTGTG-3', 5'-GGCTAGTGCTGTCAGGCC-3', 5'-CTAAGCACCCTAGACGCG-3', 5'-CAGGGATAGGGCCTGG-3', 5'-CCCCAAGAGAGCAACACC-3', TACGAGCCGTGCCT, GATGGGCTGCGCAG, CACGTGCTGGGCCT, TAGAAGCTGTACAT, CACGAGAAGTGGAG, TACGAGCTGAGCTG, GGAAATGGATGGGATTTG, CCATATGGACGGCAATTC. |
|
|
Method of production of frozen bacterial concentrate on basis of symbiosis of probiotic bacteria Method comprises preparing a culture medium, its sterilisation and cooling. In the cooled culture medium the combined inoculum is added, containing separately activated by β-galactosidase bifidobacteria of strain Bifidobacterium longum B 379 M, propionic acid bacteria of strain Propionibakterium Freudenreichii Shermanii subsp. AC-2503, and the activated bacterial inoculum Lactobacillus acidophilus of viscous race taken in a ratio of 9:0.7:0.3, respectively, in an amount of 5% by volume of the culture medium. It is cultured for 14-16 hours at given process parameters, and the cells are separated from the culture liquid to obtain a bacterial mass. The resulting bacterial mass is mixed with the protective medium at a ratio of 1:1. It is bottled, sealed and frozen. |
|
|
Group of inventions relates to the field of biotechnology. Synthetic 5'UTR regions are applied to enhance the transgene expression, with the 5'UTR regions being located between a promoter and a sequence, presenting an interest in an expression vector. The claimed invention also claims vectors, which contain the 5'UTR regions, and a method of enhancing the transgene expression in their application. |
Another patent 2513599.
| © 2013-2014 Russian business network RussianPatents.com - Special Russian commercial information project for world wide. Foreign filing in English. |