Kit for dna detection of bovine immunodeficiency provirus containing a pair of specific primers and probe and diagnostic technique for cattle immunodeficiency virus by polymerase chain reaction in real time

FIELD: biochemistry.

SUBSTANCE: invention relates to biochemistry. Described is kit for DNA detection of bovine immunodeficiency provirus (BIV (bovine immunodeficiency virus)), containing pair of specific primers and DNA-probe, by PCR in real time. Primers and probe have following nucleotide composition (5′-3′-): pf - TAGGGTAGTGGGATCTCAGAAATC, pr - ACATCCGTAACATCTCCTACCATC, z - GAGGATGGTAGGAGATGTTACGGAT. Source of fluorescence at 5′ end of the probe used is dye ROX and fluorescence quenching fluorescence on 3′ end of BHQ2. Also described is diagnostic technique for BIV by PCR in real time using kit according to claim. 1. Reaction mixture is prepared by mixing buffer 10-fold for PCR - 2.5 mql, dNTP (25 mM) is 0.2 mql, pf and pr primers (10 pmol/mql) by 1 mql, probe z (10 pmol/mql) is 0.5 mql, Taq polymerase (5 units/mql) is 0.2 mql, MgCl2 (50 mM) is 2 mql, bidistilled water is 7.6 mql, and amplification is carried out as follows: denaturation 95°C is 5 minutes, cycling: denaturation (95°C - 20 s) - annealing (55°C - 20 s) - elongation (72 C - 20 s), wherein cycle of denaturation-annealing-elongation is repeated 10 times, cycling 2 with detection: denaturation (95°C - 20 s)-annealing (55°C - 20 s)-elongation (72°C - 20 s), wherein cycle denaturation-annealing-elongation is repeated 25 or 30 times. Fluorescence is measured over a Orange channel at temperature of 55°C. Intersection of fluorescence curve line threshold, set at level of 30% of maximum level of fluorescence in last cycle amplification testifies to provirus BIV presence in sample, at that, the less value of “Ct” indicator, the higher amount of provirus BIV in analysed sample, while absence of intersection of fluorescence curve line threshold testifies to absence of provirus BIV in sample.

EFFECT: invention can be used in scientific research for detecting genetic material BIV in animal blood lymphocytes by PCR in real time.

2 cl, 6 dwg, 3 tbl, 2 ex

 



 

Same patents:

FIELD: chemistry.

SUBSTANCE: claimed solutions deal with a method of generating a starter culture, the starter culture and a fermentation method with an application of the said starter culture. The claimed method of generating the starter culture includes impact on a parent bacterial strain, which contains, at least, a part of the locus CRISPR, with a bacteriophage to obtain a mixture of bacteria, which contains a bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR; independent impact on the same parent bacterial strain with the same bacteriophage to obtain the mixture of bacteria, which contains other bacteriophage-resistant variant strain, containing the modified locus CRISPR, which contains, at least, one additional spacer in the said modified locus CRISPR, different from the additional spacer in the first bacteriophage-resistant variant strain, selection of the said bacteriophage-resistant variant strains from the mixtures of bacteria and their separation.

EFFECT: claimed inventions make it possible to obtain bacteriophage-resistant cultures and can be applied in the food industry in manufacturing fermented products.

29 cl, 23 dwg, 20 tbl, 23 ex

FIELD: medicine.

SUBSTANCE: method is staged: 1) cervical canal scrapes and biopsy materials of the uterine cervix are used to recover DNA of human papilloma virus; 2) virus genotype is determined; 3) patients with HPV 16 positive CIN are sampled; 4) real-time PCR is used to determine the number of virus DNA copies and a degree of its integration with a host gene (a physical status); 5) a threshold level of the viral load is stated taking into account the physical status of the virus (6.5 lg HPV DNA copies 16 per one cell); 6) the patients are classified according to the determined threshold viral load and physical status of the virus (the episomal and integrated form); 7) the poorly predicted patients having the high viral load (≥6.5 lg DNA copies per one cell) are detected in the episomal form of the virus, while the low load (<6.5 lg DNA copies per one cell) is shown by the integrated form of the virus.

EFFECT: method enables the early prediction of the unfavourable course of cervical intraepithelial neoplasms and potential transition into cervical cancer.

3 cl, 2 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: diagnostic set is used to determine antibodies in blood, as well as polystyrene dishes. The solid liquor in the amount of 10 mcl is dissolved at the ratio of 1:100. The sample is incubated at 37° for 40-45 min. Secondary incubation with antibody conjugate is carried out at 37°-38° for 55-60 min. By variation of critical value of optical density they determine availability of antibodies in the liquor.

EFFECT: method provides for determination of antibodies in children in a small sampled volume of liquor and may find application in diagnostics of opportunistic infections in children.

4 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to diagnosis, particularly to methods and reagents, including biochips, for detecting presence of one or more analysed objects in a sample, based on use of a set of granules which contains a plurality of families or subsets of granules, wherein each of the granules inside each family of granules of a subset can be connected with a labelled probe for capturing nucleic acid, which is capable of binding with an HPV strain specific region of the HPV genome. Each of the families of granules inside each separate set has a different fluorescence intensity.

EFFECT: fast methods and reagents which can be used in diagnosis.

13 cl, 4 ex, 5 tbl

FIELD: medicine.

SUBSTANCE: what is presented is a method for early prediction of the clinical outcome of an antiviral therapy for chronic viral hepatitis C involving detecting the immunological parameters in patient's venous blood, including the content of circulating immune complexes (CIC), and the virological parameters (hepatitis C genotype). Before the beginning of the antiviral therapy, the complex is analysed for B-lymphocytes (CD19), T-suppressor cells (CD8), natural killer cells (CD16), the level of immunoglobulin A (IgA), and the percentage of phagocytosis (F%). Total weight coefficients of the parameters is used to derive an immunological prediction coefficient (IPC). If the IPC value is 1.2 ÷ 3.2, the favourable outcome is predicted, the IPC values being 3.3 ÷ 3.9 shows potential recurrence, while if the IPC value exceeds 3.9, the unfavourable outcome is stated.

EFFECT: effective method for prediction of the clinical outcome of the antiviral therapy before the beginning thereof preventing the need for expensive treatment and inefficient expenditure of monetary resources.

4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: there are described a method and a kit for detection and identification of herpes viruses HSV-1 and HSV-2 and varicella-zoster virus VZV. A tested sample is amplified with a combination of primers. It is followed by denaturation of amplification products, hybridisation of denaturated one-chain oligonucleotides with probes and detection of hybridised oligonucleotides.

EFFECT: improved efficiency of the method.

12 cl, 9 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: identifying a yersiniosis agent is enabled by using the intestinal yersinia pague FK-100 stripped on a double-layer grass lower layer of which represents an agar medium (pH 7.1) with added ampicillin in the concentration of 50 mcg/ml, while an upper layer of which is produced of the strain being tested cultivated on 1.5% Hottinger's agar at 28°C during one day and inoculated in 4 ml of Hottinger's broth, incubated at temperature 28°C to the final concentration n·108 m.c./ml; thereafter 0.3 ml of the prepared culture is mixed with 4.5 ml of 0.7% Hottinger's agar melted and cooled to 45°C with 50 mcg/ml of ampicillin and poured as a second layer on the agar plates. The inoculation is incubated at 28°C for 20-24 hours. Yersinia enterocolitica in the sample being tested is identified from the other types of yiersinia by the presence of phagolysis on the growth culture.

EFFECT: method provides complete identification effectiveness.

1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology, virology and veterinary. An attenuated recombinant classical swine fever virus (CSFV) is described. Modification is carried out by progressively mutating a portion of the E2 gene of the highly pathogenic strain Brescia. As a result, two to six amino acids on the section 829-837 are replaced with two to six amino acids which are characteristic for the heterologous E2 glycoprotein of the Bovine Viral Diarrhea Virus (BVDV). A classical swine fever vaccine is also obtained based on the obtained attenuated CSFV. The invention can be used in veterinary.

EFFECT: classical swine fever vaccine is obtained.

7 cl, 7 dwg, 4 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, virology and medicine. What is disclosed is a recombinant protein containing one or more polypeptides carrying one or more epitopes of one or more human papilloma virus HPV antigens. Said polypeptides are embedded in one or various permissive sites of adenylatecyclase (CyaA) or its fragments. What is also disclosed is the polypeptide coding such protein and their use in expression systems for producing immunogenic compositions and drugs. The invention can be used in medicine.

EFFECT: CyaA fragment possesses the property of said adenylatecyclase protein for targeted interaction with antigen-presenting cells.

60 cl, 21 dwg, 1 tbl, 3 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biochemistry, particularly to a set of primers for amplifying the L1 gene of the human papilloma virus (HPV), a set for detecting the human papilloma virus (HPV) genotype and methods of detecting human papilloma virus (HPV) genotypes. The method involves primary PCR amplification of the HPV L1 gene in an analysed sample using a set of direct and reverse primers which are specific for the L1 gene section. Further, secondary PCR amplification of the product of primary PCR amplification of the L1 gene is carried out using a reverse primer to obtain a biotin-labelled single-stranded L1 gene. The product of secondary PCR amplification and biotin-labelled single-stranded L1 gene undergo a hybridisation reaction with one or more probes for detecting the HPV genotype or a probe for detecting the HPV genotype. Further, the product of the hybridisation reaction reacts with phycoerythrin, bonded with streptavidin. The level of fluorescent substance is measured and probes are identified in the product of the hybridisation reaction to identify the HPV genotype. Further, the HPV genotype is determined, as well as the level of its presence in accordance with probes and the level of the fluorescent substance.

EFFECT: invention provides a method for detecting HPV in a sample with high sensitivity, sufficient for detecting extremely small quantities of HPV in the sample.

8 cl, 2 dwg, 1 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: method includes treating a sample with a denaturing buffer solution, sorbing short RNA on a fibre glass sorbent in the presence of a chaotropic agent, followed by washing off non-bonded biopolymers and chemical reagents from the sorbent and eluting the end product. The biological fluid sample undergoes two-step denaturing, wherein at the first step two volumes of the denaturing buffer solution are added to the sample and at the second step two volumes of 96% ethanol and equal volume of chloroform are added to the obtained mixture, followed by stirring and separating the residue by centrifuging. Non-bonded biopolymers are washed off from the sorbent twice with the buffer solution and elution of the end product from the sorbent is carried out with the buffer solution.

EFFECT: simple method, short duration of the method and high output of short RNA.

3 cl, 3 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to the field of biotechnology and deals with a method of detecting a provirus of cattle leukosis. The characterised method includes the detection of LTR (Long Terminal Repeat) fragment - a sequence of the leukosis provirus. Determination of the size of an amplified fragment of a nucleotide sequence by the electrophoretic separation in an agarous gel is performed. As primers applied are oligonucleotides: BL1.F 5-GAGTTAGCGGCACCAGAAGC-3 and BL1.R 5-ATAGAGCTCGCGGTGGTCTC-3. The product of synthesis constitutes 175 pairs of the nucleotides. A genomic DNA is extracted by a sorbent method with the following elution in TE buffer, amplification is carried out in the mode: 95°C for 3 minutes 1 time, 94°C for 20 seconds - denaturation, 66°C for 20 seconds - annealing of the primers, 74°C for 25 seconds - elongation, 45 times, 74°C for 3 minutes - chains completion. As a positive control of reaction proceeding applied is a preparation of a positive control of BLV antigen.

EFFECT: invention can be applied in the molecular-genetic diagnostics of animal diseases and scientific research in veterinary.

2 dwg, 1 tbl

FIELD: medicine.

SUBSTANCE: invention relates to biochemistry. Described is method of detecting presence or absence of several serotypes of human papillomavirus (HPV) in biological sample by means of multi-channel analysis system, where said analysis system detects larger quantity of serotypes than the number of existing channels of detection. Method peculiarity consists in the fact that first and second sets of primers and probes, which are degenerate with respect to each other, are used; as well as the fact that each degenerate probe has signal grouping, each of which studies signal, detected on one and the same channel. Third set of primers and probes is not degenerate with respect to two other sets of primers and probes and is distinctive for third serotype, which does not belong to serotypes, to which mainly annealing of degenerate sets of primers and probes takes place, and where third set of primers and probes has signal grouping, which emits signal with wavelength, which is the same or differs from wavelength, emitted by signal grouping of degenerate probes. Respective primers and probes are presented.

EFFECT: invention makes it possible to detect larger quantity of HPV types than the number of existing channels of detection in analysis system.

11 cl, 3 dwg, 6 tbl

FIELD: medicine.

SUBSTANCE: inventions relate to the field of DNA-genealogy and deal with a method of determining haplogroups of human Y-chromosomes, a test-system and oligonucleotide primers. The characterised method is realised in two stages. At the first stage genetic typing is carried out by basic haplogroups R,N,J,I,Q,C,E,D,G,O of an Y-chromosome tree by multiplex PCR with the application of specific oligonucleotide primers of the first and second sets of the test-system. At the second stage, if mutation is detected, additional multiplex PCR for typing by subhaplogroups is carried out. If at the first stage mutation is not detected, multiplex PCR for typing by rare haplogroups A,C3,F,H,K,L,O3 and T is carried out. The area of annealing primers outside mutation zones within the limits of species specificity corresponds to sequences from the first set of the test-system. The area of annealing of the oligonucleotide primers, directly adjoining the mutation zone within the limits of species specificity corresponds to sequences from the second set of the test-system.

EFFECT: inventions can be applied for the determination of haplogroups of the human Y-chromosome.

3 cl, 2 dwg, 7 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: DNA is recovered from peripheral venous blood which is followed by a genetic typing of the APOE gene and detecting polymorphous alleles APOE*2, APOE*3, APOE*4; if the assays shows any genetic types containing alleles APOE*2, a high risk of endometrial cancer is predicted.

EFFECT: invention provides a highly specific criterion for predicting the risk of hyperproliferative diseases of the endometrium, including endometrioid adenocarcinoma in females with hyperplastic processes in the endometrium.

2 dwg, 10 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to a method for the prediction of developing occupational hyperkeratosis. Substance of the method consists in recovering DNA from peripheral venous blood lymphocytes, genotyping TP53 gene rs1625895 polymorphism by polymerase chain reaction with restriction enzyme digest analysis. Finding G/A genotype and A allele ensured predicting a risk of developing occupational hyperkeratosis.

EFFECT: using the invention enables predicting developing occupational hyperkeratosis after the body has been exposed to occupational hazards.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: presented group of inventions refers to medicine, molecular biology and biotechnology. A method for determining lung cancer cell sensitivity to cisplatin involving determining MLH1, ERCC1, DDB2, AKR1B1, FTL genes expression patterns vs. cisplatin IC50 for known cell lines; constructing cisplatin IC50 for these cell lines vs. derived gene expression patterns calibration straight, and hybridising on a microchip. What is also presented is a set of oligonucleotide probes presented by SEQ ID NO: 9-13.

EFFECT: presented group of inventions provides effective aids and methods for determining lung cancer cell sensitivity to cisplatin.

2 cl, 1 dwg, 2 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of biochemistry, in particular to method of identifying changes in gene expression, characteristic of ageing, in selected tissue. Selected tissue represents cardiac, muscular, cerebral or adipose tissue. Method includes selection of one or several genes, differentially expressed in tissue of old subjects in comparison with young subjects, with application of two criteria. Said criteria are: change of expression in at least 50% of lines, breeds or ethnic groups of tested species at preliminarily determined significance level p<0.10, as well as at least partial reversion of changes in gene expression by restriction in caloric content.

EFFECT: invention provides obtaining reliable tissue-specific biomarkers of ageing.

7 cl, 11 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to molecular biology and can be used in diagnosing cardiomyopathies of various origin Presented is a set of synthetic oligonucleotides for identifying mutations of a coding part of desmin (DES) gene associated with cardiomyopathies. The mutations are identified by detecting a full sequence of the coding part of DES gene. The coding part of DES gene is amplified by means of 7 pairs of synthetic oligonucleotides at the same temperature and annealing time, and the prepared amplification products are sequenced by means of one pair of universal primers.

EFFECT: presented invention enables the sensitive and specific detection of DES gene mutations, with reducing the amplification reaction time, the number of manipulations, the time of agent application for the sequencing reaction, and reducing a probability of a reaction error.

3 cl, 1 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, more specifically to AXL signalling pathway inhibitors, and can be used in medicine. What is produced is a soluble AXL polypeptide version free from AXL transmembrane domain, which contains at least one amino acid modification in position No. n, wherein n is specified in 32, 72, 87, 92 or 127 or a combination thereof, wherein n+7 is described by numbering SEQ ID NO: 1 that are wild-type AXL sequences, wherein the above modification increases a AXL polypeptide binding affinity to protein 6 specifically inhibiting the growth (GAS6), which is twice as strong as the wild-type AXL polypeptide affinity. The polypeptide can be fused with Fc fragment and used in a method of treating, reducing or preventing tumour dissemination and invasion in a mammalian patient.

EFFECT: invention enables inhibiting the AXL/GAS6 signalling pathways effectively.

8 cl, 15 dwg, 6 tbl, 3 ex

FIELD: biology.

SUBSTANCE: present invention relates to biotechnology, particularly to genetic engineering and can be used in the biomedical industry. Proposed is a recombinant plasmid pBMC-RT(A)-hum, meant for expressing reverse transcriptase of the human immunodeficiency virus, and is distinguished by that, it contains an artificial gene (RT(A)-hum) synthesised by an enzyme, which is characterised by a sequence of nucleotides, optimally adapted to expression in cells of mammals.

EFFECT: use of the recombinant plasmid provides for significant increase (6-8 times) in output of the target protein compared with the primary standard.

4 dwg, 1 tbl, 3 ex

Up!