Recombinant chimerical ntbi polypeptide-immunogen with ability to induce neutralizing antibodies to type 1 human immunodeficiency virus and intended for use as component of vaccine against hiv-1

FIELD: medicine.

SUBSTANCE: recombinant chimerical polypeptide-immunogen is proposed, including conservative T- and B-cell epitopes of HIV-1 and consecutive peptide fragments of p24, gp41, gp120 proteins, recognizable by wide-neutralizing 10e8, 2F5, VRC01 antibodies.

EFFECT: improved HIV-specific immune response due to the inclusion of unique linear conformational epitopes imitators, recognizable by wide-neutralizing antibodies into the polypeptide-immunogen nTBI.

6 dwg, 5 ex

 



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biotechnology and can be applied for the selection of affine molecules. Constructed is a plasmid DNA pGST/APT/X 6193 bp long, with the weight of 4.09 MDa, containing as a genetic marker the gene β-lactase and unique sites of the recognition of restriction endonucleases, located at the following distance to the right from the site NdeI: BgIII 665bp, BamHI 779 bp., XhoI 801 bp. The plasmid pGST/APT/X consists of a NdeI-XhoI DNA fragment of the commercial plasmid pET22b(+) and nucleotide sequence SEQ ID NO:1, inserted by sites NdeI-XhoI and combining in its composition the sequences, which code a fragment of a gene of glutathione-S-transferase, a peptide substrate of a lethal factor of anthrax RRKKVYPYPME, peptide GGLNDIFEAQKIEWHED, biotinylated in vivo under the influence of E.coli biotin-ligase, and a linker sequence, substituted by genetic-engineering manipulations by sites of restriction endonucleases BamHI and XhoI for a sequence, coding a target protein B-subunit of shiga-toxin I.

EFFECT: invention makes it possible to carry out the selection of highly specific aptamers to the said target protein.

2 cl, 4 dwg, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, the modified polypeptide having homoserine-O-acetyltransferase activity having the amino acid sequence of SEQ ID NO:17 or at least 95% homologous thereto, in which the amino acid at position 111 from the start amino acid methionine, of the sequence is substituted with glutamic acid. The invention also relates to a method for producing O-acetyl homoserine, comprising culturing the microorganism belonging to the genus Escherichia, transformed with polynucleotide, encoding the said polypeptide.

EFFECT: high production yield of O-acetyl homoserine.

18 cl, 5 dwg, 3 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: inventions concerns recombinant DNA pA3, recombinant plasmid DNA pQE 30-pA3, strain E.coli M 15-A3, recombinant polypeptide A3, test systems for the qualitative detection and quantitative determination of microalbuminuria. The characterised recombinant DNA pA3 is produced by a polymerase chain reaction with the use of chromosomal DNA of the strain DG 13 of group B streptococci and structured primers. An amplification fragment has been cloned by a system of expression vectors pQE-pQE 30 in E.coli M 15 to produce recombinant DNA pQE 30-pA3, which codes an amino acid sequence of the recombinant polypeptide A3 having an ability to bind human serum albumin (HSA) selectively.

EFFECT: presented inventions can be used in the medical practice and industry for producing the test systems for the detection and quantitative determination of microalbuminuria - one of the earliest signs of renal irritation in the patients suffering from diabetes mellitus and essential arterial hypertension.

6 cl, 9 dwg, 1 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used for recombinant production of human tissue factor (hTF). Constructed is a plasmid pHYP-10ETFCS6 having a length of 5,912 b.p. with a physical map presented on Fig. 2, for expression in a bacterium of the genus Escherichia, which is a precursor of the mutant [C245S] hTF containing an inseparable N-terminal leader peptide containing a deca-histidine cluster and an enterokinase identification sequence fused in a frame with a sequence coding the above mutein fused in the frame with the sequence coding the additional inseparable C-terminal peptide containing the deca-histidine cluster. A method for producing the precursor of the mutein[C245S]hTF contains culturing the producing bacterium in a nutrient medium, recovering inclusion bodies, solubilising the precursor protein, performing a metal chelator chromatography in the denaturation environment, re-folding and diafiltration of the protein solution. A method for producing the mature mutein[C245S] hTF involves detecting the N-terminal leader peptide from the above mutein precursor with using enterokinase and recovering the target protein.

EFFECT: invention enables increasing the level of biosynthesis and yield of pro-coagulation active hTF.

9 cl, 5 dwg, 1 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: claimed inventions deal with an isolated polynucleotide, coding a polypeptide, involved in biosynthesis of pyripyropene A, a vector and a host cell, including such a polypeptide, and methods of obtaining pyripyropene A precursors, including the host cell cultivation. The claimed polynucleotide codes the polypeptide, possessing any one or more of the activities - polyketide synthase, prenyltransferase, hydroxylase, acetyltransferase or adenylate synthase.

EFFECT: claimed inventions make it possible to synthesise pyripyropene A, which is an insecticidal agent, and can be used in the formation of plant resistance to pest insects.

16 cl, 11 dwg, 1 tbl, 11 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology, in particular to obtaining recombinant enzyme-labelled antigen G2 of hantavirus Dobrava. Essence of invention consists in the following: claimed method of obtaining antigen G2 of hantavirus Dobrava consists in expression of antigen in cells of E.coli in form of enzyme-labelled antigen of G2 hantaviruses based on HT protein antigen. Beta-galactosidase, which is highly active stable enzyme, serves enzyme label for protein antigen. Invention can be used to increase specificity and reproducibility of immunosorbent assay in HFRS diagnostics.

EFFECT: presence of commercially available chromogenic substrate of beta-galactosidase (X-gal) makes it possible to quickly estimate result of immunosorbent reaction visually or by change of optic density of solution in visible area.

6 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry and represents a new bifunctional PSH protein containing human peroxiredoxin Prx6 and manganese superoxide dismutase MnSOD possessing the antioxidant activity of superoxide dismutase and peroxidase. What is also described is a chimeric nucleic acid coding the presented protein. A method for preparing the presented protein by culturing cells of the strain E.coli BL21(PSH) transformed by constructed recombinant expression vector based on pET22b(+) plasmid is disclosed.

EFFECT: invention enables producing high-yield protein PSH possessing the high antioxidant activity.

4 cl, 6 dwg, 3 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology, namely to recombinant obtaining G-CSF, and can be used for production of G-CSF in cells of E.coli. For effective production of protein in cells of E.coli G-CSF-coding DNA sequence is optimised. On the basis of obtained optimised DNA sequence plasmid pAS017, also including NdeI/BamHI-fragment of DNA of pETM-50 vector and having physical map, presented on the drawing, is constructed.

EFFECT: invention provides effective production of protein in cells of Ecoli.

2 cl, 1 dwg, 1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, particularly to genetically engineered production of human proteins, and may be used for preparing human epidermal growth factor (hEGF) in bacterial cells in the form of glutathione-3-transferase fusion protein. What is constructed is the recombinant DNA coding GST-hEGF fusion protein which consists of an amino acid sequence of glutathione-S-transferase and an amino acid sequence of human epidermal growth factor divided by a cleavage site by enterokinase, and characterised by the nucleotide sequence SEQ ID NO:1. The KpnI/XhoI fragment of the vector pET41 and the above recombinant DNA are used to create the recombinant plasmid pAS007 for expression of GST-hEGF fusion protein in E.coli cells.

EFFECT: invention enables reaching high GST-hEGF expression levels in Ecoli cells.

2 cl, 3 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to biotechnology, gene and protein engineering and specifically to recombinant plasmid DNA pG1-Rm7, which facilitates synthesis of hybrid protein G1-Rm7 in Escherichia coli cells, which is capable of biding the tumour necrosis factor and has bioluminescence of luciferase Renilla muelleri, where said plasmid DNA includes the nucleotide sequence SEQ ID NO: 1 and can be in medicine. The invention also relates to the protein pG1-Rm7 having molecular weight of 65.4 kDa, consisting of a single-strand anti tumour necrosis factor antibody, a GGSGGS peptide and modified luciferase Renalla muelleri and characterised by SEQ ID NO: 2.

EFFECT: invention enables to obtain a highly sensitive reporter for detecting a tumour necrosis factor via bioluminescent analysis.

2 cl, 4 dwg, 3 ex

FIELD: biology.

SUBSTANCE: present invention relates to biotechnology, particularly to genetic engineering and can be used in the biomedical industry. Proposed is a recombinant plasmid pBMC-RT(A)-hum, meant for expressing reverse transcriptase of the human immunodeficiency virus, and is distinguished by that, it contains an artificial gene (RT(A)-hum) synthesised by an enzyme, which is characterised by a sequence of nucleotides, optimally adapted to expression in cells of mammals.

EFFECT: use of the recombinant plasmid provides for significant increase (6-8 times) in output of the target protein compared with the primary standard.

4 dwg, 1 tbl, 3 ex

FIELD: gene engineering.

SUBSTANCE: vector of present invention includes expression cassette containing transgene located under promoter control and central polypurine tract (cPPT) located upstream from cassette. Said vector provides delivery of desired transgenes into target cells and high level expression thereof in such cells. Also disclosed are host cell transduced with lentiviral vector, methods for transduction and uses thereof.

EFFECT: new agent for gene therapy.

26 dwg, 2 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention describes a gene therapeutic structure coding vascular endothelial growth factor (VEGF) and (FGF-2). Codon-optimised recombinant plasmid lies in the basis of gene therapeutic structure coding both factors. Introduction of gene therapeutic structure may be made directly to a damaged nerve and paraneural tissues both in intraoperative and postpoperative period. The invention may be used for stimulation of nerves regeneration.

EFFECT: invention improves significantly results of reparative treatment for damaged peripheral nerves.

3 cl, 15 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly to methods of producing a plant with higher drought and salt tolerance compared to the wild-type plant by reducing expression/function of the protein transcription factor in the plant. The invention also relates to a plant with high drought and salt tolerance obtained using said method.

EFFECT: invention enables to efficiently obtain a plant with high drought and salt tolerance compared to the wild-type plant.

6 cl, 6 dwg, 1 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: codon-optimised cDNA are declared, encoding the stromal cell factor 1 alpha and the vascular endothelial growth factor of isoform 165, and also a recombinant plasmid containing them. The recombinant plasmid can be used as part of a pharmaceutical composition for the recovery of blood vessels and improvement of blood supply in the damaged tissues or organs.

EFFECT: invention enables to increase the efficiency of use of gene products.

4 cl, 5 dwg

FIELD: medicine.

SUBSTANCE: invention refers to molecular biology and can be used in diagnosing cardiomyopathies of various origin Presented is a set of synthetic oligonucleotides for identifying mutations of a coding part of desmin (DES) gene associated with cardiomyopathies. The mutations are identified by detecting a full sequence of the coding part of DES gene. The coding part of DES gene is amplified by means of 7 pairs of synthetic oligonucleotides at the same temperature and annealing time, and the prepared amplification products are sequenced by means of one pair of universal primers.

EFFECT: presented invention enables the sensitive and specific detection of DES gene mutations, with reducing the amplification reaction time, the number of manipulations, the time of agent application for the sequencing reaction, and reducing a probability of a reaction error.

3 cl, 1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry. There are presented pharmaceutical compositions having a concatemer molecule and a kit, as well as using for preparing an agent for immune system modulation or for human's or animal's immune system activity modulation, and a composition according to the invention. The given invention can find further application as an immunomodulatory agent in therapy of various diseases.

EFFECT: what is presented is a concatemer molecule of non-coding nucleic acid containing at least four single-strand sites with non-methylated CG motives for human's or animal's immune system activity modulation.

20 cl, 4 dwg

FIELD: biotechnologies.

SUBSTANCE: invention refers to a method of detection of Mycobacterium tuberculosis isolates resistant to pyrazinamide by detection of mutations in pncA gene, associated with evolving resistance to pyrazinamide, by PCR in real time mode using HRM analysis. It involves amplification in a mixture of equal amounts of tested DNA and wild type DNA using primers: Pnc18U: 5'-TACGCTCCGGTGTAGGCAC-3' and Pnc15R: 5'-GAAGCGGCGGACTACCATC-3', formation of heteroduplexes due to simultaneous co-amplification of wild type DNA and test DNA, where the first PCR stage includes concentration equalisation by quantitative PCR using the same pair of primers (Pnc18U/Pnc15R) with calibration curve generation and use of regression equation.

EFFECT: reliable and fast detection of mutations in pncA gene associated with evolving resistance to pyrazinamide, due to high specificity and sensitivity.

1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to oligopeptides, containing the sequence NLSSAEVVV (SEQ ID NO:6), in which one or two amino acids can be substituted, possessing the inducibility of cytotoxic T-cells, their pharmaceutical compositions and application for the production of anti-cancer vaccines.

EFFECT: obtaining pharmaceutical compositions for the production of anti-cancer vaccines.

20 cl, 6 dwg, 1 tbl, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and represents a method of obtaining useful metabolites with the application of bacteria of the Enterobacteriaceae family, in particular bacteria, belonging to the genus Escherichia, which is modified in such a way that it contains a genetic expression system, including a transcription apparatus, regulated by a protein of the LysR type, and modified in such a way that the self-induced positive regulation of the feedback type in the said system is mediated by a coinducer.

EFFECT: method is suitable for the production of L-amino acids with a branched chain, in particular L-valine, L-isoleucine and L-leucine, higher alcohols and D-pantothenic acid; invention makes it possible to obtain L-amino acids with the high degree of efficiency.

23 cl, 2 dwg, 5 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

Up!