Novel il-17-binding compounds and their medicinal application

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to biotechnology, namely to novel IL-17-inhibiting polypeptides, corresponding to fused proteins, to compositions and their application for medicinal purposes. Polypeptide contains amino acid sequence, which is selected from group, consisting of GVTLFVALYD YKAFWPGDLS FHKGEKFQIL RTSDGDWWEA RSLTTGETGY IPSNYVAPVD SIQ (SEQ ID NO: 39), GVTLFVALYD YKAFWPGDIS FHKGEKFQIL RTSDGEWWVA RSLTTGEEGY IPSNYVAPVD SIQ (SEQ ID NO: 57) or GVTLFVALYD YKAFWPGDIS FHKGEKFQIL RTSDGEWWIA RSLTTGEEGY IPSNYVAPVD SIQ (SEQ ID NO: 107); amino acid sequence, which has, at least, 80%, preferably, at least, 90%, more preferably, at least, 95% identity of amino acid sequence with SEQ ID NO: 39, SEQ ID NO:57 or SEQ ID NO: 107; fragment or functional derivative of SEQ ID NO: 39, SEQ ID NO: 57 or SEQ ID NO: 107, obtained due to substitution, addition and/or removal of not more than 5 amino acids.

EFFECT: invention makes it possible to bind IL-17 with high specificity and affinity.

33 cl, 17 dwg, 3 tbl, 12 ex

 

The technical field to which the invention relates

The present invention relates to a new IL-17-inhibiting polypeptides corresponding to fused proteins, to compositions and their medical use.

Background of the invention

CD4+ T cells play a Central role in initiating immune responses, helping other cells of the adaptive or innate immune system. Early studies have identified two classes of CD4+ T cells (Th1 and Th2). Recently, it was identified a new subpopulation of CD4+ T-cell - line Th17. Apparently, Th17 cells have emerged as an offshoot of the adaptive immune system, specializing in strengthening the protection of the host against extracellular bacteria and some fungi and microbes, against which there is no good defense by Th1 or Th2 immunity.

Th17 cells have been identified in the context of opening a new family of cytokine family, IL-17, which is known at the present time, contains six members (IL-17A-F). IL-17 (formerly known as CTLA-8) is mainly expressed Th17-cells and was designated as IL-17A to show that he is the founder of this family of cytokines. The sequence of the members of the family of IL-17 does not have homology with other currently known mammalian proteins and thus form a separate�Maisto cytokines. It is assumed that the structural features of members of the family of IL-17 and mounted on the base of the crystal structure of IL-17F, similar to many cytokines, and each of the members of the family, probably produced as C) an homodimer, although structural similarities imply that may exist and heterodimer. Recently, it was discovered that heterodimer IL-17A and IL-17F expressed by activated CD4+ T-cells, transmits a signal through the IL-17RA/IL-17RC (J. F. Wright et al. (2008) J. of Immunol., 181, p.2799-2805).

The identification of Th17 cells as a Central mediator of chronic inflammatory processes and as a major pathogenetic effectors certain types of autoimmune conditions, previously considered to be Th1-mediated, heralds the creation of new therapeutic approaches (T. Weaver et al. (2008) Annu. Rev. Immunol., 25, p. 821-852). In addition, pro-inflammatory cytokine IL-17 is mainly expressed Th17-cells and is present in increased amounts in the synovial fluid of patients with rheumatoid arthritis (RA) and, as shown, included in the development of early RA. In addition, IL-17 is a major inducer of TNF-alpha and IL-1, the latter of which is responsible for the development of erosion of the bone and very painful consequences for injured patients (Lubberts E. (2008) Cytokine, 41, p. 84-91). In addition, inadequate and excessive production of IL-17 is associated with Pat�a wise variety of diseases and disorders, such as osteoarthritis, loosening of bone implants, acute graft rejection (Antonysamy et al., (1999) J. Immunol, 162 p.577-584; van Kooten et al. (1998) J. Am. Soc. Nephrol., 9, p.1526-1534), septicemia, and septic endotoksicski shock, allergies, asthma (Molet et al. (2001) J. Allergy Clin. Immunol., 108, p.430-438), bone loss, psoriasis (Teunissen et al. (1998) J. Invest. Dermatol, 111, p.645-649), ischemia, systemic sclerosis (Kurasawa et al. (2000) Arthritis Rheum., 43, p.2455-2463), stroke and other inflammatory diseases.

Therefore, anti-IL-17-compounds have potential as anti-inflammatory agents, therapeutic approach, along with a number of in vivo studies demonstrated that neutralization of IL-17 attenuates inflammatory processes such as arthritis. For example, early neutralization of endogenous IL-17 through IL-17 receptor-IgG1-Fc-fused protein beginning after immunization Protocol during the initial phase of arthritis, suppresses the development of experimental arthritis (Lubberts et al. (2001) J. Immunol., 167, p.1004-1013). Furthermore, treatment with neutralizing anti-IL-17 antibodies in experimental models after the onset of collagen-induced arthritis reduced the inflammation of the joints, destruction of cartilage and bone erosion (Lubberts et al. (2004) Arthritis and Rheumatism, 50; 650-659). Histological analysis confirmed the suppression of joint inflammation, and systemic levels of IL-6 were significantly decreased after treatment with anti-IL-17-antibodies. Compared to�I, the system, as well as local overexpression of IL-17 using an adenoviral vector expressing murine IL-17 accelerated start collagen-induced arthritis (CIA) and increased synovial inflammation (Lubberts et al. (2001) J. Immunol., 167, p.1004-1013 and Lubberts et al. (2002), Inflamm. Res. 51, p102-104).

Despite the fact that the antibodies used for routine analytical, purification, diagnostic and therapeutic purposes due to the ease of their preparation, the high affinity and specificity to virtually any desired antigens-targets, there are still a number of serious shortcomings such as the need for integrated systems of products on basis of mammalian cells, the dependence on the stability of disulfide bonds, the tendency of some fragments of antibodies to aggregate, limited solubility and last but not least, they can cause unwanted immune responses, even if humanitarian. Consequently, recent studies have focused on the development of small globular proteins as frameworks for developing new classes of universal binding proteins. To create a variety of sighting and specificity, usually surface components (e.g., extracellular loop) of a protein backbone with suitable biophysical properties of combinatorial mutated to produce libraries �elkow, which was subjected to screening to determine specificdate binding of interest (Binz, H. K., and Pluckthun, A. (2005) Curr. Opin. Biotechnol. 16, 459-469).

These non-immunoglobulin origin binding reagents jointly referred to as "frames" (Skerra, A. (2000) J. Mol. Recognit. 13, 167-187). Over the past 10-15 years, offered more than 50 different protein cages, the most advanced approaches in this area include the following (as noted in Gebauer M and Skerra, A. (2009) Curr Opinion in Chemical Biology 13:245-255): officela (based on Z-domain of staphylococcal protein A), the domains of the kunitz shot goals-type, anectine (based on 10-m domain of human fibronectin), anticline (derived from lipocalin), DARPins (derived from proteins with ancyranum repeat), aimery (based on multimedijalnih LDLR-A), officina (based on Sac7d from hyperthermophilic archaeon), and hinomaru, which are derived from Fyn SH3 domain.

In General, SH3 domains are present in various proteins involved in the transduction of cellular signals (Musacchio et al. (1994) Prog. Biopbys. Mol. Biol. 61; 283-297). These domains do not occupy a fixed position in proteins and can be expressed and purified independently. More than 1000 events in the domain currently known among about 300 SH3 domains (Musacchio, A. (2003) Advances in Protein Chemistry. 61; 211-268). Although there is a huge variety of sequences among SH3 domains, they all have conservati�tion fold: compact beta-barrel, formed by two anti-parallel beta-layers (Musacchio, A. (2003) Advances in Protein Chemistry. 61; 211-268). Usually, SH3 domains bind to Proline-rich peptides containing the binding motif RHR (Ren et al. (1993) Science 259; 1157-1161), but examples of non-traditional SH3 binding sites are also described (Karkkainen et al. (2006) EMBO Rep. 7; 186-191). Most SH3 domains, already sequenced, have a total length of approximately 60 to 65 amino acids, but some of them can be more than 85 amino acids due to insertions in the loops connecting the main conservative elements of the secondary structure (Koyama et al. (1993) Cell 72(6); 945-952). The alignment of different SH3 domains reveals conserved amino acid residues responsible for the formation of correct structure, and for the canonical recognition of Proline-rich motif (Larson et al. (2000) Protein Science 9; 2170-2180).

Recently, the inventors demonstrated that Fyn SH3 domain is a particularly effective frame ("Fynomer") for generating binding proteins, since it (i) can be expressed in bacteria in soluble form in large quantities, (ii) is a monomer and aggregates during storage in solution, (iii) is very stable (Tm70,5°C), (iii) does not contain cysteine residues, and (iv) is of human origin, characterized by the amino acid sequence, a fully conservative from mouse to man and, �a consequence, nimmunogenic (Grabulovski et al. (2007) JBC, 282, p.3196-3204).

The aim underlying the present invention is to provide a new IL-17A-binding molecules, in particular those that have high specificity and high affinity for IL-17A. An additional objective is the provision of IL-17A-binding molecules, preferably IL-17 inhibitors that are suitable for research, diagnosis and treatment, preferably for use in medicinal products for the treatment and/or prevention of IL-17A-mediated diseases and medical conditions.

Surprisingly, the above objectives are achieved by polypeptides containing an amino acid sequence selected from the group consisting of:

(i)

where a-h corresponds to 0 to 20

preferably a represents from 1 to 10, more preferably from 2 to 8, most preferably 6;

preferably b is from 0 to 5, more preferably from 1 to 3, most preferably 1;

preferably corresponds to from 0 to 5, more preferably from 1 to 3, most preferably 1;

preferably, d is from 1 to 10, more preferably from 3 to 9, most preferably 5 or 7;

preferably e corresponds to from 0 to 5, more preferably from 1 to 3, most preferably 1;

preferred�Uo f corresponds to from 0 to 5, more preferably from 1 to 3, most preferably 1;

preferably g corresponds to from 0 to 5, more preferably from 1 to 3, most preferably 1;

preferably h corresponds to from 0 to 6, more preferably from 1 to 3, most preferably 1 or 2;

(ii) the amino acid sequence having at least 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% identity amino acid sequence (i);

(iii) the amino acid sequence encoded by a nucleic acid that's hybrid with a complementary thread of a nucleic acid that encodes (i), preferably under stringent conditions;

(iv) the fragment or functional derivative (i) to (iii), obtained by substitution, addition and/or deletion of at least one amino acid,

where the specified polypeptide binds to IL-17A.

The above-mentioned General formula (I) is the result of repetitive and extensive mutational analysis of human Fyn SH3-frame and selection based on binding of IL-17A.

Position, denoted as X, can vary greatly for the type of amino acid(amino acids) and also the number of amino acids. Preferably, X is cysteine. The preferred amount of the amino acid�t for X is specified by sub-items (a-h), all of which are preferably from 0 to 20, more preferably from 0 or 1 to 10.

In native human Fyn SH3 (X)andand (X)dwill be correlated with the RT - Src and-loop, respectively. Preferably, but not necessarily, that (X)andand (X)dconstitute a loop structure. It is known that a typical loop structures span from 2 to more than 20 amino acids (Larson et al. (2000) Protein Science 9; 2170-2180). Consequently, it is preferable that (X)andand/or (X)dhave from 2 to 20 amino acids. Preferably, a represents 1 to 10, more preferably from 2 to 8, most preferably 6. Preferably d represents from 1 to 10, more preferably from 3 to 9, most preferably 5 or 7. Preferably (X)andis TAFWPG, more preferably VAFWPG, most preferably KAFWPG. Preferably (X)dis LNSSE, more preferably TRTSD or LHTSD, most preferably LRTSD.

(X)b, (X)c, (X)e, (X)fand (X)grepresent, independently from each other, preferably from 0 to 5, more preferably from 1 to 3, most preferably 1. (X)hrepresents preferably from 0 to 6, more preferably from 1 to 3, most preferably 1.

In the most preferred embodiment of formula (I) corresponds to:

Of course, there are many variations of the amino acid sequence of formula (I), which still allow the binding of IL-17A with a polypeptide according to the invention. Consequently, the present invention also encompasses polypeptides containing an amino acid sequence having at least 50, 60 or 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% amino acid sequence identity with (i).

In the value used here, the term "identity of amino acid sequences between the amino acid sequences, refers to methods of alignment and comparison, the generally accepted and widely used by specialists in the field of biochemistry. The identity of amino acid sequences of two amino acid sequences can be determined by conventional methods and alignment tools. For example, to determine the degree of identity of amino acid sequences randomly selected polypeptide relative to the amino acid sequence of formula (I), you can use a program to determine the local similarities SIM Local similarity program (Xiaoquin Huang and Webb Miller, "A Time-Efficient, Linear-Space Local Similarity Algorithm." Advances in Applied Mathematics, vol. 12:337-357, 1991.), which is freely available from the authors and their inst�mulberries (see, also the Internet: http://www.expasy.org/tools/sim-prot.html); for the analysis of a multiple alignment can be used ClustalW (Thompson et al., "CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice". Nucl Acids Res., 22(22):4673-4680, 1994.). Preferably, the degree of identity of amino acid sequences of the polypeptide, fragment or functional derivative of the invention with an amino acid sequence of formula (I) is defined relative to the full sequence of the formula (I).

In addition, the present invention also encompasses polypeptides containing the amino acid sequence encoded by a nucleic acid that's hybrid with a complementary thread of a nucleic acid that encodes (i), preferably under stringent conditions. In other words, the amino acid sequence covered by the polypeptides in accordance with the invention, preferably is determined, indirectly, its coding nucleic acid, which can still gibridizatsiya with a complementary thread of a nucleic acid encoding the amino acid sequence of formula (I). Gibridizatsiya whether the nucleic acid with each other, usually determined by known in the art specific methods alignment and comparison, as well as experimentally. After the General�risetime and/or standard protocols, known in the art, to determine the ability of one nucleic acid to gibridizatsiya with specific reference nucleic acid sequence under stringent conditions (e.g., Sambrook and Russell, Molecular cloning: A laboratory manual (3 volumes), 2001), it is preferred to analyze and determine the ability of randomly selected nucleic acid encoding interest polypeptide, gibridizatsiya with a complementary thread of a nucleic acid sequence that encodes the amino acid sequence of formula (I), subject to strict conditions, which is performed by comparison of these two nucleotide sequences using the alignment tools, such as, e.g., BLASTN (Altschul et al., J. Mol. Biol., 215, 403-410, 1990) and LALIGN. Most preferably, the ability of the nucleic acid that encodes a polypeptide of interest, which presumably is a polypeptide according to the invention, gibridizatsiya with a complementary thread of a nucleic acid encoding the amino acid sequence of formula (I), is confirmed in the analysis of southern blots under the following conditions: 6x sodium chloride/sodium citrate (SSC) at 45°C, followed by laundering in 0.2×SSC, 0,1% SDS at 65°C.

In addition, the present invention encompasses polypeptides containing a fragment, preferably a functional FR�gment, or functional derivative of any of the above amino acid sequences according to the invention.

Consequently, the term "polypeptide or amino acid sequence in accordance with the present invention also encompasses functional fragments and derivatives of the polypeptide or amino acid sequence of the invention, having the properties defined above, i.e. the ability of binding to IL-17A. Functional derivatives of a polypeptide or amino acid sequence of the present invention encompass any amino acid sequence and/or its chemical derivative (unnatural amino acid equivalents, glycosylation, chemical receipt), which has a practically sufficient number of available amino acid residues or unnatural equivalents for the existence of binding to IL-17A. The functional derivatives of a polypeptide or amino acid sequence of the invention, one or more amino acids may be deleted, modified, inserted and/or substituted. In addition, in the context of "functional derivative", the insertion refers to the insertion of one or several amino acids in the above-described "non-derivative" binding proteins. Preferably, with increasing advantage that the functional derivative contains no more than 5, 4, 3, 2 or 1 amino acid change(I) (i.e. deleted, modified, inserted and/or substituted amino acids). In another embodiment, preferably, with increasing advantage, what's changed no more than 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2% or no more than 1% of all amino acids of the polypeptide or amino acid sequence (i.e. are deleted, modified, inserted and/or substituted amino acids). Substitution in the derivative may be conservative or non-conservative substitution, but is preferably a conservative substitution. In some embodiments, the substitution includes replacement of natural amino acids unnatural amino acid. Conservative substitution includes a substitution of amino acid by another amino acid that has chemical properties similar to the amino acid that is replaced. Preferably, a conservative substitution is a substitution that is selected from the group consisting of: (i) substitution of the basic amino acid by another basic amino acid; (ii) the substitution of an acidic amino acid to another acidic amino acid; (iii) the substitution of other aromatic amino acids aromatic amino acid; (iv) substitution of non-polar, aliphatic amino acid by another non-polar, aliphatic amino acid; and (v) the substitution of the polar, uncharged amino acids, other polar, uncharged amino acid. Main am�nakilat selected from the group consisting of arginine, histidine and lysine. The acidic amino acid is selected from aspartate or glutamate. Aromatic amino acid selected from the group consisting of phenylalanine, tyrosine and tryptophan. Non-polar, aliphatic amino acid selected from the group consisting of glycine, alanine, valine, leucine, methionine and isoleucine. Polar, uncharged amino acid selected from the group consisting of a series NCT-al, threonine, cysteine, Proline, asparagine and glutamine. Compared to a conservative amino acid substitution, non-conservative amino acid substitution is a substitution of one amino acid any amino acid that does not fall under the above(s) conservative(s) substitution(I) (i) - (v). If the functional derivative contains division, in a derivative one or more amino acids that is present in the original polypeptide, removed. However, the deletion should not be very extensive, so that the derivative contains less than 3, preferably less than 4, more preferably less than 5 and most preferably less than 6 amino acids in General. As indicated above, amino acid polypeptide or amino acid sequence of the invention can also be modified, e.g., chemically modified. For example, side chain or a free amino - or carboxy end of the amino acid�t polypeptide may be modified, eg., by glycosylation, amidation, phosphorylation, ubiquitination, etc. Chemical modification can also occur in vivo, e.g., in the host cell, as is known in the art. For example, suitable chemically modified motif, e.g., the glycosylation motif sequence present in the amino acid sequence of the polypeptide, will do a glycosylated polypeptide. In all embodiments relating to the functional derivative of the invention, it is necessary to understand that amino acid sequence having the formula (I) as defined herein above, is the starting molecule, which introduces a functional derivative. In the case of insertion in the two original molecules having identical sequences, except that in the first molecule Xandequivalent to 4 and in the second molecule Xandequivalent to 5 to be obtained molecules of identical length, and possibly identical with the amino acid sequence, if the insert, e.g. in the end, Xandconsists of two amino acids in the first molecule and one amino acid in the second molecule.

The polypeptides of the present invention bind IL-17A, preferably IL-17A human. Preferably, they bind specifically to IL-17A, i.e. they do not bind to other cytokines or concerned�t them to a lesser extent, preferably, at least 2, 5, 10, 50, 100, 500 or 1000 times smaller. Exemplary and preferred ELISA to determine the binding specificity of the polypeptides of the present invention are provided in examples 6 and 7.

In a preferred embodiment, the polypeptides of the present invention bind IL-17A humans and monkeys with specific and high affinity binding.

In additional preferred embodiments, the polypeptides of the invention have a specific (in vivo and/or in vitro) the affinity of binding to human IL-17A, preferably with KDfrom 10-7up to 10-12M, more preferably from 10-8up to 10-12M, most preferably less than 10-12M. for Example, and also preferably, the affinity of binding of the polypeptides of the present invention may be determined in accordance with Example 2 below.

In the most preferred embodiment, the polypeptides of the present invention is selected from the group consisting of SEQ ID NO:1-119, or their functional derivatives, which are appended to the description.

In a preferred embodiment, the polypeptides of the present invention not only bind, but actually inhibit IL-17A (function). This ability is demonstrated in Examples 3 and 10, which shows the ability of the polypeptides to inhibit the induction of IL-6 in fibroblasts of human skin�and in response to the addition of IL-17A.

In addition, the polypeptides of the present invention have high stability in solution, e.g., they are stable at 4°C for at least 6 months in normal phosphate-buffered saline (see Example 4).

However, stability is not limited to the compositions in vitro, but also confirmed in mice, in which the polypeptide of the present invention was administered intravenously (see Examples 5 and 12).

In conclusion, it should be noted that the polypeptides of the present invention are well suited for research, diagnostic and medical purposes.

Along with replacement of IL-17A antibodies, they can also be used to create new and less immunogenic fusion proteins for pharmaceutical and diagnostic applications in vivo and in vitro. Thus, in a second aspect, the invention relates to a fused protein containing the polypeptide of the invention, which merged with pharmaceutically and/or diagnostically active component.

As indicated, the protein of the invention may contain polipeptide components, e.g., non-peptide linkers, non-peptide ligands, e.g., for radionuclides suitable for therapeutic or diagnostic purposes.

Preferably, the specified active component is a cytokine selected from the group consisting of IL-2, IL-12, TNF-alpha, IFN-alpha, IFN-beta,IFN-gamma, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, 70, TNF-beta, LT-beta, CD-40-ligand, Fas-ligand, TGF-beta, IL-1-alpha and IL-1-beta.

In another preferred embodiment, the specified active ingredient is a toxic compound, preferably a low-molecular organic compound or a polypeptide, more preferably toxic compound selected from the group consisting of calicheamicin, maytansinoid, neocarzinostatin, espiramicina, dynemicin, cedarcide, naturopatia, doxorubicin, daunorubicin, auristatin, A-chain of ricin, modeccin, the truncated exotoxin A of Pseudomonas, diphtheria toxin and recombinant gelonin.

In another preferred embodiment, a protein of the invention represents a protein, where the specified active ingredient is a chemokine, which is preferably selected from the group consisting of IL-8, GRO-alpha, GRO-beta, GRO-γ, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1 alpha/beta, BUNZO/STRC33, I-TAC, BLC/BCA-1, M1R-1-alpha, MIP-1 beta, MDC, TECK, TARC, RANTES, HCC-1, HCC-4, DC-CK1, MIP-3-alpha, MIP-3-beta, MCP-1-5, eotaxin, eotaxin-2,1-309, MPIF-1, 6Ckine, CTACK, MEC, lymphotactin and fractalkine.

In an additional preferred embodiment, the polypeptide or protein according to the invention contains artificial amino acids.

In additional preferred embodiments of the fused protein of the present invention, the decree�tion of the active component is a fluorescent dye, preferably a component selected from the group of Alexa Fluor or colors of su (Berlier et al. "Quantitative Comparison of Long-wavelength Alexa Fluor Dyes to Cy Dyes: Fluorescence of the Dyes and Their Bioconjugates", J. Histochem. Cytochem. 51 (12):1699-1712, 2003.); the photosensitizer, preferably phototoxic red fluorescent protein KillerRed (Bulina et al. (2006) Nat Biotechnol., 24, 95-99) or hematoporphyrin; drug test etc factor, preferably the tissue factor; an enzyme for prodrug activation, preferably an enzyme selected from the group consisting of carboxypeptidases, glucuronides and glycosides; radionuclide, or from the group of gamma-emitting isotopes, preferably99mTc,123I,111In or from the group of positron emitters, preferably18F,64Cu,68Ga86Y124I or from the group of beta-emitters, preferably131I,90Y177Lu,67Cu, or from the group of alpha-emitters, preferably213Bi211At.

In another preferred embodiment, the polypeptide of the present invention can be attached directly or through a chemical linker to one or more polipeptidnyi components, as indicated here above.

In a more preferred embodiment of the fused protein of the present invention, the specified active ingredient is one or more functional Fc domain, preferably one Il� several functional Fc domains (see, for example, SEQ ID NO:117 to 119 and SEQ ID NO:130), which(th) let(et) to extend the half-life in vivo (half-life) of IL-17A-binding polypeptides of the invention and some of which direct the immune response in mammals towards specific directional binding polypeptide component fused protein according to the invention, e.g., in therapeutic, prophylactic and/or diagnostic purposes. The polypeptides of the invention can be fused to either the N - or C-end of one or more functional Fc domains with both N - and C-ends of one or more Fc domains. Preferably, fusion proteins of the invention contain multimer, preferably tetramers, trimers, or most preferably dimers of polypeptides of the invention fused with at least one part, preferably with N-end of one or more, preferably one Fc domain. In this regard, it should be noted that protein Fynomer-Fynomer-Fc, denoted by (2Cl)2-Fc, demonstrating the advantage of multimeric mergers polypeptide-Fc, which have a higher affinity to IL-17A than the corresponding Monomeric protein 2C1-Fc, as shown below in Fig.3E and 3f and Table II of Example 2. Consequently, the preferred embodiment of the invention is directed to a multimeric fusion proteins, the polypeptide-Fc.

"Functional Fc" antibody is a term well known to a qualified specialist in this field, and is determined on the basis of means of the papain cleavage of antibodies. Depending on the amino acid sequence of the constant plot heavy chains, immunoglobulins are divided into the classes: IgA, IgD, IgE, IgG and IgM, and several of them can be further divided into subclasses (isotypes), e.g., IgG1, IgG2, IgG3 and IgG4, IgA1, and IgA2. In accordance with the constant parts of the heavy chains of different classes of immunoglobulins are called [alpha], [Delta], [Epsilon], [gamma] and [mu], respectively. Functional Fc domain of an antibody is directly included in ADCC (antibody-dependent cell-mediated cytotoxicity) and CDC (complement-dependent cytotoxicity) based on the activation of complement, C1q-binding and Fc receptor binding. Four isotype of human IgG bind different receptors, such as the neonatal Fc-receptor, activating Fc-gamma receptors, FcγRI, FcγRIIa, and FcγRIIIa, the inhibitory receptor FcγRIIb and C1q with different affiniscape getting a very different activity. It is known that the affinity for the activating and the inhibitory receptor Fc-domain antibodies can be constructed and modified (see, Strohl W. (2009) Curr Opin Biotechnol, 20, p.685-691). Therefore, as indicated above, the invention contains a Fc-fusion(I) that(s) allow(s) to increase the time �aluizni in vivo IL-17A-binding polypeptides of the invention, and that(s) contains a functional Fc domain of human origin, preferably of human functional Fc domain of IgG1 antibody (see, e.g., SEQ ID NO:117 to 119 and SEQ ID NO:130).

In a more preferred embodiment of the fused protein of the present invention the active ingredient is one or more recombinant functional Fc domains of human IgG1 with activated or suppressed effector functions, preferably one or more recombinant functional Fc domains of human IgG1 with suppressed effector functions, and most preferably one or more recombinant functional Fc domains of human IgG1 with suppressed effector functions with a mutation in L234 and L235 (see, e.g., SEQ ID NO:131-135), the encoding according to the nomenclature Kabata (see G. Johnson and T. T. Wu (2000) Nucl Acids Res. 28 p.214-218).

An additional preferred embodiment relates to the polypeptide or fused protein of the invention, as described above, which additionally contain a component, modulating the half-life in serum, and the component is preferably selected from the group consisting of polyethylene glycol (PEG), immunoglobulin and albuminaemia peptides.

Furthermore, it is preferable that a protein of the invention contains any of the above inventive IL-17A-binding polypeptides, �predpochtitelno the which is selected from the group consisting of SEQ ID NO:117 to 119 and SEQ ID NO:130-135, or its functional derivative.

It should be noted that the polypeptide or protein of the invention is preferably a monomer, but also covered and multimer, preferably tetramers, more preferably trimers, or most preferably dimers of the inventive polypeptides.

Polypeptides and fusion proteins of the invention can be prepared by using any of the many conventional and well known methods, such as conventional strategies of synthesis of organic compounds, solid-phase synthesis technique, or using commercially available automated synthesizers. On the other hand, they also can be prepared using conventional recombinant technology by themselves or in combination with conventional methods of synthesis.

In this regard, an additional aspect of the present invention relate to (i) a nucleic acid that encodes a polypeptide or protein of the invention, (ii) a vector containing this nucleic acid, and (iii) to the cell host containing the said polynucleotide and/or a specified vector.

Preferably, the invention relates to an isolated and purified nucleic acid containing

(i) nucleic acid encoding the polypeptide of the invention, it is preferable to�yuushuu amino acid sequence of formula (I), more preferably,

(G/E)VTLFVALYDY-(X)6-D-(X)-SFHKGEKF-(X)1-I-(X)5-7-G-(X)1-WW-(X)-A-(X)-SLTTG-(X)1-2-GYIPSNYVAPVDSIQ;

(ii) a nucleic acid having a sequence at least 60 or 70%, preferably at least 80%, more preferably at least 90%, most preferably at least 95% sequence identity with the nucleic acid sequence (i);

(iii) a nucleic acid that's hybrid with a complementary thread of nucleic acid from (i) or (ii);

(iv) nucleic acid, wherein the specified nucleic acid is obtained by substitution, addition and/or deletion in one of the nucleic acids from (i), (ii) or

(iii);

(v) a fragment of any of the nucleic acids from (i) to (iv) that's hybrid with a complementary thread of the nucleic acid of (I) encoding a polypeptide of the invention.

More preferably, a nucleic acid of the invention contains a nucleic acid encoding the polypeptide or protein as described above. In this regard, it should be understood that any one of nucleic acids (i) to (v) above, preferably encodes a polypeptide that binds IL-17A and more preferably inhibits the function of IL-17A.

Nucleic acids of the invention can be DNA, RNA, PNA and any other of their counterparts. Vectors and cells-owners can �be of any conventional type, which is suitable for the purpose, e.g., obtaining polypeptides and/or fusion proteins of the invention, therapeutic applications of vectors and host cells, e.g., for gene therapy. The person skilled in the art is able to choose such nucleic acids, vectors and cells-the owners are from a wide level of technology and confirm their specific suitability for the desired goal, using routine methods and without excessive work.

Preferably the nucleic acid is functionally linked to a promoter, preferably linked to a promoter which is selected from the group of prokaryotic promoters, consisting of the T5-promoter/lac operator element, T7-promoter/lac operator element, or from the group of eukaryotic promoters, consisting of hEF1-HTLV, CMV enh/hFerL-promoter.

Also is preferred that the recombinant vector of the invention is a vector containing a nucleic acid of the invention and is preferably capable of producing a polypeptide or protein of the invention. Preferably, such a vector selected from the group consisting of pQE vectors, pet vectors pFUSE vectors, pUC vectors, YAC vectors, fominyh vectors, phage vectors, vectors used in gene therapy, such as retroviruses, adenoviruses, adeno-associated viruses.

In addition, the present invention relates to cells-Josee�am containing nucleic acid and/or vector of the invention.

In addition, the present invention encompasses an antibody that specifically binds to a polypeptide or fused protein of the invention. If the antibody binds to a fused protein, it specifically binds to part, which consists of a polypeptide of the invention or fusion of the epitope, i.e., with a binding site of the antibody, partially consisting of a polypeptide of the invention and partly consisting of pharmaceutically and/or diagnostically active component, which is preferably a polypeptide or peptide. Antibodies may be polyclonal or monoclonal antibodies. In the value used here, the term "antibody" refers not only to whole antibody molecules, but also to antigen-binding fragments, e.g., Fab, F(ab')2, Fv, and single chain Fv-fragments. Also included are chimeric antibodies, preferably humanized antibodies. Such antibodies are useful as research tools to identify differences between random proteins and polypeptides of the invention. An additional aspect relates to a hybrid cell line expressing a monoclonal antibody of the invention.

Since the polypeptides and fusion proteins of the present invention demonstrate IL-17A-binding and inhibitory properties, � well as stability during storage and in vivo, an additional aspect of the present invention relates to pharmaceutical compositions containing the polypeptide or protein, nucleic acid and/or recombinant vector of the invention and, optionally, pharmaceutically suitable carrier. Also, the meaning of the term "pharmaceutical composition" encompasses diagnostic compositions for use in vivo.

Pharmaceutical compositions of the invention can be manufactured by any conventional method. For the implementation of treatment of a subject suffering from diseases noted below, at least one compound of the present invention can be administered in any form or by any means, which makes therapeutic polypeptide or a therapeutic fragment bioavailable in effective amounts, including oral or parenteral route of administration. For example, the compositions of the present invention can be administered subcutaneously, intramuscularly, intravenously, by inhalation and in this way. Specialist in the field of preparing formulations can readily select the appropriate form and route of administration depending on the specific characteristics of the selected product, the disease or condition that requires treatment, stage of disease or condition and other relevant circumstances (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co. (1990)). Suitable nositelj�m or excipient may be a liquid material, which can serve as a binder or medium for the active ingredient. Suitable carrier materials or excipients well known in the art and include, for example, stabilizers, antioxidants, pH-regulating substances, controlling the release of excipienti. the Composition according to the invention, preferably is provided in lyophilized form. For direct entry it is dissolved in a suitable aqueous carrier, e.g. sterile water for injection or sterile buffered saline. If you want to prepare large amounts for administration by infusion, but not in the form of a bolus injection, it is useful introduction human serum albumin or a private heparinized blood of the patient in the solvent at the time of completion of the preparation. Alternatively, the composition can be administered subcutaneously. The presence of excess physiologically inert protein such as human serum albumin, prevents loss pharmaceutically effective polypeptide due to absorption on the walls of the container and the vials used for the infusion solution. If used albumin, a suitable concentration is from 0.5 to 4.5 mass% physiological saline solution.

IL-17A-binding and inhibitory polypeptides of the invention are particularly under�odat for the treatment and/or prevention of IL-17A - and/or Th17-associated diseases or medical conditions. Consequently, an additional aspect of the present invention is directed to the use of polypeptide or fused protein, nucleic acids and/or recombinant vector of the invention for medical purposes, i.e. for the preparation of medicines, preferably for the treatment and/or prophylaxis of a disease or medical condition which is preferably selected from the group consisting of IL-17A - and/or Th17-associated diseases or medical conditions.

In a preferred embodiment, the medical application of the invention relates to treatment and/or prevention of diseases or medical conditions selected from the group consisting of inflammatory, autoimmune and/or associated with osteoporosis diseases and conditions.

In the most preferred embodiment, these inflammatory, autoimmune and/or associated with osteoporosis diseases and conditions selected from the group consisting of arthritis, preferably rheumatoid arthritis, chronic progressive arthritis, reactive arthritis, psoriatic arthritis, enteropathic arthritis and deforming arthritis, rheumatic diseases, spondyloarthropathies, ankylosing spondylitis, Reiter's disease, hypersensitivity (including both respiratory hypersensitivity and dermal hypersensitivity) and allergies, with�systematic lupus erythematosus, inflammatory lesions of muscles, polychondritis, sclerodoma, granulomatosis granulomatosis, dermatomyositis, syndrome Stevens-Johnson, chronic active hepatitis, myasthenia gravis, psoriasis, idiopathic sprue, autoimmune inflammatory bowel disease, ulcerative colitis, Crohn's disease, irritable bowel syndrome, endocrine ophthalmopathy, graves ' disease, sarcoidosis, ischemia, systemic sclerosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (diabetes mellitus type I), autoimmune hematologic lesions, hemolytic anemia, aplastic anemia, congenital aplastic anemia, idiopathic thrombocytopenia, uveitis (anterior and posterior), dry keratoconjunctivitis, vernal keratoconjunctivitis, interstitial lung fibrosis, glomerulonephritis (with and without nephrotic syndrome), idiopathic nephrotic syndrome or minimal change nephropathy, tumors, inflammatory diseases, skin inflammation, inflammation of the cornea, myositis, bone grafts rejection, acute transplant rejection, metabolic disorders, atherosclerosis, diabetes, and dyslipidemia, bone loss, osteoarthritis, osteoporosis, periodontitis, obstructive or inflammatory airway diseases, and�we, bronchitis, pneumoconiosis, emphysema, acute and sharp inflammatory reactions, diseases, pathogenesis of which is involved in IL-17A-mediated TNF-alpha, acute infections, septicemia, septic shock, endotoksicski shock, syndrome of respiratory disorders in adults, meningitis, pneumonia, severe burns, cachexia, syndrome of exhaustion, stroke, herpes stromal keratitis keratitis and dry. All of the above diseases and medical conditions have in common that their etiology and/or symptom(s) are IL-17A - and/or Th-17-associated.

The number and route of administration of the claimed compounds, i.e., polypeptides, fusion proteins, nucleic acids, vectors and host cells for the treatment and/or prophylaxis of a disease or medical condition, preferably selected from the group consisting of IL-17A - and/or Th17-associated diseases or medical conditions, more preferably those listed above will, of course, vary depending on the specific inhibitor of the polypeptide or fused protein of the invention, a specific group of patients or patient, the presence of additional medical active compounds and the nature and severity of the condition, undergoes the treatment. However, presently preferably for the prophylactic and/or therapeutic Prim�tion injected dose from about 0.01 mg to about 20 mg per kilogram of body weight, preferably from about 0.1 mg to about 5 mg per kilogram of body weight. Preferably, frequency of administration for prophylactic and/or therapeutic applications is from about twice a week to about once every 3 months, preferably from about once every 2 weeks to about once every 10 weeks, more preferably once every 4-8 weeks. IL-17A-binding polypeptides and fusion proteins of the invention are conveniently and preferably, administered parenterally, intravenously, preferably in the antecubital or other peripheral vein, intramuscularly, or subcutaneously. Also, IL-17A-binding polypeptides can be delivered topically as eye drops. Preferred prophylactic and/or therapeutic effect on a patient comprises administering polypeptides of the invention from once a month to once every 2-3 months or less.

Therefore, the present invention also relates to a method of treatment in which a pharmacologically effective amount of the above pharmaceutical composition is administered to a patient in need of treatment, preferably a patient suffering from IL-17A - and/or Th17-associated diseases or medical conditions, more preferably from one of the above diseases or medical conditions. The term "treatment" used here value�, relates to prophylactic and/or therapeutic treatment aimed at cure of the disease or medical condition.

IL-17A-binding polypeptides and fusion proteins of the invention can be entered as the sole active ingredient or in conjunction with, e.g., as an adjuvant to or in combination with other drugs, e.g., immunosuppressive or immunomodulating agents or other anti-inflammatory agents, e.g., for the treatment or prophylaxis of the diseases mentioned above. For example, IL-17A-binding polypeptides and fusion proteins of the invention can be used in combination with immunosuppressive monoclonal antibodies, e.g., monoclonal antibodies with affinity to receptors of leukocytes, e.g., MHC, CD2, CD3, CD4, CD7, CD8, CD25, CD28, CD40, CD45, CD58, CD80, CD86 or their legandary; other immunomodulatory compounds, e.g., recombinant binding molecule having at least a portion of the extracellular domain of CTLA4 or a mutant, e.g., at least extracellular portion of CTLA4 or a mutant associated with HC-CTLA4 protein sequence, e.g., CTLA4Ig (e.g., denote ACSS 68629) or a mutant, e.g., LEA29Y; with inhibitors of adhesion molecules, e.g., LFA-I antagonists, ICAM-I or-3-antagonists, VCAM-4 antagonists or VLA-4 antagonists. In addition, the polypeptides and fusion proteins of the image�etenia can be used in combination with DMARD, eg., gold-hydrochloric sodium, sulfasalazine, antimalarial medicines, methotrexate, D-penicillamine, azathioprine, mycophenolic acid, cyclosporine A, tacrolimus, sirolimus, minocycline, Leflunomide, glucocorticoids; inhibitor of calcineurin, e.g., cyclosporin a or FK 506; a modulator recirculation limitow, e.g., FTY720 and FTY720-analogs; a mTOR inhibitor, e.g., the rapamycin, 40-O-(2-hydroxyethyl)-rapamycin, CCI779, AVT, AR or TAFA-93; an ascomycin having immunosuppressive properties, e.g. ABT-281, ASM981, etc.; corticosteroids; cyclophosphamide; azathioprene; methotrexate; Leflunomide; mizoribine; mycophenolic acid; mycophenolate mofetil; 15-deoxynivalenol or immunosuppressive homologue, analogue or derivative; or with a chemotherapeutic agent, e.g., formulations, gemcitabine, cisplatinum, doxorubicin or 5-fluorouracil; anti TNF agents, e.g., monoclonal antibodies to TNF, e.g., infliximab, adalimumab, CDP870, or receptor constructs to TNF-RI or TNF-RII, e.g., Etanercept, PEG-TNF-RI; blockers of proinflammatory cytokines, IL-1 blockers, e.g. Anakinroj or IL-1 trap, AAL160, ACZ 885, IL-6 blockers; inhibitors or activators of proteases, e.g., the muscles, anti-IL-15 antibodies, anti-IL-6 antibodies, anti-IL-23 antibody, anti-I-22 antibodies anti-IL-21 antibodies, anti-IL-12 antibodies, anti-IFN - gamma antibodies, anti-IFN-alpha antibodies, anti-CD20 antibodies, NSAIDs, such as aspirin, or anti-infective agent. Of course, this list of agents for the combined introduction is not exhaustive.

Additionally, the invention is described through the following examples, none of which restricts the scope of the invention which is claimed is determined by the claims.

Figures

Fig 1. the analysis shows SDS PAGE of different variants of IL-17-binding polypeptides of the invention: (a) SDS PAGE B1_2 (SEQ ID No:39) (track 1), E4 (SEQ ID NO:57) (track 2), 2C1 (SEQ ID NO:107) (track 3), E4-Fc (SEQ ID NO:117) (track 4: non-regenerative conditions, track 5: reduction conditions), 2C1-Fc (SEQ ID NO:118) (track 6: non-reduction conditions, the track 7: reduction conditions); (b) SDS PAGE [(2Cl)2-Fc] (SEQ ID NO:119) (track 1: non-reduction conditions, track 2: reduction conditions). Molecular weight (2Cl)2-Fc is calculated relative molecular mass marker wide range (not shown).

Fig.2 shows the gel chromatograms (SEC) of IL-17A-binding polypeptides of the invention: (a) Clone B1_2 (SEQ ID NO:39), (b) E4 (SEQ ID NO:57), (C) 2C1 (SEQ ID NO:107), (d) E4-Fc (SEQ ID NO:117), (e) SEC-purified peak E4-Fc, analyzed 40 days after treatment and storage in PBS at 4°C, (f) 2C1-Fc (SEQ ID NO:118), (g) (2Cl)2-Fc (SEQ ID NO:119).

Fig.3 depicts a BIAcore-sensogram IL-17A-binding polypeptides of the invention: (a) Clone B1_2 (SEQ ID NO:39), (b) E4 (SEQ ID NO:57), (C) 2C1 (SEQ ID NO:107), (d) E4-Fc (SEQ ID NO:117), (e) 2C1-Fc (SEQ ID NO:118), (f) (2Cl)2-Fc (SEQ ID NO:119).

Fig.4 presents the results of the analysis of the cellular inhibition of IL-17A: (a) dose-dependent induction of IL-6 after incubation NHDF-cells with IL-17A. (b) dose-dependent inhibition of IL-17A-induced IL-6 production in NHDF cells, obtained by on the basis of the Fyn SH3 IL-17-binding agents and Chimera IL-17A receptor-Fc. (C) same as b), protein Fyn SH3 wt was used as a control protein affinity binding to IL-17A. (d) HTT-analysis: viable cells are able to metabolize the tetrazolium salt HTT up to the painted product. In our experiment, all cells were viable after 24 hours of incubation with IL-17A, IL-17A and Fyn SH3 binders, or IL-17A and chimeric IL-17R-Fc.

Fig.5 depicts gel chromatography with IL-17A-binding polypeptide of the invention, denoted by G3 (SEQ ID NO:34), one day after cleaning (stored in PBS at 4°C). Chromatography was performed using a column of Superdex 75 (GE Healthcare).

Fig.6 depicts a gel chromatography with IL-17A-binding polypeptide of the invention, denoted by G3 (SEQ ID NO:34), stored for more than six months at 4°C and -20°C (b).

Fig.7 shows the pharmacokinetic data of IL-17A-binding polypeptide of the invention, denoted by E4-Fc (SEQ ID NO:117), in mice: (a) the concentration of E4-Fc in the serum plotted against time after nutrion�CSOs introduction, (b) as in (a), but with semi-logarithmic image. The last four time points were used for calculation of finite-time half-life, amounting to 50.6 hours.

Fig.8 shows a table of the binding specificity of the polypeptide of the invention, denoted by 2C1 (SEQ ID NO:107). The results of absorption are related to ELISA performed with various target proteins: human IL-17A, human IL-17F, mIL-17A (mouse IL-17, TNF-alpha (human tumor necrosis factor-alpha), BSA (bovine serum albumin), Ovalbumin (chicken egg white), IL-6 (human interleukin 6).

Fig. 9 shows the specificity obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107). Different members of the family of IL-17, IL-17A various kinds and other unrelated antigens were used in ELISA together with obtained on the basis of the Fyn SH3 a polypeptide of the invention 2C1 (SEQ ID NO:107) as a binding agent. Obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) binds only IL-17A human and macaque. No binding to any other antigen. On the right side of the Figure (right side of dashed line) shows the signal of the ELISA for IL-17C man who was determined on another day along with control IL-17A human. Designation: hIL-17A: Interleukin 17A man, hIL-17B: Interleukin 17B person, HIL-17D: Interleukin 17D man, ML-17E Interleukin A person ML-17F Interleukin 17F human IL-17A (mouse): Interleukin 17A mice, IL-17A rat Interleukin 17A rat IL-17A dogs: Interleukin 17A dogs, Il-17A macaques: Interleukin 17A macaques, EDB: external domain In fibronectin, hIL-6: Interleukin 6 human hTNF alpha: tumor necrosis factor-alpha human, Ovalbumin: albumin from chicken egg, BSA: bovine serum albumin neg ctrl: coating antigen was not used, hIL-17C: Interleukin 17C person.

Fig.10 represents a Biacore-sensogram obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) on the chip, coated with IL-17A macaque denaturirovannym from Taurus inclusion.

Figure 11 shows the analysis of SDS-PAGE of Fc-fusion proteins. Track 1: multi-color marker wide range (GE Healthcare), track 2: 2C1-Fc (SEQ ID NO:130), track 3: multi-color marker wide range (GE Healthcare), track 4: 2C1-m5-Fc(LALA) (SEQ ID NO:133), track 5: 2C1-m10-Fc(LALA) (SEQ ID NO:134), track 6: 2C1-m15-Fc(LALA) (SEQ ID NO:135), track 7: 2C1-m5E-Fc(LALA) (SEQ ID NO:132), track 8: 2C1-Fc(LALA) (SEQ ID NO:131).

Figure 12 shows ELISA 2C1-Fc (SEQ ID NO:130) binding to IL-17A after storage for 5 days at 37°C in serum (*) compared with standard control 2C1-Fc (SEQ ID NO:130), stored at 4°C in PBS (x).

Figure 13 shows the concentration in serum at various time points 2C1-Fc(LALA) (SEQ ID NO:131) after a single intravenous injection to mice. 2C1-Fc(LALA)-a protein (SEQ ID NO:131), produced in the cells of a mA�volatility, were injected (40 µg / animal) intravenously (iv) (n=5) mice. The last four time PK profile was used to calculate the finite-time-life 2C1-Fc-fused protein of 53 hours.

Figure 14 shows the inhibition of human IL-17A induces the production of the COP by anti-IL-17 polypeptide 2C1 (SEQ ID NO:107) of the invention obtained on the basis of the Fyn SH3 in a model of acute inflammation. Two hours after subcutaneous (s.c.) injection of either 3 μg of IL-17A (IL-17), PBS (PBS), 3 μg of IL-17A man with 17 μg of the monomer obtained on the basis of the Fyn SH3 polypeptide 2C1 (SEQ ID NO:107) of the invention (IL-17+2C1), 3 μg of IL-17A man with 16 µg Fyn SH3-monomer of wild-type (IL-17+wt), 17 µ g of the monomer obtained on the basis of the Fyn SH3 polypeptide 2C1 (SEQ ID NO:107) of the invention only (2C1), or 16 μg Fyn SH3-monomer of wild-type only (we), took blood samples and calculated the COP levels in murine serum. Presents the average levels of KC 4 mice per group (±SD), except for the control groups of wild type Fyn SH3 without and with IL-17A), which shows the average of 3 mice±SD).

Figure 15 shows the inhibition of human IL-17A induces KC products through 2C1-Fc-fused protein (SEQ ID NO:130) in a model of acute inflammation. 2C1-Fc/IL-17: 44 mcg 2C1-Fc (SEQ ID NO:130) were injected intravenously with subsequent subcutaneous injection of 3 μg of IL-17A human. Two hours after the administration of IL-17A from mice on�were taken to pieces, blood samples and measured the levels of KC in serum by ELISA. Control experiments were carried out as follows: PBS/IL-17: the intravenous injection of PBS, followed by subcutaneous injection of IL-17; 2C1-Fc/PBS: intravenous injection 2C1-Fc (SEQ ID NO:130), followed by subcutaneous injection of PBS; PBS/PBS: the intravenous injection of PBS, followed by subcutaneous injection of PBS. Shows the average levels of KC 3-5 mice per group (±SD).

Examples

Example 1. Obtained on the basis of the Fyn SH3 polypeptides of the invention are joined to IL-17A, as determined using monoclonal phage ELISA ELISA.

Methods

DNA encoding the amino acid sequence shown in SEQ ID NO:1-116, cloned in formigny vector pHEN1, as described for FYN SH3-library in Grabulovski et al. (Grabulovski et al. (2007) JBC, 282, p.3196-3204). The production of phages was carried out in accordance with standard protocols (F. Viti et al. (2000) Methods Enzymol., 326, 480-505). For ELISA using monoclonal bacterial supernatants: biotinylating IL-17A (purchased from R&D Systems, biotinylation complied with NHS-PEO4-Biotin (Pierce) according to manufacturer's instructions) immobilizerpower on coated with streptavidin wells (StreptaWells, High Bind, Roche), and then blocked with PBS, 2% milk (Rapilait, Migros, Switzerland), 20 μl PBS, 10% milk and made 80 μl of phage supernatants. After incubation for 1 h and washing, bound phages were detected using the conjugate antibodies� with anti-M13-HRP (GE Healthcare). Detection of peroxidase activity was performed by adding substrate VM blue POD (Roche) and the reaction was terminated by adding 1 M H2SO4. The DNA sequence of binders was checked by DNA sequencing (set for sequencing BigDye Terminator v3.1 cycle, genetic analyzer ABI PRISM 3130, Applied Biosystems).

Results

The amino acid sequence derived from Fyn SH3 IL-17A-binding agents, is presented in SEQ ID NO:1-116, which are listed in the sequence listing.

Example 2. Obtained on the basis of the Fyn SH3 polypeptides of the invention bind with recombinant human IL-17A with high affinity.

This example shows the cloning and expression of different formats obtained on the basis of the Fyn SH3 IL-17A-binding polypeptides, as well as characteristics of the polypeptides according to the results of gel chromatography and surface plasma resonance.

a) Cloning and expression of IL-17A-binding polypeptides derived from Fyn SH3.

Selected IL-17A-binding polypeptides (clone B1_2: SEQ ID NO:39, clone E4: SEQ ID NO:57 and a clone 2C1: SEQ ID NO:107), obtained on the basis of the Fyn SH3 cloned in cytosolic expression vector pQE-12 and expressively and purified as described in Grabulovski et al. (Grabulovski et al. (2007) JBC, 282, p.3196-3204).

b) Cloning and expression obtained on the basis of the Fyn SH3 IL-17A-associated�their polypeptides, fused with the Fc part of the antibody is human IgG1.

Clones E4 and 2C1 (SEQ ID NO:57 and SEQ ID NO:107) was cloned and expressively, in the form of fusion proteins with the Fc-part of antibodies of human IgG1 (see below for procedure; SEQ ID NO:117 and 118). In addition, cloned 2C1-dimer with a linker of 10 amino acids [(2C1)2-Fc] and expressively, Fc-fused protein (SEQ ID NO:119).

Fc-portion of human IgG1 was amplified by PCR using primers fm5 (5' ATCGGGATCCGACAAAACTCACACATGCC 3', SEQ ID NO:121) and fm6 (5' TACGAAGCTTTCATTTACCCGGAGACAGGG 3', SEQ ID NO:122) and using commercial eukaryotic vector pFUSE-hIgG1-Fc2 (Invivogen) as the matrix. The resulting PCR products were digested with BamHI/HindIII and was ligated with the vector pASK-IBA2 (IBA-Biotagnology), previously digested by the same enzymes, yielding a new vector pAF.

The genetic information of the clones E4 and 2C1 (SEQ ID NO:57 and SEQ ID NO:107) were amplified by PCR using fm7 (5' ATATCACCATGGGGCCGGAGTGACACTCTTTGTGGCCCTTTATG 3', SEQ ID NO:123) and fm8 (5' CGTAGGA-TCCCTGGATAGAGTCAACTGGAGC 3', SEQ ID NO:124). To prepare 2C1-dimer fused with the Fc, used 2C1 DNA-matrix for two independent PCR. The first reaction used the primers 47b.fo (5' AGA GCC ACC TCC GCC TGA ACC GCC TCC ACC CTG GAT GTC AGA AAC AGC TGG CAC 3', SEQ ID NO:125) and 52. ba (5' GAC TAA CGA GAT CGC GGA TCC GGA GTG ACA CTC TTT GTG GCC CTT TAT 3', SEQ ID NO:126) and the second used PCR primers 48b.ba (5' GGT GGA GGC GGT TCA GGC GGA GGT GGC TCT GGA GTG ACA CTC TTT GTG GCC CTT TAT 3', SEQ ID NO:127) and 51. fo (5' ATC CCA AGC TTA GTG ATG GTG ATG GTG ATG CAG ATC CTC TTC TGA GAT GAG TTT TTG TTC ACC CTG GAT GTC AGA AAC AGC TG CAC 3', SEQ ID NO:128).

Two of the DNA fragment was collected using a PCR with getting 2C1-homodimer with a linker of 10 amino acids (GGGGSGGGGS, SEQ ID NO:120) between the two domains. The resulting DNA fragment were amplified further, as described for 2C1-monomer, using primers fm7 and fm8. Then, the obtained PCR products were digested with NcoI/BamHI and cloned in the double-split periplasmic expression vector pAF. Plasmids were electroporative in TG1 E. coli and protein expression was induced with 0.2 ág/ml of anhydrotetracycline. Bacterial cultures grow overnight at 25°C in a rotary shaker and fusion proteins Fynomer-Fc was purified from the periplasmic fraction in a purification step manobala And using affinity chromatography. Electrophoresis in polyacrylamide gel in the presence of sodium dodecyl sulphate (SDS PAGE, Invitrogen) was performed with 20 µl of protein solution.

(c) Gel-chromatography (SEC)

Gel-chromatography (SEC) was performed on the system AKTA FPLC using a column of Superdex 75 (10/300) or column (Superdex 75 Short (5/150) (GE Healthcare).

(d) measuring the affinity

The affinity measurement was carried out using the device BIAcore 3000 (Biacore). To analyze the interaction between biotinylating IL-17A and Monomeric IL-17A-binding polypeptides derived from Fyn SH3, and between biotinylating IL-17A and E4-Fc (SEQ ID NO:117), used SA-chip (Biacore) with immobilized 1300 510 and EN biotinylating IL-17A, respectively. A movable buffer was PBS, with 0.1% NaN3and surfactant P20 (Biacore). Interaction was measured at a flow rate of 20 µl/min and injected with different concentrations of IL-17A-binding polypeptides derived from Fyn SH3. To analyze the interaction between IL-17A and merged 2C1-Fc, and merged (2C1)2-Fc, cm 5 chip (Biacore) was coated 2900 RU of goat anti-human IgG Fc-specific antibody (Jackson Immunoresearch). A movable buffer was HBS-EP (Biacore). Interaction was measured by introducing from about 250 to 275 resonant units of the Fc-fused protein at a flow rate of 10 µl/min, followed by injection of different concentrations of IL-17A (R&D Systems) at a flow rate of 30 μl/min. All kinetic data of the interaction (separate kon/'koff) was evaluated using 3 software.2RC1 BIA to determine.

e) Results

Outputs the expression for Monomeric IL-17A-binding polypeptides of the invention derived from Fyn SH3 was changed from 60 to 85 mg/liter of bacterial culture under non-optimized conditions in shake flasks. Fc-fusion proteins expressibility with access from 0.2 to 0.4 mg/liter (table I). Fc-fusion proteins have the sequence shown in SEQ ID NO:117 to 119, which are in the application.

Table I
The outputs of the expression after purification of bacterial culture under non-optimized conditions in shake flasks in E. coli
CloneSEQ ID NO:The output expression (mg/l)
W3965
E45785
2C110760
E4-Fc1170,4
2C1-Fc1180,3
[(2C1)2-Fc]1190,2

Fig.1 shows the analysis of SDS-PAGE of the indicated purified proteins.

Profiles of gel-chromatography (SEC) show that all designs-eluted essentially as a single, Monomeric peaks (see Fig.2). As was already observed in earlier studies for binding proteins derived from Fyn SH3 (Grabulovski et al. (2007) JBC, 282, p.3196-3204), the main peak Loiret later than expected for a protein of about 8 kDa. For Fc-fusion proteins of the invention a second purification step using gel chromatography and resulted�and after one-step purification using protein a-sepharose, getting Monomeric proteins, as shown for fused protein E4-Fc (SEQ ID NO:117) in Fig.2E. E4-Fc (SEQ ID NO:117) is stable for at least 40 days when stored at 4°C in PBS.

The binding properties were analyzed by analysis of real-time communication on the BIAcore chip (Figure 3), showing the following dissociation constants (KDfor selected IL-17A-binding polypeptides and fusion proteins:

Table II
CloneSEQ ID NO:KD
W39117 nm
E45731 nm
2C11075 nm
E4-Fc1175 nm
2C1-Fc118305 PM
[(2C1)2-Fc]119180 PM

Example 3. Analysis of cell inhibition of IL-17A

IL-17A induces the production of IL-6 in fibroblasts dose-head�independent manner (Yao et al. (1995) Immunity, 3, p.811-821). Inhibitory activity of these IL-17A-binding polypeptides derived from Fyn SH3 and fusion proteins, were tested by stimulating skin fibroblast recombinant human IL-17A in the absence or presence of various concentrations of Fyn SH3 mutants or chimeras IL-17A receptor human Fc. The supernatants of cell cultures were collected after 24 h of stimulation and analyzed for IL-6 using ELISA. In addition, performed a colorimetric test using the reagent HTT to demonstrate that the cells were viable after 24 h of incubation with only IL-17A, or IL-17A and inhibitor of IL-17A-binding polypeptides of the invention derived from Fyn SH3 or with IL-17A and IL-17R-Fc-Chimera. Only viable and metabolically active cells are able to recover the tetrazolium salt to HTT painted orange compounds of formazan (Scudiero, et al.(1988). Cancer Res. 48, p.4827-4833).

Methods

To remove endotoxins, these protein solutions were filtered three times through a membrane Acrodisc Mustang E (VWR). After filtration, the levels of endotoxins from protein solutions containing inhibitor of IL-17A-binding polypeptides of the invention derived from Fyn SH3 was less than 0.1 endotoxin units/ml as determined using a test with a lysate of amebocytes Limulus (Limulus amebocyte lysate, LAL) (PYROGENT Single test Gel Clot LAL Assay (Lonza)).

400 µl of the cell�: suspension, containing about 1×104normal skin fibroblasts (PromoCell, NHDF-c S), distributed per well (24-well plate, Nunc or TPP) and were cultured for 24 hours at 37°C (environment: the nutrient medium for the cultivation of fibroblasts With a-23010, Fibroblast Growth Medium C-23010, PromoCell). The supernatant was removed and after mixing various concentrations of IL-17A-binding polypeptides of the invention derived from Fyn SH3 or chimeric IL-17A receptor Fc (RnD Systems) with IL-17A (RnD Systems) containing medium (final concentration 50 ng/ml), was added 350 μl of the appropriate solution on the hole (the ratio of mixing between the inhibitor solution and IL-17A-containing medium was 1:3). As positive control, PBS was mixed with IL-17A containing medium ("no inhibitor"), in the ratio of 1:3 and as negative control, PBS was mixed only with medium (without IL-17A) in a ratio of 1:3. To determine the IL-6-production-dependent IL-17A, used a medium containing IL-17A (final concentration of IL-17A: 10, 25 and 50 ng/ml), and was mixed with PBS in a ratio of 3:1. After 24 hours of incubation at 37°C the supernatant was removed and the concentration of IL-6 were determined using ELISA according to the manufacturer's instructions (kit IL-6 ELISA, R&D Systems). Directly after removal of the supernatant was added HTT-containing environment (set for cell proliferation - Cell Proliferation Kit II, Roche) and determined gisnep�the capacity of the cells according to the manufacturer's instructions.

The percentage of inhibition of IL-17A was determined by the following formula:

Inhibition (%)=100-(A450-650 nm(sample)-A450-650 nm(neg.control)×100)(A450-650 nm(floor.control)-A450-650 nm(neg.control))

Results

Normal skin fibroblasts (NHDF) were incubated with IL-17A at different concentrations. Figure 4 (a) shows IL-17A dose-dependent induction of IL-6. At the next stage, NHDF cells were incubated with IL-17A (50 ng/ml) and various concentrations of the indicated IL-17A-binding polypeptides of the invention derived from Fyn SH3 or chimeric IL-17A receptor-Fc (Figure 4(b)). According to the observations, both clone 2C1 (SEQ ID NOD:107) and E4 (SEQ ID NO:57) inhibited IL-17A-induced production of IL-6 with a value of IC50about 1 nm and 6 nm, respectively. Chimera IL-17A receptor-Fc had the set value IC50500 PM (R&D Systems). In this experiment, it was obtained a value of about 1 nm. The analysis shows a representative result of three independent experiments. To further demonstrate that the inhibition of IL-6 production were the result of specific neutralization of IL-17A, cells were incubated with Fyn SH3 wt-domain (Grabulovski et al. (2007) JBC, 282, p.3196-3204) as a protein, not obl�giving binding specificity against IL-17A (Figure 4 (C)). As anticipated, did not observe inhibition of production of IL-6, whereas clone 2C1 (SEQ ID NOD:107) was able to inhibit IL-17A-induced production of IL-6. Figure 4(d) presents the analysis of HTT, confirming that all viable cells after incubation with IL-17A-binding polypeptides of the invention derived from Fyn SH3 (at a concentration of 750 nm) and IL-17 receptor (10 nm) for 24 hours.

Example 4. Stability

A key aspect of any biological compounds intended for therapeutic use, is its stability and resistance to aggregation when stored in solution. IL-17A-binding polypeptides of the invention derived from Fyn SH3, are particularly suitable medicines and diagnostic candidates, as they have confirmed the stability during storage at 4°C or at -20°C for at least 6 months in the sample, saline, phosphate buffered.

Methods

Protein solutions of IL-17A-binding polypeptides of the invention were stored for 6 months at 4°C and at -20°C after purification. For analysis of protein stability and state of aggregation, protein solutions were filtered (Millex GP, 0.22 µm, Millipore) and was carried out by gel-chromatography (SEC) on the system AKTA FPLC using a column of Superdex 75 Short (5/150) (GE Healthcare)

Results

Received OS�ove Fyn SH3Fyn IL-17A-binding polypeptide G3 (SEQ ID NO:34) was producyrovtsa with the release of expression 123 mg/l and elyuirovaniya mainly as a single peak from the gel chromatographic column (see Figure 5).

Stability and aggregational resistance G3 (SEQ ID NO:34) was evaluated by storing the protein at 4°C and -20°C in PBS. After 6 months determined the state of the protein by gel chromatography. Measurements did not show any signs of aggregation or degradation. The elution profiles after 6 months of storage is shown in Figure 6.

Example 5. The half-life in vivo

The half-life in vivo fused protein of the invention E4-Fc (SEQ ID NO:117) was determined by measuring concentrations of E4-Fc (SEQ ID NO:117) in murine serum at different time points after a single intravenous injection using ELISA.

Methods

Cloning and expression of E4-Fc (SEQ ID NO:117) described in Example 2. 200 μl of 3.3 μm (0,22 mg/ml) solution E4-Fc (SEQ ID NO:117) were injected intravenously 5 mice (C57BL/6, Charles River). After 7 minutes, 20 minutes, 1, 2, 4, 8, 24 and 48 h, approximately 20 μl of blood was collected from the saphenous vein using capillary Microvette CB 300 (Sarstedt). The blood samples were centrifuged for 10 min at 9500×g and the serum was stored at -20° until analysis by ELISA. Using dilution series E4-Fc (SEQ ID NO:117) with known concentrations were determined by the concentration of E4-Fc (SEQ ID NO:117) in serum using ELISA: 50 μl biotinylated IL-17A (30 nm) (R&D Systems, biotinylating using NHS-PEO4-Biotin (Pierce) according to manufacturer's instructions) was added to streptavidin-coated wells (Reactibind, Pierce) and after blocking with PBS, 4% m�Loco (Rapilait, Migros, Switzerland), was added 45 μl PBS, 4% milk and 5 μl of serum. After incubation for 1 h and washing, the binding of Fc-fusion proteins were detected using a conjugate of protein A-HRP (Sigma). Peroxidase activity was determined by adding the substrate QuantaRed enhanced chemifluorescent HRP (Pierce). Fluorescence intensity was measured after 5-10 min at a wavelength of 544 nm (excitation) and 590 nm (emission). From concentrations of E4-Fc (SEQ ID NO:117) identified in serum (n≥3 at the time, except for the last time: n=1) at different time points and the slope k of the elimination phase (plotted on semi-logarithmic scale), calculated the half-life of E4-Fc (SEQ ID NO:117), using the formula t1/2=ln2/k.

Results

The half-life of fused protein of the invention E4-Fc (SEQ ID NO:117), as calculated from the elimination phase (beta phase 4 the last time), was € 50.6 hours (see Figure 7).

Example 6. ELISA to determine binding specificity to IL-17A-binding polypeptides and fusion proteins

Methods

Protein-targeted IL-17F (R&D systems), mouse IL-17A (R&D Systems), TNF-alpha (Thermo Scientific), IL-6 (R&D Systems), bovine serum albumin (Sigma) and ovalbumin (Sigma) were coated tablet MaxiSorp (Nunc) overnight (100 μl of each target in a concentration of 5 μg/ml). The wells were washed three times with PBS and after blocking with 200 μl PBS, 4% milk (Raplait, Migros) and stage of washing with PBS (as above) to the wells was added 50 μl 2C1 (SEQ ID No:107) at final concentration of 50 nm with 50 µl of anti-myc antibody A (own production, with the optical density of the basic solution OD=2 and diluted 1:250 in PBS, 2% milk). After incubation the wells were washed three times with PBS and the wells were added 100 µl of anti-mouse-HRP-immunoconjugate (Sigma), diluted 1:1000 in PBS, 2% milk. 96-well plates were incubated for 1 h at room temperature (RT) and then washed three times with PBS, 0,1% Tween, followed a three-time washing with only PBS. Performed colorimetric detection by adding 100 µl of substrate VM blue POD (Roche) and the reaction was stopped with 60 μl of 1 M H2SO4.

Results

Clone 2C1 (SEQ ID No:107) binds IL-17A person is highly specific and does not cross react with any other proteins tested, as shown by ELISA (Figure 8). A small signal above background was observed for IL-17F, but if 2C1 used as a probe for IL-17F-coated BIAcore chip, detected binding was detected (data not shown).

Example 7. The polypeptide of the invention derived from Fyn SH3-specific and with high affinity binds IL-17A human and macaque.

Methods

(a) Specificity

To determine binding specificity to IL-17A-binding on�of peptides of the invention, used the following target proteins (more target proteins in comparison with Example 6):

- IL-17A (R &D Systems)

- IL-17B (Peprotech)

- IL-17C (R &D Systems)

- IL-17D (Peprotech)

- IL-17E (Peprotech)

- IL-17F (Abd Serotec)

- IL-17A mouse (R &D Systems)

- IL-17A rat (Akron Biotech)

- IL-17A dogs (R & D Systems)

- IL-17A macaques (macaca fascicularis) (own production, produced in E. coli, without the signal peptide, with C-terminal glycine residue with subsequent label hexa-his, denaturirovannyj from Taurus inclusion, SEQ ID NO:129)

- external domain In fibronectin (own production produced in E. coli; see Carnemolla et al. (1996) Int J Cancer, 68(3), p.397-405)

- IL-6 (R &D Systems)

- TNF alpha (Thermo Scientific)

- Ovalbumin (Sigma)

- BSA (bovine serum albumin, Sigma)

Protein targets were coated tablet MaxiSorp (Nunc) overnight (100 μl of each target at a concentration of 10 μg/ml). The wells were washed three times with PBS and after blocking with 200 μl PBS, 4% milk (Rapilait, Migros) for 1 hour at room temperature and a subsequent step of washing with PBS (as above) to the wells was added 50 μl of the polypeptide of the invention 2C1 (SEQ ID No:107), obtained on the basis of the Fyn SH3 in a final concentration of 80 nm with 50 µl of anti-myc antibody A (own production, with the optical density of the basic solution OD=2 and diluted 1:250 in PBS, 2 mol%�Ko). After incubation the wells were washed three times with PBS and the wells were added 100 µl of anti-mouse-HRP-immunoconjugate (Sigma), diluted 1:1000 in PBS, 2% milk. 96-well plates were incubated for 1 h at room temperature and then washed three times with PBS, 0,1% Tween, followed a three-time washing only PBS. Colorimetric detection was performed by adding 100 µl of substrate VM blue POD (Roche) and the reaction was stopped with 60 μl of 1 M H2SO4.

(b) measuring the affinity for IL-17A macaque

The affinity measurement was carried out using the device BIAcore 3000 (Biacore). To analyze the interaction between IL-17A macaques and a polypeptide of the invention 2C1 (SEQ ID NO:107), obtained on the basis of the Fyn SH3 CM 5 chip (Biacore) was coated 6900 resonance units of IL-17A macaques. A movable buffer was HBS-EP (Biacore). Interaction was measured at a flow rate of 20 µl/min and the injection of different concentrations of IL-17A-binding polypeptide of the invention 2C1 (SEQ ID NO:107), obtained on the basis of Fyn SH3. All kinetic data of the interaction (separate kon/'koff) was estimated using the software BIA evaluation 3.2RC1.

Results

The polypeptide of the invention 2C1 (SEQ ID No:107), obtained on the basis of the Fyn SH3 binds IL-17A humans and macaques is highly specific and does not cross react with any other proteins tested, as shown by ELISA (Figure 9).

AF�innosti Monomeric polypeptide of the invention 2C1 (SEQ ID NO:107), obtained on the basis of the Fyn SH3 for IL-17A macaques was measured using Biacore, using IL-17A macaques produced in E. coli (denaturirovannyj from Taurus inclusion). Found that the 2S1 binds IL-17A macaques with the equilibrium constant of dissociation (KD) 11 nm (Figure 10).

Example 8. The expression obtained on the basis of the Fyn SH3 polypeptides of the invention fused with the Fc-part and with a modified Fc part of IgG1 antibodies in mammalian cells.

The polypeptide of the invention 2C1 (SEQ ID NO:107), obtained on the basis of the Fyn SH3, was genetically fused with Fc-castio IgG1 (2C1-Fc, SEQ ID NO:130) and expressed in cells HEK EBNA. The polypeptide of the invention 2C1 (SEQ ID NO:107), obtained on the basis of the Fyn SH3 was also cloned slitm with modified Fc-part of human IgG1 containing the mutations L234A (alanine instead of leucine at amino acid position 234) and L235A and expressed in cells HEK EBNA (2C1-Fc(LALA), SEQ ID NO:131). In addition, there were produced the following four fused protein 2C1-Fc(LALA) with linkers of different lengths between the polypeptide of the invention derived from Fyn SH3 and Fc-part:

- (SEQ ID NO:132) "2C1-m5E-Fc(LALA)"; the elongation of the hinge region at the expense of 5 amino acids: EPKSS-linker

- (SEQ ID NO:133) "2C1-m5-Fc(LALA)"; lengthening to 5 amino acids, GGGGS-linker

- (SEQ ID NO:134) "2C1-m10-Fc(LALA)"; lengthening to 10 amino acids, GGGGS)2-linker

- (SEQ ID NO:135) "2C1-m15-Fc(LALA)"; elongation of 15 amino acids (GGGGS)3-linker

Methods

�onirovanie "2C1-Fc"; obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) were fused with the Fc-part of antibodies of human IgG1 (SEQ ID NO:130):

The gene encoding the clone 2C1 (SEQ ID NO:107), was used as template and was amplified using primers SB3 (5' CGA ATT CGG GAG TGA CAC TCT TTG TGG CCC 3', SEQ ID NO:136) and SB4 (5' GAA GAT TGG CTC GAG ATA TCA ACT GGA GCC-3', SEQ ID NO:137), introducing the restriction sites EcoRI and BglII. The obtained PCR product was digested with EcoRI and BglII and cloned into the pre-double-digested vector pFUSE-hIgG1-Fc2 (Invivogen), For cloning, this Fc-merge rser-vector (Invitrogen), the resulting vector pFUSE containing the gene encoding fused 2C1-Fc, was used as template and was amplified with primers SB5 (5' CCC AAG CTT GGG ATG GGC TAC AGG ATG CAA CTC CTG TC 3', SEQ ID NO:138) and SB6 (5' CGG GAT CCT CAT TTA CCC GGA GAC AGG GAG 3', SEQ ID NO:139), introducing the restriction sites HindIII and BamHI. After cleavage with HindIII/BamHI, and the insert was ligated twice with pre-cleaved vector rser, yielding the plasmid containing the genetic information of SEQ ID NO:130.

Cloning "2C1-Fc(LALA)": obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) were fused with a modified Fc-part of antibodies of human IgG1 (L234A, L235A) (receiving SEQ ID NO:131)

The above-mentioned plasmids containing genetic information 2C1-Fc (SEQ ID NO:130) was used as template for two PCR reactions. The first reaction used the primers SB5 and SB7 (5' ACT GAC GGT CCC CCC GCG GCT TCA GGT GCT GGG CAC-3', SEQ I NO:140). The second PCR used the primers SB8 (5' GCG GCC GGA GGG CCG TCA GTC TTC CTC TTC CC 3', SEQ ID NO:141) and SB6. Performed PCR Assembly with two fragments as matrices, the obtained PCR product was digested with BamHI and HindIII and was ligated with digested rser vector as described above.

Cloning "2C1-m5E-Fc(LALA)" (SEQ ID NO:132); obtained based on the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) was merged with EPKSS-lynxr of 5 amino acids with modified Fc-part of antibodies of human IgG1 (L234A, L235A)

The above-mentioned plasmids containing genetic information 2C1-Fc(LALA) (SEQ ID NO:131), was used as template for two PCR. The first reaction used the primers SB5 and "Ba_2C1_R_EPKSS" (5' GCT GCT TTT TTC CGG CTG GAT GTC AGA AAC AGC TGG CAC 3', SEQ ID NO:142). In the second reaction used the primers SB6 and "Ba_Hinge_F_EPKSS" (5' CCG GAA AAA AGC AGC GAC AAA ACT CAC ACA TGC CCA CCG 3', SEQ ID NO:143). Was carried out by PCR Assembly with both fragments as matrices, the obtained PCR product was digested with BamHI and HindIII and was ligated with digested rser vector as described above.

Cloning "2C1-m5-Fc(LALA)" (SEQ ID NO:133): obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) was merged with GGGGS-linker of 5 amino acids with modified Fc-part of antibodies of human IgG1 (L234A, L235A)

The above-mentioned plasmids containing genetic information 2C1-Fc(LALA) (SEQ ID NO:131), was used as template for two PCR. At first the reaction� used the primers SB5 and 47c.fo (5' - TGA ACC GCC TCC ACC CTG GAT GTC AGA AAC AGC TGG CAC 3', SEQ ID NO:144). In the second reaction used the primers SB6 and "Ba_Hinge_F_5aaGS-linker" (5' GGT GGA GGC GGT TCA GAC AAA ACT CAC ACA TGC CCA CCG 3', SEQ ID NO:145). Was carried out by PCR Assembly with both fragments as matrices, the obtained PCR product was digested with BamHI and HindIII and was ligated with digested rser vector as described above.

Cloning "2C1-m10-Fc(LALA)" (SEQ ID NO:134): obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) were fused using a linker of 10 amino acids (GGGGS)z with modified Fc-part of antibodies of human IgG1 (L234A, L235A)

The above-mentioned plasmids containing genetic information 2C1-Fc(LALA) (SEQ ID NO:131), was used as template for two PCR. The first reaction used the primers SB5 and 47b.fo (5' AGA GCC ACC TCC GCC TGA ACC GCC TCC ACC CTG GAT GTC AGA AAC AGC TGG CAC 3', SEQ ID NO:146). In the second reaction used the primers SB6 and "Ba_Hinge_F_10aaGS-linker" (5' GGT GGA GGC GGT TCA GGC GGA GGT GGC TCT GAC AAA ACT CAC ACA TGC CCA CCG 3', SEQ ID NO:147). Was carried out by PCR Assembly with both fragments as matrices, the obtained PCR product was digested with BamHI and HindIII and was ligated with digested rser vector as described above.

Cloning "2C1-m15-Fc(LALA)" (SEQ ID NO:135); obtained based on the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) were fused using a linker of 15 amino acids (GGGGS)3 with a modified Fc-part of antibodies of human IgG1 (L234A, L235A)

The above-mentioned plasmids containing genetic information 2C1-Fc(LALA) (SEQ ID NO:13), used as template for two PCR. The first reaction used the primers SB5 and 47.fo.corr (5' - TGA TCC GCC ACC GCC AGA GCC ACC TCC GCC TGA ACC GCC TCC ACC CTG GAT GTC AGA AAC AGC TGG CAC 3', SEQ ID NO:148). In the second reaction used the primers SB6 and "Ba_Hinge_F_15aaGS-linker" (5' GGT GGA GGC GGT TCA GGC GGA GGT GGC TCT GGC GGT GGC GGA TCA GAC AAA ACT CAC ACA TGC CCA CCG 3', SEQ ID NO:149). Was carried out by PCR Assembly with both fragments as matrices, the obtained PCR product was digested with BamHI and HindIII and was ligated with digested rser vector as described above.

For expression of fusion proteins, the corresponding plasmids were purified using a set that does not contain endotoxin, Megaprep (Qiagen), and used for temporary transfection HEK EBNA cells (ATSS No CRL-10852). HEK EBNA cells were sown at 30% of confluently 24 hours before transfection. The medium was replaced by DMEM/5% FCS/penstrep (Invitrogen) immediately prior to transfection. 60 μg of DNA was used for transfection of 150 cm2adhesive cells. DNA and PEI (25 kDa from Polysciences) were mixed in a ratio of 1:3 and stirred on a vortex for 10 sec. Then, a mixture of DNA/PEI incubated at RT for 10 minutes and then added to HEK EBNA cells. After 24 hours the medium was replaced with CD-CHO/HT/L-glutamine/Penstrep (Invitrogen) and incubated at 37°C with 5% CO2. After 96 hours collecting the supernatant of the cell culture.

For protein purification, cell culture supernatant was used in the affinity column of protein A-seph�rose. Then, the column was washed with PBS, followed by protein elution using 0.1 M glycine, pH of 2.7. Then-eluted protein is dialyzed in PBS. If necessary, carried out the second purification step for the removal of endotoxins using Triton-X114 (Magalhaes et al. (2007) J Pharm Pharmaceut Sci, 10(3), p.388-404).

Results

Derivatives Fyn SH3 fused with the Fc according to the invention can be expressed and purified. Figure 11 shows the analysis of SDS-PAGE of Fc-fusion proteins.

Example 9. The polypeptides of the invention derived from Fyn SH3 stable in human serum

Protein drug must be stable in serum for a certain period of time in order to be able to cause pharmacodynamic effects in patients. In this example, tested the serum stability 2C1-Fc (SEQ ID NO:130).

Methods

Solution was prepared from 3 ml human serum (Sigma) containing 10 µg/ml 2C1-Fc (SEQ ID NO:130) and placed in an incubator at 37°C, 200 µl of the sample were selected at a certain time point and frozen at -20°C until the end of the experiment. After 5 days, was carried out by ELISA with samples collected using 2S1-Fc-sample (SEQ ID NO:130), which was stored at 4°C in PBS as a control standard.

For the implementation of the ELISA, IL-17A (R&D Systems) was coated on the tablet MaxiSorp (Nunc) overnight (100 μl of 5 μg/ml). The wells were washed three times with PBS and after interlock� 200 µl PBS, 4% milk (Rapilait, Migros) and stage wash of PBS (as above), add 100 ál of test samples containing 2C1-Fc (SEQ ID NO:130) (at the indicated concentrations), diluted in PBS, 2% milk. After incubation, the wells were washed three times with PBS, followed by the addition of 100 µl Protein A-HRP (Sigma) diluted 1:1000 in PBS, 2% milk. 96-well plates were incubated for 1 h at RT and then washed three times with PBS, 0,1% Tween, followed a three-laundering only PBS. Colorimetric detection was performed by adding 100 µl of substrate VM blue POD (Roche) and the reaction was stopped with 60 μl of 1 M H2SO4.

Results

After 5-day storage period in human serum at 37°C 2C1-Fc (SEQ ID NO:130) was able to bind its target IL-17A, essentially also as 2C1-Fc (SEQ ID NO:130), which were stored in PBS at 4°C, which shows that 2C1-Fc (SEQ ID NO:130) is stable in human serum at 37°C (Figure 12).

Example 10. The polypeptides of the invention derived from Fyn SH3, inhibit IL-17A in vitro

This analysis indicated polypeptides of the invention derived from Fyn SH3, were tested for their ability to inhibit IL-17A in vitro. Cellular analysis of the same cell analysis described in Example 3 of this invention, except that IL-17A was used at a lower concentration of 1 ng/ml (compared with 50 ng/ml in Example 3) with NF alpha (50 ng/ml).

Methods

The levels of endotoxin tested IL-17A-binding polypeptides of the invention derived from Fyn SH3 was less than 0.1 endotoxin units/ml as determined using a test with a lysate of amebocytes Limulus (LAL PYROGENT Single test Gel Clot LAL Assay (Lonza)).

Normal skin fibroblasts (NHDF, PromoCell Inc., NHDF-c S) was used for cell analysis of inhibition of IL-17A. The addition of IL-17A (R&D Systems) in combination with tumor necrosis factor-α (TNF-α, Thermo Fisher Scientific) to the cell culture medium induces the production of IL-6 in NHDF cells dose-dependent manner. IL-6 released into the cell culture medium (PromoCell, C-23010), were quantitatively determined in the supernatant of cell cultures using ELISA, using a commercially available ELISA kit (R&D Systems, DuoSet ELISA System kit (DY206)).

104normal skin fibroblasts (PromoCell, NHDF-c S) was distributed per well (24-well plate, Nunc or RTR) and were cultured for 24 hours at 37°C (environment: Fibroblast Growth Medium C-23010, PromoCell). The supernatant was removed and after mixing various concentrations of IL-17A-binding polypeptides of the invention derived from Fyn SH3, or Chimera of IL-17A receptor-Fc (RnD Systems) with IL-17A (RnD Systems) and TNF-alpha (Thermo Scientific) containing medium (1 ng/ml final IL-17A concentration and 50 ng/ml TNF-alpha), was added 350 μl of the appropriate solution per well, three times (zootoxin�e mixing between the inhibitor solution and cytokine-containing medium was 1:23). Control wells consisted of incubation without polypeptides derived from Fyn SH3 (PBS only), one of IL-17A, one TNF-α and only Wednesday. After 24 hours of incubation at 37°C the supernatant was removed and the ELISA-absorption (dependent on IL-6 concentrations were determined using ELISA according to the manufacturer's instructions (IL-6 ELISA kit, R&D Systems).

Results

NHDF cells were incubated with a constant concentration of IL-17A (1 ng/ml) and TNF-alpha (50 ng/ml) and various concentrations of commercially available Chimera IL-17A receptor-Fc - or with various concentrations of the following polypeptides of the invention derived from Fyn SH3:

- 2C1 (SEQ ID NO:107)

- 2C1-Fc (SEQ ID NO:130)

- 2C1-Fc(LALA) (SEQ ID NO:131)

- 2C1-m5E-Fc(LALA) (SEQ ID NO:132)

- 2C1-m5-Fc(LALA) (SEQ ID NO:133)

- 2C1-m10-Fc(LALA) (SEQ ID NO:134)

- 2C1-m15-Fc(LALA) (SEQ ID NO:135)

Table III shows the average values of IC50derived from several cellular assays, carried out with the indicated polypeptides of the invention derived from Fyn SH3. Best value IC50(0,11 nm) was obtained 2C1-m15-Fc(LALA) (SEQ ID NO:135).

Table III
Average values of IC50derived from several cellular assays for polypeptides of the invention derived from Fyn SH3
IC50-value (nm)Standard deviationThe number of cell assays
2C1 (SEQ ID NO:107)2,310,083
2C1-Fc (SEQ ID NO:130)1,130,34
2C1-Fc(LALA) (SEQ ID NO:131)1,090,534
2C1-m5E-Fc(LALA) (SEQ ID NO:132)0,720,34
2C1-m5-Fc(LALA) (SEQ ID NO:133)1,45n.d.2
2C1-m10-Fc(LALA) (SEQ ID NO:134)0,270,136
2C1-m15-Fc(LALA) (SEQ ID NO:135)0,110,023
Chimera IL-17A Receptor-Fc (R&D Systems)0,610,386

Example 11. The half-life of 2C1-Fc(LALA) in vivo (SEQ ID NO:131)

The half-life in vivo CL�that the protein of the invention 2C1-Fc(LALA) (SEQ ID NO:

131) was determined by measuring concentrations 2C1-Fc(LALA) (SEQ ID NO:131) in murine serum at different time points after a single intravenous injection.

Methods

The solution 2C1-Fc(LALA) (SEQ ID NO:131) (0.2 mg/ml) were injected intravenously 5 mice (C57BL/6, Charles River), 200 μl per mouse. After certain time points were taken approximately 20 μl of blood from the saphenous vein using capillary Microvette CB 300 (Sarstedt). The blood samples were centrifuged for 10 min at 9500×g and the serum was stored at -20° until analysis by ELISA. Using dilution series 2C1-Fc(LALA) (SEQ ID NO:131) with known concentrations, determined the concentration 2C1-Fc(LALA) (SEQ ID NO:131) in serum using ELISA: 50 μl biotinylated IL-17A (30 nm) (R&D Systems, is biotinylated using NHS-PEO4-Biotin (Pierce) according to manufacturer's instructions) was added to streptavidin-coated wells (Reactibind, Pierce) and after blocking with PBS, 4% milk (Rapilait, Migros, Switzerland), was added 45 μl PBS, 4% milk and 5 ál of serum sample. After incubation for 1 h and washing, the binding of Fc-fusion proteins were detected using a conjugate of protein A-HRP (Sigma). Peroxidase activity was detected by adding substrate QuantaRed enhanced chemifluorescent HRP (Pierce). The intensity of fluorescence was measured after 5-10 min at a wavelength of 544 nm (excitation) and 590 (emission). From concentrations 2C1-Fc(LALA) (SEQ ID NO:131) defined in the serum (the number of the bat� n=5 per time point) at different time points and the slope k of the elimination phase (plotted on a semilog scale), calculated the half-life of 2C1-Fc(LALA) (SEQ ID NO:131), using the formula t1/2=ln2/k.

Results

The half-life of fused protein of the invention 2C1-Fc(LALA) (SEQ ID NO:131), as computed from the elimination phase (beta phase 4 the last time, was 53 hours (see Figure 13).

Example 12. The polypeptides of the invention derived from Fyn SH3, neutralize IL-17A human in vivo

IL-17A human is able to bind and stimulate the mouse IL-17 receptor, resulting in an increase and subsequent secretion of murine chemokine KC (CXCL1) (Allan V. et al. (2007) WO2007/070750, Eli Lilly, US). Observed levels of KC 2 hours after subcutaneous injection of IL-17A (3 µg) was between 500 and 1000 PG/ml in serum, compared to about 100 PG/ml main level KC.

Methods

(a) In vivo neutralization of IL-17A using a Monomeric polypeptide of the invention 2C1 (SEQ ID NO:107), obtained on the basis of the Fyn SH3

Obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) (17 μg) was injected into mice of the line C57BL/6 (subcutaneously) together with 3 μg of IL-17A (R&D Systems), and 2 hours after injection were collected blood samples from the saphenous vein using capillary Microvette CB 300 (Sarstedt). The blood samples were centrifuged for 10 min at 9500×g and the serum was stored at -20°C until analysis by ELISA. The KC levels in serum were determined using commercially available kit Quantikine mouse CLCL1/KC (R&D Systems). The control group incl�whether mice the injected IL-17A and the domain of the Fyn SH3 wt (see, Grabulovski et al. (2007) JBC, 282, p.3196-3204) as a protein with a different binding specificity, PBS only, only IL-17A, only obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107) or to mice given only protein Fyn SH3 wt.

(b) In vivo neutralization with the merged 2C1-Fc (SEQ ID NO:130):

Obtained on the basis of the Fyn SH3 polypeptide of the invention 2C1-Fc (SEQ ID NO:130) (44 μg/mouse) were injected intravenously to mice of the line C57BL/6. Within 20-60 minutes were injected subcutaneously with IL-17A (R&D Systems) at a rate of 3 μg/mouse, and 2 hours after injection of IL-17A were taken blood samples from the saphenous vein using capillary Microvette CB 300 (Sarstedt). The blood samples were centrifuged for 10 min at 9500×g and the serum was stored at -20°C until analysis by ELISA. The KC levels in serum were determined using commercially available kit Quantikine mouse CLCL1/KC (R&D Systems). Control groups included mice, PBS injected (intravenously) and IL-17A (subcutaneously), only PBS (intravenous and subcutaneous), and are based on Fyn SH3 polypeptide of the invention 2C1-Fc (SEQ ID NO:130) intravenously followed by administration of PBS (subcutaneously).

Results

After subcutaneous injection of IL-17A human animals mice were sverkhekspressiya the chemokine called KC. Elevated levels of KC in serum of mice can be measured using ELISA. Injection of the polypeptide derivatives of Fyn SH3 according to the invention ol�Datasheet KC activation.

(a) mice (C57BL/6) were injected subcutaneously IL-17A together with the Monomeric polypeptide 2C1 derived from Fyn SH3 (SEQ ID NO:107). Due to the inhibitory properties derived from Fyn SH3 polypeptide of the invention 2C1 (SEQ ID NO:107), the levels of the COP is not increased in this group, they remained low, almost comparable to the main levels. To demonstrate that inhibition of KC products is accomplished through the specific IL-17A-neutralizing, the mice were injected jointly IL-17A and Fyn SH3-domain of wild-type (which has no binding affinity to IL-17A); in these mice, the levels of KC were as high as in the group that received only IL-17A. Figure 14 shows the results obtained from this experiment.

(b) In the second experiment, acute inflammation derived from Fyn SH3 polypeptide of the invention 2C1-Fc (SEQ ID NO:130) were injected intravenously, followed by subcutaneous injection of IL-17A. As indicated above in a), a polypeptide derived Fyn SH3 invention prevents an increase in KC levels in serum. Figure 15 shows the inhibition of IL-17A through 2C1-Fc (SEQ ID NO:130) in vivo.

1. The polypeptide containing the amino acid sequence, which is selected from the group consisting of:
(i) SEQ ID NO: 39, 57 or 107
(ii) the amino acid sequence having at least 80%, preferably at least 90%, more preferably, less� least 95% amino acid sequence identity with (i);
(iii) the fragment or functional derivative (i) obtained by substitution, addition and/or deletion of not more than 5 amino acids,
where the specified polypeptide binds to IL-17A and where, optionally, the polypeptide is MultiTerm.

2. The polypeptide according to claim 1, having a specific binding affinity to IL-17A person, preferably with KDfrom 10-7up to 10-12M, more preferably from 10-8up to 10-12M, most preferably less than 10-12M.

3. The polypeptide according to claim 1, which is selected from the group consisting of SEQ ID NO: 1-119, or their functional derivatives.

4. The polypeptide according to claim 2 which is selected from the group consisting of SEQ ID NO: 1 -119 or their functional derivatives.

5. Protein for use in pharmaceuticals and diagnostics containing the polypeptide according to any of claims. 1-4, merged with pharmaceutically and/or diagnostically active component, where, optionally, the polypeptide is MultiTerm.

6. A protein according to claim 5, in which the specified component is a cytokine, which is preferably selected from the group consisting of IL-2, IL-12, TNF-alpha, IFN alpha, IFN-beta, IFN-gamma, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, 70, TNF-beta, LT-beta, CD-40 ligand, Fas-ligand, TGF-beta, IL-1-alpha, 1b-beta.

7. A protein according to claim 5, in which� the specified component is a toxic compound, preferably low molecular weight organic compound or polypeptide, more preferably toxic compound selected from the group consisting of calicheamicin, maytansinoid, neocarzinostatin, espiramicina, dynemicin, cedarcide, naturopatia, doxorubicin, daunorubicin, auristatin, A-chain of ricin, modeccin, the truncated exotoxin A of Pseudomonas, diphtheria toxin and recombinant gelonin.

8. A protein according to claim 5, in which the specified component is a chemokine, which is preferably selected from the group consisting of IL-8, GRO-alpha, GRO-beta, GRO-γ, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1 alpha/beta, BUNZO/STRC33, I-TAC, BLC/BCA-1, MIP-1-alpha, MIP-1-beta, MDC, TASK, TARC, RANTES, NCC-1, NCC-4, DC-CK1, MIP-3-alpha, MIP-3-beta, MCP-1-5, eotaxin, eotaxin-2,1-309, MPIF-1, 6Ckine, STACK, MONTHS, lymphotactin and fractalkine.

9. A protein according to claim 5, in which the specified component is a fluorescent dye, preferably a component selected from dyes Alexa Fluor or su.

10. A protein according to claim 5, in which the specified component is a photosensitizer, preferably phototoxic red fluorescent protein KillerRed or hematoporphyrin.

11. A protein according to claim 5, in which the specified component drug test etc is a factor, preferably the tissue factor.

12. A protein according to claim 5, in which the specified component is fer�UNT to activate the prodrug, moreover, the enzyme is preferably selected from the group consisting of carboxypeptidases, glucuronides and glycosides.

13. A protein according to claim 5, in which the specified component is radionucleid or from the group of gamma-emitting isotopes, preferably99mTc,123I,111In or from the group of positron emitters, preferably18F,64Cu,68Ga86Y124I or from the group of beta-emitters, preferably131I,90Y177Lu,67Cu, or from the group of alpha-emitters, preferably213Bi211At.

14. A protein according to claim 5, in which the specified component is a functional Fc domain, preferably a functional Fc domain of a human, more preferably containing multimeric, preferably dimeric polypeptides from any PP. 1-4.

15. Polypeptide that binds to IL-17A containing the polypeptide according to any one of items 1 to 4 and component, modulating the half-life in serum, preferably a component selected from the group consisting of polyethylene glycol (PEG), immunoglobulin and albuminaemia peptides.

16. Protein for use in pharmaceuticals and diagnostics containing the protein according to any one of claims. 5-14 component and modulating the half-life in serum, preferably a component selected from the group consisting of poly�of etilenglikola (PEG), immunoglobulin and albuminaemia peptides.

17. Protein for use in pharmaceuticals and diagnostics containing the polypeptide, which is selected from the group consisting of SEQ ID NO: 1-116 or their functional derivatives and pharmaceutically and/or diagnostically active component selected from cytokines, such as IL-2, IL-12, TNF-alpha, IFN-alpha, IFN-beta, IFN-gamma, IL-10, IL-15, IL-24, GM-CSF, IL-3, IL-4, IL-5, IL-6, IL-7, IL-9, IL-11, IL-13, LIF, CD80, 70, TNF-beta, LT-beta, CD-40-ligand, Fas-ligand, TGF-beta, IL-1-alpha and IL-1-beta, toxic compounds, preferably low molecular weight organic compounds or polypeptides, preferably selected from the group consisting of calicheamicin, maytansinoid, neocarzinostatin, espiramicina, dynemicin, cedarcide, naturopatia, doxorubicin, daunorubicin, auristatin, A-chain of ricin, modeccin, the truncated exotoxin A of Pseudomonas, diphtheria toxin and recombinant gelonin; chemokines, which are preferably selected from the group consisting of IL-8, GRO-alpha, GRO-beta, GRO-γ, ENA-78, LDGF-PBP, GCP-2, PF4, Mig, IP-10, SDF-1 alpha/beta, BUNZO/STRC33, I-TAC, BLC/BCA-1, MIP-1 alpha, MIP-1 beta, MDC, TASK, TARC, RANTES, NCC-1, NCC-4, DC-CK1, MIP-3-alpha, MIP-3-beta, MCP-1-5, eotaxin, eotaxin-2, 1-309, MPIF-1, 6Ckine, STACK, MONTHS, lymphotactin and fractalkine; fluorescent dyes, preferably from the group of Alexa Fluor or dyes su; photosensitizers, preferably foot�sichnego red fluorescent protein KillerRed or hematoporphyrin; drug test etc factor, preferably the tissue factor; enzyme for prodrug activation, preferably selected from the group consisting of carboxypeptidases, glucuronides and glycosides; radionuclides, or from the group of gamma-emitting isotopes,
preferably99mTc,123I,111In or from the group of positron emitters, preferably18F,64Cu,68Ga86Y124I or from the group of beta-emitters, preferably131I,90Y177Lu,67Cu, or from the group of alpha-emitters, preferably213Bi211At; functional Fc domain, preferably one or more functional Fc domains of a person.

18. A protein according to claim 17 which is selected from the group consisting of SEQ ID nos: 117-119.

19. The polypeptide according to any of claims. 1 - 4,15 or fused protein according to any one of claims. 5-14, 16-18, containing dimer or trimer of polypeptide according to any of claims. 1-4.

20. Isolated and purified nucleic acid that encodes a polypeptide that binds IL-17A containing nucleic acid encoding the polypeptide according to claims. 1-4, 15 or 19.

21. A nucleic acid according to claim 20, in which a specified nucleic acid is a DNA, NCP or RNA.

22. Nucleic acid that encodes a protein according to any one of claims. 5-14, 16-19.

23. A nucleic acid according to claim 22, in which a specified nucleic �islote is a DNA NCP or RNA.

24. A nucleic acid according to any one of claims. 20-23, in which a specified nucleic acid is functionally linked to a promoter, preferably linked to a promoter which is selected from the group of prokaryotic promoters, consisting of item T5-promoter/1 ░ -operator element T7-promoter/1 ░ -operator, or from the group of eukaryotic promoters, consisting of hEFl-HTLV, CMV enh/hFerL-promoter.

25. A recombinant vector for the production of polypeptides or fusion proteins according to any one of claims. 1-19 containing nucleic acid according to any one of claims. 20-24, in which the vector is preferably capable of producing a polypeptide or protein according to any one of claims. 1-19.

26. Recombinant vector according to claim 25 which is selected from the group consisting of pQE vectors, pet vectors pFUSE vectors, pUC vectors, YAC vectors, fahmideh vectors, phage vectors, vectors used in gene therapy, such as retroviruses, adenoviruses, adeno-associated viruses.

27. A host for the production of polypeptides or fusion proteins according to any one of claims. 1-19 containing nucleic acid and/or a vector according to any one of the above paragraphs.

28. Pharmaceutical composition for the treatment of IL-17A - and/or Th17-associated diseases or medical conditions that contains a polypeptide or a protein according to any one of claims. 1 to 19 in an effective amount.

29. The use �of polypeptide according to any one of claims. 1-4, 15 or 19 for the preparation of medicines, preferably for the treatment or prophylaxis of a disease or medical condition which is selected from the group consisting of IL-17A and Th17 - associated diseases or medical conditions.

30. The use of fused protein according to any one of claims. 5-14, 16-19 for the preparation of medicines, preferably for the treatment or prophylaxis of a disease or medical condition which is selected from the group consisting of IL-17A and Th17 - associated diseases or medical conditions.

31. The use according to any one of claims. 29-30, in which the disease or medical condition is selected from inflammatory, autoimmune and/or associated with bone loss diseases and medical conditions.

32. The use according to any one of claims. 29-30, in which the disease or medical condition selected from the group consisting of arthritis, preferably rheumatoid arthritis, chronic progressive arthritis, reactive arthritis, psoriatic arthritis, enteropathic arthritis and deforming arthritis, rheumatic diseases, spondyloarthropathies, ankylosing spondylitis, Reiter's disease, hypersensitivity (including both respiratory hypersensitivity and dermal hypersensitivity) and allergies, systemic lupus erythematosus, inflammatory lesions �ysz, polychondritis, sclerodoma, granulomatosis granulomatosis, dermatomyositis, syndrome Stevens-Johnson, chronic active hepatitis, myasthenia gravis, psoriasis, idiopathic sprue, autoimmune inflammatory bowel disease, ulcerative colitis, Crohn's disease, irritable bowel syndrome, endocrine ophthalmopathy, graves ' disease, sarcoidosis, ischemia, systemic sclerosis, multiple sclerosis, primary biliary cirrhosis, juvenile diabetes (diabetes mellitus type I), autoimmune hematologic lesions, hemolytic anemia, aplastic anemia, congenital aplastic anemia, idiopathic thrombocytopenia, uveitis (anterior and posterior), dry keratoconjunctivitis, vernal keratoconjunctivitis, interstitial lung fibrosis, glomerulonephritis (with and without nephrotic syndrome), idiopathic nephrotic syndrome or minimal change nephropathy, tumors, inflammatory diseases of the skin, inflammation of the cornea, myositis, loosening of bone implants, metabolic disorders, atherosclerosis, diabetes, and dyslipidemia, bone loss, osteoarthritis, osteoporosis, periodontitis, obstructive or inflammatory airway diseases, asthma, bronchitis, pneumoconiosis, emphysema, acute and sharp will vocalic�found reactions diseases, pathogenesis of which is involved 1b-17A-mediated TNF-alpha, acute infections, septicemia, septic shock, endotoksicski shock, syndrome of respiratory disorders in adults, meningitis, pneumonia, severe burns, cachexia, syndrome of exhaustion, stroke, herpes stromal keratitis keratitis and dry.

33. The use according to claim 31, wherein the disease or medical condition selected from the group consisting of arthritis, preferably rheumatoid arthritis, chronic progressive arthritis, reactive arthritis, psoriatic arthritis, enteropathic arthritis and deforming arthritis, rheumatic diseases, spondyloarthropathies, ankylosing spondylitis, Reiter's disease, hypersensitivity (including both respiratory hypersensitivity and dermal hypersensitivity) and allergies, systemic lupus erythematosus, inflammatory lesions of muscles, polychondritis, sclerodoma, granulomatosis granulomatosis, dermatomyositis, syndrome Stevens-Johnson, chronic active hepatitis, myasthenia gravis, psoriasis, idiopathic sprue, autoimmune inflammatory bowel disease, ulcerative colitis, Crohn's disease, irritable bowel syndrome, endocrine ophthalmopathy, graves ' disease, sarcoidosis, ischemia, systemic sclerosis, type SC�of Arosa, primary biliary cirrhosis, juvenile diabetes (diabetes mellitus type I), autoimmune hematologic lesions, hemolytic anemia, aplastic anemia, congenital aplastic anemia, idiopathic thrombocytopenia, uveitis (anterior and posterior), dry keratoconjunctivitis, vernal keratoconjunctivitis, interstitial lung fibrosis, glomerulonephritis (with and without nephrotic syndrome), idiopathic nephrotic syndrome or minimal change nephropathy, tumors, inflammatory diseases of the skin, inflammation of the cornea, myositis, loosening of bone implants, metabolic disorders, atherosclerosis, diabetes, and dyslipidemia, bone loss, osteoarthritis, osteoporosis, periodontitis, obstructive or inflammatory airway diseases, asthma, bronchitis, pneumoconiosis, emphysema, acute and sharp inflammatory reactions, diseases, pathogenesis of which is involved 1b-17A-mediated TNF-alpha, acute infections, septicemia, septic shock, endotoksicski shock, syndrome of respiratory disorders in adults, meningitis, pneumonia, severe burns, cachexia, syndrome of exhaustion, stroke, herpes stromal keratitis keratitis and dry.



 

Same patents:

FIELD: biotechnology.

SUBSTANCE: monoclonal antibody against human interleukin-6 is represented, which comprises hypervariable regions of the heavy chain CDRH-1: GFSLSTSGMGVG; CDRH-2: HIWWDDDKYYNPSLKS; and CDRH-3: RANYGTSYDYGMDY; and the hypervariable regions of the light chain CDRs CDRL-1: KASQSVSDVLT; CDRL-2: YASNRYT; and CDRL-3: QQGYRSPYT. In addition, the invention also relates to a hybridoma strain deposited in the Russian Collection of Cell Cultures under number RKKK(P) 751D, and producing the said antibody.

EFFECT: invention enables to expand the range of antibodies against human IL-6, having high ability to inhibit IL-6.

4 cl, 3 dwg, 2 tbl, 4 ex

FIELD: biotechnology.

SUBSTANCE: strain of permanent hybridoma cell line of mouse Mus.musculus is proposed. The present invention can find application as "capturing" and detecting antibodies in enzyme immunodetection during diagnosing equine influenza.

EFFECT: monoclonal antibodies produced by the strain are specific to the surface glycoprotein H3 of equine influenza virus H3N8 and have no cross-reactivity relating to antigens of equine influenza virus of 1 subtype of H7N7.

4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to biochemistry, in particular to a monoclonal human antibody, specific to alpha-toxin of S. aureus. The claimed invention additionally relates to pharmaceutical compositions for treatment of prevention of the abscess formation in an organ, which contains at least one antibody or one nucleic acid, which codes the said antibody.

EFFECT: invention makes it possible to extend an assortment of antibodies, specific to alpha-toxin of S aureus.

23 cl, 7 dwg, 4 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: invention is a strain of cultured hybrid cells of animal Mus musculus L. CCHFV Vd-3 deposited in the State collection of pathogenic microorganisms and cell cultures "SCPM-OBOLENSK" under number H-27, which is a producer of monoclonal antibody 3H6/F2 to virus of Crimean Congo haemorrhagic fever (CCHF), is suitable for manufacture on its base of one of the components of a set of reagents for immunoenzymometric detection of antigens of CCHF virus in samples of biological material.

EFFECT: invention enables to obtain highly specific monoclonal antibodies suitable for use as one of the components of the set of reagents for immunoenzymometric detection of antigens of CCHF virus.

1 tbl, 3 ex

FIELD: biotechnology.

SUBSTANCE: invention is a strain of cultured hybrid cells of animal Mus musculus L. CCHFV Vd-2 deposited in the State collection of pathogenic microorganisms and cell cultures "SCPM-OBOLENSK" under number H-26, which is a producer of monoclonal antibody 1E2/E5 to virus of Crimean Congo haemorrhagic fever (CCHF), suitable for the manufacture on its base of one of the components of the set of reagents for immunoenzymometric detection of antigens of CCHF virus in samples of biological material.

EFFECT: invention enables to obtain highly specific monoclonal antibodies suitable for use as one of the components of the set of reagents for immunoenzymometric detection of antigens of CCHF virus.

1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: present invention refers to biotechnology and medicine. What is presented is a method for generating an antibody and its functional fragments against a tumour antigen expressed on the tumour surface resistant to at least one anti-tumour compound by applying ground homogenate, and/or suspension, and/or cell lysate originated from the same tumour for immunisation. There are also disclosed using the method according to the invention for producing the monoclonal antibodies and their functional fragments, the monoclonal antibodies produced by the method, nucleic acids coding them, an expression vector, a host cell, and a method for preparing the antibody with using them, as well as hybridomes secreting these antibodies and their functional fragments for preparing a drug, the anti-tumour composition and using it as a drug.

EFFECT: invention can find further application in therapy of resistant tumours.

42 cl, 7 dwg, 4 ex, 6 tbl

FIELD: biotechnologies.

SUBSTANCE: chimeric monoclonal antibody is described, which specifically connects to human erythropoietin, characterised by the following criteria: a) Kd=2.4×10-9 M, isoelectric point in the range pH 7.5-8.0; b) sequence of the heavy chain SEQ ID NO:12; c) sequence of the light chain SEQ ID NO:14. A mouse hybridome strain is proposed, which is a producent of a monoclonal antibody to human erythropoietin, deposited in the Russian Academy of Agricultural Sciences, Specialised Collection of Cell Cultures of Farm and Game Animals under the No.84. Also a mouse anticlonal antibody is described, which specifically connects to human erythropoietin, produced by the specified hybridome and characterised by the following criteria: a) Kd=0.95×10-9 M, molecular weight = 160 kD, isopoint in the range pH 6.8-7.1; b) sequence of variable area of light chain SEQ ID NO:1; c) sequence of variable area of heavy chain SEQ ID NO:2; d) sequence of areas that define antibody complementarity: CDRH-1 - SEQ ID NO:5, CDRH-2 - SEQ ID NO:6, CDRH-3 - SEQ ID NO:7, CDRL-1 - SEQ ID NO:8, CDRL-2 - SEQ ID NO:9, CDRL-3 - SEQ ID NO:10.

EFFECT: invention makes it possible to expand arsenal of mouse antibodies against human erythropoietin.

3 cl, 3 dwg, 5 ex, 2 tbl

FIELD: biotechnologies.

SUBSTANCE: two antibodies against IL-21 of a human being are presented. The first antibody includes a variable region of a heavy chain, which includes SEQ ID NO: 31, 33 and 35, and a variable region of a light chain, which includes SEQ ID NO: 39, 41 and 43. The second antibody includes a variable region of heavy chain, which includes SEQ ID NO: 47, 49 and 51, and variable region of light chain, which includes SEQ ID NO: 55, 57 and 59. Besides, the invention describes hybridomes producing the first and the second antibodies against IL-21 of a human being and deposited in the collection of cultures "American Type Culture Collection" and have numbers "ATCC Patent Deposit Designation PTA-8790" and "ATCC Patent Deposit Designation PTA-8786" respectively.

EFFECT: invention allows obtaining antibodies to IL-21 of a human being.

48 cl, 4 dwg, 16 tbl, 23 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: this invention relates to biotechnology and immunology. One proposes: JAM-A protein antibody or functional fragment thereof, hybridoma secreting such antibody, nucleic acid, expression vector and host cell as well as a method for the antibody and composition production. One considers application of the JAM-A protein antibody or functional fragment thereof.

EFFECT: invention usage ensures creation of new JAM-A protein antibodies which may be further applied in treatment or prevention of diseases related to proliferation of tumour cells extracting JAM-A protein.

34 cl, 31 dwg, 5 tbl, 19 ex

FIELD: medicine.

SUBSTANCE: invention presents cultivated hybrid cell strains of Mus. musculus animals Sp2/0-BC/rhPC-4F10, Sp2/0-BC/rhPC-1C6, Sp2/0-BC/rhPC-3H6, producers of monoclonal antibodies specific to human protein C. The strains are deposited in the Russian National Collection of Industrial Microorganisms of Federal Unitary Enterprise State Research Institute 'Genetics', No. (VKPM H-111), (VKPM H-112), respectively. The antibodies belong to hPROC-specific murine immunoglobulin G possessing cross-responsiveness, are selectively bound with human protein C and form a stable complex.

EFFECT: antibodies under the invention may be used for purposes of pharmaceutical and biomedical analytical studies, particularly for quantitative detection of the human recombinant factor C.

1 dwg, 4 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to biotechnology, gene and protein engineering. There are engineered plasmids pCLm4/hygro-14D5 and pCHm2-14D5. The plasmids provide the synthesis in eukaryotic cells of polypeptides with light and heavy chain properties of a chimeric antibody, which are combined into the chimeric antibody ch14D5 class IgG1/kappa. The producing chimeric antibody ch14D5 recovered from the culture fluid of CHO-K1 cells transfected by plasmids pCLm4/hygro-14D5 and pCHm2-14D5 having a molecular weight of about 150 kDa. The antibody consists of two identical light chains, a constant portion of which corresponds to human kappa antibodies, and two identical heavy chains, a constant portion of which corresponds to human IgGI antibodies; having an amino acid sequence SEQ ID NO: 1 and SEQ ID NO: 2.

EFFECT: antibody is targeted to tick-borne encephalitis and provides the acute prevention of mice against tick-borne encephalitis.

3 cl, 7 dwg, 8 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used for recombinant production of human tissue factor (hTF). Constructed is a plasmid pHYP-10ETFCS6 having a length of 5,912 b.p. with a physical map presented on Fig. 2, for expression in a bacterium of the genus Escherichia, which is a precursor of the mutant [C245S] hTF containing an inseparable N-terminal leader peptide containing a deca-histidine cluster and an enterokinase identification sequence fused in a frame with a sequence coding the above mutein fused in the frame with the sequence coding the additional inseparable C-terminal peptide containing the deca-histidine cluster. A method for producing the precursor of the mutein[C245S]hTF contains culturing the producing bacterium in a nutrient medium, recovering inclusion bodies, solubilising the precursor protein, performing a metal chelator chromatography in the denaturation environment, re-folding and diafiltration of the protein solution. A method for producing the mature mutein[C245S] hTF involves detecting the N-terminal leader peptide from the above mutein precursor with using enterokinase and recovering the target protein.

EFFECT: invention enables increasing the level of biosynthesis and yield of pro-coagulation active hTF.

9 cl, 5 dwg, 1 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. What is presented is a completely human monoclonal antibody, which binds insulin-like growth factor-II (IGF-II) and has a cross responsiveness to IGF-I, as well as its antigen-binding fragment. There are disclosed a nucleic acid molecule coding an antibody according to the invention, a vector and a host cell for the expression of the antibody according the invention. There are described a pharmaceutical composition, as well as conjugates for treating and diagnosing malignant tumour, using the antibody according to the invention in preparing the therapeutic agent and a method for determining IGF-II and IGF-I levels in a patient's sample.

EFFECT: present invention can find further application in cancer therapy.

16 cl, 27 ex, 18 tbl

FIELD: medicine.

SUBSTANCE: invention relates to field of immunology. Claimed is isolated antibody to ICOS protein of people with increased effector function. Also described are cell and method of obtaining antibody in accordance with claimed invention, pharmaceutical composition, method of treating autoimmune disease or disorder, transplant rejection and malignancy of human T-cells, as well as method of depletion of ICOS-expressing T-cells, method of destroying germ centre structure in secondary lymphoid organ of primates, methods of depleting B-cells of germ centre of secondary lymphoid organ and circulating B-cells, which have undergone class switching, in primates.

EFFECT: invention can be further applied in therapy of diseases, mediated by T-cells.

33 cl, 21 dwg, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented group of inventions concerns fused proteins, nucleic acids coding these proteins, an expressing cartridge providing nucleic acid expression, a vector comprising this cartridge, a diagnostic technique for in vitro borreliosis, a kit for this diagnostic technique, which use these proteins, as well as a vaccine composition for preventing borreliosis containing these proteins. The characterised fused proteins contain (i) at least one sequence of DbpA protein of the species Borrelia specified in B. afzelii, B. burgdorferi sensu stricto and B. garinii, and (ii) least one sequence of OspC protein of the species Borrelia specified in B. afzelii, B. burgdorferi sensu stricto and B. garinii.

EFFECT: presented group of inventions enables performing more sensitive and specific analyses related to the presence of certain pathogenic species Borrelia.

11 cl, 8 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology and represents anti-nerve growth factor (NGF) antibodies. The present invention also discloses a pharmaceutical composition for relieving pain associated with a disease or a condition, wherein pain progression or persistence is mediated by NGF, containing the above antibodies, as well as a kit for treating a HGF-related disease, such as e.g. osteoarthritis, nucleic acids coding a heavy or light chain of the antibody, an expression vector, a host cell for preparing the above antibodies, a method for expressing the above anti-NGF antibodies, as well as using the above antibodies in managing pain and for preparing a therapeutic agent for managing pain associated with the disease or condition, wherein pain progression or persistence is mediated by NGF.

EFFECT: present invention enables producing the anti-NGF antibodies characterised by high stability in vivo.

16 cl, 7 dwg, 13 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology. Presented is an antibody able to bind to an amplified epidermal growth factor receptor (EGFR) and to de2-7 EGFR, a truncated version of EGFR, and characterised by sequences of variable domains. There are also disclosed a kit for diagnosing a tumour, an immunoconjugate, pharmaceutical compositions and methods of treating a malignant tumour based on using the antibody according to the invention, as well as a single-cell host to form the antibody according to the present invention.

EFFECT: invention can find further application in diagnosing and treating cancer.

43 cl, 98 dwg, 20 tbl, 26 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to biotechnology and represents an expression plasmid without resistance to an antibiotic, containing a polynucleotide, coding a repressor protein cI. The expression of the said repressor protein regulates the expression of a toxic gene product, embedded into a non-essential section of a host genome. The claimed invention also discloses a constructed host cell, belonging to Gram-negative bacteria, which contains the said plasmid. The host cell is used to obtain the plasmid or to obtain a protein or an immunogen, if the expression plasmid additionally contains genes, coding the said protein or immunogen. The method of obtaining the expression plasmid and the method of obtaining the protein or immunogen are carried out in several stages. First, a strain of host cells, belonging to the Gram-negative bacteria, is created by embedding by the allele substitution of the gene, coding the toxic product, into the non-essential section of a host chromosome. After that, construction of the DNA-plasmid, which contains the gene, coding the repressor protein cI, and in case of necessity the gene, coding the protein or immunogen, is performed. Then, the obtained host cells are transformed by the said plasmid and grown in the presence of sucrose at a temperature of 30-42°C.

EFFECT: invention makes it possible to realise control of the toxic gene, localised on a chromosome, by means of the repressor, localised on the plasmid in the absence of selective pressure by an antibiotic.

33 cl, 31 dwg, 8 tbl, 10 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to immunology. Presented are variants of anti-CD20 modified antibody or its antigen-binding fragment. Each of the variants is characterised by the fact that it contains a variable light and heavy chain domain, and induces a higher apoptosis level as compared to anti-B-Ly1 chimeric antibody. There are presented: a mixture of antibodies, wherein at least 20% of oligosaccharides in Fc domain have a branched chain and are not fucosylated, as well as a pharmaceutical composition for producing a therapeutic agent for a malignant haematological or autoimmune disease by using the antibodies or the mixture of antibodies. Described are: an expression vector, a based host cell, variants of coding polynucleotides, as well as a method for producing the antibody in the cell.

EFFECT: using these inventions provides the new antibodies with the improved therapeutic properties, including with increased binding of Fc receptor, and with the increased effector function that can find application for treating the malignant haematological or autoimmune disease.

32 cl, 3 ex, 9 tbl, 26 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry, in particular to method of obtaining bivalent bispecific antibody, which includes transformation of host cell by vectors, containing molecules of nucleic acids, coding first light chain and first heavy chain of bivalent bispecific antibody, and vectors, containing molecules of nucleic acids, coding second light chain and second heavy chain of bivalent bispecific antibody, cultivation of host cell under conditions, providing synthesis of molecule of bivalent bispecific antibody from said culture. Said antibody contains first light chain and first heavy chain of antibody, specifically binding with first antigen, and second light chain and second heavy chain of antibody, specifically binding with second antigen, in which variable domains VL and VH of second light chain and second heavy chain are replaced by each other and constant domains CL and CH1 of second light chain and second heavy chain are replaced by each other.

EFFECT: invention makes it possible to increase output of correct bispecific antibody by increasing the level of correct heterodimerisation of heavy chains of wild type and modification of heavy chains resulting from crossing over.

2 cl, 31 dwg, 3 tbl, 4 ex

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

Up!