Rna-aptamer having ability to recognise autoantibodies specific to disseminated sclerosis

FIELD: biotechnology.

SUBSTANCE: proposed RNA-aptamer is a 57-unit mixed-type oligonucleotide having the nucleotide sequence GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G are ribonucleotides, U, C are 2'-desoxy-2'-fluoro-ribonucleotides, has the ability to recognise autoantibodies specific to disseminated sclerosis.

EFFECT: characterised invention binds specifically and highly affine with autoantibodies specific to disseminated sclerosis, and can be used for the diagnostics of disseminated sclerosis.

3 dwg, 2 ex

 

The invention relates to biotechnology and medicine, namely to RNA aptamers capable of specific and high affinity contact autoantibodies characteristic of multiple sclerosis.

Aptamers - synthetic nucleic acids that are able to learn specific target molecules due to the formation of a unique tertiary structure. To obtain them using the method of in vitro selection from pools of oligonucleotides with random sequences. Targets of aptamers can be as low molecular weight compounds, proteins or whole cells.

Aptamers, like peptides generated using phage display or monoclonal antibodies capable of modulating the activity of selected targets at the expense of the specific binding. So, for example, binding of the aptamer with the target can block its function. At the moment obtained aptamers for a large variety of proteins, including growth factors, transcription factors, enzymes, immunoglobulins and receptors [G. Zhu, M. Ye, M. J. Donovan, Song E., Zhao Z., Tan W. // Chem. Commun. 2012. V. 48. P. 10472-10480]. Typically, the size of aptamers is in the range of 25-90 nucleotides (10-30 kDa), they bind to their targets with mu or subnanomolar affinity and is able to distinguish between closely related targets (e.g., proteins from the same gene family). The binding of the aptamer�in with targets is implemented by the same types of interactions, which determine the affinity and specificity of binding of the antibody-antigen (hydrogen bonds, electrostatic and van der Waals interactions) [Pendergrast PS, H. N. Marsh, Grate D., Healy J. M., Stanton M. // J. Biomol. Tech. 2005. V. 16. P. 224-234].

Aptamers have a number of properties required for use as therapeutic and diagnostic tools, including high specificity and binding affinity, biological activity and excellent pharmacokinetic properties. In addition, they provide specific competitive advantages compared to antibodies and other biologically active substances of protein nature.

Multiple sclerosis (PC) is a chronic progressive autoimmune disease of the Central nervous system, which is characterized by the formation of randomly scattered foci of demyelination, i.e. loss of myelin - protein-lipid membrane covering the nerve fiber [I.e., Schmidt, N. N. Yakhno Multiple sclerosis. -M.: Medicine. 2003]. Timely diagnosis and early therapy immunomodulatory drugs enable change for PC and significantly slow down its development. At the same time, PC diagnostics, especially in the initial stages of the disease, is a complex task and requires the analysis of a combination of clinical and laboratory data in combination with results� MRI.

Currently as a laboratory test for the early diagnosis of PC, using analysis of cerebrospinal fluid for the presence of oligoclonal IgG antibodies, however, a positive result of this test is not exhaustive proof and serves only to confirm the diagnosis [Awad A., Hemmer W., Hartung, H.-P., Kieseier B., Bennett J. L., Stuve, O. // J. Neuroimmunol. 2010. V. 219. P. 1-7], a specific method for laboratory diagnostics PC does not yet exist.

A promising method of laboratory diagnosis is the quantification of the protein markers characteristic of certain diseases. Currently intensively developed approaches to the detection of proteins based on the use of biosensors, which recognizes the protein part is the aptamer. The affinity to targets of aptamers are comparable to monoclonal antibodies have the additional advantages [V. Ruigrok, Levisson, M., Eppink, M. H. M., Smidt H., van der Oost J. Biochem. J. // 2011. V. 436. P. 1-13], among which one should highlight the possibility of selection of aptamers to almost any target, and the possibility of chemical synthesis of aptamers and incorporating various modifications [G. Mayer // Angew. Chem. Int. Ed. 2009. V. 48. P. 2672-2689].

At the moment there are a number of DNA and RNA aptamers capable vysokoaffinnye and to learn specific protein markers of various diseases and bio�of Insarov based on them [P. Hong, Li W., Li J. // Sensors. 2012. V. 12. P. 1181-1193]. In particular, the obtained aptamers that are able to make proteins - mediators of the inflammatory response characteristic of several autoimmune diseases, including multiple sclerosis.

For example, a known RNA aptamers capable of specific contact interleukin-17 [Y. Nakamura, Ishigiro A., Miyakawa S. // Genes Cells. 2012. V. 17. P. 344-364], interleukin-12 and interleukin-23 [Aptamersto the human il-12 cytokine family and their use as autoimmune disease therapeutics. Cload, S. T., Diener J. L, A. Ferguson, N. Hamaguchi, S. C. Keene, H. A. and D. Lagasse, P. Sawhney, K. Thompson WO 2005086835 A2, op. 22.09.2005].

The most closest to the claimed aptamer - prototype, is an RNA aptamer to midkine (MKapt), representing a 49-segment oligoribonucleotide containing 2'-O-methylribonucleotides, 2'-deoxy-2'-ferrimagnetic and deoxyribonucleotides in certain provisions of the oligonucleotide chain, the balance of cholesterol at the 5'-end and a thymidine residue, attached 3'-3'-fosfodiesterasi communication. [J. Wang et al. Inhibition of midkine alleviates experimental autoimmune encephalomyelitis through the expansion of regulatory T cell population. Proc. Natl. Acad. Sci. USA. 2008. V. 105. P. 3915-3920]. Malkin - growth factor with a wide range of biological activity, which plays an important role in development of inflammation, in particular multiple sclerosis is characterized by elevated levels of this protein. This aptamer has a high affinity for its target (Kd=0.9 nm) and is able to slow down.....�ment of experimental autoimmune encephalomyelitis in mice (disease similar to multiple sclerosis).

From the point of view of potential diagnostic applications, the disadvantage of the above-mentioned analogues and the prototype of the invention aptamers directed to proteins-mediators of the inflammatory response, is the lack of specificity in relation to specific autoimmune diseases. The use of such aptamers for the detection of the target protein in biological samples is only possible to obtain information about the presence or absence of autoimmune diseases in General, however, to determine the specific form of the disease with the help of such aptamers impossible.

One of the characteristic features of multiple sclerosis is the appearance in the body of autoantibodies-proteases that are able to hydrolyze the myelin basic protein (WSO) [Ponomarenko N. A. Durova O. M., Vbrobiev I. I., Aleksandrova E. S., Telegin G. B., Chamborant O. G., Sidorik L. L., Suchkov S. V., Z. S. Alekberova, Gnuchev N. V., Gabibov A. G. // J. Immunol. Meth. 2002. V. 269. P. 197-211; Polosukhina, D. I., Kanyshkova T. G., B. M. Doronin, Tyshkevich O. B., Buneva V. N., Boiko A. N., Gusev E. I., Favorova 0.0., Nevinsky G. A. // J. Cell. Mol. Med. 2004. V. 8. P. 359-368].

The object of the present invention is to provide a stable in biological environments RNA aptamer capable of specific and high affinity to connect with anti SHARE autoantibodies obtained from the blood of patients with multiple sclerosis.

The technical result of the receipt of a new RNA aptamer, which has a specific ability and high�latinno contact autoantibodies, characteristic of multiple sclerosis.

The task is achieved by the proposed RNA aptamer (Apt-2-9c), representing a 57-segment oligonucleotide of mixed type, containing purine ribonucleotides and 2'-deoxy-2'-torpedinidae the ribonucleotides, having the following nucleotide sequence: GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A, G - ribonucleotides; U, C - 2'-deoxy-2'-ferrimagnetic.

The nucleotide sequence of the aptamer Apt2-9c installed using the method of in vitro selection using as targets of polyclonal anti-WSO antibodies isolated from blood of patients with multiple sclerosis. After the establishment of the nucleotide sequences of individual aptamers organized the screening of affinity and specificity of their binding to autoantibodies target. As a result of minimization of the nucleotide sequence was obtained 57-tier the aptamer Apt2-9c with the following characteristics:

- has a high affinity to proteolytic anti-SHARE the autoantibodies from the blood of patients with multiple sclerosis;

- has a significantly lower affinity to the antibodies from the blood of healthy donors.

The synthesis of the RNA aptamer according to the invention is carried out in an automatic DNA/RNA synthesizer ASM-800 using standard solid-phase hospitaliano method.

Defined�sponding differences of the proposed RNA aptamer from the prototype are:

- declare RNA aptamer is a 57-segment oligonucleotide of mixed type, containing purine ribonucleotides and 2'-deoxy-2'-torpedinidae nucleotides having the nucleotide sequence of SEQ ID NO:1, which improves its stability to enzymatic and chemical degradation in biological samples;

- RNA aptamer specific and with high affinity binds to anti-SHARE autoantibodies, which are biomarkers of multiple sclerosis that will allow it to be used for the diagnosis of this disease.

The invention is illustrated by the following examples.

Example 1. Obtaining RNA aptamer Apt2-9c

Synthesis Apt2-9c were performed on an automatic DNA/RNA synthesizer ASM-800 (Biosset, Russia) according to standard protocols [L. Bellon Oligoribonucleotides with 2'-O-(tert-butyldimethylsilyl) groups. Current protocols in nucleic acids chemistry. 2001. S. 1. P. 3.6.1-3.6.13], optimized for this device, using β-Tianeti of hospitalito 5',2',N-protected purine ribonucleotide and 5',the N-protected pyrimidine 2'-deoxy-2'-F-ribonucleotides. As the polymer carrier used glass particles CPG (controlled pore glass) with a pore diameter of 500 And attached via the 3'-hydroxyl group of 5',2',N-protected ribonucleosides.

Each synthesis cycle consisted of the following steps:

1) datetimerange - removal dimethoxytrityl�filled, the protective group from the 5'-hydroxyl of a growing oligonucleotide chain by treatment with 3% solution dichloroquinone acid in dichloromethane;

2) the accession of the next monomer unit, which is the β-Tianeti-N,N-bis-diisopropylaminoethyl one of the protected nucleoside. As the activating agent in the condensation used 5 ethylthio-1H-tetrazole;

3) kupirovanie - blocking unreacted 5'-hydroxyls with acetic anhydride and N-methylimidazole, which allows to avoid admissions of nucleosides in the sequence of the desired oligonucleotide;

4) oxidation with a solution of iodine in pyridine, in which the conversion occurs hospitalfind magnoliopsida ties in phosphocreatine.

After the necessary number of synthetic cycles and removal of the 5'-terminal dimethoxytrityl group received protected polymersandy 2'-F-pyrimidinediamine RNA aptamer. To separate the oligonucleotide from the polymer carrier, the release of heterocyclic bases and binucleated phosphates to polimerbetona the aptamer was added 300 µl of 40% aqueous methylamine was allowed to stand for 2 h at 25°C and constant stirring, and then at -20°C for 15-20 min and was separated from the polymer by centrifugation. The polymer was washed with 3×100 μl of smesitel:acetonitrile:water (1:1:1). The solutions were combined and evaporated to dry residue in vacuum evaporator Speed-Vac Concentrator SVC 100H. To remove tert-b�telematically protective groups with 2'-hydroxyls of purine nucleosides to the dry residue of the oligonucleotide was added 200 μl of a mixture of N-methyl-2-pyrrolidinone:triethylamine:TEM·TASKS (1.5:0.75:1, v/v/v) and kept at 65°C for 1.5 h. After cooling the solution to room temperature, was added 300 μl of ethoxytrimethylsilane and stirred for 10 min. To the mixture was added 1 ml of ether and centrifuged, the solution was decanted, and the precipitate was washed with ethyl ether, and air dried. Fully released aptamer was purified by preparative electrophoresis in a denaturing 12% polyacrylamide gel: acrylamide:N,N'-methylenebisacrylamide (30:1), 8 M urea, 50 mm Tris-borate (pH 8.3), 0.1 mm Na2EDTA, at a voltage of 50 V/cm. After electrophoresis the gel was placed on a TLC plate and visualized the aptamer in the UV light, then cut out the relevant parts of the gel and precipitated as sodium salt. The aptamer was suirable aqueous solution of 0.3 M sodium perchlorate, the eluate was desalted using a cartridge Waters SepPac C18, evaporated to a volume of 100 μl and precipitated the aptamer by adding 10-fold excess of 2% NaClO4in acetone. The precipitate was separated by centrifugation for 10 min at 4°C and 13200 rpm. Supernatant was isolated, the residue of the oligonucleotide was washed with acetone, dried at 37°C.

Received Apt2-9c, representing a 57-segment oligonucleotide of mixed type, containing purine ribonucleotides and 2'-deoxy-2'-torpedinidae nucleotides, has consistently nucleotide�th SEQ ID NO:1 (Fig.1).

RNA aptamer Apt2-9c were analyzed by analytical electrophoresis in 12% denaturing page followed by staining the gel with a solution of dye "Stains-All" and MALDI-TOF mass spectrometry.

Example 2. The use of RNA aptamer Apt2-9c for detecting a characteristic of multiple sclerosis (PC) autoantibodies.

Investigated the binding Apt2-9c carrying radioactive [32R]-tag at the 3'-end, with a mixture of polyclonal anti-SHARE autoantibodies (a mixture of IgG, IgA and IgM antibodies with predominance of IgG) from blood of 12 patients with PC. The reaction was performed at 25°C for 16 hours in a buffer solution (50 mm Tris-HCl, pH 7.5, 100 mm NaCl, 0.1% Tween 20) in the presence of trace amounts of radioactively labeled aptamer. Antibody concentrations ranged from 0.5 to 100 nm. For the formation of complexes was monitored by electrophoresis in a 6% polyacrylamide gel, which allows the separation of free aptamers complexes from the aptamer-antibody, under conditions of: acrylamide:N,N'-methylenebisacrylamide (50:1), 25 mm Tris-borate (pH 8.3), a voltage of 15 V/cm. in a Similar way, it was investigated the binding of the aptamer with a mixture of total IgG antibodies extracted from the blood of 12 healthy donors. After electrophoresis, the gel was dried and placed in a cassette with the photosensitive screen. The screen was scanned using phosphorimager Bio-Rad. To obtain quantitative characteristics radiator�s translated in the digital form in the software package Quantity One. Using the software package GraphPad Prism 5.0.4.533 for each series of experiments were postoroenny binding isotherms, which allowed to assess the affinity of aptamers to antibodies and to calculate binding constants.

Fig.2 shows radioautography 6% sedentarismo polyacrylamide gel after separation of the reaction mixtures. Tracks 1-5 - incubation of the aptamer with pathogenic autoantibodies from the blood of patients with multiple sclerosis at the specified concentration; track 6 (control) - aptamer after incubation in the reaction conditions in the absence of antibodies; lanes 7-13 - incubation with total IgG antibodies in healthy donors at the indicated concentration.

Fig.3 shows the binding isotherms Apt2-9c with anti SHARE autoantibodies from the blood of patients with PC and antibodies from the blood of healthy donors.

From Fig.2, 3 shows that Apt2-9c effectively binds with anti-SHARE autoantibodies from patients with PC, while with antibodies from healthy donors was obtained only a small number of complexes. Dissociation constants of complexes of aptamer-antibody to pathogenic antibodies (Kd=1.2±0.1 nm) and antibodies in healthy donors (Kd=2300±460 nm) differ by almost 2000 times. The results indicate that the Apt2-9c has a high affinity autoantibodies characteristic of multiple sclerosis, and selectively learn the antibody.

So�m, the proposed RNA aptamer Apt2-9c has a high affinity and specificity of binding to proteolytic anti SHARE autoantibodies that are specific for multiple sclerosis autoantibodies, and can be used for the diagnosis of multiple sclerosis.

<110>Federal state budgetary institution of science Institute of chemical biology and fundamental medicine, Siberian branch of the Russian Academy of Sciences (icbfm)
<120>RNA aptamer having the ability to know multiple sclerosis is characterized by autoantibodies
<160>The number SEQ ID NO
<210>SEQ ID NO: 1
<211>57
<212>The oligonucleotide of mixed type, containing purine ribonucleotides and 2'-deoxy,2'-torpedinidae nucleotides
<213>artificial sequence
<400>1

GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUUGUUU50
ACCCCCA57

Fig. 1.

RNA aptamer, representing a 57-segment oligonucleotide of mixed type, containing purine ribonucleotides and 2'-deoxy - 2'-torpedinidae the ribonucleotides, having the following nucleotide sequence: GGGAGGACGAUGCGGUGUUUUCUGAGUACAUCUCUGCCCCACCCUU GUUUACCCCCA, where A,G-ribonucleotides, U, C - 2'-deoxy-2'-ferrimagnetic having the ability to know multiple sclerosis is characterized by autoantibodies.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: group of inventions relates to the field of biochemistry. Claimed is a device for nucleic acid sampling, application of the device of nucleic acid sampling, a set for nucleic acid amplification, as well as a method of nucleic acid amplification. The device includes a probe for holding the nucleic acid sample and a manipulator, connected to the probe with an account of a possibility of the probe manoeuvring. The probe includes a multitude of probe elements, which are capable of travelling with respect to each other between approximated and mutually remote configurations. Each probe element has a nozzle. When the probe elements move into an approximated configuration, each nozzle is joined with other nozzles to form a composite nozzle. The composite nozzle is capable of contacting with nucleic acid in order to deliver its sample. The method of amplification of nucleic acid from higher eukaryotes includes the contact of the sampling device with a source of nucleic acid from higher eukaryotes, introduction of the sampling device or its part into a reaction vessel to carry out the reaction of nucleic acid amplification without preliminary material processing and realisation of the reaction of nucleic acid amplification.

EFFECT: inventions provide portability, easiness of the application of device for nucleic acid sampling, as well as carrying out the analysis in the short period of time.

43 cl, 27 dwg, 2 tbl, 12 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly a method of detecting somatic mutations in the PI3K gene, which are responsible for tumour sensitivity to target therapy, using DNA biochip technology. The method includes determining presence of somatic mutations E542K, E545K, Q546K, H1047L and H1047R in the PI3K gene using LNA-blocking multiplex "nested" PCR, subsequent hybridisation of the labelled PCR product in the biochip, recording and interpreting the results.

EFFECT: invention provides rapid and efficient detection of somatic mutations in the PI3K gene, associated with tumour sensitivity to target therapy.

3 cl, 2 dwg, 4 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of molecular genetics, genosystematics and pharmacognosy and is intended for the identification of the species affinity of common heather (Calluna vulgaris (L.) Hull.). Claimed is a set of synthetic oligonucleotides for PCR with the fragment ITS2 of nuclear DNA, including forward and reverse primers and a degradable probe.

EFFECT: set possesses high sensitivity and specificity and makes it possible to carry out the identification of a medicinal plant in a fast and reliable way.

1 dwg, 1 ex

FIELD: biotechnology.

SUBSTANCE: method comprises sequential centrifugation, ultrafiltration and ultracentrifugation of the culture condensed medium. The resulting residue is dissolved in phosphate-saline buffer and re-centrifuged. The resulting residue is dissolved in water. The resulting solution is subjected to electrophoresis in a free flow on the device FFE System. Ultracentrifugation of each of the obtained fractions is carried out. Each fraction is purified from the cell walls of exosomes by filtration and centrifugation. Reaction of reverse transcription is carried out using reverse transcriptase. The reaction is stopped by heating to 95°C for 5 minutes.

EFFECT: invention enables to extract microRNA from biological fluids containing exosomes with high yield.

2 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: claimed invention relates to the field of biotechnology, namely to the preliminary estimation of the efficiency of the autologic cell material transplantation to stimulate the growth of blood vessels, and can be applied in medicine. Claimed is a method of the complex estimation of the angiogenic potential of progenitor cells in patients with cardiovascular diseases, tested on mesenchymal stromal cells of the adipose tissue (MSC-AT) of patients with ischemic heart disease and including the measurement of content of mRNA and proteins of basic angiogenic factors, produced by the progenitor cells such as the vascular endothelial growth factor (VEGF), the placental growth factor (PIGF), the hepatocyte growth factor (HGF), angiopoetin-1 and angiogenin, the angiogenic activity of total cell secretion products, as well as the estimation of the ability of the progenitor cells to stimulate the vascularisation of subcutaneous Matrigel implants, introduced to immunodeficient mice. As the screening method used is a simpler and more available but less informative method of express-assessment of the angiogenic properties of the progenitor cells, based on the measurement of the angiogenic activity of the total cell secretion products.

EFFECT: invention makes it possible to carry out testing of the autologic cell material obtained from the patients, including those with ischemic heart disease, before transplantation in order to choose the optimal tactics of cell therapy aimed at the stimulation of the growth of blood vessels.

2 cl, 2 dwg, 4 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: group of inventions relates to field of biotechnology. Method of detecting genome of virus of infectious anaemia in horses includes carrying out polymerase chain reaction, amplification of virus DNA, evaluation of reaction carrying out. If viral RNA is detected, reaction of denaturation and reverse transcription is preliminarily carried out, and detection is carried out by means of RT-PCR in real time in case of detection of INAN virus and PCR in real time in case of detection of pDAN of INAN virus. To realise the method specific primers and DNA-probe are applied. Temperature modes include the following stages: 5 min of preliminary denaturation at 94°C, 5 cycles of amplification without detection (94°C - 10 sec, 56°C - 15 sec, 72°C - 15 sec) and 35 cycles of amplification with detection (94°C - 10 sec, 56°C - 15 sec, 72°C - 15 sec). Interpretation of results is carried out on the basis of presence/absence of crossing of fluorescence curve with threshold line (Threshold).

EFFECT: application of inventions makes it possible to detect RNA and pDAN of INAN virus by means of RT-PCR in real time mode, as well as to increase method specificity and sensitivity.

2 cl, 3 tbl, 1 ex

FIELD: biotechnology.

SUBSTANCE: method is based on single nucleotide polymorphism of genes of toxin-anatoxin systems of type II of superfamilies VapBC, HigAB and MazEF and is characterised in that for identification amplification is carried out with genomic DNA using the set of oligonucleotide primers for 10 genes of toxin-anatoxin systems. PCR products are analysed in agarose gel, the size of the obtained fragment is determined by DNA marker, the target fragments are isolated from the PCR mixture or the agarose gel and they are sequenced in order to detect the respective polymorphisms.

EFFECT: invention enables to carry out fast and accurately genotyping of mycobacteria in PCR mode and can be used for identification of clinically important strains, including with multiple and wide drug resistance, and also with altered virulence in operation with patients.

1 dwg, 3 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to multi-channel devices, modified by nanocarriers of aniline-containing polymers. Claimed are: a multi-channel nozzle for the extraction of nucleic acids, proteins, peptides and a method of production of a multi-channel element, included in the composition of the multi-channel nozzle. The nozzle consists of a glass hexagonal multi-channel array, which includes multi-channel elements from a multitude of parallel capillaries. A sorption layer, which consists of one to three polymeric nanolayers, is applied on the internal surface of the capillaries. A multi-channel element is made with a protective framing from several rows of glass rods. The glass hexagonal multi-canal array consists of the laid repeatedly extended single multi-channel elements with the diameter of capillaries from 1 mcm and more, working surface to 500 cm2, volume to 500 mcl. The method of the multi-channel element production includes the assembly of glass tubes into a multi-channel pack, fastening one of its ends in a supply unit grip, heating of the other end in a furnace with the formation of a bulb and extension to a required size. In order to obtain the structures with the diameter of the channel of the order and less than 1 mcm in the process of moulding the repeated extension of the multi-channel elements, preliminarily formed by laying the elements of the hexagonal shape, is realised.

EFFECT: inventions ensure carrying out the express-extraction and purification of both nucleic acids and proteins, peptides, as well as ensure the high reproducibility of results.

5 cl, 6 dwg, 3 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, virology and immunology. Particularly, the present invention refers to a new avian astrovirus; to antibodies and their fragments targeted to the above new virus; to antigen preparations, proteins and DNA molecules of new avian astrovirus; to vaccines based on the above new virus or to its antigen preparations, protein or DNA; to methods for producing such vaccines and to diagnostic kits. The present invention can be used in veterinary science.

EFFECT: preparing the new avian astrovirus.

11 cl, 5 dwg, 4 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: biotechnology.

SUBSTANCE: invention provides method of simultaneous (multiplex) amplification and fluorescent marking of DNA of several segments of the genome of mycobacteria of tuberculosis complex (Mycobacterium tuberculosis, M. bovis, M. bovis BCG, M. africanum and M. microti). Then the hybridisation or electrophoretic analysis of the sequences of these segments is carried out. The multiplex PCR is carried out in a single reaction volume with use of specific and adapter primers, the fluorescent substrate embedded into the growing DNA chain during PCR, and genomic DNA as a matrix. The multiplex PCR comprises two consecutive amplification profiles, different in annealing temperatures of specific and adapter primers by not less than 10°C. The invention enables to carry out the analysis of sequences of these genes to identify mutations associated with resistance to anti-tuberculosis preparations.

EFFECT: method according to this invention reduces the number of stages of amplifications to obtain single stranded fluorescent-labelled PCR-products, eliminates the transfer of a DNA-matrix from one reaction volume to another, which increases the stability of the procedure to contamination with PCR-products and reduces significantly the time and complexity of the analysis.

4 dwg, 1 tbl, 1 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents pCFP10-DBD recombinant plasmide consisting of an artificial bacterial operon of a chimeric protein including a promoter region of early promoter of T5 bacteriophage, a chimeric protein gene consisting of a sequence of protein antigene CFP10 from Mycobacterium tuberculosis, which is merged with a sequence of a dextrane-binding domain (DBD) of dextrane sucrase Leuconostoc citreum KM20, and a transcription terminator, a bacterial operon of beta-lactamase and a bacterial initiation section of replication of ColE1 type. Besides, strain Escherichia coli - a producer of CFP10-DBD chimeric protein is presented. The invention describes a method of immobilisation, concentration and cleaning of the obtained protein on cellulose. The invention describes an immunogenic composition containing CFP10-DBD recombinant protein, which is aimed at induction of immunity against tuberculous infection.

EFFECT: invention enlarges the range of devices used for treatment of tuberculosis.

4 cl, 6 dwg, 1 tbl, 4 ex

FIELD: process engineering.

SUBSTANCE: set of invention relates to biology, particularly, to automated purification of biological specimens at extraction of target matters involving the magnetic field application. Magnetic field application element and heater are integrated for up and down movement. Automatic device comprises unit 100 displacing vertically and horizontally to accommodate pipettes 141, 142 for suction and discharge of fluid. Heater 810 heats a particular unit of holes of multihole tray 420, 420' while element 700 for magnetic field application is arranged on support plate 400 including magnet seat 710. Element 700 accommodates magnet 711 at bottom side of said unit of said tray Proposed method exploits above described device.

EFFECT: higher process efficiency.

26 cl, 48 dwg

FIELD: biotechnology.

SUBSTANCE: bionanoconjugate comprises a nano-sized superparamagnetic particle of cobalt ferrite spinel CoxFe3-xO4, where 0.6≤x≤0.98, obtained by mechanochemical synthesis. To isolate the nucleic acid containing oligo- or poly-A/dA sequence the synthetic single stranded oligonucleotide 5'-dGndTm is used, where n=5-30, m=10-35, one portion of which, consisting of guanine nucleotides in the presence of phosphate anions in the solution is specifically associated with the surface of the nanoparticle and the other - consisting of thymine nucleotides is able to enter into hybridisation with oligo- or poly-A/dA nucleotide sequences. For isolation from the solution in the presence of phosphate anions of specific hetero-nucleotide sequence additionally create a molecule of oligonucleotide-adapter containing the sequence of oligo-dAx at the 3'-end, hybridised with thymine nucleotides of a complex 5'-dGndTm, where n=5-30, m=10-35, and a portion at the 5'-end complementary to a specific hetero-nucleotide sequence in the solution.

EFFECT: invention enables to detect effectively and to isolate the single-stranded nucleic acids.

3 cl, 8 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology, in particular to methods of obtaining enzyme preparations. Invention deals with thermally stable two-domain laccase of bacterium Streptomyces griseoflavus Ac-993 with alkaline optimum of activity, DNA sequence, coding said enzyme, and method of obtaining enzyme, including cloning enzyme gene in cells of bacterium Escherichia coli, production of enzyme in cells of Escherichia coli, introduction of copper ions in medium for cultivation of recombinant strain in order to form active enzyme, obtaining enzyme preparation by methods of metal chelate chromatography and gel filtration.

EFFECT: invention makes it possible to extend assortment of enzymes such as laccase.

3 cl, 3 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to gene engineering, biochemistry, biotechnology and immunology, and represents recombinant plasmid pESAT6-CFP10-DBD, recombinant strain Escherichia coli M15 [pREP4, pESAT6-CFP10-DBD], a method for preparing, immobilising, concentrating and purifying recombinant protein ESAT6-CFP10-DBD on dextran, recombinant protein ESAT6-CFP10-DBD with molecular weight 26.4 kDa, an immunogenic composition containing protein ESAT6-CFP10-DBD immobilised on dextran, specifically activating T-lymphocytes synthesising IFN-gamma with antigen stimulation of mycobacteria.

EFFECT: invention enables ensuring the high level of protein expression, which induces the immune response to mycobacterial antigen effectively.

5 cl, 2 dwg, 1 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, in particular to molecular biology, biotechnology, genetic engineering. The invention represents optimised DNA sequences, coding a light and heavy chain of a monoclonal antibody, intended for the synthesis of the antibody in recombinant CHO-S cells, and a method of obtaining the said antibody in the said cells. The performed work resulted in the elaboration of several conditions making it possible to obtain the monoclonal antibody with high productivity.

EFFECT: invention makes it possible to maximise the cell productivity and optimise post-translational modifications of the antibody, in particular glycosylation of heavy chains of the antibody.

3 cl, 2 dwg, 6 tbl

FIELD: chemistry.

SUBSTANCE: claimed invention relates to biotechnology and represents molecular conjugates, capable of binding with nucleic acids (DNA or RNA) for their delivery into cells of mammals, expressing transferring receptors. The said molecular conjugates consist of a polycationic sequence, represented by a modified signal of nuclear localisation of the virus SV40 T-antigen, and a ligand. One of two sequences HAIYPRH or THRPPMWSPVWP is used as ligands of cell receptors. Complexes of the molecular conjugate and nucleic acid are used for obtaining medications for genetic therapy or diagnostics of various diseases. To obtain the said complexes solutions of nucleic acid and the molecular conjugate are poured together with a ratio of charges in the reaction medium from 1:0.63 and lower and used for complex formation of solutions with ionic power less than 300 mM.

EFFECT: claimed invention makes it possible to increase the efficiency of delivering genetic constructions into cells.

12 cl, 8 dwg, 1 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to molecular biology and genetic engineering. What is presented is a RNAi molecule for suppressing the thymidilate synthase expression by the action of RNAi, containing a double-stranded RNA domain consisting of a sense chain consisting of a nucleotide sequence presented by SEQ ID NO: 1 hybridised with an anti-sense chain hybridized in the demanding conditions with the sense chain.

EFFECT: molecule can substantially potentiate the antineoplastic action of 5-FU-antineoplastic agent for which reason it can be used in medicine as a part of the antineoplastic therapy.

15 cl, 2 dwg, 3 ex

FIELD: molecular biology.

SUBSTANCE: the suggested innovation deals with the fact that nucleic acids should be isolated directly out of the sample without pipetting stage but with the help of interconnected reservoirs being prepared beforehand. The above-mentioned vessels should be applied either separately or being interconnected according to standard microtitrating format. The sample should be mixed with a lyzing buffer and nucleic acids are bound with matrix in closed system including, at least, two interconnected reservoirs. Forced movement of sample's mixture and buffer back and forth from one reservoir into another one for several times through narrow passage provides their thorough intermixing. The method provides quick and safe isolation of nucleic acids.

EFFECT: higher efficiency.

44 cl, 4 dwg, 1 ex

Up!