Anti-icos antibodies and their application in treatment of oncological, transplantation-associated and autoimmune diseases

FIELD: medicine.

SUBSTANCE: invention relates to field of immunology. Claimed is isolated antibody to ICOS protein of people with increased effector function. Also described are cell and method of obtaining antibody in accordance with claimed invention, pharmaceutical composition, method of treating autoimmune disease or disorder, transplant rejection and malignancy of human T-cells, as well as method of depletion of ICOS-expressing T-cells, method of destroying germ centre structure in secondary lymphoid organ of primates, methods of depleting B-cells of germ centre of secondary lymphoid organ and circulating B-cells, which have undergone class switching, in primates.

EFFECT: invention can be further applied in therapy of diseases, mediated by T-cells.

33 cl, 21 dwg, 3 tbl

 

Introduction

The present invention relates to an anti-ICOS antibodies with enhanced effector function. The present invention also relates to compositions comprising anti-ICOS antibody with enhanced effector function, which may mediate one or more of the following features: complement-dependent cell-mediated cytotoxicity (CSC), antigen-dependent cell-mediated cytotoxicity (ADCC) and antibody-dependent phagocytosis (opsonization). The present invention also relates to compositions comprising anti-ICOS antibody of isotype IgG1 and/or IgG3 human rights, and also to compositions comprising anti-ICOS antibody of isotype IgG2 and/or IgG4 human that may mediate ADCC, CSC and/or antibody-dependent phagocytosis.

The present invention also relates to methods for the treatment and prevention mediated T-cell diseases and disorders. For example, chronic infections, autoimmune diseases and disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and proliferative disorder of T cells, but not only them, using therapeutic anti-ICOS antibody with enhanced effector function, in which therapeutic use of anti-ICOS antibodies with enhanced effector function.

Prerequisites create�ment of the invention

ICOS is a transmembrane protein type I, consisting of the extracellular (Ig)V-like domain. ICOS serves as a receptor for co-stimulatory molecules B7h. The expression of ICOS is at a low level in not subjected to any influence of T-cells, but expression regulation increases for several hours after contact with T-cell receptor. The expression of ICOS is stored in the subpopulations of activated T-cells, e.g., Th1 cells, Th2, and Th17 CD4+.

Because the expression of ICOS is concentrated in populations of activated T cells-helper cells, therapeutic applications of anti-ICOS antibodies with enhanced effector function contributes to the improvement of the effectiveness of treatment and prevention mediated T-cell diseases and disorders, such as chronic infections, autoimmune diseases and disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and proliferative disorder of T cells, but not only them, using therapeutic anti-ICOS antibody with enhanced effector function.

Brief description of the invention

The present invention also relates to an anti-ICOS antibodies with enhanced effector function, are associated with the molecule ICOS person, and also to compositions comprising these antibodies. In one variation�tov implementation of the present invention provide for the JMab-136 anti-ICOS antibodies (see US 6803039), which can mediate effector function of the antibody is more efficient than the original antibody JMab-136. In one embodiment of the present invention, anti - ICOS antibody of the present invention comprises a variant Fc region. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes a glycosylation different from the glycosylation of the original antibody.

The present invention also provides for pharmaceutical compositions comprising anti-ICOS antibody with enhanced effector function.

The present invention also relates to methods of treating or preventing mediated T-cell diseases and disorders, such as chronic infections, autoimmune diseases and disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and proliferative disorder of T cells, using therapeutic anti-ICOS antibody with enhanced effector function.

Definition

In the context of the present invention the term "antibody" and "antibodies" (immunoglobulins) encompass monoclonal antibodies (including monoclonal antibodies to full length), polyclonal antibodies, multispecific antibodies (e.g., bispecific antibodies) formed on �ENISA least two intact antibodies, antibodies, humanized antibodies, kanalizirovanija antibodies, chimeric antibodies, single-chain Fv (scFv), single-chain antibodies, antibodies with one domain, domain antibodies, Fab fragments, fragments F(ab')2fragments of antibodies that exhibit the desired biological activity, the Fv region with disulfide bonds (sdFv), and anti-idiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies to antibodies of the present invention), intracellular antibodies, and epitope-binding fragments of any of the above antibodies. In particular, antibodies include immunoglobulin molecules and immunologically active fragments of immunoglobulin molecules, i.e., molecules containing the binding site of the antigen. The immunoglobulin molecules can be of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass.

Native antibodies are usually heterotetrameric glycoproteins weight of about 150000 Nam, consisting of two identical light chains (light - L) and two identical heavy chains (heavy - H). Each light chain is linked to a heavy chain by one covalent disulfide bond, while the number of disulfide linkages varies among the heavy chains of different immunoglobulin isotypes. Each heavy and light chain also contains regularly spaced disulfide bridge�Ki between circuits. Each heavy chain with one end contains a variable domain (VH) which should be a number of constant domains. Each light chain contains a variable domain at one end (VL) and a constant domain at the other end; the constant domain of the light chain is aligned with the first constant domain of the heavy chain variable domain and the light chain is aligned with the variable domain of the heavy chain. Light chains are classified as lambda and Kappa chains based on the amino acid sequence of the constant region light chain. Variable domain light chain Kappa also may be referred to in the present invention "VK". The term "variable region" can also be used to describe the variable domain of the heavy chain and light chain. Suggest that certain amino acid residues form the interface between the variable domains of light and heavy chains. Such antibodies can be obtained from organisms of any mammal, e.g., humans, monkeys, pigs, horses, rabbits, dogs, cats, mice and other mammalian species.

The concept of "variable" is applicable taking into account the fact that certain portions of the variable domains differ in sequence from other parts of antibodies and is responsible for the binding specificity of each of konkretno� antibody with its corresponding antigen. However, the variability is not evenly distributed through the variable domains of antibodies. It is concentrated in segments, called complementary predetermined regions (Complementarity Determining Regions CDR) of the variable domains and light chain and heavy chain. More highly conservative part of variable domains are called the frame parts (framework regions - FW). Each of the variable domains of native heavy and light chains include four sections of FW, largely adopting a β-folded configuration, connected by three CDR regions, which form loops connecting, and in some cases forming part of β-folded structure. In each chain CDR localized together in close proximity to areas FW and CDR regions from the other chain, thereby participating in the formation of the binding site of the antigen by the antibody (see kN.: Kabat et al. "Sequences of Proteins of Immunological Interest, 1991, 5th ed., National Institute of health, public health, Bethesda, MD). The constant domains normally are not directly involved in antigen binding, but may influence the binding affinity to the antigen and can exhibit various effector functions, such as participation of the antibody in ADCC, CSC, antibody-dependent phagocytosis and/or apoptosis.

The term "hypervariable region" in the context of the present invention relates to OST�Kam amino acids in the antibody, associated with binding to the antigen. Hypervariable region covers amino acid residues complementary predetermined regions" or "CDR" (e.g. residues 24-34 (L1), 50-56 (L2) and 89-97 (L3) variable domain of the light chain and residues 31-35 (H1), 50-65 (H2) and 95-102 (H3) variable domain of the heavy chain, kN.: Kabat et al. "Sequences of Proteins of Immunological Interest, 1991, 5th ed., National Institute of health, public health, Bethesda, MD) and/or the residues from a "hypervariable loop" (e.g. residues 26-32 (L1), 50-52 (L2) and 91-96 (L3) in the variable domain light chain and 26-32 (H1), 53-55 (H2) and 96-101 (H3) in the variable domain of the heavy chain Chothia and Lesk, J. Mol. Biol., 196, 1987, cc.901-917). Remnants of a "skeleton plot" or "FW" are the remains of the variable domain of the flanking region of CDR. Remnants FW contained in chimeric, humanized, human, domain antibodies, double-antibody, antibodies vaccibodies, linear antibodies and bespecifically antibodies.

In the context of the present invention, the term "Fc region" includes polypeptides containing a constant region of an antibody excluding the first domain of the constant region of an immunoglobulin. Thus Fc refers to the last two domains of the constant region of immunoglobulins IgA, IgD, and IgG, and the last three domains of the constant region of immunoglobulins IgE and IgM, and the flexible hinge N-end � those domains. The Fc region of IgA and IgM may include the j chain of immunoglobulin IgG Fc region comprises immunoglobulin domains Shamma and Shamma (γ2 and γ3) and hinge region between Shamma (γ1) and Shamma (γ2). Although the boundaries of the Fc region may vary, the Fc region of the heavy chain of human IgG is usually determined by incorporating the remains S or R with C-Termini, and the numbering corresponds to the EU index by Kabat and others (1991, NIH Publication 91-3242, national technical information Springfield, Virginia). The concept of "EU index, established by Kabat" refers to the EU numbering of residues of IgG1 antibodies according to the description in the work of Kabat and others, cited above. Fc may refer separately to a specific area, or that area consisting of antibody, antibody fragment or hybrid Fc protein. Variant Fc protein may be an antibody, Fc hybrid, or any protein or protein domain comprising an Fc region. Particularly preferred are proteins, including variants of the Fc region that are non-natural variants of the Fc region. Amino acid sequence of unnatural Fc region (also referred to in the present invention "variant Fc region") includes the substitution, insertion and/or deletion of at least one amino acid residues compared to the amino acid sequence of the wild type. A new amino acid residue, poeavleaysi�I in the sequence of the variant Fc region as a result of the insertion or substitution, can be considered as non-natural amino acid residues. Note: the polymorphisms were installed in a number of provisions in the Fc, including, but not limited to, the provisions 270, 272, 312, 315, 356 and 358 in Kabat, and therefore slight differences between the presented sequence and sequences in the prior art may exist.

The term "monoclonal antibody" in the context of the present invention refers to an antibody obtained from a population of substantially homogeneous antibodies, i.e. the individual antibodies comprising the population are identical except for possible naturally occurring mutations that may be present in minor amounts. Monoclonal antibodies are highly specific and directed against a single antigenic site. In addition, in contrast to the preparations of polyclonal antibodies, which typically include different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against a single determinant on the antigen. In addition to their specificity, monoclonal antibodies are useful in that they can be synthesized hybrid cells without admixtures of other cells that produce immunoglobulin. Other known methods of obtaining specialisting this area for example, a monoclonal antibody can be obtained by cells that are temporarily or permanently transfected genes of the heavy or light chain encoding the monoclonal antibody.

The concept of the modifier "monoclonal" indicates the character of the antibody obtained from a population of antibodies that are substantially homogeneous, and should not be considered that antibodies get some special way. The term "monoclonal antibody" in the context of the present invention relates to an antibody that is formed in the population of cells of the clone, including eukaryotic, prokaryotic, or phage clone, but not to the way by which the indicated antibody design. For example, monoclonal antibodies used in the present invention, can be obtained on the basis of hybrid technology, first described by Kohler et, Nature, 256, 1975, cc.495, or they can be obtained by recombinant DNA methods (see, e.g., US 4816567), including, for example, the selection from phage libraries of antibodies by the methods described by Clackson et, Nature, 352, 1991, cc.624-628, and Marks et, J. Mol. Biol., 222, 1991, cc.581-597. These methods can be used to obtain monoclonal antibodies of mammalian, chimeric antibodies, humanized antibodies, human antibodies, domain antibodies, bivalent antibodies, antibodies vaccibodies, linear antibodies, and bespecifically anti�ate.

"Human antibody" can be an antibody obtained from a person or an antibody derived from a transgenic organism that has been "engineered" to produce specific human antibodies in response to the introduction of antigen, and which may be obtained by any method known in this field. In some methods, the elements of loci heavy and light chains of the person in introducing strains of the organism obtained from lines of embryonic stem cells that contain the target breaks endogenous loci heavy and light chains. The transgenic organism can synthesize human antibodies specific against human antigens, and the body can be used to obtain hybridomas secreting antibodies. The human antibody can also be an antibody in which the heavy and light chains are encoded by nucleotide sequence obtained from one or more sources of human DNA. The antibody, which is a fully human antibody, can be obtained also when designing methods for genetic or chromosomal transfection, and the phage display method or activated in vitro expression of ICOS T cells, known in this field.

The term "antibody-dependent cell-mediated cytotoxicity (ADCC)" refers to cells mediated response, which will�and, in which nonspecific cytotoxic cells (e.g. natural killer cells (NK - natural killer), neutrophils, and macrophages) recognize bound antibody on a target cell and then cause lysis of the target cells. In one embodiment of the present invention, such cells are human cells. Not wishing to be limited to any particular mechanism of action, it should be noted that these cytotoxic cells that mediate ADCC, usually Express Fc receptors (FcR). Primary cells for mediating ADCC, NK cells, Express FcγRIII only, and monocytes Express FcγRI, FcγRII, FcγRIII and/or FcγRIV. The FcR expression in hematopoietic cells is summarized Ravetch and Kinet in Annu. Rev. Immunol., 9, 1991, cc.457-492. To assess ADCC activity of a molecule can hold ADCC-assay in vitro, for example, described in patents US 5500362 or 5821337. Appropriate effector cells for such assays include mononuclear cells of peripheral blood (PBMC) and natural killer cells (NK). In another embodiment, or additionally, ADCC activity of interest molecules can be assessed in vivo, e.g., in animal models, for example, described Clynes, etc. in PNAS (USA), 95, 1998, cc.652-656.

"Complement-dependent cytotoxicity (KSC") refers to the ability of a molecule to initiate activation of complement and �'izirovat target in the presence of complement. The path of complement activation begins with the binding of the first component of the complement system (C1q) to a molecule (e.g. antibody), forming a complex with the cognate antigen. To assess activation of complement can hold CSC-analysis, for example, described Gazzano-Santoro et at, J. Immunol. Methods 202, 1996, p. 163.

The term "antibody-dependent phagocytosis or opsonization" in the context of the present invention relates to a cell-mediated reaction in which nonspecific cytotoxic cells that Express FcγR receptors, recognize bound antibody on a target cell and as a result cause phagocytosis of the target cells.

"Effector cells" are leukocytes which Express one or more FcR and exhibit effector function. Cells Express at least FcγRI, FCγRII, FcγRIII and/or FcγRIV and exhibit ADCC effector function. Examples of human leukocytes that mediate ADCC include mononuclear cells of peripheral blood (PBMC), natural killer cells (NK), monocytes, cytotoxic T cells and neutrophils.

The concept of "Fc receptor" or "FcR" is used to describe a receptor that binds to the Fc region of the antibody. In one of the embodiments of the present invention FcR is a natural sequence of the FcR person. In addition, in some� embodiments of the present invention, the FcR receptor is the receptor which binds an IgG antibody (a gamma receptor) and is receptors FcγRI, FcγRII, FcγRIII, and FcγRIV subclasses, including allelic variants and otherwise spliced forms of these receptors. The FcγRII receptors include FcγRIIA (an"activating receptor") and FcγRIIB (an"inhibiting receptor"), which have similar amino acid sequences that differ primarily in their cytoplasmic domains. The activating FcγRIIA receptor in its cytoplasmic domain contains immunoreceptor activator motif-based tyrosine (ITAM - immunoreceptor tyrosine-based activation motif). Inhibitory FcγRIIB receptor in its cytoplasmic domain contains immunoreceptor inhibitory motif-based tyrosine (ITIM - immunoreceptor tyrosine-based inhibition motif). (Cm. review of M. to Daeron, Annu. Rev. Immunol., 15, 1997, cc.203-234). The review of FcR are presented Ravetch and Kiner in Annu. Rev. Immunol., 9, 1991, cc.457-492, Capel, etc., Immunomethods, 4, 1994, cc.25-34 and de Haas et, J. Lab. Clin. Med., 126, 1995, cc.330-341. The term "FcR" unite in the present description and other FcR, including those that will be identified in the future. This concept also includes the neonatal receptor FcRn, which is responsible for the transfer of maternal IgG to the fetus (Guyer et, J. Immunol., 117, 1976, p. 587, Kim et al., Eur. J. Immunol., 24, 1994, p. 249).

The concept of "affinity" of an antibody to an epitope to the epitope used in the treatment (treatments) and described in the present invention, the tri�by the term well known in this field, and means the length or the strength of binding of an antibody to an epitope. Affinity may be measured and/or expressed in a variety of ways known in this field, including, but not limited to, the equilibrium constant of dissociation (KD or Kd), apparent equilibrium constant of dissociation (KD or Kd') and IC50 (amount needed for 50% inhibition in the competitive analysis). Obviously, for the purposes of the present invention, the affinity is a weighted average of the affinity for this population of antibodies that binds to the epitope. The value of KD' in the present invention are expressed in mg IgG per ml (or mg/ml) and indicates the amount of Ig expressed in mg/ml of serum, although can also be in mg/ml of plasma. If the affinity of the antibody used as the basis for the application of the methods of treatment described in the present invention, or the choice of methods of treatment described in the present invention, affinity of the antibody may be measured before and/or during treatment, and the values obtained can be used by the Clinician in assessing whether the sick person is an appropriate candidate for the application of this treatment.

In the context of the present invention, the term "avidity antibodies" means the measurement of the total binding strength (i.e., both parts of the antibody which antibody binds to the antigen. Avidity and�Titel can be measured to determine the bond dissociation of antigen-antibody with excess antigen, using any means known in this field, for example, modification of the indirect fluorescence antibody described by Gray and others, J. Virol. Meth., 44, 1993, cc.11-24, and other methods.

The term "epitope" is widely used in this area means any portion of a molecule that exhibits specific binding with the antibody. The term "antigen" means that portion of a molecule or molecule that contains an epitope, and, therefore, also specifically binds to the antibody.

The concept of "the half-life of antibodies in the context of the present invention means a pharmacokinetic property of the antibody, which is a measure of the average time saving of antibody molecules after their introduction. The half-life of the antibody may be expressed in the form of time required to eliminate 50% of a known quantity of immunoglobulin from the human body or its specific compartment, for example, measured in serum or plasma, i.e., the half-life of circulating antibodies, or in other tissues. The half-life can vary depending on the type and class of immunoglobulin. Usually increasing the half-life of the antibody leads to an increase of the average time of retention in the body (IEDs) by circulation of the introduced antibodies.

The term "isotype" refers to the classification of constant region of heavy�and light chains of the antibody. The constant domains of antibodies are not involved in binding to the antigen, but exhibit various effector functions. Depending on the amino acid sequence of the constant region of the heavy chain of the human antibody or immunoglobulin can be assigned to one of five major classes of immunoglobulins: IgA, IgD, IgE, IgG and IgM. Some of these classes can be further divided into subclasses (isotypes), e.g. IgG1 (gamma 1), IgG2 (gamma 2), IgG3 (gamma 3) and IgG4 (gamma 4), and IgA1 and IgA2. The constant region of the heavy chain, which correspond to the different classes of immunoglobulins are called α, δ, ε, γ and µ, respectively. Structure and three-dimensional configurations of different classes of immunoglobulins are well known. It is known that different classes of immunoglobulins only IgG1, IgG2, IgG3, IgG4 and IgM activate human complement. It is known that IgG1 and human IgG3 mediate ADCC in humans. Constant area light chain human can be classified into two major classes - the Kappa and lambda.

In the context of the present invention, the term "immunogenic" means that the compound is able to initiate an immune response (stimulating the production of specific antibodies and/or proliferation of specific T cells).

In the context of the present invention, the term "antigenicity" means that the connection is recognized by the antibodies�ohms or can be contacted with the antibody and induce an immune response.

The concept of "cure" or "treatment" or grammatical equivalents) imply that the severity of the condition of the subject is reduced or at least partially improved or facilitated by, and/or achieved some alleviation, mitigation or decrease in at least one clinical symptom, and/or suppression or delay of progression of a condition and/or prevent or delay the onset of disease or disease condition. Thus, the terms "treat" or "treatment" or grammatical equivalents) refer to the prophylactic and therapeutic treatment regimes.

In the context of the present invention the concept of "sufficient amount" or "amount sufficient to" achieve certain results, refers to the amount of the antibodies or compositions of the present invention, which is sufficient to produce the desired result, which is optionally a therapeutic effect (i.e., by introducing a therapeutically effective amount). For example, the concept of "sufficient amount" or "amount sufficient to" can refer to a quantity that is effective for the depletion of T cells expressing ICOS protein.

The term "therapeutically effective amount" in the context of this invention means the amount that includes not�AutoRAE improving the condition of the subject or of benefit to the subject. In other words, a "therapeutically effective" amount is an amount that provides some alleviation, reduction and/or decrease in at least one clinical symptom. Clinical symptoms associated with the disorders can be cured by the methods of the present invention, well known to specialists in this field. In addition, professionals in this field can appreciate that therapeutic effects need not necessarily be complete or curative, as long while some benefit is manifested in the attitude of a subject.

Brief description of figures

Fig.1. Amino acid sequence of VH domains (A) and VL (B) JMab-136 anti-ICOS antibody. The remains of the CDR as defined by Kabat are placed in frames and bold. Potential sites of O-glycosylation (T or S residues) and sites of deliciouse (DS or DG residues) are marked in gray.

Fig.2. Increased binding affinity IC9G1-aFuc with FcgRIIIa humans and macaques of graboid. Binding affinity (nm) IC9G1-aFuc with recombinant FcγR humans and macaques of graboid measured by comparing with a control antibody (IC009 and IC9G1), and to summarize the present figure.

Fig.3. IC9G1-aFuc inhibits CD3/ICOSL induced proliferation of T-cells. T-cells were incubated for 72 h in the tablet, covered with B7h-Fc (50 µl at a concentration of 4 μg/ml) and anti-CD3 anti�Elam (50 µl at a concentration of 0.2 μg/ml) in the presence of elevated amounts IC9G1-aFuc antibody. Shows the proliferation of T-cells as a function of concentration IC9G1-aFuc antibody. Data obtained from control experiments using antibodies IC009 and IC9G1, are also shown.

Fig.4. IC9G1-aFuc did not inhibit the proliferation of T-cells, human tonsils, mediated by anti-CD3/anti-CD28 antibody. Selected T-cells of human tonsils were incubated for 72 h in the plate coated with anti-CD3 and/or anti-CD28 antibodies. Show cell proliferation detected in the presence of 10 μg/ml IC9G1.

Fig.5. The ADCC activity of the antibody IC9G1-aFuc higher activity of antibodies IC9G1 or IC009. The ADCC activity was measured using stably transfected cells (A) HPB-ALL cells (HPB-ALL h-ICOS) and (B) Jurkat cells (Jurkat h-ICOS), ICOS expressing human as target cells. Activity magnitude EU50 antibodies IC9G1-aFuc and IC9G1 cells HPB-ALL h-ICOS is 138 648 PM and PM, respectively. Activity EU50 antibodies IC9G1-aFuc and IC9G1 on transgenic Jurkat cells h-ICOS is 5.7 PM and 61 PM, respectively.

Fig.6. The expression of ICOS in the tonsils of a person is limited to CD4+ TFHthe memory cells. Show anti-ICOS-colored variant of CD4+CD45RO-CXCR5 - source of T-cells and CD4+CD45RO+CXCR5+ TFHthe memory cells.

Fig.7. The ADCC activity of the antibody IC9G1-aFuc above the corresponding action of antibodies IC9G1 or IC009. The ADCC activity was measured using selected T cells in the tonsils as cells�to target. The size EU50 antibodies IC9G1-aFuc and IC9G1 is 8.2 PM and 60.4 PM, respectively, in this study.

Fig.8. Antibody IC9G1-aFuc mediates the action of ADCC on freshly isolated T cells target macaque spleen of graboid. (A) ICOS expression Profile of selected CD4+CD45RA+ source of T-cells and CD4+CD45RA - T cells memory macaque spleen of graboid determined using liquid cytometry. Shown by the points on the staining method of the flow cytometry analysis. The level of expression of ICOS CD4+CD45RA - T cell memory is significantly higher compared to CD4+CD45RA+ original T-cells. (B) Shows the curves of cytotoxicity ADCC antibodies IC009, IC9G1 and IC9G1-aFuc, measured over a dedicated T-cells in the spleen of macaques graboid. The ADCC activity of the antibody IC9G1-aFuc higher than that of antibodies IC009 or IC9G1. In the present study, the size EU50 antibodies IC9G1-aFuc and IC9G1 PM and is 14.6 236 PM, respectively.

Fig.9. Antibody IC9G1-aFuc mediates the action of ADCC against freshly isolated T-target cells from mesenteric lymph node (mesenteric lymph node BLUE) of macaque graboid. (A) expression Profile of ICOS in isolated from macaques of graboid BLUE CD4+CD45RA+nepodvizhnykh any impact of T cells was determined by flow cytometry analysis. Shows the results of the flow cytometry analysis of stained cells. The level of expression of ICOS in CD4+CD45RA-activated T cells is significantly higher than in CD4+CD45RA+ nepodvizhnykh to�for the effects of T-cells. (B) Shows curves ADCC cytotoxicity of antibodies IC009, IC9G1 and IC9G1-aFuc, measured with the use of isolated from macaques of graboid BLUE T-cells. The ADCC activity of the antibody IC9G1-aFuc higher compared with the corresponding figure of antibodies IC009 or IC9G1. The size EU50 action of antibodies IC9G1-aFuc and IC9G1 in this study is 17.1 RM 198 RM, respectively.

Fig.10. The pharmacokinetic profile IC9G1-aFuc in macaques of Griboedov. A single dose of 0.1 mg/kg, 1 mg/kg or 10 mg/kg antibody IC9G1-aFuc is injected intravenously makaka rabadam. The concentration of antibody IC9G1-aFuc is measured within 4 weeks after injection. Shows the concentration in serum IC9G1-aFuc as a function of time.

Fig.11. One intravenous dose IC9G1-aFuc significantly depletes the level of CD3+CD4+CD45RA_ICOS+ T cell memory in vivo in macaques of Griboedov. A single dose of 0.01 mg/kg 0.1 mg/kg, 1 mg/kg or 10 mg/kg antibody IC9G1-aFuc injected makaka rabadam. The level of CD3+CD4+CD45RA-ICOS+ T cell memory is subjected to monitoring. Levels normalized T-memory cells are shown as a function of time after injection IC9G1-aFuc. The introduction of a single dose of 0.1 mg/kg, 1 mg/kg or 10 mg/kg antibody IC9G1-aFuc leads to almost complete elimination of CD3+CD4+CD45RA_ICOS+ T-memory cells on day 4. The allocation of ICOS+ T cell memory is dose-dependent.

Fig.12. Description according to the flow cytometry analysis of b cells of the germinal center. B cells of the germinal center mA�Aki crabed to identify the form or CD3-CD20+IgM-CD95+ cells, or CD3-CD20+IgM-CD27+ cells.

Fig.13. One intravenous dose of antibody IC9G1-aFuc significantly reduces the level of ICOS+ T-Halpern memory cells mesenteric limouse (BLUE) and b cells of the germinal center BLUE in vivo in macaques of Griboedov. A single dose of 0.1 mg/kg or 10 mg/kg antibody IC9G1-aFuc injected makaka rabadam. Control animals treated with a dose of 10 mg/kg IC009 or FSB. Monitored levels of ICOS+ T-Halpern memory cells mesenteric limouse (BLUE) and b cells of the germinal center BLUE. Identify T-calpernia memory cells BLUE as CD3+CD4+CD45RA-ICOS+ cells. B cells of the germinal center BLUE identified as CD20+CD95+IgM - cells. (A) Shows the total number of BLUE T-cells and BLUE b-cell germinal centre on the 8th day after treatment. (B) Shows the percentage of depletion of ICOS+ T cells and the percentage of destruction of b cells of the germinal center on the 8th day after treatment. Introduction antibodies IC9G1-aFuc leads to dose-dependent depletion of ICOS+ T-Halpern memory cells and b cells of the germinal center from mesenteric lymph node (BLUE).

Fig.14. One intravenous dose of antibody IC9G1-aFuc significantly reduces the level of ICOS+ T-Halpenny of the memory cells of the spleen and b cells of the germinal center in macaques of Griboedov in vivo. A single dose of 0.1 mg/kg or 10 mg/kg antibody IC9G1-aFuc injected makaka rabadam. Control animals treated with 10 mg/kg IC009 or FSB. Spend monitoringhost ICOS+ T cells and memory b cells of the germinal center of the spleen during the study. Identify T-calpernia memory cells of the spleen as CD3+CD4+CD45RA-ICOS+ cells, b cells of the germinal center as CD3-CD20+CD95+IgM - cells. (A) Shows the total number of T-Halpenny of the memory cells of the spleen and b cells of the germinal center on 8th and 30th day after treatment. (B) Shows the percent depletion of T cells and decay of b-cell germinal centre on 8 and 29 days after treatment. Introduction IC9G1-aFuc leads to a significant depletion of T-Halpern memory cells and b cells of the germinal center of the spleen. The levels of exhaustion significantly higher in animals receiving antibody IC9G1-aFuc, compared with control animals receiving antibody IC009. The maximum depletion of T cells is achieved on the 8th day after the administration IC9G1-aFuc. The maximum level of depletion of b-cells of the germinal center see at 29 days after application of IC9G1-aFuc.

Fig.15. The germinal centers of the spleen atrophy at 29 days after a single dose of the antibody IC9G1-aFuc makaka rabadam. The morphology of the white pulp of the spleen are investigating after a single dose of the antibody IC9G1-aFuc. Show histological sections of the spleen allocated for 8 days (A) and 29 days (B) after administration of the antibody IC9G1-aFuc. Introduction IC9G1-aFuc leads to severe atrophy of the follicles of the spleen on the 29th day.

Fig.16. The alignment of long and short isoforms ICOS amino acid sequence (SEQ IDNO:32 and 33, respectively).

Fig.17. The complementarity of the nucleotide sequence ICOS mRNA (SEQ ID NO:34) and the selected macromolecule RNA.

Fig.18. The relative expression level of miR-101 in muscle samples of patients spongioform myositis with inclusions (SMV), polymyositis (PM) and dermatomyositis (DM) compared with healthy normal controls according to the measurement method TaqMan EOC-PCR.

Fig.19. Relative levels of mRNA (A) ICOS and ICOS-L, (B) CD4 and (B) CD3ε in samples of muscle tissue of patients spongioform myositis with inclusions (SMV), polymyositis (PM) and dermatomyositis (DM) compared with healthy normal controls according to the measurement method of Affymetrix whole genome alignment. (D) the Levels of expression of ICOS and ICOS-L mRNA in whole blood samples isolated from patients spongioform myositis with inclusions (SMV), polymyositis (PM) and dermatomyositis (DM) compared with healthy normal controls according to the measurement method TaqMan quantitative real-time PCR.

Fig.20. The relative expression levels of mRNA (A) ICOS and ICOSL, (B) CD4 and (B) CD3ε in foci of cutaneous lesions of SLE patients compared with normal controls, the results of real time PCR TaqMan.

Fig.21. The relative expression levels of mRNA (A), CD28, CTLA4, ICOS, ICOS-L, (B) CD4 and (B) CD3ε in whole blood of SLE patients compared with normal controls, the result� real-time PCR TaqMan.

Detailed description of the invention

The present invention relates to methods for production of anti-ICOS antibodies with enhanced effector function. Using the methods of the present invention, the original anti-ICOS antibody is modified to obtain an anti-ICOS antibody with enhanced effector function, e.g., increased ADCC, increased CSC and increased antibody-dependent phagocytosis, as well as other functions. Any anti-ICOS antibody that specifically binds to ICOS antigen of human rights, can serve as a source of antibodies for practicing the method of the present invention. In one embodiment of the present invention, anti-ICOS antibodies described in US 6803039, act as a source of antibody. In one of the embodiments of the present invention JMAb-136 (IgG2) anti-ICOS antibody acts as the reference antibody.

The present invention provides an anti-ICOS antibody with enhanced effector function. In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent effector function more effectively compared to the original anti-ICOS antibody. In one specific embodiment of the present invention, anti-ICOS antibody of the present invention mediates �titanosauria effector function more efficiently than the JMAb-136 (see US 6803039).

In one embodiment of the present invention, anti-ICOS antibody described in the present invention mediates antibody-dependent effector function more efficiently than the original anti-ICOS antibody, and the indicated effector function selected from the group consisting of antibody-dependent cell-mediated cytotoxicity (ADCC), complement-dependent cytotoxicity (CSC), antibody-dependent phagocytosis. In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more effectively than the original anti-ICOS antibody. In another embodiment of the present invention, anti-ICOS antibody of the present invention mediates complement-dependent cytotoxicity (CSC) more effectively than the original anti-ICOS antibody. In yet another variant implementation of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent phagocytosis more efficiently than the original anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent cell-dependent cytotoxicity more effectively than the original anti-ICOS antibody, wherein �aktivnosti determine ADCC, using the analysis of cytotoxicity in vitro. In some embodiments of the present invention, anti-ICOS antibody of the present invention mediates at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher maximum cytotoxicity in the analysis of ADCC in vitro compared with the original anti-ICOS antibody. In another specific embodiment of the present invention, anti-ICOS antibody of the present invention mediates increased maximum cytotoxicity, which is greater at least 2 times in at least 3 times in at least 4 times in at least 5 times or at least 10 times, the study in vitro ADCC compared to the maximum cytotoxicity of the original anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent cell dependent immune cytotoxicity (ADCC) more effectively than the JMab-136 anti-ICOS antibody, wherein the ADCC activity is determined using the in vitro assays for cytotoxicity. In yet another variant implementation of the present invention, anti-ICOS antibody according to the present �the turbine zobretenie mediates a higher maximum cytotoxicity in the analysis of ADCC in vitro which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% compared with the corresponding value of the JMab-136 anti-ICOS antibody. In another embodiment of the present invention, anti-ICOS antibody of the present invention mediates the maximum cytotoxicity analysis of ADCC in vitro, which, at least 2 times in at least 3 times in at least 4 times in at least 5 times or at least 10 times higher than the ones obtained for the JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention in the analysis of in vitro ADCC below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times the corresponding value of the original anti-ICOS antibody. In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention in the analysis of in vitro ADCC below at least about 2 times, at least about 5-fold, at least about 10 times, �of at least about 20 times, at least about 50-fold, or at least about 100 times the corresponding value JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more effectively than the original anti-ICOS antibody, wherein the ADCC activity is determined using the analysis of cytotoxicity in vivo. In one embodiment of the present invention, anti-ICOS antibody of the present invention according to the analysis of ADCC in vivo mediates the maximum cytotoxicity which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher maximum cytotoxicity of an anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent cell-mediated cytotoxicity (ADCC) more effectively than the JMab-136 anti-ICOS antibody, wherein the ADCC activity is determined using the analysis of cytotoxicity in vivo. In one embodiment of the present invention, anti-ICOS antibody according to the present Fig�the plants according to the analysis of ADCC in vivo mediates the maximum cytotoxicity, which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher maximum cytotoxicity JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates complement-dependent cytotoxicity (CSC) more effectively than the original anti-ICOS antibody, and the activity KSC determined using analysis of cytotoxicity in vitro. In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates the maximum cytotoxicity, which in the analysis CSC in vitro exceeds at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%, the cytotoxicity of the original anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates complement-dependent cytotoxicity (CSC) more efficiently than JMab-136 anti-ICOS antibody, and the effect of CSC defined�represent, using the study of cytotoxicity in vitro. In one embodiment of the present invention, anti-ICOS antibody of the present invention according to a study CSC in vitro mediates the maximum cytotoxicity, which compared with the JMab-136 anti-ICOS antibody is higher, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention according to a study CSC in vitro compared with the original anti-ICOS antibody is lower, at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold or at least about 100 times. In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention according to in vitro studies KSC compared to the JMab-136 anti-ICOS antibody is lower, at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold or at least about 100 p�h.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent phagocytosis more efficiently than anti-ICOS antibody, which follows from the results of the analysis of cytotoxicity in vitro. In one embodiment of the present invention, anti-ICOS antibody of the present invention according to a study in vitro antibody-dependent phagocytosis mediates the maximum cytotoxicity, which compared with the original anti-ICOS antibody is higher, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%.

In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent phagocytosis more efficiently compared to the JMab-136 anti-ICOS antibody, which follows from the results of the analysis of cytotoxicity in vitro. In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates a higher maximum cytotoxicity in the study of in vitro antibody-dependent phagocytosis, which is at least about 5%, at least about 10%, by IU�Isha least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention in vitro antibody-dependent phagocytosis below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared to the original anti-ICOS antibody. In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention in vitro antibody-basicimage phagocytosis below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the corresponding value with the introduction pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region. In another embodiment of the present invention anti-ICOS of the present invention comprises a variant Fc region, which has an altered affinity in relation to the protein ligand of the Fc. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that has an altered affinity against Fc ligand selected from the group consisting of FcγRIA, FcγRIIA, FcγRIIB, FcγRIIIA, FcγRIIIB, FcγRIV, and C1q. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that has an altered affinity for the FcγRIIIA protein. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that has an altered affinity with the protein C1q. In another embodiment of the present invention the protein is an Fc ligand may be a protein ligand Fc mouse, human or Primate (e.g., monkeys of graboid).

In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that has an increased affinity to the protein ligand Fc. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that has an increased affinity to an Fc ligand selected from the group consisting of FcγRIA, FcγRIIA, FcγRIIB, FcγRIIIA, FcγRIIIB, FcγRIV, and C1q. In one of the embodiments of the infusion�his invention of an anti-ICOS antibody of the present invention comprises a variant Fc region, which has a high affinity against FcγRIIIA protein. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region with enhanced affinity in relation to the protein C1q. In yet another variant implementation of the present invention the protein is an Fc ligand may be a protein ligand Fc mouse, human or Primate (e.g., monkeys of graboid).

In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region, wherein the specified variant Fc region comprises at least one amino acid substitution, insertion or division. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region, comprising at least one amino acid substitution, insertion or deletion, and the specified at least one amino acid substitution, insertion or deletion results in increased affinity of the Fc ligand selected from the group consisting of: FcγRIA, FcγRIIA, FcγRIIB, FcγRIIIA, FcγRIIIB, FcγRIV, and C1q. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising at least one amino acid substitution, insertion or deletion, and the specified at least one AMI�kislotno substitution, the insertion or deletion results in increased affinity for the FcγRIIIA protein. In yet another variant implementation of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising at least one amino acid substitution, insertion or deletion, and the specified at least one substitution of an amino acid residue insertion or deletion results in increased affinity to the protein C1q. In yet another variant implementation of the present invention the protein of the Fc ligand may be a protein ligand Fc mouse, human or Primate (e.g., monkeys of graboid).

In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region, comprising at least one amino acid substitution, insertion or deletion, and the specified at least one amino acid residue selected from the group consisting of residue 239, 330 and 332, and amino acid residues are numbered according to the EU index. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising at least one amino acid substitution, insertion or deletion, and the specified at least one substituted, insertional or delegated amino acid residue selected from the group�, consisting of residue 239, 330 and 332, and amino acid residues are numbered according to the EU index. In another embodiment of the present invention, anti-ICOS antibody described in the present invention comprises a variant Fc region, comprising at least one amino acid substitution, wherein the specified at least one substituted amino acid residue selected from the group consisting of residue 239, 330 and 332, and amino acid residues are numbered according to the EU index. In another embodiment of the present invention, anti-ICOS antibody described in the present invention comprises a variant Fc region, comprising at least one amino acid substitution, wherein the specified at least one amino acid substitution selected from the group consisting of S239D, A330L, A330Y, and I332E, in which amino acid residues are numbered according to the EU index. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising amino acid substitution S239D, A330L, and I332E, wherein amino acid residues are numbered according to the EU index.

In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising at least one amino acid residue selected from the group comprising�th of the: D at the position 239, E at position 239, L at position 330, Y at position 330, E at position 332 and D at position 332, wherein amino acid residues are numbered according to the EU index. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising D at position 239, L at position 330 and E at position 332, wherein amino acid residues are numbered according to the EU index.

In one embodiment of the present invention, anti-ICOS antibody of the present invention includes the Fc region and engineered Fc region comprises a post-translational modification, which differs from the modification of the original anti-ICOS antibody. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region, wherein the specified engineered Fc region comprises complex N-glycoside-linked chains of Sugars, in which fucose is not bound to N-acetylglucosamine in decreasing the end of the sugar chain.

In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region with an altered affinity in relation to the ligand protein of the Fc. In another embodiment of the present invention, anti-ICOS antibody of the present invention include�em engineered Fc region, which has an altered affinity against Fc ligand selected from the group consisting of FcγRIA, FcγRIIA, FcγRIIB, FcγRIIIA, FcγRIIIB, FcγRIV, and C1q. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that has an altered affinity in relation to the FcγRIIIA protein. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that has an altered affinity in relation to the protein C1q.

In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that has an increased affinity in relation to the protein ligand of the Fc. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that has an increased affinity against Fc ligand selected from the group consisting of FcγRIA, FcγRIIA, FcγRIIB, FcγRIIIA, FcγRIIIB, FcγRIV, and C1q. In yet another variant implementation of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that has an increased affinity against FcγRIIIA protein. In another embodiment of the present invention, anti-ICOS antibody of the present invention ek�uchet engineered Fc region, which has a high affinity against protein C1q.

In one of the embodiments of the present invention, an anti-ICOS antibody of the present invention includes an engineered Fc region, wherein the specified engineered Fc region comprises a reduced level of fucose compared to the native antibody. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region comprising a reduced level of fucose, wherein the said decrease in the level of fucose leads to increased affinity of the Fc ligand selected from the group consisting of FcγRIA, FcγRIIA, FcγRIIB, FcγRIIIA, FcγRIIIB, FcγRIV, and C1q. In yet another variant implementation of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region comprising a reduced level of fucose, wherein the said decrease in the level of fucose leads to increased affinity for the FcγRIIIA protein. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region comprising a reduced level of fucose, wherein the said decrease in the level of fucose leads to increased affinity to the protein C1q.

Anti-ICOS antibodies described in the present invention include the Fc region of high binding affinity relative�tion of the protein human FcγRIIIA. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an Fc region that has an affinity constant or Ka(kon/koff) equal to at least 103M-1at least 5×103M-1at least 104M-1at least 5×104M-1at least 105M-1at least 5×105M-1at least 106M-1at least 5×106M-1at least 107M-1at least 5×107M-1at least 108M-1at least 5×108M=-1at least 10 M-1at least 5×109M-1at least 1010M-1at least 5×1010M-1at least 1011M-1at least 5×1011M-1at least 1012M-1or at least 5×1012M-1. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises an Fc region with a dissociation constant or Kd(koff/kon) less than 5×10-3M, less than 10-3M, less than 5×10-4M, less than 10-4M, less than 5×10-5M, less than 10-5M, less than 5×10-6M, less than 10-6M, less than 5×10-7M, less than 10-7M, less than 5×10-8M, m�10 -8M, less than 5×10-9M, less than 10-9M, less than 5×10-10M, less than 10-10M, less than 5×10-11M, less than 10-11M, less than 5×10-12M, or less than 10-12M.

The antibody used in accordance with the method of the present invention, can include the Fc region that binds to human FcγRIIIA with a dissociation constant (Kd) less than 3000 nm, less than 2500 nm, less than 2000 nm, less than 1500 nm, less than 1000 nm, less than 750 nm, less than 500 nm, less than 250 nm, less than 200 nm, less than 150 nm, less than 100 nm, less than 75 nm, less than 50 nm, less than 25 nm, less than 10 nm, less than 5 nm, less than 1 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA) (company Biacore International AB, Uppsala, Sweden). In one embodiment of the present invention, the antibody used in accordance with the method described in the present invention can include the Fc region that binds to human FcγRIIIA with a dissociation constant (Kd) 1-3000 nm, 1-3000 nm, 1-2000 nm, 1-1500 nm 1-1000 nm, 1-750 nm, 1-500 nm, about 1-250 nm, 1-100 nm, 1-50 nm, 1-25 nm, 1-10 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA). In another embodiment of the present invention, anti-ICOS antibody, which is used to�lsout in accordance with the method, described in the present invention, can include the Fc region that binds to human FcγRIIIA with a dissociation constant (Kd) 500 nm, 250 nm, 100 nm, 75 nm, 50 nm, 25 nm, 10 nm or 1 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA).

Anti-ICOS antibodies described in the present invention include Fc region with high affinity against FcγRIIIA protein is not from the body of the monkey (e.g., not from macaques of graboid). In one of the embodiments of the present invention, anti-ICOS antibody of the present invention includes an Fc region that has an affinity constant or Ka(kon/koff) constituting at least 103M-1at least 5×103M-1at least 104M-1at least 5×104M-1at least 105M-1at least 5×105M-1at least 106M-1at least 5×106M-1at least 107M-1at least 5×107M-1at least 108M-1at least 5×108M-1at least 109M-1at least 5×109M-1at least 1010M-1at least 5×1010M-1at least 10 11M-1at least 5×1011M-1at least 1012M-1or at least 5×1012M-1. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes an Fc region that has a dissociation constant or Kd(koff/kon) less than 5×10-3M, less than 10-3M, less than 5×10-4M, less than 10-4M, less than 5×10-5M, less than 10-5M, less than 5×10-6M, less than 10-6M, less than 5×10-7M, less than 10-7M, less than 5×10-8M, less than 10-8M, less than 5×10-9M, less than 10-9M, less than 5×10-10M, less than 10-10M, less than 5×10-11M, less than 10-11M, less than 5×10-12M, or less than 10-12M.

The antibody used in accordance with the method described in the present invention can include the Fc region which binds FcγRIIIA with monkeys (e.g., macaques of graboid) with a dissociation constant (Kd) less than 3000 nm, less than 2500 nm, less than 2000 nm, less than 1500 nm, less than 1000 nm, less than 750 nm, less than 500 nm, less than 250 nm, less than 200 nm, less than 150 nm, less than 100 nm, less than 75 nm, less than 50 nm, less than 25 nm, less than 10 nm, less than 5 nm, less than 1 nm, which was calculated according to the method described in the present invention or known to those skilled in the art (e.g., BIAcore analysis, ELISA) (company Biacore International AB, Uppsala, Sweden). In one embodiment �of sushestvennee present invention, the antibody, used in accordance with the method described in the present invention can include the Fc region which binds FcγRIIIA monkeys (e.g., macaques of graboid) with a dissociation constant (Kd) 1-3000 nm, 1-3000 nm, 1-2000 nm, 1-1500 nm 1-1000 nm, 1-750 nm, 1-500 nm, about 1-250 nm. 1-100 nm, 1-50 nm, 1-25 nm, 1-10 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA). In another embodiment of the present invention, anti-ICOS antibody used in accordance with the method described in the present invention can include the Fc region which binds FcγRIIIA with monkeys (e.g., macaques of graboid) with a dissociation constant (Kd) 500 nm, 250 nm, 100 nm, 75 nm, 50 nm, 25 nm, 10 nm or 1 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA).

Anti-ICOS antibodies described in the present invention include Fc region having a high binding affinity to FcγRIIIA protein of the mouse. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes the Fc region with an affinity constant or Ka(kon/koff) constituting at least 103M-1at least 5×10 3M-1at least 104M-1at least 5×104M-1at least 105M-1at least 5×105M-1at least 106M-1at least 5×106M-1at least 107M-1at least 5×107M-1at least 108M-1at least 5×108M-1at least 109M-1at least 5×109M-1at least 1010M-1at least 5×1010M-1at least 1011M-1at least 5×1011M-1at least 1012M-1or at least 5×1012M-1. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes an Fc region that has a dissociation constant or Kd(koff/kon) less than 5×10-3M, less than 10-3M, less than 5×10-4M, less than 10-4M, less than 5×10-5M, less than 10-5M, less than 5×10-6M, less than 10-6M, less than 5×10-7M, less than 10-7M, less than 5×10-8M, less than 10-8M, less than 5×10-9M, less than 10-9M, less than 5×10-10M, less than 10-10M, less than 5×10-11M, less than 10-11M, less than 5×10-12M, or less than 10-12M.

The antibody used in accordance with the method, motorisation in the present invention, can include the Fc region that binds to mouse FcγRIIIA with a dissociation constant (Kd) less than 3000 nm, less than 2500 nm, less than 2000 nm, less than 1500 nm, less than 1000 nm, less than 750 nm, less than 500 nm, less than 250 nm, less than 200 nm, less than 150 nm, less than 100 nm, less than 75 nm, less than 50 nm, less than 25 nm, less than 10 nm, less than 5 nm, less than 1 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA) (company Biacore International AB, Uppsala, Sweden). In one embodiment of the present invention, the antibody used in accordance with the method described in the present invention can include the Fc region that binds to mouse FcγRIIIA with a dissociation constant (Kd) 1-3000 nm, 1-3000 nm, 1-2000 nm, 1-1500 nm 1-1000 nm, 1-750 nm, 1-500 nm, about 1-250 nm, 1-100 nm, 1-50 nm, 1-25 nm, 1-10 nm, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA). In another embodiment of the present invention, anti-ICOS antibody used in accordance with the method described in the present invention can include the Fc region that binds to mouse FcγRIIIA with a dissociation constant (Kd) of 500 nm, 250 nm, 100 nm, 75 nm, 50 nm, 25 nm, 10 nm or 1 nm in evaluation applying the method described � the present invention or known to those skilled in the art (for example, the BIAcore analysis, ELISA).

In one embodiment of the present invention, anti-ICOS antibodies of the present invention include one, two, three, four, five or all six CDR regions of the antibody JMAb-136 (see US 6803039).

Amino acid sequence regions CDR1, CDR2 and CDR3 variable region of the heavy chain of the antibody JMAb-136, indicated by Kabat numbering, define in the form SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10, respectively. Amino acid sequence regions CDR1, CDR2 and CDR3 variable region light chain antibody JMAb-136, indicated by Kabat numbering, define in the form SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5, respectively.

The Kabat numbering is based on the fundamentally important work of Kabat and others, published in 1991, publication No. 91-3242 in three volumes, published by the National Institute of health. National technical information service (numbering is called in the present invention "Kabat"). Kabat is the alignment of many sequences of chains of immunoglobulin isotypes of antibodies of different species. Aligned sequences are numbered according to the unified numbering system - the numbering system of Kabat. Sequence Kabat have been updated after the publication of the 1991 and made available as an electronic database of sequences (version 1997 can be perekopirovannye on another computer). Any sequence th�of globulin can be numbered according to the Kabat system by aligning the reference sequence Kabat. Thus, the Kabat numbering system is a uniform system for numbering chains of immunoglobulins. Unless otherwise indicated, all amino acid sequence of the immunoglobulin, as described in the present invention, numbered according to the Kabat numbering system. Similarly, all individual provisions of amino acids in the present invention, numbered according to the Kabat numbering system.

In some embodiments of the present invention, anti-ICOS antibody described in the present invention, may include a variable region, VH, comprising at least one CDR region having an amino acid sequence selected from the group consisting of SEQ ID NO:8, SEQ ID NO:9 and SEQ ID NO:10. In some embodiments of the present invention, anti-ICOS antibody of the present invention may include a VH domain with amino acid sequence SEQ ID NO:7.

In some embodiments of the present invention, anti-ICOS antibody described in the present invention, may include a variable region light chain, VK, comprising at least one CDR region having an amino acid sequence selected from the group consisting of sequences SEQ ID NO:3, SEQ ID NO:4 and SEQ ID NO:5. In some embodiments of the present invention, anti-ICOS antibody of the present invention mo�et to include VK domain, having the amino acid sequence of SEQ ID NO:2.

In one embodiment of the present invention, anti-ICOS antibody of the present invention includes the VK domain having the amino acid sequence of SEQ ID NO:2, and additionally includes a VH domain having the amino acid sequence of SEQ ID NO:7.

The present invention provides antibodies that bind to the protein human ICOS, comprising derivatives of the VH domain, VH CDR1, VH CDR2, VH CDR3, a VK domain, VK CDR1, VK CDR2 or VK CDR3, as described in the present invention, which can bind to human ICOS. Standard techniques known to experts in this field can be used to introduce mutations (e.g., insertions, deletions and/or substitutions) in the nucleotide sequence encoding the antibody, including, for example, site-directed mutagenesis and PCR-mediated mutagenesis, which are commonly used to generate amino acid substitutions. In one embodiment of the present invention, the VH and/or VK CDR derivatives may include less than 25 amino acid substitutions, less than 20 amino acid substitutions, less than 15 amino acid substitutions, less than 10 amino acid substitutions, less than 5 amino acid substitutions, less than 4 amino acid substitutions, less than 3 amino acid substitutions, less than 2 amino acid substitutions, or 1 amino acid� substitution compared to the original VH and/or VK CDR regions of the antibody JMab-136 anti-ICOS. In another embodiment of the present invention derivatives of the VH and/or VK region CDR may contain conservative amino acid substitution (e.g., above), produced according to the provisions of one or more calculated no critical amino acid residues (i.e., amino acid residues that do not have a fundamentally important values for antibodies for specific binding to human ICOS). Mutations can be introduced randomly along the entire length or part of the coding sequences of the VH and/or VK CDR, for example, by a method of saturating mutagenesis and the resulting mutants can be subjected to screening for the detection of biological activity to identify mutants that retained activity. After mutagenesis, the encoded antibody can be expressed and the antibody can be determined.

The present invention also provides antibodies that bind to human ICOS, moreover, these antibodies or fragments of antibodies, comprising one or more CDR regions, and these areas include CDR amino acid sequence that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at �'ere and 85%, at least 90%, at least 95% or at least 99% identical to the amino acid sequence of one or more CDR regions of the antibody JMab-136 anti-ICOS. The percent identity of two amino acid sequences can be determined by any method known to specialists in this field, including, but not limited to, a method of searching protein BLAST.

The present invention also relates to antibodies that bind to human ICOS, moreover, these antibodies or fragments of antibodies include VH and/or VK domain and the VH and/or VK domains contain amino acid sequence that is at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% identical to the amino acid sequences of VH and VK domains of the antibody JMab-136 anti-ICOS. The percent identity of two amino acid sequences can be determined by experts in this field any method, including through research protein BLAST method, but not only them.

In one embodiment of the present invention, anti-ICOS antibody of the present invention can bind to human ICOS with� affinity, comparable to the affinity of JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody of the present invention specifically binds to the same epitope ICOS, that of the JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody specifically competes with the JMab-136 anti-ICOS antibody for binding to ICOS. Study of competition can be accomplished using any method of analysis of binding known in this field method, for example, ELISA, radioimmunoassay, liquid cytometry and other methods.

The present invention also relates to polynucleotides, including polynucleotide sequences that encode an anti-ICOS antibody with enhanced effector function. The present invention also relates to polynucleotides that gibridizatsiya under stringent conditions of hybridization or low-stringency described in the present invention, polynucleotides that encode an anti-ICOS antibody with enhanced effector function.

In one embodiment of the present invention, the polynucleotide of the present invention encoding an anti-ICOS antibody with enhanced effector function, as described in the present invention, which includes an optimized polynucleotide sequence�lnost. In one embodiment of the present invention, the polynucleotide of the present invention encoding the VH domain of the antibody described in the present invention includes the nucleotide sequence of SEQ ID NO:28. In one embodiment of the present invention, the polynucleotide of the present invention encoding VK domain antibodies described in the present invention includes the nucleotide sequence of SEQ ID NO:29. In yet another variant implementation of the present invention, the polynucleotide of the present invention encoding a heavy chain of the antibody described in the present invention includes the nucleotide sequence of SEQ ID NO:30. In another embodiment of the present invention, the polynucleotide of the present invention encoding a light chain of the antibody described in the present invention includes the nucleotide sequence of SEQ ID NO:31.

Another variant implementation of the present invention is a vector comprising one or more nucleotide sequences encoding an anti-ICOS antibody with enhanced effector function.

In one embodiment of the present invention, the vector according to the present invention includes one or more nucleotide sequences encoding an anti-ICOS antibody with enhanced effector function�Oia, moreover, the nucleotide sequence is optimized nucleotide sequence. In another embodiment of the present invention, the vector according to the present invention includes the nucleotide sequence of SEQ ID NO:28. In yet another variant implementation of the present invention, the vector according to the present invention includes the nucleotide sequence of SEQ ID NO:29. In yet another variant implementation of the present invention, the vector according to the present invention includes the nucleotide sequence of SEQ ID NO:30. In another embodiment of the present invention, the vector according to the present invention includes the nucleotide sequence of SEQ ID NO:31. In one embodiment of the present invention, the vector according to the present invention includes one or more nucleotide sequences encoding an anti-ICOS antibody with enhanced effector function, wherein the nucleotide sequence is selected from the group including sequences SEQ ID NO:28-31. In another embodiment of the present invention, the vector according to the present invention includes one or more nucleotide sequences encoding an anti-ICOS antibody with enhanced effector function, wherein the nucleotide sequence is selected from the group including sequentially�ti SEQ ID NO:28-31.

The present invention also refers to the selected cells comprising the vector and the specified vector contains one or more nucleotide sequences encoding an anti-ICOS antibody with enhanced effector function. In one of the embodiments of the present invention, the isolated cells of the present invention include a polynucleotide comprising the nucleotide sequence selected from the group comprising SEQ ID NO:28-31. In another embodiment of the present invention, the isolated cells of the present invention include a polynucleotide comprising the nucleotide sequence selected from the group comprising SEQ ID NO:28-31.

To anti-ICOS antibodies of the present invention are IgG1, IgG2, IgG3 or IgG4 isotypes of human rights.

The present invention also relates to pharmaceutical compositions comprising anti-ICOS antibody with enhanced effector function.

Another object of the present invention relates to methods for the treatment and prevention mediated T-cell diseases and disorders, for example, but their list is not limited to, chronic infections, autoimmune diseases or disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and proliferative disorders T-TC�current, includes an introduction to someone else in need, a therapeutically effective amount of an anti-ICOS antibody with enhanced effector function.

The present invention relates to an anti-ICOS antibodies with enhanced effector function, and also to compositions comprising these antibodies. In some embodiments of the present invention, anti-ICOS antibody of the present invention can mediate antigen-dependent cell-mediated cytotoxicity (ADCC). In other embodiments, the present invention is directed to compositions comprising anti-ICOS antibody IgG1 and/or IgG3 human isotype, as well as on anti-ICOS antibody IgG2 and/or IgG4 human isotype that is able to mediate ADCC, CSC person and/or antibody-dependent phagocytosis.

Anti-ICOS antibodies described in the present invention, may have a high binding affinity to the antigen human ICOS. For example, the antibody described in the present invention, may have a rate constant of Association or kon(antibody (Ab) + antigen (Ag)k-on→ Ab-Ag) of at least equal to 2×105M-1·-1at least 5×105M-1·-1at least 106M-1·-1at least 5×106M-1·-1at least 107M-1·-1at least 5×10 M-1·-1or at least 108M-1·-1.

In another embodiment of the present invention, anti-ICOS antibody may have a degree of koff((Ab-Ag)k-off→ antibody (Ab) + antigen (Ag)) of less than 5×10-1with-1less than 10-1with-1, less than 5×10-2with-1less than 10-2with-1, less than 5×10-3with-1less than 10-3with-1, less than 5×10-4with-1or less than 10-4with-1. In another embodiment of the present invention, the antibody of the present invention has a value of koffless than 5×10-5with-1less than 10-5with-1, less than 5×10-6with-1less than 10-6with-1, less than 5×10-7with-1less than 10-7with-1, less than 5×10-8with-1less than 10-8with-1, less than 5×10-9with-1less than 10-9with-1or less than 10-10with-1.

In another embodiment of the present invention, anti-ICOS antibody may have an affinity constant or Ka(kon/koff) equal to at least 102M-1at least 5×102M-1at least 103M-1at least 5×103M-1at least 104M-1at least 5×104M-1at least 105M-1at least 5×105M-1on minicamera 10 6M-1at least 5×106M-1at least 107M-1at least 5×107M-1at least 108M-1at least 5×108M-1at least 109M-1at least 5×109M-1at least 1010M-1at least 5×1010M-1at least 1011M-1at least 5×1011M-1at least 1012M-1at least 5×1012M-1at least 1013M-1at least 5×1013M-1at least 1014M-1at least 5×1014M-1at least 1015M-1or at least 5×1015M-1. In yet another variant implementation of the present invention, anti-ICOS antibody may have a dissociation constant or Kd(koff/kon) constituting less than 5×10-2M, less than 10-2M, less than 5×10-3M, less than 10-3M, less than 5×10-4M, less than 10-4M, less than 5×10-5M, less than 10-5M, less than 5×10-6M, less than 10-6M, less than 5×10-1M, less than 10-7M, less than 5×10-8M, less than 10-8M, less than 5×10-9M, less than 10-9M, less than 5×10-10M, less than 10-10M, less than 5×10-11M, less than 10-11M, less than 5×10-12M, less than 10-12M, less than 5×10-13 M, less than 10-13M, less than 5×10-14M, less than 10-14M, less than 5×10-15M, or less than 10-15M.

The antibody used in accordance with the method described in the present invention may immunospecificity contact ICOS and may have a dissociation constant (Kd) of less than 3000 PM, less than 2500 PM, less than 2000 PM, less than 1500 PM, less than 1000 PM, less than 750 PM, less than 500 PM, less than 250 PM, less than 200 PM, less than 150 PM, less than 100 PM, less than 75 PM, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA) (company Biacore International AB, Uppsala, Sweden). In one embodiment of the present invention, the antibody used in accordance with the method described in the present invention may immunospecificity contact ICOS antigen of human rights and may have a dissociation constant (Kd), component 25-3400 PM, 25-3000 PM, 25-2500 PM, 25-2000 PM, 25-1500 PM, 25-1000 PM, 25-750mm PM 25-500 PM, 25-250 PM, 25 to 100 PM, 25 to 75 PM, 25 to 50 PM, which follows from the results of analysis using the method described in the present invention, or method known in the art (e.g., BIAcore analysis, ELISA). In another embodiment of the present invention, anti-ICOS antibody used in accordance with the method described in this invented�and, can immunospecificity contact ICOS and may have a dissociation constant (Kd) of 500 PM, 100 PM, 75 PM or 50 PM, which was determined by the method described in the present invention or known to those skilled in the art (e.g., BIAcore analysis, ELISA).

The present invention is also polynucleotides comprising a nucleotide sequence encoding an anti-ICOS antibody with enhanced effector function. The present invention is also polynucleotides that gibridizatsiya in tough conditions and in conditions of low rigidity, for example, described in the present invention, polynucleotides that encode an anti-ICOS antibody with enhanced effector function.

To the hard conditions of hybridization include, but not limited to, hybridization with the DNA bound to the filter in 6X sodium chloride/sodium citrate (SSC) at a temperature of about 45°C followed by one or more washes in 0.2 X SSC/0,1% SDS at a temperature of about 50-65°C, and high rigidity, for example, hybridization with the DNA bound to the filter in 6X SSC at a temperature of about 45°C followed by one or more washes in 0.1 X SSC/0.2% of SDS at a temperature of about 60°C, or any other conditions stringent hybridization are known to those skilled in the art (see, for example, kN.: "Current Protools in Molecular Biology" ed. Ausubel, P. M. et al., 1989, vol. 1, Izd-VA Green Publishing Associates, Inc. and John Wiley and Sons, Inc., New York, cc.6.3.1-6.3.6 and 2.10.3).

The polynucleotides may be obtained, and the nucleotide sequence may be determined by any method known in this field. For example, if the known nucleotide sequence of the antibody, the polynucleotide encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described Kutmeier, etc., BioTechniques 17, 1994, p. 242), which, briefly, involves the synthesis of overlapping oligonucleotides containing portions of the sequence encoding antibody, annealing and ligation of those oligonucleotides, and then amplification legirovannykh oligonucleotides by PCR.

The polynucleotide encoding the antibody can also be obtained from nucleic acid from a corresponding source. If a clone containing a nucleic acid encoding a specific antibody is not available, but the sequence of the antibody molecule is known, a nucleic acid encoding the immunoglobulin may be chemically synthesized or obtained from the appropriate source (e.g., from a cDNA library of antibodies, or selected cDNA library, or nucleic acid, preferably polyamide+RNA, isolated from, any tissue or cells expressing the antibody, for example, cells of hybridomas, you�early for expression of the antibody) by PCR amplification, using gibridizatsiya synthetic primers for 3' and 5' ends of the sequence or cloning using an oligonucleotide probe specific for the particular gene sequence to identify, e.g., a cDNA clone from a cDNA library that encodes the antibody. Amplified nucleic acid obtained by PCR, can then be cloned into appropriate replicable cloning vectors using any method known in this field.

The present invention also provides antibodies that effectively Deplete cells expressing ICOS, the system model of the mouse with the transplant. In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may be at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of ICOS-expressing cells in the mouse model with the transplant.

In one embodiment of the present invention, the introduction of one�th or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing cells in mouse models with transplant is more effective in comparison with the original anti-ICOS antibody (e.g., an antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing cells in mouse models with transplant is more effective than fokusirovanie JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in mouse models with the transplant, which exceeds at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times, the depletion of ICOS-expressing cells caused the original anti-ICOS antibody (e.g., antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more Thera�efticiency doses of anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in mouse models with graft that exceeds at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times, the depletion of ICOS-expressing cells caused the original anti-ICOS antibody is more efficient than fokusirovanie JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing cells in mouse models with the graft below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times the similar value of the original anti-ICOS antibody (e.g., antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing cells in mouse models with the graft below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20 times, less�St least about 50 times, or at least about 100 times the similar value of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence domain, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in mouse models with the transplant, which exceeds at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% similar to the baseline anti-ICOS antibody (e.g., antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-Express�tion of cells in the model mice with graft, which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing cells in a mouse model with a graft that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody according to the present�the invention achieves a higher depletion of ICOS-expressing cells in mouse models with graft which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater than depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention also describes antibodies that efficiently Deplete ICOS-expressing cells in the system transgenic mouse model. In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of ICOS-expressing cells in the system transgenic mouse model.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing cells in a transgenic mouse model bol�e effectively than anti-ICOS antibody (e.g., an antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing cells in a transgenic mouse model is more efficient in comparison with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in a transgenic mouse model, which is higher than at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times, the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable domain amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS �ntitle of the present invention reaches the depletion of ICOS-expressing cells in a transgenic mouse model, which is higher, at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times compared with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing cells in a transgenic model mice is lower, at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times the similar value of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing cells in transgenic mouse models below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the same quantities�th anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-acupressure cells in a transgenic mouse model more, at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%, compared with the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in a transgenic mouse model more, at least about 5%, at least about 10%, at least p�around 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%, compared with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves enhancement of the depletion of ICOS-expressing cells in a transgenic mouse model, at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times compared with the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention leads to a higher depletion of ICOS-expressing cells in a transgenic mouse model, which is at least about 2 times, m�Nisha least about 5 times, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times higher in comparison with the introduction of pulselearning JMab-136 anti-ICOS antibody.

The present invention also provides antibodies that effectively Deplete cells expressing ICOS, Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may result in the depletion of cells expressing ICOS, in primates (monkeys or humans) at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100%.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing cells in a Primate (monkey or human) more efficiently compared to the original anti-ICS antibodies (e.g., an antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing cells in a Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in a Primate (monkey or human) that exceeds at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times, the exhaustion caused by the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses and�t-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing cells in a Primate (monkey or human), at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times compared with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing cells in a Primate (monkey or human) is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times less than the corresponding value of initial anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing cells in a Primate (monkey or human) is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 �AZ smaller magnitudes compared with the corresponding value of initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% more than achieved the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, by �ENISA least about 50%, at least about 75%, at least about 100% greater depletion of ICOS-expressing cells in a Primate (monkey or human) compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10 rash, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times higher depletion achieved initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15 times, at least p�around 20 times, at least about 25 fold, at least about 50-fold, or at least about 100 times greater depletion of ICOS-expressing cells in a Primate (monkey or human) compared to fokusirovannym JMab-136 anti-ICOS antibody.

The present invention also relates to antibodies that efficiently Deplete ICOS-expressing T cells in a Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention can reach the depletion of ICOS-expressing T cells in a Primate (monkey or human) is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%at least about 95%, at least about 97%, at least about 99%, or at least about 100%.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing T cells in a Primate (monkey or human) more efficiently compared to the original anti-ICOS antibody (e.g., antibody, in�luchuk the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing T cells in a Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-expressing T cells in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times more in comparison with the depletion caused by the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention reaches the depletion of ICOS-Express�arousih T cells in a Primate (monkey or human), which is at least about twice, at least about 3 fold, at least about 5 times, or at least about 10 times more in comparison with the depletion caused by fokusirovannym JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing T cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing T cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at IU�e is about 100 times compared with the corresponding value of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T cells in a Primate (monkey or human) is at least about 5%, at least prima�but 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% compared with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T cells in a Primate (monkeys�s, which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times higher compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention also relates to antibodies that efficiently Deplete ICOS-expressing T-calpernia cells in the Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing T-calpernia TC�weave an APE (monkey or human) more efficiently than the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing T-calpernia cells in Primate more effectively compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times higher than with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one of the embodiments of the present�of the invention the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human), which is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times higher compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50 times, �at least about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human), which, at least when�Erno 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a greater depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves povyshennoj� depletion of ICOS-expressing T-Halpern cells in a Primate (monkey or human), which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times higher compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention also provides for antibodies that efficiently Deplete ICOS-expressing Th1 cells in the Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention can Deplete ICOS-expressing Th1 cells in the Primate (monkey or human) is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100%.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing Th1 cells�and Primate (monkey or human) more efficiently than with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing Th1 cells in the Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion caused by anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of anti-COS antibodies of the present invention reaches, at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention / EC50 value of an anti-ICOS antibody of the present invention for the depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared to the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention / EC50 value of an anti-ICOS antibody of the present invention for the depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50 times, or u� least about 100 times compared to the original anti-ICOS antibody (e.g., an antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a greater depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion with the introduction of an anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a greater depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) that is at least about 5%, at IU�e by about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater depletion of ICOS-expressing Th1 cells in a Primate (monkey or human) compared to the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves at least about 2 times, at least about 5-fold, at least about � 10 times at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater depletion of ICOS expressing Th1 cells in a Primate (monkey or human) compared to fokusirovannym JMab-136 anti-ICOS antibody.

The present invention also relates to antibodies that efficiently Deplete ICOS-expressing Th2 cells in a Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of ICOS-expressing Th2 cells in a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing Th2 cells in a Primate (monkey or human) more efficiently compared to the original ICOS antibody (e.g., an antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing Th2 cells in a Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th2 cells in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more Thera�efticiency doses of anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th2 cells in a Primate (monkey or human), which is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times higher compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing Th2 cells in a Primate (monkey or human) is less, at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing Th2 cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at measures� about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th2 cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th2 cells in a Primate (monkey or human) that is at least about �and 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th2 cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 times, at least about 50 times, or at least about 100 times greater than the depletion with the introduction of an anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th2 cells in PR�Mat (monkey or human), which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times higher compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention also describes antibodies that efficiently Deplete ICOS-expressing Th1 7 cells in a Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of ICOS-expressing Th1 7 cells in a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing Th1 7 cells in a Primate (monkey or �of man) is more efficient than that of the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing Th1 7 cells in a Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th1 cells 7 in the Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times, more exhaustion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutically� doses of anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th1 cells 7 in the Primate (monkey or human), which is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing Th1 cells 7 in the Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times, compared with the corresponding value of initial anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing Th1 cells 7 in the Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least approx 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Th1 cells 7 in the Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing cells-T17 at the Primate (monkey or human), which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100%, greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing Thl7 cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention, dostigao� higher depletion of ICOS-expressing Th1 cells 7 in the Primate (monkey or human), which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention also provides antibodies that efficiently Deplete ICOS-expressing T-calpernia memory cells in a Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing T-helper�e memory cells in a Primate (monkey or human) more efficiently than with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes ICOS-expressing T-calpernia memory cells in a Primate (monkey or human) more efficiently than with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one of the embodiments of the present invention in�edenia one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human), which is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times, greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times the corresponding value with the introduction of the original anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold or at least about 100 times, the corresponding value with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expresser�promoting T-Halpern memory cells in a Primate (monkey or human), which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves a higher depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody according to the present invented�Yu reaches higher depletion of ICOS-expressing T-Halpern memory cells in a Primate (monkey or human), which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

Depletion of cells of a particular type can lead to depletion of these cells secreted product. For example, depletion of Th1 cells 7, using enhanced effector function anti-ICOS antibody of the present invention may lead to depletion of IL-17. The present invention also provides antibodies that effectively Deplete IL-17 in the Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention can reach the depletion of IL-17 in the Primate (monkey or human) is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least when�Erno 100%.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes IL-17 in the Primate (monkey or human) more efficiently than with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes IL-17 in the Primate (monkey or human) more efficiently than with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-17 in the Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, n� having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain, which has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-17 in the Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of IL-17 in the Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of IL-17 in�ATA (monkeys or humans) below at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times the corresponding value of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-17 in the Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher in comparison with the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or �escolca therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-17 in the Primate (monkey or human), which is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-17 in the Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased estos�of IL-17 in the Primate (monkey or human), which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention also describes antibodies that effectively Deplete IL-2 in a Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention may achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of IL-2 in a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes IL-2 in a Primate (monkey or human) more efficiently compared to the depletion with the introduction of the original anti-ICOS of anti�La (for example, antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes IL-2 in a Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-2 in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention d�steget increased depletion of IL-2 in a Primate (monkey or human), which is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of IL-2 in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared to the size of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of IL-2 in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times compared with the corresponding value of initial anti-ICOS �ntitle (for example, antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-2 in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% from exhaustion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-2 in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at measures� about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-2 in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of IL-2 in a Primate (monkey or human) that is at least about 2 times, at least about 5 times, at least prima�but 10 times, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater than the depletion of IL-2 when administered pulselearning JMab-136 anti-ICOS antibody.

ICOS-expressing T cells are involved in germinal center formation in model systems of mice. The data described in the present invention, show that ICOS-expressing cells are also involved in maintaining the structural integrity of the compartment In cells already formed germinal centers. Without being bound to a particular model, depletion of ICOS-expressing T cells in a Primate (monkey or human) by administering one or more therapeutic doses of an anti-ICOS antibody of the present invention may prevent the formation of germinal centers, can disrupt the architecture of the already-formed germinal centers, can Deplete b cells of the germinal centers of secondary lymphoid organs and/or may Deplete circulating switched b cells. The formation of germinal centres may be monitored by any method known in this field, for example, but their list is not limited to, histological examination of secondary lymphoid organs or analysis of lymphoid cells isolated from secondary Limpo�tion of tissues by the method of the flow cytometry analysis. The distribution patterns of the germinal center may be monitored by any method known in this field, for example, but not only them, histological examination of secondary lymphoid organs. Depletion of cells In germinal centers of secondary lymphoid organs can be monitored by any method known in this field, for example, but their list is not limited to, histological examination of secondary lymphoid organs or analysis of lymphoid cells isolated from secondary lymphoid tissues by the method of the flow cytometry analysis. Depletion of class circulating switched b-cells can be monitored by any method known in this field, for example, but not only them, the analysis of circulating lymphoid cells by the method of the flow cytometry analysis. Class switched b cells can be identified based on the specific expression in these cell surface markers or on the basis of such a loss of expression of, for example, the class switched circulating b-cells can be defined as CD27+IgM-IgD - b cells.

The present invention provides for antibodies that efficiently prevents the formation of germinal centers in secondary lymphoid organ of a Primate (monkey or human). In one embodiment, the implementation�ment of the present invention, the secondary lymphoid organ is the lymph node. In another embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ are the tonsils. In one embodiment of the present invention, the secondary lymphoid organ is the mesenteric lymph node.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention prevents the formation of germinal centers in secondary lymphoid organ of a Primate (monkey or human) for at least 1 day, at least 2 days, at least 5 days, at least 1 week at least 2 weeks at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months. In one embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ is the amygdala.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody according to the present� to the invention prevents the formation of germinal centers in secondary lymphoid organ of a Primate (monkey or human) for a longer time compared to the original anti-ICOS antibody (e.g., an antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention prevents the formation of germinal centers in secondary lymphoid organ of a Primate (monkey or human) for a longer time compared to the introduction of pulselearning JMab-136 anti-ICOS antibody. In another embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ are the tonsils.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention prevents the formation of germinal centers in secondary lymphoid organ of a Primate (monkey or human) more efficiently compared to the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention prevents the formation of germinal centers in secondary lymphoid organ of a Primate (monkey or human) more efficiently compared to fokusirovannym JMab-136 anti-ICOS antibody.

The present invention also provides antibodies that effectively destroy the structure of the germinal center in secondary lymphoid organ of a Primate (monkey or human). In one embodiment of the present invention, the secondary lymphoid organ is the lymph node. In another embodiment of the present invention, the secondary lymphoid organ is the spleen. In yet another variant implementation of the present invention, a secondary lymphoid organ are the tonsils. In one embodiment of the present invention, the secondary lymphoid organ is the mesenteric lymph node.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention destroys the structure of the germinal center in secondary lymphoid organ of a Primate (monkey or human) for at least 1 day, at least 2 days, �least about 5 days, at least 1 week at least 2 weeks at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months. In one embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ are the tonsils.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention destroys the structure of the germinal center in secondary lymphoid organ of a Primate (monkey or human) for a longer period compared with baseline anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention destroys the structure of the germinal center in secondary lymphoid organ of a Primate (monkey or human) for bol�e long period compared with the introduction of pulselearning JMab-136 anti-ICOS antibody. In one embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ are the tonsils.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention destroys the structure of the germinal center in secondary lymphoid organ of a Primate (monkey or human) more efficiently compared to the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention destroys the structure of the germinal center in secondary lymphoid organ of a Primate (monkey or human) more efficiently than with the introduction of pulselearning JMab-136 anti-ICOS antibody.

The present invention also describes antibodies that effectively Deplete the germinal centers b cells from a secondary lymphoid organ of a Primate (monkey or human). In one embodiment of�of westline present invention, the secondary lymphoid organ is the lymph node. In another embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ are the tonsils. In one embodiment of the present invention, the secondary lymphoid organ is the mesenteric lymph node.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes the germinal centers b cells from a secondary lymphoid organ of a Primate (monkey or human) for at least 1 day, at least 2 days, at least 5 days, at least 1 week at least 2 weeks at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months. In one embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid organ are the tonsils. Depletion of b-cells of the germinal center evaluated as "substantially retained" during the period after the introduction of one or several�lcih therapeutic doses of an anti-ICOS antibody if the number of b-cells of germinal centers is lower by at least 10%, in the sample treated with the antibody, compared with the number of b-cells of germinal centers in untreated control sample.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes b cells of the germinal centers of secondary lymphoid organ of a Primate (monkey or human) for a longer period compared with baseline anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes b cells of the germinal centers of secondary lymphoid organ of a Primate (monkey or human) for a longer period in comparison with the introduction of pulselearning JMab-136 anti-ICOS antibody. In one embodiment of the present invention, the secondary lymphoid organ is the spleen. In another embodiment of the present invention, the secondary lymphoid�th body are the tonsils.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention can achieve at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99%, or at least about 100% depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes b cells of the germinal centers of secondary lymphoid organ of a Primate (monkey or human) more efficiently compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of anti-ICOS of the present invention depletes b cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) more efficiently than with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human), which is higher by at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times compared with the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10-fold higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-IOS antibodies of the present invention for the depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 compared with the corresponding value of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold, or at least about 100 times the similar value of the original anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) that is at least about 5%, at least about 10%, at moreprepare 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher compared to the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% compared with the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of b-cells of the germinal center of secondary lymphoid about�Ghana in the Primate (monkey or human), which is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times higher compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody compared with the depletion with the introduction of the original anti-ICOS antibody (e.g., antibodies, comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50 times, or at least about 100 times higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

The present invention t�belongs to the realm of human antibodies, which effectively depletes circulating switched b cells in a Primate (monkey or human). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes circulating switched b cells in a Primate (monkey or human) for at least 1 day, at least 2 days, at least 5 days, at least 1 week at least 2 weeks at least 3 weeks, at least 1 month, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 9 months. Depletion of circulating switched b cells evaluated as "substantially stable" during the period after the introduction of one or more doses of an anti-ICOS antibody, if the number of circulating switched b cells is lower by at least 10% in the sample treated with the antibody, compared with circulating switched b-cells in untreated control sample.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes circulating switched b cells in a Primate (monkey or human) within t�e longer time compared to the depletion in the conduct of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes circulating switched b cells in a Primate (monkey or human) for a longer period compared to depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention can reach the depletion of circulating switched b cells in a Primate (monkey or human) is at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 97%, at least about 99% or at least about 100%,

In one embodiment of the present invention, the introduction of one or more therapeutic gozanti-ICOS antibody of the present invention may Deplete circulating switched b cells to less than 2%, less than 1.5%, less than 1%, less than 0.9%, less than 0.8%, less than 0.7%, less than 0.6%, less than 0.5%, less than 0.4%, less than 0.3% or less than 0.1% of peripheral blood lymphocytes (pbls) of a Primate (monkey or human).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes circulating switched b cells in a Primate (monkey or human) more efficiently than with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention depletes circulating switched b cells in a Primate (monkey or human) more efficiently than with the introduction of pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of circulating switched b cells in a Primate monkey or human), which is at least about 2 times, at least about 3 fold, at least about 5-fold or at least about 10-fold higher depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of circulating switched b cells in a Primate (monkey or human) that is at least about 2 times, at least about 3 fold, at least about 5 times, or at least about 10 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one of the embodiments of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of circulating switched b cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold or at least about � 100 times the corresponding value of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the size EU50 anti-ICOS antibody of the present invention for the depletion of circulating switched b cells in a Primate (monkey or human) is lower by at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 50-fold or at least about 100 times compared with the corresponding value of initial anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC).

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of circulating switched b cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least example�about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of circulating switched b cells in a Primate (monkey or human) that is at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 75%, at least about 100% higher depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of circulating switched b cells in a Primate (monkey or human) that is at least about 2 times, at �'ere about 5 times, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 fold, at least about 50-fold, or at least about 100 times greater than the depletion with the introduction of the original anti-ICOS antibody (e.g., antibody comprising the same variable amino acid sequence, but having 1) fokusirovannyi Fc domain or 2) amino acid sequence of the Fc domain that has not been modified to increase ADCC). In another embodiment of the present invention, the introduction of one or more therapeutic doses of an anti-ICOS antibody of the present invention achieves increased depletion of circulating category switched b cells in a Primate (monkey or human) that is at least about 2 times, at least about 5-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25 times, at least about 50-fold or at least about 100 times greater than the depletion when administered pulselearning JMab-136 anti-ICOS antibody.

In one embodiment of the present invention, anti-ICOS antibody described in the present invention mediates antibody-dependent cellular cytotoxicity (ADCC), complementability-mediated cytotoxicity (CSC) and/or antibody-dependent phagocytosis. In one embodiment of the present invention, anti-ICOS antibody of the present invention mediates antibody-dependent cellular cytotoxicity (ADCC) and/or antibody-dependent phagocytosis. In one embodiment of the present invention, anti-ICOS antibody of the present invention has an increased antibody-dependent cellular cytotoxicity (ADCC).

In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region, which mediates enhanced antibody-dependent cellular cytotoxicity (ADCC). In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region containing at least one substitution of an amino acid residue selected from the group consisting of residue 239, 330 and 332, and the position of the amino acid residues determined by the EU Convention. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that contains at least amino acid substitution selected from the group consisting of S239D, A330L, and I332E, wherein the position of amino acid residues determined by the EU Convention. In another embodiment of the present invention, anti-ICOS antibody according to the present Fig�structure includes at least one amino acid residue, selected from the group consisting of D at position 239, L at position 330 and E at position 332, and the position of the amino acid residues determined by the EU Convention.

In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that contains at least one designed glycoform, specified and designed the Fc region mediates enhanced antibody-dependent cellular cytotoxicity (ADCC). In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region that has lost glycosylation. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region having complex N-glycoside-linked chains of Sugars associated with the residue Asn297 in which fucose is not bound to N-acetylglucosamine in the reduced end.

In some embodiments of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region that has an increased affinity to Fc-binding protein, for example, but not only with him, Fc receptor, C1q compared to the Fc region of the wild type. In one embodiment of the present invention, anti-ICOS antibody on �astasia to the invention comprises a variant Fc region, which has a high affinity with a receptor protein FcλRIIIA compared with the Fc region of the wild type.

In some embodiments of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region comprising at least one engineered glycoform, specified and designed the Fc region has an increased affinity to Fc-binding protein, for example, but their list is not limited to, Fc receptor, C1q compared to a wild type Fc region. In one embodiment of the present invention, anti-ICOS antibody of the present invention includes an engineered Fc region comprising at least one engineered glycoform in which a specified engineered Fc region has an increased affinity against FcγRIIIA receptor protein compared with the Fc region of the wild type.

The present invention also relates to methods for the treatment and prevention mediated T-cell diseases and disorders, for example, but their list is not limited to, chronic infections, autoimmune diseases or disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and proliferative disorders of T cells in humans, comprising administering to the person's needs�of usemouse this, anti-ICOS antibodies with enhanced effector function (e.g., antibody-dependent cellular cytotoxicity (ADCC), complement-dependent cell-mediated cytotoxicity (CSC) and/or antibody-dependent phagocytosis) in a quantity sufficient for the depletion of circulating ICOS-expressing cells. In one of the objects of the present invention also relates to methods for the treatment and prevention of diseases and disorders mediated by T-cells, for example, but their list is not limited to, chronic infections, autoimmune diseases or disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and T-cell proliferative disorders in humans, comprising applying a therapeutically effective anti-ICOS antibody with enhanced effector function, which is the isotype IgG1 or human IgG3.

The present invention contemplates methods of identification, diagnosis, treatment and monitoring of disease progression in patients. The patient may have a disease, disorder or condition that represents the result of experimental studies, for example, it may be an experimental model developed for the disease, disorder or condition. In another embodiment, the patient may be ill�tion, disorder or condition in the absence of experimental manipulation. Patients include humans, mice, rats, pigs, cats, dogs and any animals used for research.

The patient may include different adjustable levels of ICOS mRNA or ICOSL mRNA or miR-101. Different adjustable levels of ICOS mRNA or ICOSL mRNA or miR-101 may be such that the tissue sample of the patient manifested increased expression of ICOS mRNA or ICOSL mRNA or miR-101 relative to the control tissue sample of the patient or relative to a sample from a healthy control individual. Different adjustable levels of ICOS mRNA or ICOSL mRNA or miR-101 may be such that the tissue sample of the patient is manifested by reduced expression of ICOS mRNA or ICOSL mRNA or miR-101 relative to the control sample of the patient or relative to a sample from a healthy control individual. Differently show the increase or decrease of expression can roughly be 10% - 500% of the control sample, approximately 10% - 400% of the control sample, approximately 10% - 300% of the control sample, approximately 10% - 250% of the control sample, approximately 10% - 200% of the control sample, approximately 10% - 150% of the control sample, approximately 10% - 100% of the control sample, approximately 10% - 50% of the control sample, approximately 100% - 500% of the control sample, about 200% - 500% from con�roll sample about 300% - 500% of the control sample, approximately 400% - 500% of the control sample, approximately 50% - 100% of the control sample, approximately 100% to 200% of the control sample, approximately 100% - 400% of the control sample, approximately 200% - 400% of the control sample, approximately 10% - 50% of the control sample, approximately 20% - 100% of the control sample, approximately 25% - 75% of the control sample, or approximately 50% - 100% from a control sample. The expression may be 10, 20, 25, 30, 40, 50, 75, 100, 125, 150, 175, 200, 250, 300, 400 or 500% of the control sample.

The introduction of anti-ICOS antibody of the present invention may result in neutralization of different adjustable levels of ICOS mRNA or ICOSL mRNA or miR-101. Neutralization differently regulated level of ICOS mRNA or ICOSL mRNA or miR-101 may be reduced by at least 2%, at least about 3%, by at least 4%, at least about 5%, by at least 7%, at least about 8%, by at least 10%, at least 15%, at least 25%, by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80% or at least 90% of the level of ICOS mRNA or ICOSL mRNA or miR-101. In another embodiment, the neutralization level is differently regulated ICOS mRNA or ICOSL mRNA or miR-101 refers to �the reduction of the expression of ICOS mRNA, or ICOSL mRNA or miR-101, the regulation of which is increased, and is at most 50%, 45%, 40%, 35%, 30%, 25%, 20%, 15%, 10%, 5%, 4%, 3%, 2%, or up to 1% of the expression levels of ICOS mRNA or ICOSL mRNA or miR-101 in the control sample.

Increased or decreased regulation of ICOS mRNA or ICOSL mRNA or miR-101 in the patient can be expressed in the form of any degree regarding the regulation in the control sample (which may be taken from the sample of non-diseased tissue of the patient (e.g., intact skin of patients with systemic lupus erythematosus) or from a healthy individual who has no disease or disorder). The degree of increased regulation or decreased regulation may be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, or at least 200% or at least 300%, or at least 400%, or at least 500% of the control regulation or control sample.

In the methods of monitoring or predicting disease progression in patient samples from the patient may be obtained prior to or after administration of the agent.

Samples can include any lib� biological fluid or tissue, for example, whole blood, serum, muscle, saliva, urine, synovial fluid, bone marrow, cerebrospinal fluid, nasal discharge, sputum, amniotic fluid, bronchoalveolar wash fluid mononuclear cells of peripheral blood leukocytes, lymph node cells, spleen cells, the cells of the tonsils or skin. The samples may be obtained by any known in this field.

ICOS mRNA or ICOSL mRNA or miR-101 levels are set in the samples (before or after administration of the agent). Compare the levels of ICOS mRNA or ICOSL mRNA or miR-101 in the samples.

The sample obtained from the patient may be obtained before the first injection of the agent i.e., the patient had not been previously exposed to this agent. In another embodiment, the sample obtained from the patient, may be taken after administration of the agent during the course of treatment. For example, the agent may be introduced prior to implementation of the monitoring Protocol. After the introduction of the agent from the patient can be obtained additional samples. The samples may be the same or different type, for example, each received sample can be a blood sample, or each received sample can be a serum sample. The levels of ICOS mRNA or ICOSL mRNA or miR-101 identified in each sample can be the same, may substantially overlap or may be similar.

Samples can� to be received at any time before or after administration of therapeutic agent. The sample obtained after administration of therapeutic agent may be selected using at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, or at least 14 days after the administration of a therapeutic agent. The sample obtained after administration of therapeutic agent may be selected using at least 2, at least 3, at least 4, at least 5, at least 6, at least 7 or at least 8 weeks after administration of therapeutic agent. The sample obtained after administration of therapeutic agent may be selected using at least 2, at least 3, at least 4, at least 5 or at least 6 months after administration of therapeutic agent.

Additional samples can be obtained about the patient after administration of a therapeutic agent. At least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 15, at least 20, at least 25 samples may be obtained from the patient for monitoring the progression or regression of the disease or disorder for some time. P�agressivnie of the disease can be monitored for at least 1 week at least 2 weeks at least 3 weeks at least 4 weeks at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 1 year at least 2 years at least 3 years at least 4 years at least 5 years, at least 10 years or over the period of human life. Additional samples may be taken from the patient at regular intervals, e.g., monthly, bimonthly, quarterly, semi-annual or annual. Additional samples can be taken from the patient at regular intervals after administration of the agent. For example, samples can be collected from the patient after one week after each injection of the agent, or two weeks after each injection of the agent, or within three weeks after each injection of the agent, or a month after the introduction of each agent, or two months after administration of the agent. In another embodiment, a large number of samples can be collected from the patient after each injection of the agent.

The present invention also presents methods of application levels of ICOS mRNA or ICOSL mRNA or miR-101 for the treatment, diagnosis, prognosis and monitoring of myositis. The levels of ICOS mRNA or ICOSL mRNA, �whether miR-101 can also be used to select doses and treatment of patients with myositis.

Monoclonal anti-ICOS antibody

Monoclonal anti-ICOS antibody shows specificity of binding with antigen, ICOS and can mediate ADCC, CSC and/or antibody-dependent phagocytosis in humans. Such an antibody may be produced using various methods known in this field, including with the use of a hybrid, recombination and phage display, or combinations thereof. Antibodies are vysokospetsifichnymi and directed against a single antigenic site. Designed anti-ICOS antibody can be obtained by any means known in this field, including, but not limited to, those methods described below, and improved versions of these methods. Large-scale high-output obtaining typically includes culturing host cells that produce engineered anti-ICOS antibody, and the allocation of anti-ICOS antibodies from the culture of host cells.

Method using hybrid

Monoclonal antibodies can be tried and tested techniques with the use of a hybrid, including known in this field and are described, for example, in the book: Harlow etc., "Antibodies: A Laboratory Manual", 1988, 2nd ed., publishing Cold Spring Harbor Laboratory Press, work Hammerling and others in kN.: "Monoclonal Antibodies and T Cell Hybridomas", 1981, publ Elsevier, new York, cc.563-681 (these works are included in the present invention in the form of sweat�OK on their nature). For example, in the method with the use of hybrid mice or other appropriate animal hosts, for example, hamsters, or monkeys, immunize for the induction of lymphocytes that produce or can produce antibodies capable of specifically to contact with the protein used for immunization. The lymphocytes can be immunized in vitro. Lymphocytes then hybridizing with myeloma cells using a suitable hybridizers agent such as polyethylene glycol, to form hybrid cells (in kN.: Coding, "Monoclonal Antibodies: Principles and Practice", 1986, publ Academic Press, cc.59-103).

The thus obtained hybrid cells are seeded and grown in appropriate culture medium that contains one or more substances that inhibit the growth or survival heirloom source of myeloma cells. For example, if the original myeloma cells have lost the enzyme (hypoxanthine guanine phosphoribosyi transferase - HGPRT or HPRT), the culture medium for the hybridomas typically include hypoxanthine, to produce remissions in childhood and thymidine (hypoxanthine, aminopterin and thymidine - Wednesday HAT), and these substances prevent the growth of HGPRT-deficient cells.

In specific embodiments, the present invention is used myeloma cells, which effectively hybridizers, support stable high level�tier productivity antibody selected producing antibody cells and sensitive to the environment for example, environment HAT. Among these myeloma cells lines contains lines of myeloma mice, for example, obtained from tumors of mice MORSE-21 and MPC-11, which are contained and can be obtained in the Center of the distribution of the cells of the Salk Institute, San Diego, California USA, and SP-2 or X63-Ag8.653 cells that can be obtained from the American type culture collection (American Type Culture Collection - ATCC), Rockville, Maryland, USA. Cell lines of human myeloma and heteromalla mouse-man have also been described to produce human monoclonal antibodies (Kozbor, J. Immunol., 133, 1984, p. 3001, Brodeur and others in kN.: "Monoclonal Antibody Production Techniques and Applications", 1987, publ Marcel Dekker, new York, Inc., cc.about 51 to 63.

Culture medium in which hybrid cells are grown, explore the subject production of antibodies directed against ICOS antigen person. Binding specificity of monoclonal antibodies produced by the hybrid cells can be determined by immunoprecipitation or the study of binding in vitro, for example, radioimmunoassay (RIA) or fermentating immunosorbent analysis (enzyme-linked immunoabsorbent assay - ELISA).

After the detection of hybrid cells producing antibodies with the desired specificity, affinity and/or activity, the clones can be subclavian by the method of serial dilution, and grown by standard methods (see kN.: Goding "Monoclonal Antibodies: Principles and Pracice", 1986, publ Academic Press, cc.59-103). To the appropriate media for this purpose include, for example, medium (D-MEM or RPMI 1640. In addition, hybrid cells may be grown in vivo in the form of ascitic tumors in animals.

Monoclonal antibodies that are excreted by subklonov, can be separated from the culture medium, ascites fluid or serum by conventional methods of purification of immunoglobulins, for example, protein a-sepharose, chromatography on hydroxyapatite, gel electrophoresis, dialysis or affinity chromatography.

Recombinant DNA methods

DNA encoding an anti-ICOS antibody described in the present invention are easily isolated and sequeiros using conventional techniques (e.g., using oligonucleotide probes that are able to specifically communicate with the genes encoding the heavy and light chains of an anti-ICOS antibodies). Hybrid cells are the source of such DNA. After DNA extraction can be placed into expression vectors, which are then transferred into the host cell, e.g. E. coli cells, COS cells monkeys, cells of the Chinese hamster ovary (Cho) cells or myeloma cells that do not produce the protein of the immunoglobulin, to obtain the synthesis of anti-ICOS antibodies in the recombinant cell host.

In phage display methods, the functional domains of the antibody are located on the surfaces of phage particles, carried�ing their coding polynucleotide sequence. In particular, DNA sequences encoding domains of the VHand VL, amplificateur from cDNA libraries of animals (for example, cDNA libraries of human and mice from diseased tissues). DNA encoding the V domainsHand VLrecombine together with an scFv linker by PCR and cloned in fahmida vector. Vector electroporator in E. coli and then infect E. coli Halperin the phage. Phage used in these methods are typically filamentous phage including fd and M13, and VHand VLdomains that usually recombinante hybridizing with rahovym gene III or VIII. Phages expressing antigen-binding domain that binds to a particular antigen can be selected or identified with antigen, e.g., using labeled antigen or antigen bound or enclosed in a hard surface or into pellets. Examples of phage display methods that can be applied for obtaining the antibodies of the present invention, methods are described by Brinkman and others, J. Immunol. Methods, 182, 1995, cc.41-50, Ames, etc., J. Immunol. Methods, 184, 1995, cc.177-186, Kettleborough, etc., Eur. J. Immunol., 24, 1994, cc.952-958, Persic, etc., Gene, 187, 1997, cc.9-18, Burton, etc., Advances in Immunology, 57, 1994, cc.191-280, PCT/GB91/01 134, WO 90/02809, WO 91/10737, WO 92/01047, WO 92/18619, WO 93/11236, WO 95/15982, WO 95/20401, and W097/13844, and US Patent Nos. 5698426, 5223409, 5403484, 5580717, 5427908, 5750753, 5821047, 5571698, 5427908, 5516637, 5780225, 5658727, 5733743 and 5969108, the essence of each cat�which is included in the present invention by reference.

In the above works after the selection of the phage antibody coding region from the phage can be isolated and used to generate whole antibodies, including human antibodies, or any other desired antigen-binding fragment, and expressed in any desired host, including mammalian cells, insect cells, plant cells, yeast and bacteria, for example, described below. Methods obtain recombinant Fab fragments, Fab' and F(ab')2can also be applied using techniques known in this field, for example, described in PCT WO 92/22324, Mullinax, etc., BioTechniques, 12(6), 1992, cc.864-869, Sawai, etc., AJRI, 34, 1995, cc.26-34, Better, etc., Science, 240, 1988, cc.1041-1043 (these works are included in the present invention in the form of links to their essence).

Antibodies can also be isolated from phage libraries of antibodies obtained by the methods described McCafferty et, Nature, 348, 1990, cc.552-554. Clackson et, Nature, 352, 1991, cc.624-628. Marks et, J. Mol. Biol., 222, 1991, cc.581-597 describe the selection of antibodies of mouse and human, respectively, using phage libraries. The combining circuit can be used to obtain high affinity (nm range) human antibodies (Marks et, Bio/Technology, 10, 1992, cc.779-783), as well as combinatorial infection and recombination in vivo as a strategy for constructing very large phage libraries (Waterhouse et, Nuc. Acids. Res., 2, 1993, cc.2265-2266). Thus, these techniques are viable options that can replace traditional methods of using a hybrid monoclonal antibodies for the isolation of anti-ICOS antibodies.

To obtain whole antibodies, PCR primers comprising the nucleotide sequence of VH or VL, the restriction site, and a flanking sequence to protect the restriction site can be used to amplify the VH or VL sequences in scFv clones. Using cloning techniques known to experts in this field, the PCR amplified VH domains can be cloned into vectors expressing a constant region of the heavy chain, for example, gamma 4 constant region of a human, and the PCR amplified VL domains can be cloned into vectors expressing a constant region of light chain, for example, the constant region of the Kappa and lambda man. Vectors for expression of VH domains or VL may include the promoter EF-1α, a secretion signal, a cloning site for the variable domain, constant domains, and a selective marker, e.g., neomycin. Domains VH and VL can also be cloned into the vector expressing the necessary constant region. The vectors of the conversion of the heavy chain vectors and conversion of light chain then together transferout in cell lines to generate stable or temporary �of the tap lines, which Express the full length antibody, e.g., IgG, using techniques known to experts in this field.

The DNA also may be modified, for example, by substituting the coding sequence of the constant domains of the heavy and light chain human position on homologous sequences of the mouse (US 4816567, Morrison, etc., Proc. Natl. Acad. Sci. USA, 81, 1984, pp. 6851) or by covalent connection to the immunoglobulin coding sequence all or part of the coding sequence for the polypeptide unrelated to immunoglobulins.

Chimeric antibodies

Anti-ICOS antibodies in the present invention especially include chimeric antibodies (immunoglobulins) in which a portion of the heavy and/or light chain identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class or subclass of antibody, while the other part of the chain (chain) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another class or subclass antibodies as well as fragments of such antibodies, so long as they exhibit the desired biological activity (US 4816567, Morrison, etc., Proc. Natl. Acad. Sci. USA, 81, 1984, cc.6851-6855). To investigational chimeric antibodies in the present invention include "primatized�data" antibodies, comprising variable domain antigen-binding sequences derived from apes (for example, old world monkeys, for example, baboon, rhesus macaques or macaque of graboid) and the sequence of the constant region(US 5693780).

Modified/mutant antibodies

Anti-ICOS antibodies in the compositions and methods described in the present invention may be a mutant antibodies. In the context of the present invention, the term "mutant antibody" or "modified antibody" refers to a variant of the amino acid sequence of an anti-ICOS antibody in which one or more amino acid residues of an anti-ICOS antibodies can be modified. To modifications to the amino acid sequence of an anti-ICOS antibodies are modifications of the sequence, which can improve the affinity or avidity of the antibody to its antigen, and/or modification of the Fc part of the antibody that can improve effector function.

The present invention also relates to an anti-ICOS antibodies with enhanced effector function, as described in the present invention, and its altered/mutant derivative, including, but not limited to, antibodies with modified properties by binding of ICOS to humans, for example, the modified constants kONdissociation constants (kOFFand/or constants of rawnow�SIA or binding affinity, KD. In some embodiments of the present invention the value of KDanti-ICOS antibodies described in the present invention, or altered/mutant derivative, ICOS may constitute no more than about 10-6M, 10-7M, 10-8M or 10-9M. Methods and reagents applicable to determine such binding abilities of antibodies of the present invention or its altered/mutant derivative, known in this field and are commercially available (see references above and, e.g., US 6849425, US 6632926, US 6294391 and US 6143574, the essence of which is included in the present invention in the form of links). In addition, the equipment and software designed for such kinetic analyses are commercially available (for example, Biacore instruments® And 100 and Biacore® 2000, the company Biacore International AB, Uppsala, Sweden).

Modifications can be made in any known anti-ICOS antibody or anti-ICOS antibodies described in the present invention. Such modified antibodies necessarily have the degree of identity or similarity with known anti-ICOS antibody of less than 100%. An example is a modified antibody, which may have an amino acid sequence that is about cables 25-95% identical or similar to the amino acid sequence variabel�CSOs domain or heavy, or light chain of an anti-ICOS antibodies described in the present invention. An altered antibody may have an amino acid sequence having at least 25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90%, or 95% identity or similarity with the amino acid sequence of the variable domain of either the heavy or light chain of an anti-ICOS antibodies described in the present invention. In another embodiment of the present invention, an altered antibody may have an amino acid sequence having at least 25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90%, or 95% identity or similarity with the amino acid sequence of the heavy chain CDR1, CDR2 or CDR3 of an anti-ICOS antibodies described in the present invention. In one embodiment of the present invention, the modified antibody may support the binding capacity of human ICOS. In some embodiments of the present invention, anti-ICOS antibody described in the present invention may include a VH sequence that is at least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more identical to the amino acid sequence SEQ ID NO:7.

In another embodiment of the present invention, an altered antibody may have an amino acid sequence identical to or Shodo� at least 25%, 35%, 45%, 55%, 65%, 75%, 80%, 85%, 90% or 95% with amino acid sequence of CDR1, CDR2 or CDR3 of light chain of an anti-ICOS antibody according to the description of the present invention. In some embodiments of the present invention, anti-ICOS antibody of the present invention can include a VL sequence that is at least or about 10%, 15%, 20%, 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95% or more identical to the amino acid sequence SEQ ID NO:2.

Identity or similarity to the sequence expressed in the present invention as the percentage of amino acid residues in the sequence of the candidate that are identical (i.e., the same residues) or similar (i.e., amino acid residues from the same group based on common properties of the side chain, see below) with the remnants of anti-ICOS antibodies after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. None of N-terminal, C-terminal or internal extended sequences, deletions or insertions in the sequence of the antibody outside of the variable domain may not be designed as a sequence, affecting the identity or similarity.

The term "% identity", known in this field means measuring the relationship between two� the polynucleotides or two polypeptides, which is determined by comparing their sequences. In General, two sequences being compared are aligned to obtain the maximum correlation between the sequences. Alignment of two sequences assess and identify the number of positions, which gives an exact match between two sequences, divided by the total length of the group and multiplied by 100 to obtain the percent identity. This value is the percent identity may be determined over the entire length of the compared sequences, which is particularly suitable for sequences of the same or very similar length, which is also highly homologous to, or for shorter sequences, which are more applicable for sequences of unequal lengths or who have low levels of homology.

For example, the sequence can line software Clustalw under Unix which generates a file with the past ".aln", this file can then be imported into the Bioedit program (Hall T. A. Nucl. Acids. Symp. Ser. 41, 1999, cc.95-98), which opens the file .aln. In the Bioedit program window, you can select individual sequences (two at a time) and compare them. This method allows to compare the entire sequence.

Methods for comparing the identity of two or more of a sequence�th known in this field. For example, the programs may be obtained in the form of the Wisconsin Sequence Apalises Package, version 9.1 (Devereux J. et, Nucl Acids Res., 12, 1984, cc.387-395, may be obtained from Genetics Computer Group, Madison, Wisconsin, USA). The determination of percent identity of sequences may be generated using a mathematical algorithm. For example, the programs BESTFIT and GAP, may be used to determine the % identity between two polynucleotides and the % identity between two polypeptide sequences. The program BESTFIT uses the "local homology of Smith and Waterman (Advances in Applied Mathematics, 2, 1981, cc.482-489) and installs one of the best region of similarity between two sequences. The program BESTFIT is more suited to comparing sequences of the two polynucleotides or two polypeptides differing in length, assuming that the shorter sequence represents a portion of a longer. The GAP program compares two sequences by identifying the "maximum similarity" according to the algorithm Neddleman and Wunsch (J. Mol. Biol., 48, 1970, cc.443-354). The GAP program more applicable to comparing sequences that are approximately the same length and an alignment is expected over the entire length. Preferably, the parameters "Gap Weight" and "Length Weight" used in each program are 50 and 3 for polynucleotides and 12 and 4 for polypeptide�, respectively. Preferably the percentage identity and similarity to determine if two sequences being compared are optimally aligned.

Other programs for determining identity and/or similarity between sequences are also known in this field, for instance the BLAST family of programs (publication Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 87, 1990, cc.2264-2268, and its modification Karlin and Altschul, Proc. Natl. Acad. Sci. USA, 90, 1993, cc.5873-5877, can be obtained from the National center for biotechnology information (National Center for Biotechnology Information - NCB), Bethesda, Maryland, USA, from the page on the NCBI website www.ncbi.nlm.nih.gov). These programs are not the only examples of mathematical algorithms used for comparison of two sequences. This algorithm is included in the program NBLAST and XBLAST for work Altschul et, J. Mol. Biol., 215, 1990, cc.403-410. The study of nucleotide BLAST can be performed on the NBLAST program, score = 100, word length = 12, to obtain nucleotide sequences homologous to a nucleic acid molecule that encodes all or part of an anti-ICOS antibody of the present invention. The BLAST analysis as applied to protein sequences can be performed using the XBLAST program, score = 50, word length = 3, to obtain a homologous amino acid sequence to a protein molecule of the present invention. To obtain the segment�s with spaces for the purposes of comparison may be used by the program Gapped BLAST, as described by Altschul and others, Nucl Acids Res., 25, 1997, cc.3389-3402. The program PSI-Blast can also be used for re-investigation that detects distant relationships between molecules (see link above). When using the programs BLAST, Gapped BLAST and PSI-Blast can be used the default parameters of the respective programs (e.g., XBLAST and NBLAST). Cm. http://www.ncbi.nlm.nih.gov.

Another, but not the only, known in this area of the program to determine the identity and/or similarity between sequences is the program FASTA (Pearson W. R. and Lipman D. J., Proc. Natl. Acad. Sci. USA 85, 1988, cc.2444-2448, available as part of the software package Wisconsin Sequence Apalises Package). Preferably, the BLOSUM62 amino acid substitutional matrix (Henikoff S., Henikoff J. G., Proc. Natl. Acad. Sci. USA, 89, 1992, cc.10915-10919) is used when comparing polypeptide sequences, including nucleotide sequences are first translated into amino acid sequences before comparison.

Another, but not the only, example program, known in this field to determine the identity and/or similarity between amino acid sequences is SeqWeb program (interface-based network software package GCG Wisconsin: Gap program), which is used with the default algorithm and a set of program parameters, blosum 62, the size of the gap 8, size 2.

The percentage of identichnosti two sequences can be determined, using methodology similar to that described above, with acceptable gaps or without them. When calculating percent identity, typically only considers exact matches.

Preferably, the program BESTFIT is used to determine percent identity of a sequence of the studied polynucleotide or polypeptide to the sequence of the polynucleotide or polypeptide of the present invention, the studied and the control sequence to optimally align the parameters of the program set at the default value.

To produce the modified antibody introduce one or more amino acid modifications (e.g., substitutions) in one or more hypervariable regions species-specific antibodies. One or more modifications (e.g., substitutions) in the remains of the skeleton of the plot can also be produced in an anti-ICOS antibody, if they lead to improved binding affinity of the mutant antibodies against the antigen from a mammal of the second species. Examples of residues of a frame section for modification include those residues that directly bind the antigen (Amit et, Science, 233, 1986, cc.747-753), interact/affect the conformation of a CDR (Chothia et, J. Mol. Biol., 196, 1987, cc.901-917) and/or participate in the connection VL-VH(EP 239400 B1). In some embodiments, the infusion�his invention, the modification of one or more such residues in frame area leads to increased binding affinity of the antibody to the antigen from a mammal of the second species. For example, from about one to about five residues skeleton of the plot can be changed in one of the embodiments of the present invention. Sometimes it may be sufficient for the obtaining of mutant antibodies, which can be used in preclinical studies, even if none of the residues of the hypervariable region was not changed. However, in normal altered antibody may further include modifying (changing) the hypervariable region.

Modified residues hypervariable region, which can be changed randomly, especially if the starting binding affinity of an anti-ICOS antibody against the antigen from a mammal of the second species is such that such randomly obtained antibody can be easily selected.

One of the appropriate methods to develop such modified antibodies are called "alanine scanning mutagenesis" (Cunningham, Wells, Science, 244, 1989, cc.1081-1085). One or more residues of the hypervariable region replaces a residue (residues) alanine or polyalanine to influence the interaction of amino acids with the antigen from a second species of mammal. The residue (residues) hypervariable region exhibiting functional sensitivity to the substitutions then clarify by introducing further or other mutations at with�item substitution. Thus, while the site for introducing variations in the amino acid sequence determined in advance, the nature of the mutation itself does not need a prior installation. Ala-mutants, thus obtained, is subjected to screening for biological activity according to the description of the present invention.

Another method of producing such modified antibodies involves the formation of affinity, using the method of phage display (Hawkins and others, J. Mol. Biol., 254, 1992, cc.889-896, and Lowman, etc., Biochemistry, 30(45), 1991, cc.10832-10837). Briefly, several hypervariable sites of the region (e.g., 6-7 sites) are mutated to generate all possible amino substitutions at each site. Mutants antibodies, thus obtained, are in a monovalent form of particles of filamentous phage in the form hybrids with the product of the gene III of bacteriophage M13 packaged within each particle. The mutants shown rahovym display, then subjected to screening for biological activity (e.g. binding affinity) as described in the present invention.

Mutations in the sequence of the antibody may include substitutions, deletions, including internal deletions, additions, including additions, the result of which are hybrid proteins, or conservative substitution of amino acid residues within and/or near amino acid sequence, � which there is a "silent" change, namely, the fact that the change results in the functional equivalent of an anti-ICOS antibody. Conservative amino acid substitution can be obtained on the basis of similarities in polarity, charge, solubility, hydrophobicity, hydrophilicity and/or amphipathicity nature included residues. For example, nonpolar (hydrophobic) amino acids include alanine, leucine, isoleucine, valine, Proline, phenylalanine, tryptophan and methionine, to the polar neutral amino acids include glycine, series, threonine, cysteine, tyrosine, asparagine and glutamine, to a positively charged (basic) amino acids include arginine, lysine, and histidine, and to negatively charged (acidic) amino acids include aspartic acid and glutamic acid. In addition, glycine and Proline residues are, which can influence the orientation of the chain. Non-conservative substitution may cause the substitution of a representative of one of these classes to the representative of another class. In addition, if necessary, nonclassical amino acids or chemical analogues of amino acids can be introduced as replacements or additions to the sequence of the antibody. Unconventional amino acids mainly include, but not limited to, D-isomers of conventional amino acids, α-aminoadamantane acid, 4-aminobutyric �Isleta, aminobutyric acid (Abu), 2-aminobutyric acid, γ-Abu, e-Ahx, 6-aminocaproic acid, aminoadamantane acid (Aib), 2-aminoadamantane acid, 3-aminopropionic acid, ornithine, norleucine, Norvaline, hydroxyproline, sarcosine, citrulline, cysteine acid, t-butylglycol, t-butylene, phenylglycine, cyclohexylamine, β-alanine, fluoro-amino acids, amino acids designed, for example, β-methylaminomethyl, α-methylaminomethyl, Nα-methylaminomethyl and amino acid analogs.

In another embodiment of the present invention at sites selected for modification, was formed affinity by phage display method (see above).

Any mutagenesis methods known in this field can be used to modify individual nucleotides in a DNA sequence to obtain the amino acid sequence (sequence) in the sequence of the antibody or the creation/deletion of restriction sites to facilitate further manipulations. Such methods include, but are not limited to, chemical mutagenesis, site-directed in vitro mutagenesis (Kunkel, Proc. Natl. Acad. Sci. USA, 82, 1985, p. 488, S. Hutchinson, and others, J. Biol. Chem., 253, 1978, p. 6551), oligonucleotide-directed mutagenesis (Smith, Ann. Rev. Genet., 19, 1985, cc.423-463), Hill, etc., Methods Enzymol., 155, 1987, cc.558-568), overlapping the elongation of PCR-based (But, etc., Gene, 77, 1989, cc.51-59), IU�aprimary mutagenesis based on PCR (Sarkar and others, Biotechniques, 8, 1990, cc.404-407). the Modification can be confirmed by sequencing dvuhruchevoj detoxing.

In some embodiments of the present invention, anti-ICOS antibody can be modified to produce hybrid proteins, i.e. antibody or its fragment, hybridized with a heterologous protein, polypeptide or peptide. In some embodiments of the present invention protein hybridized with a part of an anti-ICOS antibody is an enzyme - component antibodies directed enzyme Pro-drug therapy (Antibody-directed enzyme prodrug therapy ADEPT). Examples of other proteins or polypeptides, which can be designed as a hybrid protein with anti-ICOS antibody, include, but not limited to, toxins, e.g., ricin, abrin, ribonuclease, Tnkase I, staphylococcal enterotoxin-A, an antiviral protein, Phytolacca American, gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin. See, for example, Pastan, etc., Cell, 47, 1986, p. 641, Goldenberg and others, Cancer Journal for Clinicians, 44, 1994, p. 43. Can be applied enzymatically active toxins and fragments, including a chain of diphtheria toxin, non-binding active fragments of diphtheria toxin a chain, exotoxin A (from Pseudomonas aeruginosa), chain A of ricin, a chain And abrina, chain And modeccin, alpha sarcin, proteins Aleurites fordii, giantino�s proteins proteins from Phytolaca americana (PAPI, PAPII, and PAP-S), the inhibitor from Momordica charantia, Curtin, krotin, an inhibitor of Sapaonaria officinalis, gelonin, mitogillin, restrictocin, vanomycin, analyzin and trichothecene. See, for example, WO 93/21232.

Additional hybrid proteins can be obtained by methods of shuffling genes, shuffling motives, shuffling of exons and/or shuffling codons (all of these methods are referred to as "DNA shuffling"), DNA Shuffling can be applied for changing the activity of an anti-ICOS antibody or its fragments (e.g., antibodies or fragments with high affinity and low dissociation degree). Cm. US 5605793, 5811238, 5830721, 5834252 and 5837458, Patten, etc., Curr. Opinion Biotechnol., 8, 1997, cc.724-733, Harayama, Trends Biotechnol. 16(2), 1998, cc.76-82, Hansson and others, J. Mol. Biol., 287, 1999, cc.265-276, Lorenzo and Blasco, Biotechniques 24(2), 1998, cc.308-313 (the essence of each patent and each publication included in the present invention by reference). The antibody can also be domain-binding hybrid immunoglobulin protein as described in publikacja US 20030118592, US 200330133939 and PCT WO 02/056910, the essence of which is included in the present invention in the form of links.

Domain antibodies

Anti-ICOS antibody of the compositions and methods of the present invention can be domain antibodies, e.g., antibodies containing the small functional binding components of antibodies, corresponding to the variable regions �agelou (V H) or light chains (VL) human antibodies. Examples of domain antibodies include, but is not limited to, appropriate antibodies, which can be obtained from the company Domantis Limited (Cambridge, UK) and from the company Domantis Inc. (Cambridge, mA, USA), which are specific in relation to therapeutic targets (see, e.g., WO04/058821, WO04/003019, US 6291158, 6582915, 6696245 and 6593081). Commercially available libraries of domain antibodies can be used to identify anti-ICOS domain antibodies. In some embodiments of the present invention, anti-ICOS antibodies include functional unit binding ICOS and functional unit binding Fc gamma receptor.

In one embodiment of the present invention, anti-ICOS domain antibody may include any one of the CDR region, or any combination of the CDR regions of the heavy or light chain JMab-136 monoclonal antibodies.

In another embodiment of the present invention, anti-ICOS domain antibody can include a VH CDR3 of an antibody JMab-136 together with any combination of CDR regions, composed of variable regions of heavy or light chains of a monoclonal antibody JMab-136. Anti-ICOS domain antibody may also include a VK CDR3 antibody JMab-136 together with any combination of CDR regions, composed of variable regions of heavy or Le�coy chains monoclonal antibody JMab-136.

In yet another variant implementation of the present invention, anti-ICOS domain antibody can include a VH CDR3 of an antibody JMab-136. Anti-ICOS domain antibody may also comprise VK CDR3 antibody JMab-136.

Bivalent antibodies

In some embodiments of the present invention, anti-ICOS antibodies are bivalent antibodies. The term "bivalent antibody" refers to small fragments of antibodies with two binding sites of the antigen, which fragments comprise a variable domain of the heavy chain (VH) connected to the variable domain light chain (VL) in the same polypeptide chain (VH-VL). By using a linker that is too short to connect the two domains in the same chain, the domains increase for mating with complementary domains of another chain and create two binding sites of the antigen. Bivalent antibodies described more fully, for example, EP 404097, WO 93/11161, and Hollinger et, Proc. Natl. Acad. Sci. USA, 90. 1993, cc.6444-6448.

Vaccine antibodies (Vaccibody)

In some embodiments of the present invention, anti-ICOS antibodies are vaccine antibodies (Vaccibody). Vaccine antibodies are dimeric polypeptides. Each monomer vaccine antibody consists of a scFv with specificity for surface molecules on antigen-presenting cell (APC), which is connected �via a hinge region and γ3 domain with a second scFv fragment. In other embodiments of the present invention, the vaccine antibodies containing one of the fragments of the scFv fragment of the anti-ICOS antibodies can be used to map those ICOS-expressing cells that must be destroyed, and the effector cells that mediate ADCC. For example, see publication of the patent application US 20040253238.

Linear antibodies

In some embodiments of the present invention, anti-ICOS antibodies are linear antibodies. Linear antibodies comprise a pair of tandem Fd segments (VH-CH1-VH-CH1) that form a pair of antigen binding regions. Linear antibodies can be bespecifically and monospecifičeskoj. Cm. Zapata et, Protein Eng., 8(10), 1995, cc.1057-1062.

The original antibody

In some embodiments of the present invention, anti-ICOS antibody is an initial antibody. The concept of a "reference antibody" means an antibody comprising the amino acid sequence, which may lose or may be insufficient in one or more amino acid residues, or can be attached to one or more of its hypervariable regions, compared with an altered/mutant antibody according to the description of the present invention. Thus, the original antibody can be shortened Hyper�areabelow region compared with the corresponding hypervariable region of the mutant antibodies, described in the present invention. The original polypeptide can include the sequence of a native antibody (i.e., natural, including natural allelic variant) or the sequence of the antibody with the existing modifications of the amino acid sequence (for example, other insertions, division and/or displacement) of the natural sequence. The original antibody may be a humanized antibody or a human antibody.

Fragments of antibodies

"Antibody fragments" comprise a portion of a full length antibody, generally the antigen-binding portion or variable region. Examples of fragments of antibodies are Fab, Fab', F(ab')2and Fv fragments, double antibodies, linear antibodies, single-stranded molecules of antibodies and polyspecific antibodies formed from fragments of antibodies.

Traditionally, these fragments get proteolytic cleavage of intact antibodies (see, e.g., Morimoto et, Journal of Biochemical and Biophysical Methods, 24, 1992, cc.107-117, Brennan, etc., Science, 229, 1985, p. 81). However, these fragments can now be obtained directly from recombinant cells. For example, fragments of antibodies can be isolated from phage libraries of antibodies discussed above. Fragments, Fab'-SH can also be directly isolated from E. coli and chemically coupled to formation of fragments F(ab')2(Carter, etc., Bio/Technology, 0, 1992, cc.163-167). Following another approach, the fragments F(ab')2can be isolated directly from a culture of recombinant host cells. Other methods of obtaining fragments of antibodies known to practitioners in this field. In other embodiments of the present invention, the antibody of choice is a single chain Fv fragment (scFv). See, for example, WO 93/16185. In some embodiments of the present invention the antibody is a Fab fragment.

Bespecifically antibodies

Bespecifically antibodies are antibodies that have binding specificity against at least two different epitopes. Options bespecifically antibodies can bind to two different epitopes of surface marker ICOS-expressing T cells. Other such antibodies may bind the first token of ICOS-expressing T cells and optionally associate a second marker from the surface of ICOS - expressing T cells. A shoulder connecting the token anti-ICOS-expressing T cells, can also be combined with a shoulder, which is associated with the originating molecule leukocyte, e.g., a receptor molecule of T cells (e.g., CD2 or CD3), or Fc receptors for IgG (FcγR), thus, to focus the mechanisms of cell destruction in the ICOS-expressing T cells. Bispecific the antibodies�and can also be used to localize cytotoxic agents to ICOS-expressing T cells. These antibodies possess a shoulder connecting the marker ICOS-expressing T cells, and an arm that binds the cytotoxic agent (e.g., saporin, anti-interferon-α, alkaloids borovinka, the chain A of ricin, a metol-exate or hapten radioactive isotope). Bespecifically antibodies can be prepared as full length antibodies or fragments of antibodies (e.g., F(ab'): bespecifically antibodies).

Methods of obtaining bivalent antibodies known in the art (see, for example, Millstein, etc., Nature, 305, 1983, cc.537-539, and Traunecker etc., EMBO J., 10, 1991, cc.3655-3659, Suresh, etc., Methods in Enzymology, 121, 1986, p. 210, Kostelny, etc., J. Immunol., 148(5), 1992, cc.1547-1553, Hollinger, etc., Proc. Natl Acad. Sci. USA, 90, 1993, cc.6444-6448, Gruber, etc., J. Immunol., 152, 1994, p. 5368, US 4474893, 4714681, 4925648, 5573920, 560181, 95731168, 4676980 and 4676980, WO 94/04690, WO 91/00360, WO 92/200373, WO 93/17715, WO 92/08802 and EP 03089).

In one of the embodiments of the present invention, in which an anti-ICOS antibody in the compositions and methods of the present invention is bispecific, an anti-ICOS antibody may be a human antibody or humanized antibody may have specificity against human ICOS and epitope on the surface of T cells or can bind effector cells, e.g., monocytes/macrophages and/or natural killer cells to induce cell death.

The field of Fc variants

The present invention provides compositions baie�cov containing scope variant Fc. An example is the Fc region, for example the Fc region, comprising one or more unnatural amino acid residues. Also relevant variants of the Fc region of the present invention are Fc region, which include deletions of amino acids, additions and/or modifications.

Note that the Fc region in the context of the present invention includes polypeptides containing a constant region of an antibody excluding the first domain of the constant region of an immunoglobulin. Thus Fc refers to the last two domains of the constant region of immunoglobulins IgA, IgD and IgG, the latter three domains of the constant region of immunoglobulins IgE and IgM, and the flexible hinge N-Terminus to such domains. In the Fc region of IgA and IgM may be the j chain For IgG the Fc region comprises immunoglobulin domains Shamma and Shamma (γ2 and γ3) and hinge region Shamma (γ1) and Shamma (γ2). Although the binding of the Fc region may vary, the Fc region of the heavy chain of human IgG is usually defined to include residues S or R to its carboxy-Terminus, wherein the numbering corresponds to the EU index by Kabat and others (1991, NIH Publication 91-3242, national technical information Springfield, Virginia). The concept of the "EU index as specified above in publications Kabat" refers to the EU numbering of residues in human IgG1 antibody according to the description Kabat, etc., see�above. The Fc region may refer to this region of the selected antibody, or is a region consisting of antibody, antibody fragment or hybrid Fc protein. Variant Fc protein may be an antibody, a hybrid Fc, or any protein or protein domain which includes the Fc region, including but not limited to, variants of the Fc region that are not natural options Fc. Note: the polymorphisms noted in the number of provisions in the Fc, including, but not limited to, the provisions 270, 272, 312, 315, 356 and 358 in Kabat, and thus, there may be small differences of this sequence from sequences known in the prior art.

The present invention also relates to proteins of the variant Fc, which have altered binding properties in relation to Fc ligand (e.g., Fc receptor, C1q) relative to the mapped molecules (e.g., protein having the same amino acid composition except for the Fc region of the wild type). Examples of binding properties include but not limited to, binding specificity, the constant of the equation of dissociation (KD), degree of dissociation and Association (koffand konrespectively), binding affinity and/or avidity. Typically, a binding molecule (e.g., protein variant Fc, for example, antibody) with a low value of KDit may be preferable concerned�ing molecules with a high value of K D. However, in some cases the value of konor koffit may be more important than the value of KD. The person skilled in the art can determine which kinetic parameter is most important for the application of antibodies.

The affinity and binding of the Fc domain with its ligand may be determined by various methods in vitro assays (mainly based on biochemical and immunological parameters), known in this area to determine the interactions of Fc-FcγR, i.e., specific binding of the Fc region with FcγR, including but not limited to, equilibrium methods (e.g. enzyme-linked immunosorbent analysis (ELISA), or radioimmunoassay (RIA)), or kinetics (e.g. BIACORE analysis®), as well as other methods, for example, methods of indirect binding, competitive inhibition methods, energy transfer fluorescence resonance (fluorescence resonance energy transfer - FRET), gelelectrophoresis and chromatography (e.g., gelfiltration). These and other methods can use a tag to one or more components, exploring and/or using different methods of detection, including, but not limited to chromogenic, fluorescent, luminescent, or isotopic labels. Detailed description of binding affinities and kinetics are given in kN.: "Fundamental Immunology", 1999, 4th ed., edited by Paul W.., publ Lippincott-Raven, Philadelphia, in which concentrate on interactions antibody-immunogen.

In one embodiment of the present invention, the protein variant Fc has increased binding to one or more Fc ligands compared to the matched molecule. In another embodiment of the present invention the variant Fc protein has an affinity to an Fc ligand that is at least 2-fold, or at least 3 fold, or at least 5-fold, or at least 7-fold, or at least 10 fold, or at least 20-fold, or at least 30 fold, or at least 40-fold, or at least 50-fold, or at least 60 times, or at least 70 fold, or at least 80 fold, or at least 90 fold, or at least 100-fold, or at least 200 times more compared to the matched molecule. In another embodiment of the present invention the protein of the variant Fc has an increased binding to Fc receptor. In another embodiment of the present invention the protein of the variant Fc has an increased binding to the Fc receptor FcγRIIIA. In yet another variant implementation of the present invention the protein of the variant Fc has an increased binding to the Fc receptor FcRn. In yet another variant implementation of the present invention, the protein variant F has an increased binding to C1q relative to the mapped molecules.

Half-lives in serum protein comprising the Fc region, can be increased by increasing the binding affinity of the Fc region with FcRn. In one embodiment of the present invention, the protein variant Fc has an increased half-life in serum relative to a comparable molecule.

The term "antibody-dependent cell-mediated cytotoxicity (ADCC)" refers to a form of cytotoxicity in which secreted Ig bound to Fc receptors (FcR) found on certain cytotoxic cells (e.g. natural cells killer cells (NK), neutrophils and macrophages) capable these cytotoxic effector cells to bind specifically with the antigen-bearing cell-to target and destroy the target cell with cytotoxins. Specific high-affinity IgG antibodies directed to the surface of target cells, "grab" the cytotoxic cells and are absolutely required for such destruction. Lysis of target cells is extracellular, requires direct contact between cells and occurs without a complement. Assume that in addition to antibodies, other proteins comprising the Fc region, Fc specific hybrid proteins possessing the ability to specifically contact with antigen-bearing target cells, can affect mediated CL�worry-beads cytotoxicity. To simplify mediated cell cytotoxicity arising from the operation of the hybrid protein Fc, also in the context of the present invention is indicated by ADCC activity.

Can be examined the ability of any particular variant Fc protein to mediate lysis of target cells through ADCC. To evaluate ADCC studied variant Fc protein administered to target cells in combination with immune effector cells that can be activated by antigen-antibody, leading to cytolysis of target cells. Cell lysis is usually detected by the release of the label (e.g., radioactive substrates, fluorescent dyes or natural intracellular proteins from lysed cells. Applicable effector cells, for example, can be mononuclear cells of peripheral blood (PBMC) and natural killer cells (NK). Specific examples of studies in vitro ADCC are described in Wisecarver et, 79, 1985, cc.277-282, Bruggemann et, J Exp Med 166, 1987, cc.1351-1361, Wilkinson, etc., J Immunol methods 258, 2001, cc.183 to 191, Patel, etc., J Immunol methods 184, 1995, cc.29-38. The ADCC activity of the studied variant Fc protein can also be assessed in vivo, e.g., in an animal model, for example, in Clynes et, Proc. Natl. Acad. Sci. USA 95, 1998, cc.652-656.

In one of the embodiments of the present invention the variant Fc protein has a high ADCC activity �otnositelno molecules compare. In one of the embodiments of the present invention the variant Fc protein has ADCC activity that is at least 2-fold, or at least 3 fold, or at least 5-fold, or at least 10 fold, or at least 50-fold, or at least 100 times more, compared with the action of the compared molecules. In another embodiment of the present invention the variant Fc protein has a higher binding to the Fc receptor FcγRIIIA and has an increased ADCC activity compared to the activity of the compared molecules. In other embodiments of the present invention the variant Fc protein has an increased ADCC activity, and increased half-life in serum compared with the action of the compared molecules.

The term "complement-dependent cytotoxicity (CSC)" refers to lysis of target cells in the presence of complement. The metabolic pathway of activation of complement is initiated by binding of the first component of the complement system (C1q) of the antibody molecule, for example, combined with a cognate antigen. To assess activation of complement can be performed a study CSC, for example, described in Gazzano-Santoro et, J. Immunol. methods, 202, 1996, p. 163. In one of the embodiments of the present invention the variant Fc protein has a high action CSC compared�structure with the associated molecule. In another embodiment of the present invention the variant Fc protein has an effect KSC, at least in 2 times, or at least 3 fold, or at least 5-fold, or at least 10 fold, or at least 50-fold, or at least 100-fold above the mapped molecules. In other embodiments of the present invention the variant Fc protein has a high action CSC and increased half-life in serum relative to the mapped molecules.

In one of the embodiments of the present invention include compositions in which the Fc region comprises non-natural amino acid residues at one or more of the provisions selected from the group consisting of provisions 234, 235, 236, 237, 238, 239, 240, 241, 243, 244, 245, 247, 251, 252, 254, 255, 256, 262, 263, 264, 265, 266, 267, 268, 269, 279, 280, 284, 292, 296, 297, 298, 299, 305, 313, 316, 325, 326, 327, 328, 329, 330, 332, 333, 334, 339, 341, 343, 370, 373, 378, 392, 416, 419, 421, 440 and 443, the numbering of which corresponds to the EU index, based on Kabat. Optionally, the Fc region may include non-natural amino acid residue at additional and/or amended provisions, known to those skilled in the art (see, e.g., US 5624821, 6277375, 6737056, PCT WO 01/58957, WO 02/06919, WO 04/016750, WO 04/029207, WO 04/035752, WO 04/074455, WO 04/099249, WO 04/063351, WO 05/070963, WO 05/040217, WO 05/092925 and WO 06/020114).

In one embodiment, the implementation of the present invented�I provide an arrangement of the variant Fc protein, in which the Fc region includes at least one unnatural amino acid residue selected from the group consisting of 234D, E, 234N, 234Q, T, N, 234Y, 234I, 234V, 234F, A, 235D, 235R, 235W, R, 235S, 235N, 235Q, T, N, 235Y, 235I, 235V, 235F, E, 239D, E, 239N, 239Q, 239F, T, N, 239Y, 240I, 240A, 240T, 240M, 241W, 241L, 241Y, 241E, 241R, 243W, 243L 243Y, 243R, 243Q, N, A, 247L, 247V, 247G, 251F, 252Y, 254T, 255L, 256E, 256M, 2621, 262A, 262T, 262E, 263I, 263A, 263T, 263M, 264L, 264I, 264W, 264T, 264R, 264F, 264M, 264Y, 264E, 265G, 265N, 265Q, 265Y, 265F, 265V, 265I, 265L, 265H, 265T, 266I, 266A, 266T, 266M, 267Q, 267L, 268E, 269H, 269Y, 269F, 269R, 270E, 280A, 284M, 292P, 292L, 296E, 296Q, 296D, 296N, 296S, 296T, 296L, 296I, 296H, 269G, 297S, 297D, 297E, 298H, 298I, 298T, 298F, 299I, 299L, 299A, 299S, 299V, 299H, 299F, 299E, 305I, 313F, 316D, 325Q, 325L, 325I, 325D, 325E, 325A, 325T, 325V, 325H, 327G, 327W, 327N, 327L, 328S, 328M, 328D, 328E, 328N, 328Q, 328F, 328I, 328V, 328T, 328H, 328A, 329F, 329H, 329Q, 330K, 330G, T, S, 330L, 330Y, 330V, 330I, 330F, 330R, 330H, 332D, 332S, 332W, 332F, 332E, 332N, 332Q, 332T, 332H, 332Y, 332A, 339T, 370E, 370N, 378D, 392T, 396L, 416G, 419H, 421K, 440Y and 434W, numbered by the EU index set lower in Kabat. Optionally, the Fc region may include additional and/or in another embodiment, the unnatural amino acid residues, known to those skilled in the art (see, e.g., US 5624821, 6277375, 6737056, PCT WO 01/58957, WO 02/06919, WO 04/016750, WO 04/029207, WO 04/035752 and WO 05/040217).

In another embodiment of the present invention provides for the composition of the variant Fc protein in which the Fc region includes at least non-natural amino acid at one or more of the provisions selected from the group consisting of 239, 330 and 332 on numeralia EU index, established in the work of Kabat. In one embodiment of the present invention, the present invention provides for the composition of the variant Fc protein, wherein the Fc region comprises at least one unnatural amino acid selected from the group consisting of 239D, 330L and 332E numbering according to EU index, established in the work of Kabat. Optionally, the Fc region may further comprise non-natural amino acid at one or more of the provisions selected from the group consisting of 252, 254 and 256 numbering according to EU index, established in the work of Kabat. In one of the embodiments of the present invention provide for the composition of the variant Fc protein, wherein the Fc region comprises at least one unnatural amino acid selected from the group consisting of 239D, 330L and 332E, numbering according to EU index, established in the work of Kabat and at least one unnatural amino acid by one or more of the provisions selected from the group consisting of 252Y, T and E numbering according to EU index, established in the work of Kabat.

In one embodiment of the present invention, the Fc variants of the present invention can be combined with other known Fc variants, for example, described in the publications Ghetie et, Nat Biotech. 15, 1997, cc.637-640, Duncan et al., Nature 332, 1988, cc.563-564, Lund, etc., J. Immunol 147, 1991, cc.2657-2662, Lund et al., Mol Immunol 29, 1992, cc.53-59, Algre, etc., Transplantation 57, 1994, cc.1537-1543, Hutchins, etc., Proc Natl. Acad Sci USA 92, 1995, cc.11980-11984, Jefferis, etc., Immunol Lett. 44, 1995, cc.111-117, Lund, etc., Faseb J 9, 1995, cc.115-119, Jefferis et al., Immunol Lett 54, 1996, cc.101-104, Lund, etc., J Immunol 157, 1996, cc.4963-4969, Armour, etc., Eur J Immunol 29, 1999, cc.2613-2624, Idusogie et al., J Immunol 164, 2000, cc.4178-4184, Reddy, etc., J Immunol 164, 2000, cc.1925-1933, Xu, etc., Cell Immunol 200, 2000, cc.16-26, Idusogie et, J Immunol 166, 2001, cc.2571-2575, Shields, etc., J Biol Chem 276, 2001, cc.6591-6604, Jefferis, etc., Immunol Lett 82, 2002, cc.57-65, Presta, etc., Biochem Soc Trans 30, 2002, cc.487 to 490, US 5624821, 5885573, 5677425, 6165745, 6277375, 5869046, 6121022, 5624821, 5648260, 6528624, 6194551, 6737056, 6821505, 6277375, US Patent Publication Nos. 2004/0002587 and WO 94/29351, WO 99/58572, WO 00/42072, WO 02/060919, WO 04/029207, WO 04/099249, WO 04/063351. The present invention also relates to the field of Fc, which include deletions, insertions and/or modifications. Other modifications/substitution/additions/deletions Fc domain domain obvious to specialists in this field.

Methods of obtaining unnatural Fc regions are known in this field. For example, amino acid substitution and/or deletions can be obtained by mutagenesis, including but not limited to, site-directed mutagenesis (Kunkel, Proc. Natl. Acad. Sci. USA 82, 1985, cc.488-492), PCR mutagenesis (Higuchi, in kN.: "PCR Protocols: A Guide to Methods and Applications", 1990, publ Academic Press, San Diego, cc.177-183) and cassette mutagenesis (Wells, etc., Gene 34, 1985, cc.315-323). Preferably, the site-directed mutagenesis is carried out by overlapping extension PCR-based (Higuchi in kN.: "PCR Technology: Principles and Applications for DNA Amplification", 1989 publ Stockton Press, New York, cc.61-70). The technique of overlap extension PCR-based (Higuchi, see above) can also be used to introduce any desired mutation (mutations) in the sequence of a target starting DNA). For example, the first cycle of PCR in the method of overlapping lengthening involves the amplification target sequence with an outside primer (primer 1) and an internal mutagenesis primer (primer 3) and separately with a second outer primer (primer 4) and an internal primer (primer 2), yielding two PCR segment (segment A and B). Internal mutagenesis primer (primer 3) design so that were erroneous mating with sequence-target, pinpointing the appropriate mutation (mutations). In the second cycle of PCR products of the first cycle of PCR (segments a and B) amplificateur by PCR using the two outside primers (primers 1 and 4). Formed by PCR the full segment length (segment b) destroy the enzymes and the resulting restriction fragment cloned in an appropriate vector. In the first stage of the initial mutagenesis DNA (e.g., encoding a Fc fusion protein, antibody, or simply Fc region) promptly cloned into the vector for mutagenesis. Primers design to reflect the desired amino acid substitutions. Other methods applicable to obtain variants of the Fc regions, known in da�Noah field (see, for example, US 5624821, 5885573, 5677425, 6165745, 6277375, 569046, 6121022, 5624821, 5648260, 6528624, 6194551, 6737056, 6821505, 6277375, patent publication US 2004/0002587 and PCT publication WO 94/29351, WO 99/58572, WO 00/42072, WO 02/060919, WO 04/029207, WO 04/099249, WO 04/063351).

In some embodiments of the present invention the variant Fc protein comprises one or more engineered glycoforms, i.e. carbohydrate compositions, which are covalently attached to a molecule comprising an Fc region. Designed glycoform can be applied for different purposes, including, but not limited to, the increase or decrease effector function. Designed glycoform can be produced by any method known to specialists in this field, for example, with the use of strains with designed or modified expression, by co-expression with one or more enzymes, for example DI N-acetylglucosaminyltransferase III (GnTI11), by expression of a molecule comprising an Fc region in various organisms and cell lines from various organisms, or by modifying carbohydrate (carbs) after the expression of molecules including the Fc region. Approaches to engineered glycoforms are known to specialists in this field and include, but are not limited to, the methods described in the following works: Umana et al, Nat. Biotechnol 17, 1999, cc.176-180, Davies, etc., Biotechnol Bioeng 74, 2007, cc.288-294, Shields et al, J Bil Chem 277, 2002, cc.26733-26740, Shinkawa, etc., J Biol Chem 278, 2003, cc.3466-3473, US 6602684, US 10/277370, US 10/113929, PCT WO 00/61739A1, PCT WO 01/292246A1, PCT WO 02/311140A1, PCT WO 02/30954A1 and technology Potillegent™ (firm Biowa, Inc. Princeton, new Jersey), technology GlycoMAb™ design glycosylation (company GLYCART biotechnology AG, Zurich, Switzerland). See, for example, WO 00061739, IA, US 20030115614, Okazaki, etc., JMB, 336, 2004, cc.1239-1249.

Glycosylation of antibodies

In yet another variant implementation of the present invention, the glycosylation of the antibodies used in accordance with the present invention is modified. For example, can be obtained by the antibody without glycosylation (i.e., antibody, lost glycosylation). Glycosylation can be modified, for example, thus, to increase the affinity of the antibody to the antigen target. Such carbohydrate modifications can be accomplished, for example, by changing one or more glycosylation sites in the sequence of the antibody, for example, modify one or more glycosylation sites in the sequence of the antibody. For example, can be produced by one or more amino acid substitutions, which lead to the elimination of one or more glycosylation sites variable region frame section, thereby, removing glycosylation on this website. Such glycosylation may increase the affinity of the ant�body to the antigen. This approach is described in detail in US 5714350 and 6350861. Also can be made by one or more amino acid substitutions, which lead to the elimination of the glycosylation site in the Fc region (for example, asparagine 297 in IgG). In addition, deglycosylated antibodies can be produced in bacterial cells that have lost the necessary mechanism of glycosylation.

Can also be obtained antibody having an altered type of glycosylation, for example, hepatocanalicular antibody having reduced amounts of residues fucosyl, or an antibody having a branched structure GlcNAc. Such altered glycosylation variants are shown to improve the ability of ADCC antibodies. Such carbohydrate modifications can include, for example, expressing the antibody in the cell host with a modified glycosylation mechanism. Cells with altered glycosylation mechanism described in this area and can be used as host cells in which to Express recombinant antibodies of the present invention will receive the antibody with altered glycosylation. See, for example, the work of R. L. Shields, etc., J. Biol. Chem. 277, 2002, cc.26733-26740, Umana, etc., Nat. Biotech. 17, 1999, cc.176-181, US 6946292, EP 1176195, PCT WO 03/035835, WO 99/54342, the essence of each of which are included in the present invention by reference.

Antibodies with altered ipaglalaban can also be developed, using the host cell of lower eukaryotes, including the modified glycosylation mechanism described in US 7029872, US 20060148035A1, the essence of which is included in the present invention in the form of links.

Designing effector function

This may require modification of the anti-ICOS antibody of the present invention relating to effector function, e.g. so that increases the efficiency of antibody in the treatment mediated T-cell diseases. For example, cysteine residues can be introduced into the Fc region, thereby allowing the formation of miaocheng disulfide bonds in this region. Thus obtained homodimeric the antibody may possess enhanced ability to internalize and/or complement-mediated destruction of cells and/or antibody-dependent cellular cytotoxicity (ADCC) and/or antibody-dependent phagocytosis. Cm. Caron, etc., J. Exp Med., 176, 1992, cc.1191-1195 and Shopes B., J. Immunol., 148, 1992, cc.2918-2922. Homodimeric antibodies with enhanced anti-tumor activity can also be prepared using heterobifunctional cross-linkers as described by Wolff and others, Cancer Research, 53, 1993, cc.2560-2565. Can also be designed antibody that has dual Fc region and thus has an enhanced complement-dependent lysis, antibody-savetimingtables and/or ADCC capabilities. See, Stevenson, etc., Anti-cancer Drug Design, 3, 1989, cc.219-230.

Other methods of constructing the Fc regions of antibodies that allows you to alter effector functions are known in the art (for example, patent publication US 20040185045 and PCT WO 2004/016750 that describe changes in the Fc region to increase binding affinity to FcγRIIB compared with the binding affinity to FCyRIIA, see also WO 99/58572, WO 99/51642 and US 6395272, the essence of which is included in the integrity in the present invention). Methods of modifying the Fc region to decrease binding affinity to FcγRIIB is well known in the art (for example, patent publication US 20010036459 and PCT WO 01/79299, the essence of which is included in the present invention in the form of links). The modified antibodies having variants of the Fc region with enhanced binding affinity against FcγRIIIA and/or FcγRIIA as compared with the Fc region of the wild type, have also been described (for example, patent publication PCT WO 2004/063351, the essence of which is included in the present invention by reference).

Well-known in the field of in vitro methods can be applied to determine whether an anti-ICOS antibody in the compositions and methods of the present invention can mediate ADCC, CSC and/or antibody-dependent phagocytosis, for example, described in the present invention.

Receipt/production of anti-ICOS antibodies

If designed t�Abueva anti-ICOS antibody anti-ICOS antibody can be obtained on a commercial scale, using methods well-known in this area for large-scale generate antibodies. For example, this can be achieved using a recombinant expression systems, for example, but their list is not limited, is described below.

Systems recombinant expression

Recombinant expression of the antibody or its variants usually requires the construction of an expression vector containing a polynucleotide that encodes the antibody. If you have received a polynucleotide encoding an antibody molecule or a heavy or light chain of an antibody, or portion thereof, the vector to obtain the antibody molecules can be obtained by recombination of DNA using methods known in this field. See, for example, patent US 6331415, the essence of which is included in the present invention by reference. Thus, the present invention describes methods for obtaining a protein by expression of the polynucleotide containing the nucleotide sequence encoding the antibody. Methods known in this field can be used to construct expression vectors containing sequences encoding the antibody, and the corresponding signals of the control of transcription and translation. These methods include, for example, methods of DNA recombination in vitro, methods of synthesis and genetic R�combination in vivo. The present invention thus represents a replicable vectors comprising a nucleotide sequence encoding the antibody molecule, heavy or light chain antibody variable domain of the heavy and light chains of the antibodies or parts thereof, or region CDR of the heavy and light chains, operatively associated with a promoter. Such vectors may include the nucleotide sequence encoding the constant region of the antibody molecule (see, e.g., WO 86/05807, WO 89/01036 and US 5122464), and the variable domain of the antibody may be cloned into such a vector for expression of a heavy chain, a light chain, or both heavy and light chains.

In another embodiment of the present invention, anti-ICOS antibodies can be obtained using targeted homologous recombination to obtain as much as anti-ICOS antibodies or parts thereof (see, US 6063630, 6187305 and 6692737). In some embodiments of the present invention, anti-ICOS antibodies can be obtained using the methods of random recombination to obtain as much as anti-ICOS antibodies or parts thereof (see, US 6361972, 6524818, 6541221 and 6623958). Anti-ICOS antibodies can also be obtained in cells expressing an antibody from a genomic sequence of the cell comprising the locus of the modified immunoglobulin, using Cre-mediated site-specific homologous recombination (�M. US 6091001). Line host cells can be obtained from a person or from the representative of another kind, including, but not limited to, mice, and Chinese hamsters. If you want a human antibody or a humanized antibody, cell line host should be a line of human cells. These methods can mainly be used to construct stable cell lines that permanently Express the antibody molecule.

If the expression vector transferout in the host cell using conventional methods, and then transfected cells are cultivated in traditional ways, designed to produce antibodies. Thus, the present invention relates to the cell host containing the polynucleotide encoding the antibody of the present invention, or its fragments, or its heavy or light chain, or portion, or single-chain antibody of the present invention, operatively associated with a heterologous promoter. In some embodiments of the present invention for the expression of double-stranded antibodies, vectors encoding both heavy, and light chain, can co-expressed in the cells of the host for expression of the entire immunoglobulin molecule, as detailed below.

Various vector systems for the expression in a host can be used for expression of an�and-ICOS antibody or parts thereof, that can be applied in the design and development of anti-ICOS antibodies (see, e.g., US 5807715). For example, mammalian cells, e.g., cells of the Chinese hamster ovary (Chinese hamster ovary cells - CHO), in conjunction with the vector, for example, an item a large intermediate early gene promoter from human cytomegalovirus are an effective expression system for antibodies (Foecking et, Gene, 45, 1986, p. 101, and Cockett, etc., Bio/Technology, 8, 1990, p. 2). In addition, can be selected cells of strain host that modulate the expression of insertionindex antibody sequences, or modifies and ProcessInput gene product antibodies specific desired manner. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may be important for the function of the protein. Different cells-the hosts have specific mechanisms for post-translational processing and modification of proteins and gene products. Appropriate cell lines or system owners can be selected to verify the accuracy of the modification and processing of the expressed antibody or a part thereof. This purpose can be used in eukaryotic cells-the owners of which possess the cellular machinery for proper processing of the primary transcript, glycosylation, and phosphorylation of the gene product. Such cells Ho�aevum mammals include, but not limited to, cells of Cho, VERY, BHK, Hela, COS, MDCK, 293, 3T3, W138, VT, Hs578T, HTB2, BT20 and T47D, NS0 (a cell line of mouse myeloma that endogenous does not produce any functional chain of immunoglobulin), CRL7030 and HsS78Bst.

In one embodiment of the present invention, the line of human cells that is created by immortalization of human lymphocytes, can be used to obtain recombinant human monoclonal anti-ICOS antibodies. In one of the embodiments of the present invention can be applied to cell line PER person.C6. (firm Crucell, the Netherlands) to obtain recombinant human monoclonal anti-ICOS antibodies.

In bacterial systems a number of expression vectors may be advantageously selected depending upon the use intended for the expressed antibody molecules. For example, it may be desirable when large quantities of such antibodies to obtain pharmaceutical compositions, comprising anti-ICOS antibody, to obtain vectors that direct the expression of high levels of products of hybrid proteins that can be easily cleaned. Such vectors include, but the list is not limited to, the expression vector pUR278 E. coli (Ruther et, EMBO, 12, 1983, p. 1791), in which a sequence that encodes the antibody may be separately Legerova in �the projector in frame with the lac Z coding region so that a fusion protein is produced, pIN vectors (Inouye and Inouye, 1985, Nucleic Acids Res. 13, 1985, cc.3101-3109, Van Heeke and Schuster, J. Biol. Chem., 24, 1989, cc.5503-5509) and the like. pGEX Vectors may also be used for expression of foreign polypeptides as hybrid proteins with glutathione S-transferase (glutathione-S-transferase - GST). Typically, such hybrid proteins are soluble and can easily be purified from lysed cells by adsorption and binding to glutathione-agarose matrix, followed by elution in the presence of free glutathione. The pGEX vectors are designed to introduce cleavage sites of thrombin and/or the protease factor XA in a murine polypeptide so that the cloned target gene product can be released from part of the molecule GST.

In the system of insect nuclear polyhedrosis virus (Autographa californica nuclear polyhedrosis virus AcNPV) is used as a vector for expression of foreign genes. The virus replicates in cells of Spodoptera frugiperda. The sequence that encodes the antibody may be cloned separately in non-essential regions (for example, in the gene polyhedrin) of the virus and placed under control of an AcNPV promoter (e.g., promoter polyhedrin).

In the cells of the host mammal can be applied a number of expression systems based on viruses. In cases where an adenovirus is used as an expression vector that encodes posledovatel�of the investigated antibodies can be Legerova with adenoviral complex control of transcription/translation, for example, the late promoter and tripartite leader sequence. Then chimeric gene can be insertion in the genome by recombination in vitro or in vivo. Insertion in a nonessential region of the viral genome (e.g., region E1 or E3) may result in a recombinant virus that is viable and can Express the antibody molecule in infected hosts (e.g., see Logan &Shenk, Proc. Natl. Acad. Sci. USA, 81:355-359 (1984)). Signals specific initiation may also be required for efficient translation insertional sequence that encodes the antibody. Such signals include the initiation codon ATG and the attached sequence. Furthermore, the initiation codon is usually in the frame with the reading frame of the desired coding sequence to confirm the translation of the entire insert. Such exogenous signals control the broadcast and initiation codons can be of various origins, both natural and synthetic. The efficiency of expression may be enhanced by the inclusion of reinforcement elements transcription, transcription terminators, etc. (see, e.g., Bittner et, Methods in Enzymol., 153, 1987, cc.51-544).

Stable expression can be used for a long period at a high level the development of recombinant proteins. For example, can be obtained cle�full-time line which stably Express the antibody molecule. The host cell can be transformed appropriately designed vector including elements control expression (e.g., promoter, enhancer, transcription terminators, polyadenylation sites, etc.) and a selective marker gene. After the introduction of the foreign DNA, the cells are grown for 1-2 days in enriched media and then transferred to selective medium. The selective marker in the recombinant plasmid provides resistance to the selection and allows cells that have stably integrated into the chromosome of the plasmid, grow and form colonies, which in turn can be cloned and propagated in a cell line. Plasmids that encode an anti-ICOS antibody can be used for introduction of a gene/cDNA into any cell line to develop in culture.

Can be applied a number of selective systems, including, but not limited to, genes timedancing virus herpes simplex (Wigler et, Cell, 11, 1977, p. 223), (Szybalska, Szybalski, Proc. Natl. Acad. Sci. USA, 48, 1992, p. 202) and adrinfo.standortstr (Lowy, etc., Cell, 22, 1980, cc.8-17) in tk-, hgprt-or aprT-cells, respectively. Also antimetabolites can be used as the basis for the selection of the following genes: dhfr, which provides stable�you to methotrexate (Wigler, etc., Natl. Acad. Sci. USA, 77, 1980, p. 357, O'hare, etc., Proc. Natl. Acad. Sci. USA, 78, 1981, p. 1527), gpt, which provides resistance to mycophenolic acid (Mulligan, Berg, Proc. Natl. Acad. Sci. USA, 78, 1981, p. 2072), neo, which provides resistance to the aminoglycoside antibiotic G-418 (Wu and Wu, Biotherapy 3, 1991, cc.87-95, Tolstoshev, Ann. Rev. Pharmacol. Toxicol. 32, 1993, 573-596, Mulligan, Science 260, 1993, cc.926-932, Morgan, Anderson, Ann. Rev. Biochem. 62, 1993, cc.191-217, May, TIB TECH 11(5), 1993, cc.155-215), hygro, which provides resistance to hygromycin (Santerre, etc., Gene, 30, 1984, p. 147). Methods well known in the field of DNA recombination, can be used to select the desired recombinant clone, and such methods are described, for example, in the book: "Current Protocols in Molecular Biology ", 1993, ed. by Ausubel, etc., the publishing house of John Wiley & Sons, new York; in the book: Kriegler "Gene Transfer and Expression, A Laboratory Manual", 1990, Univ Stockton Press; in the book: "Current Protocols in Human Genetics", 1994, edited by Dracopoli, etc., the publishing house of John Wiley & Sons, new York, chapters 12 and 13; Colberre-Garapin, etc., J. Mol. Biol., 150, 1981, p. 1, the essence of which is included in the present invention in the form of links.

The expression levels of an antibody molecule can be increased by amplification of the vector (see review on this topic in the book: Bebbington, Hentschel, "The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells in DNA cloning", 1987, publ Academic Press, new York, vol. 3). If the marker antibodies, expressed in a vector system capable of amplification, the increase in the level of inhibitor present in culture of cells x�the owners, can increase the number of copies of a gene marker. Because amplificatory region associated with the antibody gene, production of the antibody may also increase (Crouse et, Mol. Cell. Biol., 3, 1983, p. 257). The expression levels of the antibody can be amplified through the use of recombination methods and tools, known to experts in the field of production of recombinant proteins, including technologies that modify the surrounding chromatin, and increased transgenic expression of the active form of the artificial domain of transcription.

The host cell can be co-transfected with two expression vectors: the first vector encoding a polypeptide derivative of the first chain and the second vector encoding a polypeptide derivative of the second circuit. Two vectors can contain identical or different selective markers. One vector that encodes and is capable of expression of the polypeptides and heavy and light chain, can also be used. In such cases, the light chain can be placed in a position 5' to the heavy chain to avoid an excess of toxic free heavy chain (Proudfoot, Nature 322, 1986, cc.562-565, and Kohler, Proc. Natl. Acad. Sci. USA, 77, 1980, p. 2197). Coding sequences of the heavy and light chains may include cDNA or genomic DNA.

If the molecule antibodies obtained by recombinant expression, it may be purified by any m�TOD, known in the field of purification of an immunoglobulin molecule, for example, by chromatography (e.g., ion-exchange, affinity, particularly those with an affinity for the specific antigens protein A or protein G, and size exclusion chromatography), centrifugation, differential dissolution or any other standard method of protein purification. In addition, the antibodies of the present invention or their fragments can be hybridisierung with heterologous polypeptide sequences described in the present invention or other known in the field methods for easy cleaning.

Isolation and purification of antibodies

When using recombinant techniques, the antibody can be produced intracellularly, in the periplasmic space or direct secretion into the medium. If the antibody intracellular receive, as a first stage, fragments of cells, or the host cell or lysed fragments, is removed, for example, by centrifugation or ultrafiltration. Carter, etc., Bio/Technology, 10, 1992, cc.163-167, describe the procedure for the selection of antibodies that are secreted into the periplasmic space of E. coli. Briefly, cell mass is thawed in the presence of sodium acetate (pH 3.5), EDTA and phenylmethylsulfonyl (phenylmethylsulfonylfluoride - PMSF) over about 30 min. Fragments of cells may be removed by centrifugation. Estimulante antibody is released into the environment, the supernatants from such expression systems are generally first concentrated using a commercially available filter for concentrating the protein, for example, block ultrafiltration Amicon or Millipore Pellicon. A protease inhibitor, for example, PMSF, can be applied to any of the subsequent stages to inhibit proteolysis and antibiotics may be included to prevent the growth of unwanted contaminants.

The antibody composition prepared from the cells can be cleaned using, for example, chromatography on hydroxyapatite, hydrophobic interaction chromatography, ion exchange chromatography, gel electrophoresis, dialysis, and/or affinity chromatography, alone or in combination with other purification stages. The stability of the protein And the affinity ligand depends on the species and isotype of the Fc domain of immunoglobulin present in the mutant antibodies. Protein A can be used for purification of antibodies, which are based on heavy chains γ1, γ2, or γ4 (Lindmark et, J. Immunol. Methods, 62, 1983, cc.1-13). Protein G is recommended for all mouse isotypes and for γ3 (Guss et, EMBO J., 5, 1986, cc.1567-1575). The matrix is attached to the ligand, is in most cases agarose, but also possible to use other matrices. Mechanically stable matrices, for example, a porous glass or poly(Stradivari)benzene allow Uwe�ICICI the flow velocity and reduce the time of processing compared with the relevant indicators when using agarose. If the antibody comprises a domain of CH3, applicable for cleaning resin Bakerbond ABX (company J. T. Baker, Phillipsburg, NJ). Other methods of protein purification, for example, fractionation on an ion-exchange resin, precipitation with ethanol, HPLC reverse phase chromatography on silicon, chromatography on silicon, chromatography on heparin chromatography on SEPHAROSE, chromatography on an anion - and kationoobmennuyu resin (for example, in the column with poliasparaginovaya acid), chromatofocusing, SDS-PAGE and precipitation with ammonium sulfate, can also be applied depend on secreted antibodies.

After any preliminary stages (stage) purification of the mixture comprising the antibody and analyzed contaminants may be subjected to chromatographicaliy hydrophobic interaction at low pH using a buffer for elution with a pH of about 2.5 to 4.5, and can be performed at low salt concentrations (e.g., about 0-0,25 moles of salt).

Therapeutic anti-ICOS antibody

Anti-ICOS antibody used in the compositions and methods of the present invention may be a human antibody or humanized antibody that may mediate ADCC line of T-cells, antibody-dependent phagocytosis and/or CSC, or can be selected from known anti-ICOS EN�Itel, which can mediate ADCC line of T - cells, antibody-dependent phagocytosis and/or CSC. In some embodiments of the present invention, anti-ICOS antibodies can be chimeric antibodies. In some embodiments of the present invention, anti-ICOS antibody may be a monoclonal antibody, a human antibody, humanized, or chimeric anti-ICOS antibody. Anti-ICOS antibody used in the compositions and methods of the present invention may be a human antibody or humanized antibody isotype IgG1 or human IgG3, or any allele IgG1 or IgG3 found in the human population. In other embodiments of the present invention, anti-ICOS antibody used in compositions and methods of the present invention may be a human antibody or humanized antibody isotype IgG2 or human IgG4 or any of the IgG2 or allele IgG4 detected in the human population.

Although such antibodies can be obtained using the methods described above, in other embodiments of the present invention, JMab-136 anti-ICOS antibody (see, US 6803039) can be modified to obtain an anti-ICOS antibody with enhanced effector function, for example, but their list is not limited to, ADCC, antibody-dependent phagocytosis and/or CSC. For example, the famous� anti-ICOS antibodies which can be used are, but not limited to, monoclonal antibodies against ICOS person described in US 6803039, and clone ISA-3 (eBioscience company, US).

In some embodiments of the present invention the antibody is switched option isotype known antibodies (e.g., isotype IgG1 or IgG3 human), for example, as described above.

Anti-ICOS antibody used in the compositions and methods of the present invention, can be "naked" antibodies, immunoconjugates or hybrid proteins. Anti-ICOS antibodies described above for use in the compositions and methods of the present invention may be able to decrease or depletion of ICOS-expressing T cells and circulating immunoglobulin in humans subjected to treatment them. Depletion of T cells can occur in circulating T-cells or in certain tissues, for example, but their list is not limited to, bone marrow, spleen, lymphatic tissue associated with the intestine, and/or in the lymph nodes. Such depletion may be achieved via different mechanisms, e.g., via antibody-dependent cell mediated cytotoxicity (ADCC), and/or antibody-dependent phagocytosis, and/or by blocking the interaction of ICOS with its target ligand, and/or through complement-dependent cytotoxicity (KZ�). The concept of "exhaustion" of T cells means a reduction in the number of circulating ICOS-expressing T cells and/or ICOS-expressing T cells in a specific tissue (tissue) of at least about 25%, 40%, 50%, 65%, 75%, 80%, 85%, 90%, 95% or more. In certain embodiments, virtually all detectable ICOS-expressing T cells are depleted in the bloodstream and/or in specific tissues (tissue). "Exhaustion" of circulating immunoglobulin (Ig) means a reduction of at least about 25%, 40%, 50%, 65%, 75%, 80%, 85%, 90%, 95% or more. In some embodiments, the present invention virtually all detectable Ig depleted from the circulation.

Screening antibodies for binding protein human ICOS

Analysis of binding can be used to identify antibodies that bind the antigen of human ICOS. Analysis of binding can be done either through direct binding or in the form of the analysis of competitive binding. Binding may be detected using standard ELISA or standard analysis the flow cytometry analysis. In the analysis of direct binding of the antibody-candidate tested for binding to the antigen protein of human ICOS. In some embodiments of the present invention studies to include screening in the second stage, determining the ability of antibodies to induce located nicesignal events in T-cells, expressing ICOS person. On the other hand, the study of competitive binding allows to evaluate the ability of the antibody candidate to compete with a known anti-ICOS antibody or other compound that binds to human ICOS.

In the study of direct binding of ICOS antigen human contact with the antibody-candidate in conditions which allow to bind the antibody-candidate with ICOS antigen. Binding can occur in solution and on a solid surface. The antibody-candidate may be pre-marked for identification. Any detectable compound may be used for applying labels, for example, but their list is not limited to, luminescent labels, fluorescent labels or radioactive isotope or its containing groups, or non-isotopic labels, such as enzyme or dye. After a period of incubation sufficient for forming the binding reaction is subjected to conditions and manipulations that remove excess antibodies or non-specific bound antibody. Usually includes rinsing the corresponding buffer. In the end, reveal the presence of a complex ICOS antibodies.

In the study of competitive binding of the antibody-candidate is evaluated by their ability to inhibit or displace the binding of a known anti-ICOS antibody (Il� other connection) with ICOS antigen. Labeled known binder ICOS can be mixed with the antibody-candidate and placed in the conditions under which the interaction between them in the norm can occur with/without addition of the antibody candidate. The amount of labeled known binder ICOS, which binds human ICOS can be compared with the amount bound in the presence or absence of the antibody-candidate.

In one embodiment of the present invention, the analysis of binding is carried out with one or more components immobilized on the solid surface to facilitate the formation and detection of a complex of antibody-antigen. In various embodiments, a dense basis maybe, but their list is not limited to, polyvinylidene fluoride, polycarbonate, polystyrene, polypropylene, polyethylene, glass, nitrocellulose, dextran, nylon, polyacrylamide and agarose. According to the configuration of the substrate may be in the form of granules, membranes, microparticles, the inner surface of the vessel for the reaction, for example, a tablet micrometrology, test tube or other vessel used for the reaction. Immobilization of human ICOS or other component can be achieved through covalent or non-covalent attachment. In one embodiment of the present invention, the attachment may be indirect, i.e. via the associated�inannie antibody. In another embodiment of the present invention ICOS antigen of human rights and negative controls captured by the epitope, for example, glutathione-3-transferase (GST) so that the accession to the solid substrate may be mediated by a commercially available antibody anti-GST (Santa Cruz Biotechnology firm).

For example, the analysis of binding affinity may be performed using the ICOS human antigen immobilized on the solid basis. Usually neemalirovannym component binding reactions, in this case, it is an anti-ICOS antibody candidate, mark to ensure detection. Known and can be applied to a different label, such as fluorescent, chromophoric, fluorescent, or radioactive isotope or its containing groups, and non-isotopic labels, for example, enzymes or dyes. In one embodiment of the present invention, anti-ICOS antibody-candidate labeled fluorophores, for example, fluoresceinisothiocyanate (FITC, firm Sigma Chemicals, St. Lewis). Such a study binding affinity may be performed using ICOS human antigen immobilized on the solid surface. Anti-ICOS antibodies and then incubated with the antigen and the specific binding of the antibody detected by methods known in this field, but not only by them, including BiaCore Analyses, ELISA, FMET and RIA methods.

It�GE remaining on the solid basis of the label can be detected by any detection method, known in this field. For example, if an anti-ICOS antibody observed fluorophore, the ppm can be used to detect complexes.

ICOS antigen may be added in the study of binding in the form of intact cells that Express ICOS antigen of man, or the selected membranes containing ICOS antigen person. Thus, direct binding to ICOS antigen of man can be studied in intact cells in culture or in animal models in the presence or absence of an anti-ICOS antibody candidate. Labeled anti-ICOS antibody, the candidate may be mixed with cells that Express ICOS antigen human, or grossly extracts obtained from such cells, and anti-ICOS antibody-candidate may be added. Selected membranes can be used to identify anti-ICOS antibody candidate, which interacts with human ICOS. For example, in a typical experiment using the selected membrane, the cells can be genetically engineered for the expression of ICOS antigen person. The membrane can be collected by standard methods and used in the analysis of binding in vitro. Labeled anti-ICOS antibody candidate (for example, fluorescence-labeled antibody) is associated with membranes and tested for specific activity; specific binding is determined by comparison with an�lizama binding, performed in the presence of excess unlabeled (cold) anti-ICOS antibody candidate. Soluble ICOS antigen may recombinante to be expressed and used in the studies are not based on binding of the cells to identify antibodies that binds to ICOS antigen. Recombinante murine ICOS polypeptides can be used in screening studies is not based on cells. Peptides corresponding to one or more parts of the binding of ICOS antigen human, or hybrid proteins containing one or more binding parts ICOS antigen of human rights, can also be applied in systems analysis, not based on the cells to identify antibodies that binds ICOS with parts of human antigen. In studies that are not based on cells, recombinante murine ICOS protein person attached to a thick substrate, for example, a test tube, the wells of the microplate or a column, by means known in the art (Ausubel, see above, etc.). Investigational antibody is then examined for the ability to bind ICOS antigen.

The binding reaction can also be carried out in solution. In the present study, carried out the binding of the labeled component, its binding partner (s) in solution. If the differences in size between �echenim component and its binding partner (s) permit such a separation, this separation can be achieved by passing the products of the binding reaction through an ultrafilter, pores which allow the omission of unbound labeled component but not of its binding partner (partners) or of labeled component bound to its partner (s). The separation can also be accomplished using any reagent capable of capturing a binding partner of the labeled component from solution, for example, antibodies against the binding solution, and so on.

In another preferred embodiment of the present invention, the solid substrate is a membrane containing ICOS antigen of the person attached to the Cup for micrometrology. Antibody candidates, for example, can bind cells that Express a library of antibodies, cultured under conditions that allow expression of the representatives of the libraries in cups for micrometrology. Bring together representatives of the library that bind to human ICOS. Such methods are primarily described in the form of examples in the works Parmley and Smith, Gene, 73, 1988, cc.305-318, Fowlkes, etc., BioTechniques, 13, 1992, cc.422-427, PCT WO94/18318, and in references contained in these works. Antibodies identified as binding to ICOS antigen of man can be of any type, or modified antibodies described above.

Screenin� antibody effector functions ADCC person

Antibodies of IgG class human with defined functional properties, such as long half-life in serum and the ability to mediate various effector functions, used in some embodiments of the present invention (kN.: "Monoclonal Antibodies: Principles and Applications", 1995, firm Wiley-Liss, Inc., Chapter 1). The antibody of class IgG further classified into the following 4 subclasses: IgG1, IgG2, IgG3 and IgG4. A large amount of work has been done to date on ADCC and CSC as effector functions of the IgG class antibody, and it was found that among antibodies of the IgG class human IgG1 subclass has the highest ADCC activity and CSC people (Chemical Immunology, 65, 1997, p. 88).

The expression of the action of ADCC and actions KSC antibodies of human IgG1 subclass usually involves the binding of the Fc region of the antibody with the receptor antibody (referred to in the present invention "FcγR"), located on the surface of effector cells, e.g., killer cells, natural killer cells or activated macrophages. The various components of complement can be bound. Regarding the binding was also found to be important for the binding of several amino acid residues in the hinge region and the second domain region (denoted in the present invention "γ2 domain") antibodies (Eur. J. Immunol., 23, 1993, p. 1098, Immunoloy, 86, 1995, pp. 319, Chemical Immunology, 65, 1997, p. 88) and that the sugar chain in the domain γ2 (Chemical Immunology, 65, 1997, p. 88) is also important.

Anti-ICOS antibodies can be modified to effector function, e.g. so as to enhance ADCC and/or complement dependent cytotoxicity (CSC) antibodies. This can be achieved by the introduction of one or more amino acid substitutions in the Fc region of the antibody. The residue (remainder) of cysteine can also be introduced into the Fc region, allowing the formation of miaocheng disulfide bonds in this region. In this way can be obtained homodimeric antibody that can have an important ability to internalize and/or increased complement-mediated cell death and ADCC (Caron et, J. Exp. Med., 176, 1992, cc.1191-1195, Shopes, J. Immunol., 148, 1992, cc.2918-2922). Heterobifunctional cross ligament can also be used to obtain homodimeric antibodies with enhanced anti-tumor activity (Wolff and others, Cancer Research, 53, 1993, cc.2560-2565). Antibodies can also be designed in such a way that in their structure there were two or more Fc regions, which leads to increased complement lysis and ADCC ability to (Stevenson, etc., Anti-Cancer Drug Design, 3, 1989, cc.219-230).

Other methods of constructing the Fc regions, which resulted in the change of the effector functions are known in the art (e.g., US 20040185045 and PCT O 2004/016750, which describe the change in the Fc region to increase binding affinity to FcγRIIB relative binding affinity to FCγRIIA, see also PCT WO 99/58572, WO 99/51642, US 6395272, the essence of which is included in the present invention in the form of links). Methods of modifying the Fc region to decrease binding affinity to FcγRIIB is also known in the art (e.g., US 20010036459 and PCT WO 01/79299, the essence of which is included in the present invention in the form of links). The modified antibodies having options Fc region with enhanced binding affinity against FcγRIIIA and/or FcγRIIA relative to a binding affinity to the Fc region of the wild type, have also been described (e.g., PCT WO 2004/063351, the essence of which is included in the present invention by reference).

It was discovered at least four different types of FcγR, which respectively are called FcγRI (CD64), FcγRII (CD32), FcγRIII (CD16), and FcγRIV. People types FcγRII and FcγRIII further classified into FcγRIIa, FcγRIIb, FcγRIIIa and FcγRIIIb, respectively. FcγR is a membrane protein belonging to the superfamily of immunoglobulins, and FcγRII, FcγRIII, and FcγRIV have a chain and containing two immunoglobulin-like domain, FcγRI has a chain and that contains an extracellular region with three immunoglobulin-like domain, as a constituting component, and the chain and is involved in IgG binding capacity. In addition, FcγRI and FcγRII contain the chain or the chain, as a constituting component which has the function of signal transmission in Association with the a chain (Annu. Rev. Immunol., 18, 2000, p. 709, Annu. Rev. Immunol., 19, 2001, p. 275). FcγRIV was described Bruhns, etc., Clin. Invest. Med., Canada) 27, 2004, p. 3D.

To evaluate ADCC investigational anti-ICOS antibody can be used for the analysis of ADCC in vitro, for example, described in US 5500362 or 5821337. This analysis can also be performed using a commercial kit, for example, the product CytoTox 96 ® (firm Promega). Useful effector cells for such studies include, for example, but not limited to, mononuclear cells of peripheral blood (PBMC), natural killer cells (NK) and NK cell line. Line NK cells expressing transgenic Fc receptor (e.g., CD16) and associated signaling polypeptide (e.g., FCεRI-γ), can also serve as effector cells (see, e.g., WO 2006/023148 A2). For example, can also examined the ability of any particular antibody to mediate lysis of target cells by activating complement and/or ADCC. The investigated cells are cultivated and applied the tag in vitro, the antibody is added to the cell culture in combination with immune cells that can be activated by antigen-antibody, i.e., effector cells involved in the ADCC response. The antibody can also be investigated on the activation of complement. In CA�house case cytolysis of target cells is detected by selection markers from lysed cells. The degree of lysis of target cells can also be identified by the detection of the release of cytoplasmic proteins (e.g., LDH) in the supernatant. In fact, antibodies can be screened using native serum of the patient as the source of complement and/or immune cells. Antibodies able to mediate human ADCC in the in vitro test, can then be used therapeutically for this specific patient. The ADCC activity of the studied molecules can also be assessed in vivo, e.g., in animal models, for example, models described Clynes, etc., Proc. Natl. Acad. Sci. (USA) 95, 1998, cc.652-656. In addition, methods of modulating (i.e. increasing or decreasing) the level of ADCC, and optional steps KSC antibodies known in this field. See, for example, US 6194551. The antibodies of the present invention may have the ability to induce ADCC and/or CSC, or can be modified to acquire this ability. Studies to determine the function of ADCC can be performed using effector cells of the person to assess ADCC function of the person. Such research may include studies designed to screen for antibodies that induce, mediate, promote, inhibit cell death as a result of the mechanisms of necrosis and/or apoptosis. Such methods, including the use�jiznennyh dyes, methods of detection and analysis of caspases and methods of measurement of DNA strand breaks can be used to evaluate the activity of apoptosis in cultured cells was investigated in vitro with anti-ICOS antibody.

For example, studies by staining with annexin V or TUNEL method (TdT-also been other ideas where dUTP nick-end labeling) can be performed according to the description Decker, etc., Blood (USA) 103, 2004, cc.2718-2725 to identify appticable activity. The TUNEL analysis includes the cultivation of the investigated cells with fluorescein-labeled dUTP for incorporation into the gaps of the DNA strands. Then the cells ProcessInput for liquid analysis by cytometry. A study using the annexin V detects the appearance of phosphatidylserine (PS) on the outer side of the plasma membrane apofaticheski cells using conjugated with fluorescein annexation V, which specifically recognizes the open molecule FS. At the same time viable dye, for example, reflects iodic, can be used to exclude late apofaticheski cells. Cells stained with labeled annexin V and analyzed liquid cytometry.

Immunoconjugate and hybrid proteins

In accordance with certain objects of the present invention, therapeutic agents or toxins can be anywhereman with anti-ICOS antibodies for use in the compositions and methods of the present invention. In some embodiments, the present�th invention such conjugates can be produced as a hybrid protein. Examples of therapeutic agents and toxins include, but not limited to, representatives of the family of molecules enedina, for example, calicheamicin and espiramicina. Chemical toxins can also be taken from the group including duocarmycin (see, e.g., US 5703080 and US 4923990), methotrexate, doxorubicin, melphalan, chlorambucil, ARA-C, vindesine, mitomycin C, CIS-platinum, etoposide, bleomycin and 5-fluorouracil. Examples of chemotherapeutic agents include adriamycin, doxorubicin, 5-fluorouracil, cytosine arabinoside (Ara-C), cyclophosphamide, thiotepa, Taxotere (docetaxel), busulfan, cytoxin, Taxol, methotrexate, cisplatin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, to produce remissions in childhood, dactinomycin, mitomycin, espiramicina (see, US 4675187), melphalan and connections, similar to mustard gas (yperite).

In some embodiments of the present invention, anti-ICOS antibodies anywhereman with cytostatic, cytotoxic or immunosuppressive agent, and a cytotoxic agent selected from the group consisting of enediyne, lexitropsin, duocarmycin, a taxane, a puromycin, dolastatin, maytansinoid and Vinca alkaloids. In some embodiments of the present invention cytotoxic AG�ntom is paclitaxel, docetaxel, CC-1065, SN-38, topotecan, morpholino-doxorubicin, rhizoxin, cinemaholic-doxorubicin, dolastatin-10, economizing, combretastatin, calicheamicin, maytansine, DM-1, auristatin E, AEB, AEVB, AEFP, MMAE (see, US 10/983340) or netropsin.

In some embodiments of the present invention, a cytotoxic agent conjugate of an anti-ICOS antibody-cytotoxic agent of the present invention is an anti-tubulinovykh agent. In one embodiment of the present invention, the cytotoxic agent is selected from the group including Vinca alkaloids, podophyllotoxin, Texan derived baccatin, cryptophycin, maytansinoid, combretastatin and dolastatin. In one embodiment of the present invention, the cytotoxic agent is vincristine, vinblastine, vindesine, vinorelbine, VP-16, camptothecin, paclitaxel, docetaxel, epitalon And, epitalon In, nocodazole, colchicine colcemid, estramustine, cemalettin, discodermolide, maytansine, DM-1, AEFP, auristatin E, AEB, AEVB, AEFP, MMAE or eleutherobin.

In some embodiments of the present invention, anti-ICOS antibody anywhereman with a cytotoxic agent via a linker, wherein the linker is a peptide linker. In other embodiments of the present invention, anti-ICOS antibody anywhereman with a cytotoxic agent via a linker, �rich linker is a linker of val-cit, the linker phe-lys, a hydrazone linker, or a disulfide linker.

In some embodiments of the present invention, anti-ICOS antibody conjugate anti-ICOS antibody-cytotoxic agent anywhereman with a cytotoxic agent via a linker, wherein the linker may be susceptible to hydrolysis at pH less than 5.5. In one embodiment of the present invention, the linker may be susceptible to hydrolysis at pH less than 5.0.

In some embodiments of the present invention, anti-ICOS antibody conjugate anti-ICOS antibody-cytotoxic agent anywhereman with a cytotoxic agent via a linker, wherein the linker can be broken down by the protease. In another embodiment of the present invention, the protease is a lysosomal protease. In other embodiments of the present invention protease along with other is membrane-associated protease, an intracellular protease, or endosomal protease.

Other toxins that may be applicable in the compositions and methods of the present invention include poisonous lectins, plant toxins, e.g., ricin, abrin, modeccin, botulinum and diphtheria toxins. Of course, combinations of the various toxins can also be bonded with one molecule of the antibody, thereby selecting different�know cytotoxicity. Examples of toxins suitable for use in the combined treatment of the present invention are ricin, abrin, ribonuclease, Tnkase I, staphylococcal enterotoxin-A, an antiviral protein, Phytolacca American (Phytolacca amigoe), gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin. See, for example, the publication Pastan, etc., Cell 47, 1986, p. 641, Goldenberg et al., Mosetse Journal for Clinicians, 44, 1994, p. 43. Can be applied enzymatically active toxins and fragments, including a chain of diphtheria toxin, non-binding active fragments of diphtheria toxin, a chain of exotoxin (from Pseudomonas aeruginosa), chain A of ricin, a chain And abrina, chain And modeccin, alpha sarcin, proteins Aleurites fordii, ventinove proteins, proteins from Phytolaca amigot (PAPI, PAPII, and PAP-S), the inhibitor from Momordica charantia, Curtin, krotin, an inhibitor of Sapaonaria officinalis, gelonin, mitogillin, restrictocin, vanomycin, analyzin and trichothecene. See, for example, WO 93/21232.

Applicable toxins and chemotherapeutic agents described in the book: "Remington's Pharmaceutical Sciences, 1995, 19th ed., publishing house Mack Publishing Co., and in the book: Goodman, Oilman's "The Pharmacological Basis of therapeutics, 1985, 7th ed., publishing house of MacMillan Publishing Co. Other applicable toxins and/or chemotherapeutic agents known to specialists in this field.

The present invention also relates to antibodies (including fragments of antibodies or their variants) comprising or conjug�available with a radioactive agent, applicable for diagnostic purposes. Examples of relevant radioactive materials are, but not limited to, iodine (121I,123I,125I,131I), carbon (14(C), sulfur (35S), tritium (3H), indium (111In112In113mIn115mIn), technetium (99Tc,99mTc), thallium (201Ti), gallium (68Ga67Ga), palladium (103Pd), molybdenum (99Mo), xenon (135Xe), fluorine (18F),153Sm177Lu,159Gd149Pm,140La,175Yb,166But,90Y47Sc,186Re,188Re,142Pr105Rh and97Ru.

In addition, an anti-ICOS antibody of the present invention (including an scFv or other molecule comprising, or alternatively consisting of antibody fragments or variants thereof) may be combined or anywhereman with an ion of a radioactive metal used for therapeutic purposes. Examples of appropriate radioactive ions include, but is not limited to, alpha-emitters, for example,213Bi, or other radioisotopes such as103Pd135Heh,131I,68Ge57Co,65Zn,85Sr,32P,35S,90Y153Sm153Gd169Yb,51Cr54Mn75Se113Sn,90Y117Tin,186Re,188Re and166But. In some embodiments of the present invent�ia antibody or a fragment thereof is attached to the macrocyclic chelators, which capture and attached to the polypeptides of radioactive ions of metals, including, but not limited to,177Lu,90Y166But153Sm. In other embodiments of the present invention, the macrocyclic chelator is 1,4,7,10-tetrastromatica-N,N',N",N'"-vs acid (1,4,7,10-tetraazacyclododecane-N,N',N",N'"-tetraacetic acid, DOTA). In some embodiments of the present invention the connection of the DOTA is attached to the antibody of the present invention or its fragment via a linker molecule. Examples of linker molecules, applicable for conjugating DOTA to a polypeptide are well known in the art (see, for example, DeNardo et, Clin Cancer Res 4(10), 1998, cc.2483-2490, Peterson, etc., Bioconjug Chem 10(4), 1999, cc.553-557, Zimmerman, etc., Nucl Med Biol 26(8), 1999, cc.943-950, the essence of which is included in the present invention in the form of links).

Anti-ICOS antibody of the present invention can also be used in therapy in ADEPT by conjugating the antibody to an enzyme that activates a prodrug (e.g., pipidinny chemotherapeutic agent, see WO81/01145) to an antitumor drug. See, for example, WO 88/07378 and US 4975278. Enzyme component in immunoconjugate applicable to ADEPT, is any enzyme capable of acting on a prodrug in such a way that converts it to more current cytotoxic form.

To farms�ntam, applicable in the method according to the present invention, include, but not limited to, alkaline phosphatase, applicable for the conversion of a phosphate-containing prodrug into the free drug, citizenguinea applicable for converting non-toxic 5-fertilizin in anticancer drug 5-fluorouracil, proteases, such as Serratia protease, thermolysin, subtilisin, carboxypeptidase and cathepsins (such as cathepsins b and L), which are applicable for the conversion of peptide-containing prodrug into the free drug, D-alanismorissette applicable for the conversion of prodrug that contain D-amino acid substituents, enzymes, breaks down carbohydrates, such as β-galactosidase and neuraminidase, are applicable for the conversion of glycosylated prodrug into the free drug, β-lactamase, applicable for the conversion of medicines, modified α-lactams, available drugs, and penicillin amidase, for example, penicillin V amidase or penicillin G amidase applicable for the conversion of drugs, their derivatives amine nitrogen phenoxyacetyl or phenylacetylene groups, respectively, into free drugs. Antibodies with enzymatic activity, also known in this field "absegami", �of can also be used for the conversion of the prodrug into free active drugs (see, for example, Massey, Nature 328, 1987, cc.457-458). Conjugates of the antibody-Abim can be prepared according to the description in the present invention for the release of abzyme if necessary, portions of a person with malignant disease associated with T cells expressing ICOS.

The antibodies of the present invention can be covalently linked to the enzyme by methods known in this field, for example, a method using heterobifunctional cross-linking reagents described above. Hybrid proteins comprising at least the antigen-binding region of an anti-ICOS antibody that is associated with at least a functionally active portion of an enzyme can be constructed using recombinant DNA methods known in the art (see, e.g., Neuberger et, Nature, 312, 1984, cc.604-608).

Covalent modifications of anti-ICOS antibodies included in the scope of the present invention. They can be obtained by chemical synthesis, or by enzymatic or chemical cleavage of the antibody, if it is permissible. Other types of covalent modifications of anti-ICOS antibodies are introducing into the molecule by reacting targeted amino acid residues of the antibody with an organic derivatizing agent capable of reacting with selected side chains or the N - or C-terminal residues.

Caseinline remains iná theá majority ofá theá cases interact with α-halogenation (and corresponding amines), for example, Chloroacetic acid or chloroacetamide, to obtain a carboxy-methyl or carboxylatomethyl derivatives. In a similar manner can also be applied iodine-containing reagents. From cysteinyl residues also derived by reaction with BROMOTRIFLUOROMETHANE, α-bromo-β-(5-imidazolyl)propionic acid, chloroacetylation, N-alkylamide, 3-nitro-2-pyridyldithio, methyl-2-pyridyldithio, R-chloromercuribenzoate, 2-chloromercuri-4-NITROPHENOL, or chloro-7-nitrobenzo-2-ox-1,3-diazoles.

From gistically residues also derived by reaction with diethylpyrocarbonate at pH 5.5 and 7.0 because this agent is relatively specific in relation to the side chain of histidine. Also applicable vapor-bromfenac bromide, the reaction can be performed in 0.1 M nutrie cacodylate at pH 6.0.

Lesilie and amino-terminal residues react with the anhydrides of succinic or other carboxylic acid. The derivatization of these agents leads to the restoration of the charge residues liinil. Other relevant reagents for obtaining derivatives of α-amino-containing residues and/or α-amino-containing residues include imidiately, for example, methyl picolylamine, pyridoxal phosphate, pyridoxal, harborhead, trinitrobenzenesulfonic acid, 0-methylisoleucine, 2,4-pentanedione and catalizer�th transaminase reaction with glyoxylate.

Argireline residues modified by reaction with one or several conventional reagents, among them phenylglyoxal, 2,3-butandiol, 1,2-cyclohexandione and ninhydrin. Deriving orginalny residues usually requires reaction in alkaline conditions because of the high value of the guanidine functional group. Furthermore, these reagents can interact with ε-amino groups of lysine, and arginine Epsilon-amino group.

Specific modification of residues tyrosine can be produced with specific needs in introducing spectral labels into the remains of tyrosine by reaction with aromatic compounds diasone or tetranitromethane. In most cases the use of N-acetylimidazole and tetran nitromethan for the formation of O-acetyltyrosine species and 3-nitro derivatives, respectively. Tyrosine remnants itinerol using125I or131I to obtain labeled proteins for use in radioimmunoassay.

Carboxyl side groups (asperilla or glutamina) are selectively modified by reaction with carbodiimides (R--N=C=N--R', where R and R' mean different alkyl groups, for example, 1-cyclohexyl-3-(2-morpholinyl-4-ethyl) carbodiimide or 1-ethyl-3-(4-azoni-4,4-dimethylpentyl) carbodiimide. In addition, the remains of aspartyl and glutamyl converted to ASP residues�of reginia and glutamine in the reaction with ammonium ions.

The remains of glutaminyl and asparaginyl often diamidino balances in glutamine and aspartyl, respectively. These residues diamidino in neutral or basic conditions. Deliciously form of such balances relates to the scope of the present invention.

Other modifications include hydroxylation of Proline and lysine, phosphorylation of hydroxyl groups of residues or serila threonine, methylation of the α-amino groups of the side chains of lysine, arginine and histidine (see kN.: T. E. Creighton "Proteins: Structure and Molecular Properties", 1983, publishing house W. H. Freeman & Co., San Francisco, CA, cc.79-86), acetylation of the N-terminal amine, and amidation of C-terminal carboxy group.

Another type of covalent modification is a chemical or enzymatic coupling of glycosides to the antibody. Such methods have the advantage that they need no elaboration of the antibody in the host cell, which has the ability to glycosylation of the N - or O-linked glycosylation. Depending on the connection method sugar (sugar) can be attached to (a) arginine and histidine, (b) free carboxyl groups, (C) free sulfhydryl groups such as cysteine, (d) free hydroxyl groups, for example, serine, threonine, or hydroxyproline, (e) aromatic residues, for example, � phenylalanine, tyrosine or tryptophan, or (f) the amide group of glutamine. These methods are described in WO 87/05330 and work in Aplin and Wriston, CRC Crit. Rev. Biochem., 1981, cc.259-306.

Chemotherapeutic combinations

The present invention has cancer or one or more of its symptoms can be prevented, treated, modified or alleviated by the introduction of anti-ICOS monoclonal antibody in combination with one or more of the methods of treatment, for example, but their list is not limited to, chemotherapy, radiation therapy, hormonal therapy and/or biological therapy/immunotherapy.

In one embodiment of the present invention, the methods of the present invention include the introduction of one or more antagonists of angiogenesis, which, for example, include, but their list is not limited to, angiostatin (a fragment of plasminogen), antiangiogenic antithrombin III, angiozyme, ABT-627, Bay 12-9566, benefin, bevacizumab, BMS-275291-derived inhibitor of cartilage (cartilage-derived inhibitor - CDI), CAI, a fragment of CD59 complement, CEP-7055, Col 3, combretastatin A-4, endostatin (a fragment of collagen XVIII), a fragment of fibronectin, Gro-beta, halofuginone, heparanase, hexasaccharide heparin fragments, HMV833, human chorionic gonadotropin (hCG), IM-862, interferon alpha/beta/gamma, interferon inducible protein (IP-10), interleukin-12, Kringle domain 5 (fragment PLA�of monogene), marimastat, inhibitors of metalloproteinases (TIMP), 2-methoxyestradiol, MMI 270 (CGS 27023A), a monoclonal antibody IMC-1C11, neovastat, NM-3, panzem, PI-88, an inhibitor of placental ribonuclease inhibitor plasminogen activator, platelet factor-4 (PF4), prinomastat, a fragment of prolactin 16 kDa, proliferin-related protein (PRP), PTK 787/ZK 222594, retinoids, slimstat, squalamine, SS 3304, SU 5416, SU6668, SU11248, tetrahydrocortisol-S, tetrathiomolybdate, thalidomide, thrombospondin-1 (TSP-1), TNP-470, transforming growth factor beta (Transforming growth factor-beta (TGF-b), vascularity, vasostatin (fragment of calreticulin), ZD6126, ZD 6474, inhibitors farnesyl transferase (FTI) and bisphosphonates (e.g., alendronate, clodronate, etidronate, ibandronate, pamidronate, risedronate, tiludronate and zoledronate, but their list is not limited).

In a specific embodiment of the present invention, the methods include the introduction of one or more immunomodulatory agents, e.g., chemotherapeutic and negitiations agents that the list is not limited. Examples that the list is not limited to, include methotrexate, cyclosporine a, Leflunomide, cisplatin, ifosfamide, taxanes, e.g., Taxol and paclitaxel, inhibitors of topoisomerase I (e.g., CPT-11, topotecan, 9-AC, and GG-211), gemcitabine, vinorelbine, oxaliplatin, 5-fluorouracil (5-FU), leucovorin, V�gelbin, Temodal, cytochalasin B, gramicidin D, emetine, mitomycin, etoposide, teniposide, vincristine, vinblastine, colchicin, doxorubicin, daunorubicin, dihydroxyanthracene, mitoxantrone, mithramycin, actinomycin D, 1-dehydrotestosterone, glucocorticoids, procaine, tetracaine, lidocaine, propranolol, homologues of puromycin and cytoxan. Examples negitiations immunomodulatory agents include, but are not limited to, antibodies against the receptor of T cells (e.g. anti-C antibodies (e.g., cm-T (company Boeringer), IDEC-CE9.1® (IDEC and SKB), a monoclonal antibody 4162W94, Orthoclone and OKTcdr4a (company Janssen-Cilag)), anti-CD3 antibodies (e.g., Nuvion (Product Design firm Labs), OKT3 (Johnson &Johnson), or Rituxan (firm IDEC)), anti-CD5 antibodies (e.g., anti-CD5 ricin-linked immunoconjugate), anti-CD7 antibodies (e.g., CHH-380 (firm Novartis)), anti-CD8 antibodies, anti-CD40 ligand monoclonal antibodies (e.g., IDEC-131 (firm IDEC)), anti-CD52 antibodies (e.g., CAMPATH 1H (Ilex)), anti-CD2 antibodies (e.g., MEDI-507 (MedImmune, Inc., International Publication Nos. WO 02/098370 and WO 02/069904), anti-CD11a antibodies (e.g., Xanelim (firm Genentech)), and anti-B7 antibodies (e.g., IDEC-114) (firm IDEC)), antibodies against the cytokine receptor (e.g., anti-IFN receptor antibodies, anti-IL-2 receptor antibodies (e.g., Zenapax (firm Protein Design Labs)), anti-IL-4 receptor antibodies, anti-IL-6 receptor antibodies, anti-IL-10 receptor antibodies, and anti-IL-12 recipe�R antibodies), antibodies against cytokines (e.g., anti-IFN antibodies, anti-TNF-α antibodies, anti-IL-1β antibodies, anti-IL-6 antibodies, anti-IL-8 antibodies (e.g., amplitude-time characteristic-IL-8 (firm Abgenix)), anti-IL-12 antibody and anti-IL-23 antibody)), CTLA4-immunoglobulin, and LFA-3TIP (firm Biogen, international publication WO 93/08656 and US 6162432), soluble cytokine receptors (e.g., the extracellular domain of the TNF-α receptor or its fragment of the extracellular domain of the IL-1β receptor or its fragment and the extracellular domain of the IL-6 receptor or its fragment), cytokines or fragments thereof (e.g., interleukin (IL)-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-15, IL-23, TNF-α, TNF-β, interferon (IFN)-α, IFN-β, IFN-γ, and GM-CSF) and anti-cytokine antibodies (e.g., anti-IL-2 antibodies, anti-IL-4 antibodies, anti-IL-6 antibodies, anti-IL-10 antibodies, anti-IL-12 antibodies, anti-IL-15 antibodies, anti-TNF-α antibody, and anti-IFN-γ antibodies), and antibodies that immunospecificity associated with tumor-associated antigens (e.g., Herceptin In some embodiments of the present invention, the immunomodulatory agent is an immunomodulatory agent that is different from a chemotherapeutic agent. In other embodiments of the present invention, the immunomodulatory agent is immunomoduliruushim agent, distinct from cytokine or hemopoietic factor, for example, IL-1, IL-2, IL-4, IL-12, IL-1, TNF, IFN-α, IFN-β, IFN-γ, M-CSF, G-CSF, IL-3 or erythropoietin. In other embodiments of the present invention, the immunomodulatory agent is an agent different from a chemotherapeutic agent and a cytokine or hemopoietic factor.

In one embodiment of the present invention, the methods of the present invention encompass the introduction of one or more anti-inflammatory agents that, for example, include, but their list is not limited to, nonsteroidal anti-inflammatory drugs (NCPLS), saeidnia inflammatory drugs (SPLS), beta-agonists, anticholinergic agents and methylxanthines. Examples SPULS include, but their list is not limited to, aspirin, ibuprofen, celecoxib (product CELEBREX™), diclofenac (product VOLTAREN™), etodolac (product LODINE™), fenoprofen (product NALFON™), indomethacin (product INDOCIN™), ketoralac (product TORADOL™), oxaprozin (product DAYPRO™), nabumetone (product RELAFEN™), sulindac (product CLINORIL™), tolmetin (product TOLECTIN™), rofecoxib (VIOXX product™), naproxen (ALEVE product™, product NAPROSYN™), Ketoprofen (product ACTRON™) and nabumetone (product RELAFEN™). Such SPULS function by inhibiting the enzyme cyclooxygenase (for example, COX-1 and/or COX-2). Examples sterilnih anti-inflammatory agents include, but are not restricted�tsya, glucocorticoids, dexamethasone (product DECADRON™), cortisone, hydrocortisone, prednisone (product DELTASONE™), prednisolone, triamcinolone, azulfidine and eicosanoids, for example, prostaglandins, thromboxanes and leukotrienes.

In another embodiment of the present invention, the methods of the present invention include the introduction of one or more antiviral agents (which, for example, include amantadine, ribavirin, rimantadine, acyclovir, famciclovir, foscarnet, ganciclovir, trifluridine, vidarabine, didanosine, stavudine, zalcitabine, zidovudine, interferon), antibiotics (to which, for example, include dactinomycin (formerly known as actinomycin), bleomycin, mithramycin and astromicin (AMC)), anti-vomiting (which, for example, include alprazolam, dexamethasone, domperidone, dronabinol, droperidol, granisetron, haloperidol, lorazepam, methylprednisolone, metoclopramide, nabilone, ondansetron, prochlorperazine), antifungal agents (which, for example, include amphotericin, clotrimazole, econazole, fluconazole, flucytosine, griseofulvin, Itraconazole, ketoconazole, miconazole and nystatin), antiparasitic agents (which, for example, include dehydroemetine, diloxanide furoate, emetine, mefloquine, melarsoprol, metronidazole, nifurtimox, paromomycin, pentamidine, pentamidine isetionate, Primo�n, chinagreen, quinidine), or combinations thereof.

Specific examples of anticancer agents that can be used in various embodiments of the present invention include pharmaceutical compositions, dosage forms and kits that include, but are not limited to, acivicin, aclarubicin, acetasol hydrochloride, Cronin, adozelesin, aldesleukin, altretamin, Albaicin, Metatron acetate, aminoglutethimide, amartin, anastrozole, astromicin, asparaginase, aspirin, azacytidine, asettaa, azithomycin, batimastat, benzodia, bicalutamide, bisantrene hydrochloride, benefit dimesylate, bizelesin, bleomycin sulfate, brequinar sodium, bropirimine, busulfan, actinomycin, calusterone, karatekid, carburiser, carboplatin, carmustine, orubicin hydrochloride, carzelesin, Cedeira, chlorambucil, tirolerin, cisplatin, cladribine, krishnalal mesilate, cyclophosphamide, cytarabine, dacarbazine, dactinomycin, daunorubicin hydrochloride, decitabine, decarbamylated, deazaguanine, deazaguanine mesilate, diaziquone, docetaxel, doxorubicin, doxorubicin hydrochloride, droloxifene, droloxifene citrate, dromostanolone propionate, deatomizer, edatrexate, eflornithine hydrochloride, elsamitrucin, angloplats, impromat, epirubicin, epirubicin hydrochloride, arbolada, zorubicin hydrochloride, estramustine, estramustine FD�fat sodium etanidazole, etoposide, etoposide phosphate, etopan, fadrozole hydrochloride, basarabi, fenretinide, floxuridine, fludarabine phosphate, fluorouracil, fluorocytosine, voskuilen, fostriecin sodium, gemcitabine, gemcitabine hydrochloride, hydroxyurea, idarubicin hydrochloride, ifosfamide, ilmofosine, interleukin II (including recombinant interleukin II, or gel), interferon alpha-2A, interferon alpha-2b, interferon Alfa-n1, interferon alpha-n3, interferon beta-I a, and interferon gamma-I b, iproplatin, irinotecan hydrochloride, lanreotide acetate, letrozole, leuprolide acetate, liarozole hydrochloride, sodium salt of lometrexol, lomustine, losoxantrone hydrochloride, masoprocol, maytansine, mechlorethamine hydrochloride, megestrol acetate, melengestrol acetate, melphalan, menogaril, mercaptopurine, methotrexate, sodium salt of methotrexate, metapan, maturegay, maintain, miacalcin, mitotropin, mitogillin, mitomycin, mitomycin, mitosis, mitotane, mitoxantrone hydrochloride, mycophenolic acid, nocodazole, nogalamycin, ormaplatin, oxysure, paclitaxel, Pegaspargase, pediamycin, pentamycin, peplomycin sulfate, perforated, pipobroman, piposulfan, proxitron hydrochloride, plicamycin, plomelin, sodium salt porfimer, porfiromycin, prednimustine, procarbazine hydrochloride, puromycin, puromycin hydrochloride, pyrazofurin, ibuprin, p�gleamed, safingol, safingol hydrochloride, semustine, simtran, spartacat sodium, sparsomycin, spirogermanium hydrochloride, spiramycin, spirometer, streptonigrin, streptozocin, alienor, talisayan, sodium salt tecogen, tegafur, Alexandre hydrochloride, temoporfin, teniposide, teraxion, testolactone, timipre, thioguanine, thiotepa, tianfuan, tirapazamine, toremifene citrate, trestolone acetate, triciribine phosphate, trimetrexate, trimetrexate the glucuronate, triptorelin, tubulosa hydrochloride, nitrogen mustard, Oradea, vapreotide, verteporfin, vinblastine sulfate, vincristine sulfate, Indesit, Indesit sulfate, benefitin sulfate, Inglesina sulfate, villarodin sulfate, vinorelbine tartrate, vinosity sulfate, ventolin sulfate, verosol, triplatin, zinostatin, zorubicin hydrochloride. Other anti-cancer drugs include, but is not limited to, 20-EPI-1,25 dihydroxyvitamin D3; 5-itinerarary, abiraterone, aclarubicin, allfusion, Adelina, adozelesin, aldesleukin, ALL-TK antagonists, altretamin, abamectin, amidex, amifostine, aminolevulinate acid, amrubicin, amsacrine, anagrelide, anastrozole, Andrographolide, inhibitors of antigenes, antagonist D, antagonist G, entrelacs,anti-neural morphogenetic protein-1, antiandrogen (prostate carcinoma), antiestrogen, antineoplaston, antisense �oligonucleotide, aphidicolin glycinate, modulators of the gene of apoptosis, regulators of apoptosis, perinova acid, ara-CDP-DL-PTBA, argininemia, Bulacan, atamestane, adrimycin, axenstein 1, axenstein 2, axenstein 3, azasetron, anatoxin, asteroid derived baccatin III, balana, batimastat, BCR/ABL antagonists, benzocaine, benzoylthiourea, derivatives of beta-lactams, beta-alamin, butaclamol b, betulinic acid, an inhibitor of bFGF, bikalutamid, pesantren, besuseradminclient, benefit, bitrate And, bizelesin, bruflat, bropirimine, bodacity, buthionine sulfoximine, calcipotriol, calphostin With derivatives camptothecin, canarypox IL-2, capecitabine, carboxamide-amino-triazole, carboxamidates, CaRest M3, CARN 700, an inhibitor of cartilage, carzelesin, inhibitors caseinline (ICOS), castanospermine, cecropin In, cetrorelix, chlorine, chlorination a sulfonamide, cicaprost, CIS-porphyrin, cladribine, analogs, clomiphene, clotrimazole, colimycin And, colimycin In, combretastatin A4 analog combretastatin, congentin, kambezidis 816, krishnalal, cryptophycin 8, derived cryptophycin And, korazin And, cyclopentadiene, cyclopean, cephamycin, the cytarabine ocfosfate, cytolytic factor, cytostatin, galiximab, decitabine, dehydrodidemnin In, deslorelin, dexamethasone, Taxifolin, dexrazoksana, dexverapamil, diaziquone, didemnin b, d�docks, diethylnitrosamine, dihydro-5-azacytidine, dihydroxy, 9-dioxazine, diphenyl spiramycin, docetaxel, docosanol, dolasetron, doxifluridine, droloxifene, dronabinol, duocarmycin SA, ebselen, elastin, edelfosine, edrecolomab, eflornithine, elements, Amateur, epirubicin, epristeride, analog estramustine, estrogen agonists, estrogen antagonists, etanidazole, etoposide phosphate, exemestane, fadrozole, basarabi, fenretinide, filgrastim, finasteride, flavopiridol, freelatin, fluasterone, fludarabine, forceunauthorized hydrochloride, forenames, formestane, fostriecin, fotemustine, gadolinium, texaphyrin, gallium nitrate, Galitsin, ganirelix, inhibitors gelatinase, gemcitabine, inhibitors of glutathione, HaSulam, heregulin, hexamethylen biscyane, hypericin, ibandronic acid, idarubicin, idoxifene, Idamante, ilmofosine, ilomastat, imidazolidone, imiquimod, peptides as stimulators, inhibitors of receptor insulin-like growth factor-1, interferon agonists, interferons, interleukins, iobenguane, iodocarbons, ipomeanol, 4-, isoplast, irsogladine, isomerases, isohemagglutinins In, fusetron, jasplakinolide, kahalalide F, lamellarin-N triacetate, lanreotide, Lannemezan, lenograstim, lentinan sulfate, leprostatic, letrozole, suppression factor leukemia, leukocyte alpha interferon, leuprolide + �estrogen + progesterone, leuprorelin, levamisol, liarozole, the analogue of the linear polyamine, a lipophilic peptide with a disaccharide, a lipophilic platinum compounds, lysocline 7, lobaplatin, lombrices, lometrexol, lonidamine, losoxantrone, an inhibitor of HMG-CoA reductase inhibitors (for example, but their list is not limited to, lovastatin, pravastatin, fluvastatin, statin, simvastatin, and atorvastatin), doxorubin, lurtotecan, lutetium, texaphyrin, lisofylline, lytic peptides, maytansine, sandostatin And, marimastat, masoprocol, maspin, inhibitors matrilysin, inhibitors of matrix metalloproteinases, menogaril, monbaron, peterlin, methionine, metoclopramide, the MIF inhibitor, mifepristone, miltefosine, Miramistin wrongly paired two-chain RNA, mitoguazone, mitolactol, analogues of mitomycin, mitonafide, mycotoxin, fibroblast growth factor, saporin, mitoxantrone, Maarten, molgramostim, monoclonal antibody, human chorionic gonadotropin, monophosphoryl the lipid A + sphingosines (sk) of the cell wall of mycobacteria, mopidamol, an inhibitor of the gene for multiple drug resistance, therapy based on multiple tumor suppressor 1, Britny anticancer agent, megaproxy In the extract of the cell wall of bacteria, mylapore, N-azetidinone, N-substituted benzamide, nafarelin, Negresti, naloxone + pentazocine, nipawin, Natterer, �nartograstim, nedaplatin, nemorubicin, pridanova acid, neutral endopeptidase, nilutamid, nizamettin, modulators of nitric oxide, nitroacetanilide, nitrolon, O6-benzylguanine, octreotide, ariznoa, oligonucleotides, onapristone, ondansetron, ondansetron, oracin,inductor oral cytokine, ormaplatin, osaterone, oxaliplatin, exonomics, paclitaxel, analogs of paclitaxel, derivatives of paclitaxel, palamin, palmitoylation, pamidronate acid, panaxytriol, promife, pyrabactin, pallidin, Pegaspargase, peltatin, pentosan polysulfon sodium pentostatin, petrosal, perflubron, perforated, Perilla alcohol, pentinomycin, phenylacetate, the phosphatase inhibitors, picibanil, pilocarpine hydrochloride, pirarubicin, piritrexim, Platin And, placein b, plasminogen activator inhibitor, platinum complex, platinum compounds, a complex of platinum-triamine, porfimer sodium, porfiromycin, prednisone, propyl bis-acridone, prostaglandin 32, proteasome inhibitors, immune modulator on the basis of protein A, an inhibitor of protein kinase C, inhibitors of protein kinase C, microalgal, inhibitors proteinconcentrated, inhibitors polynucleotides, purpurin, pyrazoloacridine, conjugate pyridoxamine hemoglobin and polyoxyethylene, raf antagonists, raltitrexed, ramosetron, inhibitors of ras farnesylation�feraz, inhibitors of ras, an inhibitor of ras-GAP, reality demetilirovanny, rhenium Re 186 etidronate, rhizoxin, ribozymes, the RII retinamide, Rogatkin, rohitukine, romurtide, roquinimex, rubiginous V1, robaxin, safingol, saintaubin, SarCNU, sarcophyton A, sargramostim, Sdi 1 mimetics, semustine, derived aging inhibitor 1, sense oligonucleotides, signal transduction inhibitors, modulators of signal transduction, single-chain antigen-binding protein, sizofiran, sobuzoxane, sodium borocaptate, sodium phenylacetate, solvera, somatomedin-binding protein, sonarmen, Spartina acid, spicamycin D, spiramycin, splenopathy, spongistatin 1, squalamine, an inhibitor of stem cell division inhibitors, stem cell stipend, inhibitors stromelysin, solifenacin, overactive antagonist of vasoactive intestinal peptide, coralista, suramin, swainsonine, synthetic glycosaminoglycans, tallimustine, tamoxifen methiodide, tautomycin, tazarotene, sodium salt tecogen, tegafur, tellurophene, telomerase inhibitors, temoporfin, temozolomide, teniposide, tetrachlorodecaoxide, tetrasomy, calibratin, thiocoraline, thrombopoetin, a mimetic of thrombopoetin, thymalfasin, agonist of the receptor of thymopoietin, timorian, thyroidstimulating hormone, utilityperson tin, tirapazamine, titanocene bichloride, topsentin, toremove�, totipotency factor stem cells, inhibitors of translation, tretinoin, triacetyluridine, triciribine, trimetrexate, triptorelin, tropisetron, trosterud, tyrosine kinase inhibitors, tyrphostin, UBC inhibitors, ubenimex that is derived from the urogenital sinus factor growth inhibition, antagonists of the urokinase receptor, vapreotide, variolin In, vector system, erythrocyte gene therapy, valarezo, vermin, verdini, verteporfin, vinorelbine, vincity, the product Vitaxin®, verosol, sonotron, triplatin, cerasorb and zinostatin stimulater. Additional cancer drugs are 5-fluorouracil and leucovorin. These two agents can be useful in ways in which are used thalidomide and a topoisomerase inhibitor. In certain embodiments of the present invention the anti-cancer agent is a chemotherapeutic agent.

In more specific embodiments, the present invention also includes administration of anti-ICOS monoclonal antibody in combination with the introduction of one or more drugs, for example, anticancer agents, but their list is not limited to, for example, described in table.1, for the treatment of breast, ovarian, melanoma, prostate, colon and lung, as explained above. When using combination therapy dose and/or frequency up�t, are shown in table.1, can be lowered.

Table 1
Antineoplastic agents
therapeutic agentDose/introduction/composition
Doxorubicin hydrochloride (the product adriamycin RDF® and the product adriamycin PFS®Intravenous60-75 mg/m21 dayIntervals with a duration of 21 days
Epirubicin hydrochloride (a product of Ellence™)Intravenous100-120 mg/m2on day 1 of each cycle or dose equal to divide and take on the 1-8 day cycleThe duration of cycles of 3-4 weeks
FluorouracilIntravenousDepending on the package: ampoules of 5 ml and 10 ml (containing 250 and 500 mg of fluorouracil, respectively)
Docetaxel (product Taxotere®)Intravenous60-100 mg/m2introduction to 1 HREvery three weeks
Paclitaxel (product Taxol®)Intravenous175 mg/m2for 3 hEvery three weeks for 4 courses (administered sequentially after combinatorial chemotherapy containing doxorubicin)
Tamoxifen citrate (Nolvadex product®)Oral (pills)20-40 mg Doses above 20 mg, may be given in divided doses (morning and evening)Daily
Leucovorin calcium salt for injectionIntravenous or intramuscular injectionDepending on the packaging: 350 mg ampouleFrom the text of dose unclear. PDR 3610

therapeutic agentDose/introduction/composition
Leuprolide acetate (product Lupron®)One subcutaneous injection1 mg (0.2 ml or 20 unit mark)Once a day
Flutamide (Eulexin product®)Oral (capsule)50 mg (each capsule �will win 125 mg flutamide) 3 times a day at intervals of 8 h (total daily dose of 750 mg)
Nilutamid (product Nilandron®)Oral (pills)300 mg or 150 mg (tablets contain 50 or 150 mg of noitamina each)300 mg once a day for 30 days, then 150 mg once a day
Bikalutamid (Casodex product®)Oral (pills)50 mg (each tablet contains 50 mg bikalutamida)Once a day
ProgesteroneInjectionUSP in sesame oil 50 mg/ml
Ketoconazole (Nizoral product®)Ointment2% ointment apply 1-2 times a day depending on symptoms.
PrednisoneOral (pills)The initial dose may vary from 5 mg to 60 mg per day depending on the specific disease being treated.
Estramustine phosphate sodium salt (product Emcyt®) Oral (capsule)14 mg/kg of body weight (i.e., one capsule 140 mg for each 10 kg or 22 lb of body weight)Daily dose is divided into 3 or 4 doses
Etoposide or VP-16Intravenous5 ml 20 mg/ ml (100 mg)
Dacarbazine (product DTIC-Dome®)Intravenous2-4,5 mg/kgOnce a day for 10 days. Repetition is possible at intervals of 4 weeks.

therapeutic agentDose/introduction/composition
Polifeprosan 20 with the implant of carmustine (BCNU) (nitrosamine) (product Gliadel®)The plate is placed in the dissected cavity8 plates, each containing 7.7 mg of carmustine, in General, of 61.6 mg, if size and shape of the dissected cavity allow
CisplatinInjection[not applicable in PDR 861] Dosage form: solution 1 mg/ml in multi-dose vials containing 50 ml and 100 ml
MitomycinInjectionThe ampoules contain 5 mg and 20 mg mitomycin
Gemcitabine hydrochloride (a product Gemzar®)IntravenousFor NSCLC-2 schemes were investigated and the optimal scheme was not specified Four-week scheme, the intravenous administration of 1000 mg/m2for 30 min On a three-week scheme - product Gemzar® is administered intravenously at a dose of 1250 mg/m2within 30 min.Scheme duration of 4 weeks. Day 1, 8 and 15 of each cycle lasting 28 days. The intravenous cisplatin 100 mg/m2in 1 day after infusion of the product Gemzar®. Scheme with a duration of 3 weeks. Day 1 and 8 of each cycle lasting 21 days. Cisplatin at a dose of 100 mg/m2administered intravenously after administration of Gemzar product® in 1 day.

therapeutic agentDose/introduction/composition
Carboplatin (product Paraplatin®)IntravenousTreatment with a single agent: 360 mg/m2intravenously in 1 day (infusion over 15 min or more) Other under�couple of doses: combined treatment with cyclophosphamide, Recommendations for dose adjustment, formula dosing, etc.Once in 4 weeks
Ifosamide (product Ifex®)IntravenousDaily 1.2 g/m5 consecutive days. Repeat every 3 weeks or after recovery from hematologic toxicity.
Topotecan hydrochloride (a product Hycamtin®)Intravenous1.5 mg/m2administered by intravenous infusion over 30 minutes daily.5 consecutive days, starting 1 day course duration 21 days.
Bisphosphonate: pamidronate alendronate risedronateIntravenous or oral together with 6-8 oz of water60 mg or 90 mg one infusion over 4-24 h for the correction of hypercalcemia in cancer patients is 5 mg/day daily for 2 years and then 10 mg/day for 9 months to prevent or control bone resorption. 5.0 mg to prevent or control bone resorption.

therapeutic agentDose/th�/composition
Lovastatin (Mevacor product™)Oral10-80 mg/day in one dose or a specified amount is divided into two doses

The present invention also covers the introduction of anti-ICOS monoclonal antibody in combination with radiation therapy comprising the use of x-rays, gamma rays and other sources of radiation to destroy cancer cells. In some embodiments of the present invention, the radiation treatment is carried out in the form of internal beam radiation or radiotherapy (teletherapy) at which the radiation occurs from the deleted source. In other embodiments, implementation of the present invention, the radiation treatment is carried out in the form of internal therapy or brachytherapy (close-focus radiation therapy in which a radioactive source is placed inside the body close to cancer cells or a tumor mass.

Anticancer therapy and dosing, routes of administration and recommended usage are known in this field and have been described, for example, in the book: "Physician's Desk Reference" 2002, 56eed.

The pharmaceutical composition

The present invention also relates to immunotherapeutic compositions and methods for the treatment of people Soboleva�th and disorders, mediated by T-cells, for example, but their list is not limited to, chronic infections, autoimmune diseases or disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), graft rejection and T-cell proliferative disorders in humans using therapeutic antibodies that bind to ICOS antigen and mediate human ADCC.

The present invention relates to pharmaceutical compositions comprising anti-ICOS antibody with enhanced effector function of the IgG1 or IgG3 human isotype. The present invention also relates to pharmaceutical compositions comprising anti-ICOS antibodies are human or humanized anti-ICOS antibody IgG2 or IgG4 human isotype that mediate human ADCC. In some embodiments, the present invention also relates to pharmaceutical compositions comprising monoclonal anti-ICOS antibody with enhanced effector function, which can be obtained by methods known in this field.

Therapeutic formulations and regimens are described for treating people who have been diagnosed with autoimmune diseases, for example, but their list is not limited to, systemic lupus erythematosus, rheumatoid arthritis, immune thrombocytic purpura (ITP), diabetes, psoriasis and reaction�AI hypersensitivity (e.g., Allergy, hay fever, asthma, and acute edema caused by hypersensitivity reactions type I). The present invention also relates to compositions and regimens for the treatment of people diagnosed with chronic inflammatory diseases, for example, but their list is not limited to, inflammatory bowel disease (Crohn's disease and ulcerative colitis), grave's disease, Hashimoto's thyroiditis, and diabetes mellitus.

Therapeutic formulations and regimens are described for treating people diagnosed with T-cell malignant disease, which is derived from ICOS-expressing T cells and their precursors.

In some embodiments of the present invention, anti-ICOS antibodies can mediate ADCC, complement-dependent cellular cytotoxicity or antibody-dependent phagocytosis. Compositions and methods of the present invention also have the advantage consisting in targeting a narrow population of T cells, unlike other immunotherapy directed at T cells. For example, an anti-ICOS antibody of the present invention can be effective against specifically targeted activated T-cells, for example, but their list is not limited to, activated T-cells. Accordingly, the methods and compositions of the present invention can be effective in reducing �whether depletion of circulating activated CD4+ T cells, as well as activated CD8+ T cells.

Accordingly, one object of the present invention includes the compositions and methods of treatment and prevention BTP and transplant rejection, which is associated with smaller and/or less severe complications compared to less targeted therapeutic agents and regimens. In one of the embodiments of the present invention in the compositions and methods of the present invention use of lower doses of traditional therapeutic agents that have been possible in the absence of the methods and compositions of the present invention. In another embodiment of the present invention compositions and methods of the present invention free from the necessity of more severe forms of therapy, such as radiation therapy, high-dose chemotherapy or splenectomy.

In some embodiments of the present invention, anti-ICOS antibodies and compositions may be administered to the patient is a transplant recipient prior to or after transplantation, alone or in combination with other therapeutic agents or regimens for the treatment or prevention BTP and transplant rejection. For example, anti-ICOS antibodies and compositions can be used for depletion of activated T cells from the transplant recipient prior to or after the transplant�tion of allogeneic transplant. Anti-ICOS antibodies and compositions can also be used for depletion of activated T cells from the graft ex vivo, prior to transplantation, or in the body of the donor, or as prophylaxis BTP and transplant rejection.

Pharmaceutical formulas, introduction and dosage

The pharmaceutical compositions of the present invention contain as an active ingredient an anti-ICOS antibody with enhanced effector function. The compositions contain a "naked" antibody, immunoconjugate or hybrid protein in amounts effective to obtain the desired answer in units of weight or volume suitable for administration to a sick person, and preferably are sterile. The answer may, for example, be measured by determining the physiological effects of the composition of an anti-ICOS antibody, for example, but their list is not limited to, depletion of T cells, depletion of IL-17, the regression T-cell malignancy, or reduce the symptoms of the disease. Other studies may be known to specialists in this field and can be applied to measure the level of response.

Pharmaceutical formulations

Composition comprising an anti-ICOS antibody with enhanced effector function, can be processed with pharmaceutically acceptable carrier. The term "pharmaceutically acceptable" means one or carried�only non-toxic materials which do not affect the efficiency of biological action of active ingredients. Such preparations usually contain salt, buffering agents, preservatives, compatible carriers, and optionally other therapeutic agents. Such pharmaceutically acceptable formulations are also typically contain a compatible solid or liquid fillers, diluents or encapsulated substances, which are applicable for administration to humans. When used in medicine the salts should be pharmaceutically acceptable, but salts that are not pharmaceutically acceptable may also be used for the preparation of their pharmaceutically acceptable salts and are included in the scope of the present invention. Such pharmacologically and pharmaceutically acceptable salts include, but are not limited to, salts prepared from the following acids: hydrochloric, Hydrobromic, sulfuric, nitric, phosphoric, maleic, acetic, salicylic, citric, boric, formic, malonic, succinic and other. Pharmaceutically acceptable salts can be prepared in the form of alkali metal salts or salts of alkaline earth metals, e.g. sodium, potassium or calcium. The term "carrier" refers to organic or inorganic ingredients, natural or synthetic, with which the active ingredient of the�represent for ease of use. Components of the pharmaceutical compositions also can be mixed with the antibodies of the present invention and with each other in such a manner that no interaction occurs which would substantially reduce the desired pharmaceutical efficiency.

According to some objects of the present invention, compositions of anti-ICOS antibodies can be prepared for storage by mixing the antibody or immunoconjugate, possessing the requisite degree of purity, with optional physiologically acceptable carriers, excipients or stabilizers (kN.: "Remington's Pharmaceutical Sciences", 1999, ed. by A. Osol, 16th ed.) in the form of lyophilized formulations or aqueous solutions. Appropriate media, excipients or stabilizers are nontoxic to recipients at the used doses and concentrations, and include buffers, for example, histidinemia, phosphate, citrate and other organic acids, antioxidants include ascorbic acid and methionine, preservatives (such as octadecyltrimethylammonium ammonium chloride, hexamethonium chloride, benzalkonium chloride, benzethonium chloride, phenol, butyl or benzyl alcohol, alkylarene, for example, methyl or propyl paraben, catechin, resorcinol, cyclohexanol, 3-pentanol, and m-cresol), low molecular weight polypeptides (approximately less than 10 residues)Bel�and, for example, serum albumin, gelatin or immunoglobulins, hydrophilic polymers, for example, polivinilpirolidon, amino acids, e.g., glycine, glutamine, asparagine, histidine, arginine or lysine, monosaccharides, disaccharides, and other carbohydrates including trehalose, glucose, mannose or dextrins, chelating agents, e.g. EDTA, sugars, such as sucrose, mannitol, trehalose or sorbitol, salt forming counterions, for example, sodium, metal complexes (e.g., complexes of Zn-protein) and/or nonionic surfactants, e.g., tween, Polysorbate 80, a product of PLURONICS™ or polyethylene glycol (PEG).

Composition anti-ICOS antibody may also optionally include appropriate preservatives, such as benzalkonium chloride, chlorobutanol, parabens and thimerosal.

Compositions of anti-ICOS antibodies can usually be provided in a separate dosage form and may be prepared using any method known in the pharmaceutical field. All methods include the stage of introduction of the active agent and the pairing with the carrier that constitutes one or more auxiliary ingredients. In General, compositions of anti-ICOS antibodies are prepared by uniform and harmonize existing direct connection into contact with a liquid carrier, a finely divided solid carrier � then, if necessary, shaping the product.

Compositions suitable for parenteral administration usually comprise a sterile aqueous or non-aqueous preparation of an anti-ICOS antibody, which can be isotonic to the blood of the recipient. Such a drug may be processed according to known methods using suitable dispersing or wetting agents and suspendida agents. The sterile injectable preparation may also be sterile injectable solution or suspension in a nontoxic diluent or solvent suitable for parenteral administration, for example, a solution in 1,3-butanediol. Among the appropriate solvent can be used water, ringer's solution and isotonic sodium chloride solution. In addition, sterile fixed oils are usually used as a solvent or suspendida environment. For this purpose may be used any conventional non-volatile oil as a solvent or suspendida environment. For this purpose may be used any conventional non-volatile oil, including synthetic mono - or diglycerides. In addition, fatty acids such as oleic acid, can be used in injectable formulations. The composition of the carrier suitable for oral, subcutaneous, intravenous, intramuscular, etc. administration, you can get more informatio� in the book: "Remington's Pharmaceutical Sciences", publishing house Mack Publishing Co., Easton, Pennsylvania. In some embodiments of the present invention the composition of the medium, suitable for different routes of administration, may be the same as or similar to the composition of the medium, are described for the product RITUXAN™. Cm. kN.: "Physicians' Desk Reference", 2005, publishing house of Medical Economics Company, Inc., Montvale, new Jersey, cc.958-960 and 1354-1357, the essence of which is included in the present invention by reference. In some embodiments of the present invention the composition is an anti-ICOS antibody redesigned for intravenous injection with sodium chloride, sodium citrate dehydrate the, Polysorbate 80, and sterile water in which the pH of the composition is brought to a value of about 6.5. Specialists in this field it is known that intravenous injection is a useful model introduction due to the rapid distribution of antibodies through the blood circulation. Intravenous administration, however, has limitations due to vascular barrier, including endothelial cells of the vasculature and subendothelial matrix. In addition, the vascular barrier is more important for the consumption of therapeutic antibodies for solid tumors. Lymphomas have a relatively high velocity of blood flow, contributing to the effective delivery of antibodies. Vnutripoliticheskie routes of administration, e.g., subcutaneous or intramuscular injection, or by cat�tarsali lymphatic vessels also provide a useful means of treating diseases and disorders mediated by T-cells. In some embodiments of the present invention, compositions of anti-ICOS antibodies and methods of the present invention are the introduction of the hypodermic. In such embodiments, the composition is processed in the form of lyophilized drugs or liquid buffer (for example, histidinemia buffer, PBS, citrate) in a concentration of about 50 mg/ml.

The composition of the present invention can also include a number of active connections that are required for specific indications for treatment, preferably such compounds have combined action and do not impact negatively on each other. For example, you may need to enter additional immunosuppression agent. Such molecules are suitably present in combination in amounts that are effective for the intended purpose.

The active ingredients can also be enclosed in microcapsules prepared, for example, methods of coacervation or polymerization on the topic of media, e.g. hydroxymethylcellulose or gelatin microcapsules and poly(methacrylate) microcapsules, respectively, in colloidal systems drug delivery (for example, liposomes, albumen Microsof�p, microemulsions, nano-particles and nanocapsules) or in microemulsion. Such methods are described in the book: "Remington's Pharmaceutical Sciences", 1980, ed. by A. Osol, 16th ed.

Used formulations for administration in vivo is usually sterile. This is easily achieved by filtration through sterile filtration membranes.

Can be prepared the drugs sustained release. Relevant examples of drugs sustained release include semi-permeable matrices of solid hydrophobic polymers containing anti-ICOS antibody, wherein the matrix has a particular form of particles, for example, films or microcapsules. Examples of matrices for sustained release include polyesters, hydrogels (e.g., poly(2-hydroxyethylmethacrylate), or poly(vinyl alcohol), polylactic acid called PLA (US 3773919), copolymers of L-glutamic acid and gamma ethyl-L-glutamate, nonseparated ethylene-vinyl acetate, degradable copolymers of lactic acid and glycolic acid, for example, the product LUPRON DEPOT™ (injectable microspheres composed of a copolymer of lactic acid and glycolic acid and leuprolide) and poly-D-(-)-3-hydroxybutyric acid. If the polymers, such as ethylene vinyl acetate and a copolymer of lactic acid and glycolic acid, are capable of releasing molecules for over 100 days, certain hydrogels release proteins for shorter time. If� encapsulated antibodies remain in the body for a long time, they can denaturirate or aggregate as a result of exposure to moisture at 37°C, resulting in a loss of biological activity and possible change in immunogenicity. Rational strategies can be developed for stabilization depending on the mechanism involved. For example, if it is established that the mechanism of aggregation is the formation of intermolecular bonds S-S through thio-disulfide moving, stabilization may be achieved by modifying sulfhydryl residues, lyophilization from acidic solutions, controlling moisture content, using appropriate additives, and creating specific polymer matrix compositions. In some embodiments of the present invention, pharmaceutically acceptable carriers used in the compositions of the present invention do not affect ADCC or CSC person.

Compositions of anti-ICOS antibodies described in the present invention, can also be recycled in the form of immunoliposome. The term "liposome" means a small ball made up of different types of lipids, phospholipids and/or surfactants that are applicable for the delivery of drugs (such as described above, an anti-ICOS antibody) in the human body. Components of liposomes are usually collected in a two-layer structure similar to the lipid Assembly Biol�logical membranes. Liposomes containing the antibody of the present invention, prepared by methods known in this field, for example, described in the works of Epstein and others, Proc. Natl. Acad. Sci. USA, 82, 1985, p. 3688, Hwang, etc., Proc. Natl. Acad. Sci. USA, 77, 1980, p. 4030, US 4485045 and 4544545. Liposomes with an increased time of the circulation described in US 5013556. Particularly useful liposomes can be obtained by evaporation from a reverse phase with a lipid composition comprising phosphatidylcholine, cholesterol and PEG-derived phosphatidylethanolamine (PEG-PE). Liposomes are passed through filters with defined pore size to obtain liposomes of the desired diameter. The antibody of the present invention may be combined with liposomes as described in Martin et, J. Biol. Chem., 257, 1982, cc.286-288, through the reaction of interaction via a disulfide bond. therapeutic agent can also be encapsulated in liposomes. Cm. Gabizon, etc., J. the National Moedig Inst., 19, 1989, p. 1484.

Some of the pharmaceutical compositions include, but are not limited to:

(a) sterile preservative liquid concentrate for intravenous administration of anti-ICOS antibody, supplied at a concentration of 10 mg/ml or 100 mg (10 ml) or 500 mg (50 ml) disposable ampoules. The product can be recycled for intravenous injection using sodium chloride, sodium citrate dihydrate, Polysorbate and sterile water for injection. For example, p�keep this product can be recycled at 9.0 mg/ml sodium chloride, of 7.35 mg/ml sodium citrate the dihydrate, 0.7 mg/ml Polysorbate 80 and sterile water for injection. The pH value was adjusted to 6.5.

(b) Sterile lyophilized powder in single-use glass vials for subcutaneous injection. The product can be recycled with sucrose, L-histidine hydrochloride monohydrate, L-histidine and Polysorbate 20. For example, each single-use vial can contain 150 mg of an anti-ICOS antibody of 123.2 mg of sucrose, and 6.8 mg L-histidine hydrochloride monohydrate, 4.3 mg L-histidine and 3 mg of Polysorbate 20. Recovering disposable vials with sterile water for injection in an amount of 1.3 ml forms approximately 1.5 ml of solution to deliver 125 mg per 1.25 ml (100 mg/ml) antibodies.

(b) without preservative Sterile lyophilized powder for intravenous administration. The product can be recycled to the α-trehalose dehydrate the, L-histidine chloride, histidine and Polysorbate 20, USP. For example, each ampoule may contain 440 mg of an anti-ICOS antibody, 400 mg of α,α-trehalose dihydrate, 9.9 mg L-histidine hcl, 6.4 mg L-histidine, and 1.8 mg Polysorbate 20, USP. The restoration is carried out using 20 ml of bacteriostatic water for injection (BUDI), USP, containing 1.1% benzyl alcohol as preservative, with obtaining a multi-dose solution containing 21 mg/ml antibody at about pH 6.

(g) a Sterile lyophilized powder DL� intravenous infusion, which anti-ICOS antibody processed with sucrose, Polysorbate, monoammonium sodium phosphate monohydrate and dibasic sodium Fustat by dehydrate. For example, each single-use vial can contain 100 mg of antibody, 500 mg sucrose, 0.5 mg Polysorbate 80, 2.2 mg of nonoonono sodium phosphate monohydrate, and 6.1 mg dibasic sodium phosphate dihydrate. Preservatives are absent. Subsequent recovery using 10 ml of sterile water for injection, USP, results in the pH value which has a value of about 7.2.

(d) Sterile preservative solution for subcutaneous injection, placed in a disposable 1 ml, pre-filled filter. The product can be processed with sodium chloride, monoammonium sodium phosphate dihydrate, dibasic sodium phosphate dihydrate, sodium citrate, citric acid monohydrate, mannitol, Polysorbate 80 and water for injection, USP. Sodium hydroxide may be added to bring the pH to about magnitude of 5.2.

For example, each syringe can be recycled for the release of 0.8 ml (40 mg) of drug product. In each dose with a volume of 0.8 ml contains 40 mg of an anti-ICOS antibody, is 4.93 mg sodium chloride, 0,69 mg nonoonono sodium phosphate dihydrate, 1.22 mg dibasic sodium phosphate dihydrate, of 0.24 mg sodium citrate, 1.04 for citric acid monohydrate, 9.6 to �g of mannitol, 0.8 mg Polysorbate 80 and water for injection, USP.

(e) Sterile, no preservatives lyophilized powder contained in a disposable ampoule, which is reduced with sterile water for injection, USP, and administered as a subcutaneous injection. The product can be recycled with sucrose, histidine hydrochloride monohydrate, L-histidine and Polysorbate. For example, an ampoule of 75 mg may contain of 129.6 mg or 112.5 mg of an anti-ICOS antibody, 93,1 mg sucrose, 1.8 mg L-histidine hydrochloride monohydrate, 1.2 mg L-histidine and 0.3 mg of Polysorbate 20, and is designed to release 75 mg of the antibody in 0.6 ml after recovery of 0.9 ml of sterile water for injection, USP. Ampoule 150 mg may contain 202,5 mg or 175 mg anti-ICOS antibody, at 145.5 mg sucrose, 2.8 mg L-histidine hydrochloride monohydrate, 1.8 mg L-histidine, and 0.5 mg Polysorbate 20, and is designed to release 150 mg of the antibody in 1.2 ml after recovery of 1.4 ml of sterile water for injection, USP.

(g) a Sterile, lyophilized product for the recovery of sterile water for injection. The product can be recycled in the single use ampoules for intramuscular injection, using mannitol, histidine and glycine. For example, each single-use vial can contain 100 mg of an anti-ICOS antibody, 67,5 mg mannitol, 8,7 mg histidine and 0.3 mg glycine, and is designed to release 100 mg of antibody in 1.0 ml after in�of Stanovlenie 1.0 ml of sterile water for injection. In another example, each single-use vial may include 50 mg of an anti-ICOS antibody, 40.5 mg mannitol, 5.2 mg histidine and 0.2 mg glycine, and is designed to release 50 mg antibodies after recovery of 0.6 ml of sterile water for injection.

(h) Sterile preservative solution for intramuscular injection is prepared with a concentration of 100 mg/ml. the Product can be recycled in a disposable vial of histidine, glycine and sterile water for injection. For example, each single-use vial can be recycled with 100 mg of antibody, 4.7 mg of histidine and 0.1 mg of glycine in the amount of 1.2 ml based release 100 mg of antibody in 1 ml. as another example, each single-use vial can be recycled with 50 mg of antibody, 2.7 mg of histidine and 0.08 mg of glycine in the amount of 0.7 ml or 0.5 ml and is designed to release 50 mg of antibody in 0.5 ml.

In some embodiments of the present invention, a pharmaceutical composition of the present invention is stable at 4°C. In some embodiments of the present invention, a pharmaceutical composition of the present invention is stable at room temperature.

In one embodiment of the present invention, a liquid composition of the present invention is an aqueous composition. In another embodiment of the present invention liquid comp�in the present invention is an aqueous composition, moreover, the aqueous carrier is distilled water.

In one embodiment of the present invention, the composition of the present invention is sterile. In one embodiment of the present invention, the composition of the present invention is homogeneous. In one embodiment of the present invention, the composition of the present invention is isotonic.

In one embodiment of the present invention, the composition of the present invention includes at least about 1 mg/ml, at least about 5 mg/ml, at least about 10 mg/ml, at least about 20 mg/ml, at least about 30 mg/ml, at least about 40 mg/ml, at least about 50 mg/ml, at least about 60 mg/ml, at least about 70 mg/ml, at least about 80 mg/ml, at least about 90 mg/ml, at least about 100 mg/ml, at least about 110 mg/ml, at least about 120 mg/ml, at least about 130 mg/ml, at least about 140 mg/ml, at least about 150 mg/ml, at least about 160 mg/ml, at least about 170 mg/ml, at least about 180 mg/ml, at least about 190 mg/ml, at least about 200 mg/ml, or at least about 300 mg/ml anti-ICOS antibody or its fragment�.

Optionally the compositions of the present invention can include the usual excipients and/or additives, for example, buffering agents, saccharides, salts and surface active agents. Additionally, or in another embodiment, the compositions of the present invention may additionally include conventional excipients and/or additives such as thinners, solvents, binding agents, stabilizing agents, salts, lipophilic solvents, amino acids, chelating agents, preservatives, etc.

In some embodiments of the present invention the buffering agent is selected from the group consisting of histidine, citrate, phosphate, glycine, and acetate. In another embodiment of the present invention, excipient saccharide selected from the group consisting of trehalose, sucrose, mannitol, maltose and raffinose. In yet another variant implementation of the present invention surface-active agent selected from the group consisting of Polysorbate 20, Polysorbate 40, Polysorbate 80 and pluronic F68. In another embodiment of the present invention the salt is selected from the group consisting of NaCl, KCl, MgCl2and CaCl2.

Optionally the compositions of the present invention can optionally include other well-known auxiliary components, for example, but their list is not limited to, relevant excipienti, polio�s, solvents, diluents, binding agents, stabilizing agents, lipophilic solvents, chelators, preservatives, or others.

The compositions of the present invention include a buffering or pH regulating agent to provide improved pH control. In one embodiment of the present invention, the composition of the present invention has a pH of about from 3.0 to 9.0 and about, approximately from 4.0 to 8.0 and about from about 5.0 and about to 8.0, from about 5.0 and about 7.0, from about 5.0 and about 6.5, from about 5.5 and about to 8.0, from about 5.5 to about 7.0 or about 5.5 and about 6.5. In another embodiment of the present invention, the composition of the present invention is about pH of 3.0, about 3.5, about 4.0, about 4.5, about 5.0 to about a 5.1, about 5.2, about 5.3, about 5.4, about 5.5, about 5.6, about 5.7, about 5,8, some 5.9, about 6.0, about 6.1, about 6.2, about 6.3, in around 6.4, about 6.5, about 6.6 and about 6.7, about 6.8, about 6,9, about of 7.0, about 7.5, about 8.0 to about 8.5 or approximately 9.0. In another embodiment of the present invention, the composition of the present invention has a pH of about 6.0.

The pH value of the composition typically may not be equal to the isoelectric point of the particular antibody (including antibody fragment), as a result,�CSOs in the composition (for example, but their list is not limited to, the isoelectric point of 13H5, N or N), and can range from about 4.0 to about of 8.0, or may range from about 5.5 to about 6.5.

Typically, the buffering agent is a salt prepared from an organic or inorganic acid or base. To the representatives of the buffer agents include, but are not limited to, salts of organic acids, e.g., salts of citric acid, ascorbic acid, gluconic acid, carbonic acid, tartaric acid, succinic acid, acetic acid, or phthalic acid; Tris, tromethamine hydrochloride, or phosphate buffers. In addition, the amino acid components can also affect the buffering capacity. Examples of amino acid components, which can be used in the compositions of the present invention as buffer agents include, but are not limited to, glycine and histidine. In some embodiments of the present invention the buffering agent is selected from the group consisting of histidine, citrate, phosphate, glycine, and acetate. In one embodiment of the present invention, the buffering agent is histidine. In another embodiment of the present invention, the buffering agent is citrate. Purity buffer agent should be at least 98% or at least 99%, or IU�Isha least 99.5% pure. In the context of the present invention, the term "purity" in relation to the histidine relates to chemically pure histidine and used in this area, for example, according to the description in the book: "The Merck Index" 2001, ed O'neil, etc., Merck & Co., 13eed.

Buffer agents are usually used in concentrations from about 1 mm to about 200 mm, or at any ranges and magnitudes, depending on the desired ionic strength and buffer capacity. With normal concentrations of traditional buffering agents used in the compositions for parenteral administration can be found in the book: "Pharmaceuticals Dosage Form: Parenteral Medications, 2nd ed., vol. 1, Chapter 5, p. 194, table 5: "Commonly used additives in Parenteral Products (Usually used additives in products for parenteral administration)". In some embodiments of the present invention the composition of the present invention includes a buffering agent. In one of the embodiments of the present invention the specified buffering agent selected from the group consisting of histidine, citrate, phosphate, glycine, and acetate. In one embodiment of the present invention, the composition according to the present invention comprises histidine as a buffering agent. In another embodiment of the present invention, the composition of the present invention includes nitrate buffer.

In one Varian�s implementation of the present invention, the composition of the present invention includes at least about 1 mm, at least about 5 mm, at least about 10 mm, at least about 20 mm, at least about 30 mm, at least about 40 mm, at least about 50 mm, at least about 75 mm, at least about 100 mm, at least about 150 mm, or at least about 200 mm buffer agent.

In some embodiments of the present invention the compositions of the present invention include the carbohydrate excipient. Carbohydrate excipient can act, for example, as agents for increasing the viscosity, stabilizers, agents bulk forming, agents for dissolving and/or other Hydrocarbon excipient typically comprise from about 1% to about 99% by weight or volume. In one of the embodiments of the present invention the carbohydrate excipient contained in a concentration of from about 0.1% to about 20%. In another embodiment of the present invention the carbohydrate excipient contained in a concentration of from about 0.1% to about 15%. In one of the embodiments of the present invention the carbohydrate excipient contained in a concentration of from about 0.1% to about 5%, or from about 1% to about 20%, or from about 5% to about 15%, or from about 8% to about 10%, or from about 10% to about 15%, or from about 15% to about 20%. In another variation�the implementation of the present invention the carbohydrate excipient contained in a concentration of from about 0.1% to 20%, or from 5% to 15%, or from 8% to 10%, or from 10% to 15%, or from 15% to 20%. In yet another variant implementation of the present invention the carbohydrate excipient is from about 0.1% to about 5%. In another embodiment of the present invention the carbohydrate excipient is from about 5% to about 10%. In yet another variant implementation of the present invention the carbohydrate excipient is from about 15% to about 20%. In yet another variant implementation of the present invention the carbohydrate excipient is up to 1%, or 1.5%, or 2%, or 2.5%, or 3%, or 4%, or 5%, or 10%, or 15%, or 20%.

Carbohydrate excipient applicable to the compositions of the present invention include, for example, monosaccharides, such as fructose, maltose, galactose, glucose, D-mannose, sorbose and other disaccharides, such as lactose, sucrose, trehalose, cellobiose, etc., polysaccharides, for example, the raffinoses, melezitose, maltdextrin, dekstrana, starches, etc., and validity, for example, mannitol, xylitol, maltitol, lactitol, xylitol, sorbitol (glucit) and others In one of the embodiments of the present invention the carbohydrate excipient for use in the present invention selected from the group consisting of sucrose, trehalose, lactose, mannitol and raffinose. In one of the embodiments of the present invention �glodny excipient is trehalose. In another embodiment of the present invention carbohydrate excipient is mannitol. In yet another variant implementation of the present invention carbohydrate excipient is sucrose. In another embodiment of the present invention carbohydrate excipient is raffinoses. Purity carbohydrate excipient must be at least 98% or at least 99% or at least 99,5%.

In one embodiment of the present invention, the composition of the present invention includes excipient. In one embodiment of the present invention, the composition of the present invention includes at least one excipient selected from the group consisting of: sugar, salt, surfactants, amino acid, polyol, chelating agent, emulsifier and preservative. In one embodiment of the present invention, the composition of the present invention includes a salt. In one embodiment of the present invention, the composition of the present invention includes a salt selected from the group consisting of: NaCl, KCl, CaCl2and MgCl2. In one embodiment of the present invention, the composition of the present invention includes NaCl.

In one embodiment of the present invention, the composition according to the present �the turbine zobretenie includes at least about 10 mm, at least about 25 mm, at least about 50 mm, at least about 75 mm, at least about 100 mm, at least about 125 mm, at least about 150 mm, at least about 175 mm, at least about 200 mm, or at least about 300 mm of sodium chloride.

The compositions of the present invention can optionally include a surface active substance. The concept of "surface active substances" in the context of the present invention relates to organic substances with amphipathicity structures, namely, they are composed of groups with opposing trends of solubility, usually of oil-soluble hydrocarbon chain and a water-soluble ionic group. Surfactants can be classified depending on the surface charge of the active part of the molecules in anionic, cationic and nonionic surface-active substances. Surfactants are often used as a wetting, emulsifying, dissolving and dispersing agents for various pharmaceutical compositions and preparations of biological materials. Pharmaceutically acceptable surfactants, for example, Polysorbate (e.g. Polysorbate 20 or 80), poloxamer (e.g., poloxamer 188), Triton, sodium octylglucoside, lauryl-, myristyl-,linoleyl - or stearyl-sulfobetaine, lauryl-, myristyl-, linoleyl - or stearyl-sarcosine, lauryl-, myristyl - or cetyl-betaine, lauramidopropyl, cocamidopropyl, linoleamide, myristamide, Palmitoyl - or isostearamide-betaine (for example, lauramidopropyl), myristamide, Palmitoyl - or isostearamide-dimethylamine, sodium metalcolor - or disodium metalreinforced and product series MONAQUA.TM. (firm Mona Industries, Inc., Patterson, new Jersey), politiical, polypropylenglycol and copolymers of ethylene or propylene glycol (e.g., pluronic, PF68 etc), can optionally be added to the compositions of the present invention to reduce aggregation. Surfactants are particularly applicable if used for the introduction of composition a pump or plastic container. The presence of pharmaceutically acceptable surfactants softens the tendency of proteins to aggregate. In one embodiment of the present invention, the compositions of the present invention include Polysorbate, which is contained in a concentration ranging from about 0,001% to about 1%, or about 0.001% to about 0.1%, or from about 0.01% to about 0.1%. In other specific embodiments of the present invention the compositions of the present invention include Polysorbate at a concentration of 0.001% or 0.002 per cent, or less than 0.003%, or 0.004% of that �whether 0,005%, or 0,006% or 0,007%, 0,008%, or 0,009%, or 0.01%, or 0.015%, or 0.02%. In another embodiment of the present invention, the Polysorbate is Polysorbate-80.

In one embodiment of the present invention, the composition of the present invention includes a surface-active substance. In one embodiment of the present invention, the composition of the present invention include Polysorbate 20, Polysorbate 40, Polysorbate 60 or Polysorbate 80. In another embodiment of the present invention, the composition of the present invention includes Polysorbate 80.

Optionally the compositions of the present invention may additionally include other common excipients and/or additives, including, but not limited to, diluents, binders, stabilizers, lipophilic solvents, preservatives, adjuvants, etc. Pharmaceutically acceptable excipient and/or additives can be used in the compositions of the present invention. Usually used excipients/additives, for example, pharmaceutically acceptable chelators (for example, their list is not limited to, EDTA, DTPA or EGTA), can optionally be added to the compositions of the present invention to reduce aggregation. Such additives are preferably used, if the introduction of the composition using a pump or plastic container.

Opener�guys, for example, phenol, m-cresol, p-cresol, o-cresol, chlorocresol, benzyl alcohol, PHENYLMERCURIC, Phenoxyethanol, formaldehyde, chlorobutanol, magnesium chloride (e.g., hexahydrate, but not only), alkylboranes (methyl, ethyl, propyl, butyl, etc.), benzalkonium chloride, benzethonium chloride, sodium dehydroacetate and thimerosal or mixtures thereof can optionally be added to the compositions of the present invention in any appropriate concentration, e.g., about 0.001% to about 5%, or any range or value. The concentration of preservative used in the compositions of the present invention is a concentration sufficient to provide a microbiological effect. These concentrations depend on the preservative selected and easily determined by the expert.

Other excipienti/supplements that can be used in the compositions of the present invention include, for example, flavoring agents, antimicrobial agents, sweeteners, antioxidants, antistatic agents, lipids, e.g., phospholipids or fatty acids, steroids, e.g., cholesterol, protein excipient, for example, serum albumin (human serum albumin (human serum albumin - HAS), recombinant human albumin (recombinant human albumin - rHA)), gelatin, casein, salt-forming counterions, for example, sodium, etc. These and additional known pharmaceutical excipients and/or additives suitable for use in the compositions of the present invention, known in this field, for example, are listed in the book: "Remington: The Science &Practice of Pharmacy", 2005, 21st ed., publishing house Lippincott Williams & Wilkins, in kN.: "Physician's Desk Reference", 2005, 60th ed., publishing house of Medical Economics, Montvale, new Jersey. Pharmaceutically acceptable carriers can be selected in the usual way so that they are suitable for the method of administration, solubility and/or stability of the variant Fc protein that is known or described in the present invention.

Specialists in this field should take into account that the compounds of the present invention may be isotonic to human blood, and that the compositions of the present invention have substantially the same osmotic pressure as human blood. Such isotonic formulations generally may have an osmotic pressure from about 250 mosmol to about 350 mosmol. Izotonichnost can be measured, for example, using the types of osmometers based on vapor pressure or freezing ice. The correct tonicity of the composition is adjusted by applying a modifier of toychest. The concept of "modifiers toychest" refers to pharmaceutically acceptable inert substances that can be added to the composition to provide�of isotonicity of the composition. Modifiers toychest applicable in the present invention include, but are not limited to, saccharides, salts and amino acids.

In some embodiments of the present invention the compositions of the present invention have an osmotic pressure from about 100 mosmol to about 1200 mosmol, or from about 200 mosmol to about 1000 mosmol, or from about 200 mosmol to about 800 mosmol, or from about 200 mosmol to about 600 mosmol, or from about 250 mosmol to about 500 mosmol, or from about 250 mosmol to about 400 mosmol, or from about 250 mosmol to about 350 mosmol.

The concentration of any component or any combinations of the various components of the compositions of the present invention are selected so as to achieve the desired toychest final composition. For example, the ratio of carbohydrate excipient and antibodies can be modified on the basis of methods known in the art (e.g., US 6685940). In some embodiments of the present invention the molar ratio of carbohydrate excipient and antibodies can be from about 100 moles to about 1000 moles of the carbohydrate excipient about 1 to pray antibody, or from about 200 moles to about 6000 moles of carbohydrate excipient to about 1 pray antibody, or from about 100 moles to about 510 moles of carbohydrate ex�of ipient to about 1 pray antibodies, or from about 100 moles to about 600 moles of carbohydrate excipient to about 1 pray antibodies.

Required izotonichnost of the final solution can also be achieved by selection of the concentration of salt in solution. Salts that are pharmaceutically acceptable and applicable in the present invention as modifiers of toychest include, but are not limited to, sodium chloride, sodium succinate, sodium sulfate, potassium chloride, magnesium chloride, magnesium sulfate and calcium chloride. In one embodiment of the present invention, the compositions of the present invention include NaCl, MgCl2and/or CaCl2. In one of the embodiments of the present invention, the NaCl concentration is from about 75 mm to about 150 mm. In another embodiment of the present invention, the concentration of MgCl2is from about 1 mm to about 100 mm. The amino acids that are pharmaceutically acceptable and applicable in the present invention as modifiers of toychest include, but not limited to, Proline, alanine, L-arginine, asparagine, L-aspartic acid, glycine, series, lysine and histidine.

In one embodiment of the present invention, the compositions of the present invention do not contain pyrogens, which are substantially free of endotoxins and/or related p�rogenic substances. The endotoxins are toxins that are closed inside the microorganisms and is released only when the microorganisms are destroyed or die. To pyrogenic substances are also causing fever thermostable substances (glycoproteins) on the outer membrane of the bacteria and other microorganisms. All of these substances can cause fever, hypotension and shock when administered to humans. Because of possible harmful effects of even small amounts of endotoxins must be removed from intravenous solutions pharmaceutical medicines. Management on control over products and medicines USA (Food and Drug Administration - FDA) has set an upper limit of 5 units of endotoxin (endotoxin units, EU) per dose per kg of body weight during a 1 h intravenous drugs (The United States Pharmacopeial Convention, Pharmacopeial Forum 26 (1), 2000, p. 223). When therapeutic proteins are administered in amounts of several hundred or thousand milligrams per 1 kg of body weight, which may be in the case of the introduction of antibodies, even trace amounts of harmful and dangerous items should be removed. In some embodiments, the implementation of the present invention, the levels of endotoxin and pyrogene in the composition is less than 10 EU/mg, or less then 5 EU/mg, or less than 1 EU/mg, or less than 0.1 EU/mg, or less then 0.01 EU/mg, or less than 0.001 EU/mg.

For administration in vivo, the compositions of the present invent�NIJ must be sterile. The compositions of the present invention can be sterilized by various sterilization methods, including sterile filtration, radiation, etc. In one of the embodiments of the present invention the composition of the antibody was sterilized by filtration through a pre-sterilized filter with a pore size of 0.22 μm. Sterile compositions for injection can be processed in accordance with conventional pharmaceutical practice as described in the book: "Remington: The Science &Practice of Pharmacy", 2005, 21eed., publishing house Lippincott Williams & Wilkins. Compositions, including antibodies, for example, described in the present invention is typically stored in lyophilized form or in solution. Thus hope to sterile composition comprising the antibody and place in a container having a sterile access port to enter, for example, in a container or vial for intravenous solution with an adapter that allows you to extract the contents, for example, limiter, permeable to hypodermic injection needle.

The concept of "stability" and "stable" in the context of the present invention relate to a composition comprising an anti-ICOS antibody of the present invention, which ensures the stability of the antibody in the composition to aggregation, destruction or fragmentation of a particular production, preparation, transportation and storage�me. "Stable" formulations of the present invention retain biological activity in the conditions of a particular production, preparation, transportation and storage. The stability of the specified antibody can be assessed by degrees of aggregation, destruction or fragmentation, measured by HPSEC, static light scattering (static light scattering - SLS), infrared spectroscopy based on the Fourier transform, circular dichroism, methods of deployment with application of urea, characteristic of tryptophan fluorescence, differential scanning calorimetry and/or methods appropriate American national standard (American National Standard - ANS), when compared to a control composition. For example, the control structure can be a standard frozen at -70°C with 10 mg/ml anti-ICOS antibody of the present invention to the FSB. The General stability of the composition comprising an anti-ICOS antibody of the present invention, can be assessed by various methods, including, for example, ELISA method, radioimmunoassay analysis and analysis of ADCC. The General stability of the composition comprising an anti-ICOS antibody of the present invention, can be assessed in vivo methods, including, for example, methods of depletion in vivo.

In one embodiment of the present invention, the composition according to the present invention comprises an anti-ICOS and�titulo. In one embodiment of the present invention, the composition of the present invention reduces the aggregation of an anti-ICOS antibody or its fragment. In another embodiment of the present invention, the composition of the present invention reduces the fragmentation of an anti-ICOS antibody or its fragment. In another embodiment of the present invention, the composition of the present invention lowers delicioasa anti-ICOS antibody or its fragment.

In one embodiment of the present invention, the composition according to the present invention comprises an anti-ICOS antibody of the present invention and is stable during storage at about 40°C for at least about 1 week, at least about 2 weeks, at least about 3 weeks or at least about 4 weeks. In one embodiment of the present invention, the composition of the present invention is stable during storage at about 40°C for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months.

In one embodiment of the present invention, the composition according to the present invention comprises an anti-ICOS antibody of the present invention and is with�abellinum when stored at about 5°C for at least about 1 month, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 10 months, at least about 11 months, or at least about 12 months. In one embodiment of the present invention, the composition of the present invention is stable during storage at about 5°C for at least about 1 year, at least about 2 years, at least about 3 years, at least about 4 years, at least about 5 years, at least about 6 years, at least about 7 years, at least about 8 years, at least about 9 years, at least about 10 years, at least about 11 years, or at least about 12 years.

In one embodiment of the present invention, the composition of the present invention includes at least about 50 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable during storage at about 40°C for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at measures� about 4 weeks at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months.

In one embodiment of the present invention, the composition of the present invention includes at least about 50 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable when stored at about 5°C for at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 1 year, at least about 2 years or at least about 3 years.

In one embodiment of the present invention, the composition of the present invention includes at least about 100 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable during storage at about 40°C for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months.

In one of the embodiments of the present invention composition, comprising� of the present invention includes, at least about 100 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable when stored at about 5°C for at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 1 year, at least about 2 years, or at least about 3 years.

In one embodiment of the present invention, the composition of the present invention includes at least about 110 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable during storage at about 40°C for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months.

In one embodiment of the present invention, the composition of the present invention includes at least about 110 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable when stored at about 5°C for at least about 6 months, at least about 7 months, at least about mesyatsev, at least about 9 months, at least about 1 year, at least about 2 years or at least about 3 years.

In one embodiment of the present invention, the composition of the present invention includes at least about 150 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable during storage at about 40°C for at least about 1 week, at least about 2 weeks, at least about 3 weeks, at least about 4 weeks, at least about 2 months, at least about 3 months, at least about 4 months, at least about 5 months, or at least about 6 months.

In one embodiment of the present invention, the composition of the present invention includes at least about 150 mg/ml anti-ICOS antibodies described in the present invention, wherein the composition is stable when stored at about 5°C for at least about 6 months, at least about 7 months, at least about 8 months, at least about 9 months, at least about 1 year, at least about 2 years or at least about 3 years.

The half-life of antibodies

In some embodiments, the implementation of the present invention, the half-life period� anti-ICOS antibody in the compositions and methods of the present invention is, at least about 4-7 days. In some embodiments of the present invention, the average half-life of anti-ICOS antibodies in the compositions and methods of the present invention is at least about 2-5 days, 3-6 days, 4-7 days, 5-8 days, 6-9 days, 7-10 days 8-11 days, 8-12, 9-13, 10-14, 11-15, 12-16, 13-17, 14-18, 15-19 or 16-20 days. In other embodiments of the present invention, the average half-life of anti-ICOS antibodies in the compositions and methods of the present invention is at least about 17 to 21 days, from 18 to 22 days, 19 to 23 days, 20 to 24 days, 21 to 25, days, 22 to 26 days, 23 to 27 days, 24 to 28 days, 25 to 29 days 26-30 days. In other embodiments of the present invention the half-life of anti-ICOS antibodies in the compositions and methods of the present invention may be approximately 50 days. In some embodiments of the present invention the half-life of antibodies in the compositions and methods of the present invention can be prolonged by methods known in this field. Such prolongation in turn may reduce the amount and/or frequency of lizirovania compositions of antibodies. Antibodies with improved in vivo half-lives and methods for their preparation are described in US 6277375, WO 98/23289 and WO 97/3461.

Circulating serum anti-ICOS antibodies in vivo can also be about�envirowacko by attaching inert polymer molecules, for example, high molecular weight polyethylene glycol (PEG) to the antibodies with a multifunctional linker or without him, or through site-specific conjugation of PEG to the N - or C-end of the antibodies or via Epsilon-amino groups present on the remains liila. Can be used linear or branched derivative, which leads to minimal loss of biological activity. The degree of conjugation can be closely monitored by the methods of SDS-PAGE and mass spectrometry to confirm the conjugation of PEG molecules to the antibodies. Unreacted PEG can be separated from conjugates antibody-PEG using size exclusion or ion-exchange chromatography. PEG-derivatives of antibodies can be tested on the ability to contact and action in vivo, using methods known to experts in this field, for example, the immunoassay described in the present invention.

In addition, the antibodies in the compositions and methods of the present invention can be anywhereman with albumin to obtain a more stable antibody in vivo or for the prolonged half-life in vivo. Appropriate methods known in this field, see, e.g., WO 93/15199, WO 93/15200, WO 01/77137 and 413 622, which are included in the present invention in the form of links.

In addition, variants have been described in the Fc region that provide for�yenny in vivo half-life of antibodies (see US US2003/0190311 A1). Consider the use of Fc variants with extended in vivo half-lives in combination with the compositions and methods of the present invention. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region with increased in vivo half-life. In another embodiment of the present invention, anti-ICOS antibody of the present invention includes variant region tfc comprising at least one substitution of an amino acid residue selected from the group consisting of residues 252, 254 and 256, and the position of the amino acid residues determined by the EU Convention. In one embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising at least one amino acid substitution selected from the group comprising M252Y, S254T and TE, and the position of the amino acid residues determined by the EU Convention. In another embodiment of the present invention, anti-ICOS antibody of the present invention comprises a variant Fc region comprising at least one amino acid residue selected from the group consisting of Y at position 252, T at position 254 and E at position 256, wherein the position of amino acid residues determined by the EU Convention.

Introduction and dozy�the stripes

The introduction of the compositions of the present invention to a sick person can be held in any way, including, but not limited to, intravenous, intradermal, transcutaneous, subcutaneous, intramuscular, inhalation (e.g., when using aerosol), oral (for example, placing the medication under the tongue), local (i.e., through the skin and mucous membranes, including mucous membranes of the respiratory tract), intrathecal, intraarticular, multiple, intracerebral, intraarterial, intraperitoneal, oral, WinUtilities, intranasal, rectal or vaginal, introduction by perfusion through a regional catheter, or by direct injection into the wound. In one of the embodiments of the present invention the compositions of the present invention is administered by intravenous injection or by intravenous infusion over a certain period (e.g., 0.5-2 hrs). The compositions of the present invention can be released by means of pressure or in the form of a depot, although those skilled in the art knows that the most applicable route of administration in each particular case may depend on a number of factors, such as age, gender and General condition of the subject, the nature and severity of the condition being treated, and/or from the specific nature of composition administered (i.e., the dose � composition). In one of the embodiments of the method of administration is bolus or continuous infusion over a certain period of time, once or twice a week.

In certain other embodiments of the present invention, the method of administration is subcutaneous injection, optional one or two times a week. In one embodiment of the present invention, compositions and/or methods of the present invention is administered as an outpatient. In some embodiments of the present invention, the dose of the composition comprising an anti-ICOS antibody, expressed in mg/kg of body weight of the patient. In other embodiments of the present invention, the dose of the composition comprising an anti-ICOS antibody, expressed in mg/kg of body weight of the patient without the mass of a fat component. In other embodiments of the present invention, the dose of the composition comprising an anti-ICOS antibody, expressed in mg/m2the surface area of the patient's body. In other embodiments of the present invention, the dose of the composition comprising an anti-ICOS antibody, is measured in mg per dose, injected into a patient. Any dose measurement can be used in combination with the compositions and methods of the present invention and the dose units can be converted means, standard in this field.

Special�leaves in this area obviously what doses can be chosen based on a number of factors, including age, sex, and condition of the subject (e.g., stage of the disease), the desired degree of cellular depletion, the disease being treated and/or used a specific antibody or antigen-binding fragment, and may be determined by the experts in this field. For example, effective amounts of the compositions of the present invention can be extrapolated by curve a dose-response obtained in the test systems in vitro, or test-systems of animal models (e.g., use of cotton hamster or monkey). Models and methods for assessing the impacts of antibody known in the art (see Wooldridge, etc., Blood, 89(8), 1997, cc.2994-2998), the essence of which is included in the present invention by reference). In some embodiments of the present invention for certain forms of malignant diseases associated with T cells expressing ICOS, standard therapeutic regimes in this area related to the treatment with antibodies, can be used with the compositions and methods of the present invention.

Examples of dosing schedules that can be used in the methods of the present invention include, but their list is not limited to, daily administration, the introduction of three times weekly (intermittent), RA� a week or every 14 days. In some embodiments of the present invention to the dosing schedules include, but not limited to, dosing once a month or every 6-8 weeks.

For specialists in this field it is obvious that the dosage is usually higher and/or frequency of administration is more at the beginning of treatment compared to supportive treatment regimes.

In some embodiments of the present invention, anti-ICOS antibodies bind to ICOS-expressing T-cells and can lead to efficient (i.e., low dose) depletion of ICOS-expressing T cells (as described in the present invention). In some embodiments of the present invention the dosage of the antibody (optionally in a pharmaceutically acceptable carrier as a pharmaceutical composition) are at least approximately 0,0005, 0,001, 0,05, 0,075, 0,1, 0,25, 0,375, 0,5, 1, 2,5, 5, 10, 20, 37,5 or 50 mg/m2and/or less than about 500, 475, 450, 425, 400, 375, 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 60, 50, 37,5, 20, 15, 10, 5, 2,5, 1, 0,5, 0,375, 0,1, 0,075 or 0.01 mg/m2. In some embodiments of the present invention, the dosage is from about 0.0005 to about 200 mg/m2about of 0.001-150 mg/m2approximately 0,075-125 mg/m2approximately 0,375-100 mg/m2approximately 2.5 to 75 mg/m2about 10-75 mg/m2and about 20-50 mg/m2. Close variants be implemented thr�ment of the present invention is used, the dose of anti-ICOS antibody is at least about 0,1, 0,2, 0,3, 0,4, 0,5, 0,6, 0,7, 0,8, 0,9, 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6, 6,5, 7, 7,5, 8, 8,5, 9, 9,5, 10, 10,5, 11, 11,5, 12, 12,5, 13, 13,5, 14, 14,5, 15, 15,5, 16, 16,5, 17, 17,5, 18, 18,5, 19, 19,5, 20, 20,5 mg/kg of body weight of the patient. In some embodiments of the present invention, the dose used "naked" anti-ICOS antibody is at least about 1-10, 5-15, 10-20, 15-25 mg/kg of body weight of the patient. In some embodiments of the present invention applied dose of an anti-ICOS antibody is at least about 1-20, 3-15 or 5-10 mg/kg mg/kg of body weight of the patient. In other embodiments of the present invention, the dose used in anti-ICOS antibody is at least about 5, 6, 7, 8, 9, or 10 mg/kg of body weight of the patient. In some embodiments of the present invention, a single dose of the antibody (optionally in a pharmaceutically acceptable carrier component in the form of pharmaceutical compositions) may be equal to at least about 0,5, 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 66, 68, 70, 72, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102, 104, 106, 108, 110, 112, 114, 116, 118, 120, 122, 124, 126, 128, 130, 132, 134, 136, 138, 140, 142, 144, 146, 148, 150, 152, 154, 156, 158, 160, 162, 164, 166, 168, 170, 172, 174, 176, 178, 180, 182, 184, 186, 188, 190, 192, 194, 196, 198, 200, 204, 206, 208, 210, 212, 214, 216, 218, 220, 222, 224, 226, 228, 230, 232, 234, 236, 238, 240, 242, 244, 246, 248 or 250 μg/m2. In other embodiments, the present�present invention increase the dose to 1 g per single dose.

In some embodiments of the present invention the methods of the present invention, antibodies and/or compositions of the present invention may be administered in a dose lower than about 375 mg/m2, lower than about 37.5 mg/m2, lower than about 0.375 mg/m2and/or in a dose of from about 0.075 mg/m2to about 125 mg/m2. In some embodiments of the present invention the methods of the present invention, dosing regimens comprise low doses, administered with repeat intervals. For example, in one embodiment of the present invention, the compositions of the present invention may be administered in a dose lower than about 375 mg/m2at intervals of approximately every 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 15, 20, 25, 30, 35, 40, 45, 50, 60, 70, 80, 90, 100, 125, 150, 175 or 200 days.

Specified dosing may lead to depletion of ICOS-expressing T cells in humans after treatment with compositions and methods of the present invention over a period of at least about 1, 2, 3, 5, 7, 10, 14, 20, 30, 45, 60, 75, 90, 120, 150 or 180 days or more. In some embodiments of the present invention in the methods of the present invention depletes ICOS-expressing T cells by at least 30%, 40%, 50%, 60%, 70%, 80%, 90% or 100% compared with the levels of ICOS-expressing T cells in a patient, powerhouse�Xia treatment before application of the compositions and methods of the present invention. In other embodiments of the present invention in the methods of the present invention depletes ICOS-expressing T cells by at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, or 100% compared to the levels of ICOS-expressing T cells in humans. In close to embodiments of the present invention the standard levels of ICOS-expressing T cells in humans is determined using the patients, comparable to those exposed to treatment of patients by age, sex, weight and other parameters.

In some embodiments of the present invention, the dose is approximately 125 mg/m2or less of antibody or antigen-binding fragment, leads to the depletion of ICOS-expressing T cells for a period of at least about 7, 14, 21, 30, 45, 60, 90, 120, 150 or 200 days. In another embodiment of the present invention, the dose is approximately 37.5 mg/m2or less, depletes ICOS-expressing T cells for a period of at least about 7, 14, 21, 30, 45, 60, 90, 120, 150 or 200 days. In other embodiments of the present invention, the dose is approximately 0.375 mg/m or less, leads to the depletion of ICOS-expressing T cells for at least about 7, 14, 21, 30, 45 or 60 days. In another embodiment of the present invention, the dose component approx�RNO 0.075 mg/m 2or less, leads to the depletion of ICOS-expressing T cells for a period of at least about 7, 14, 21, 30, 45, 60, 90, 120, 150 or 200 days. In yet another variant implementation of the present invention, the dose is approximately 0.01 mg/m2, 0.005 mg/m2or even 0.001 mg/m2or leads to depletion of ICOS-expressing T cells for at least about 3, 5, 7, 10, 14, 21, 30, 45, 60, 90, 120, 150 or 200 days. In accordance with the variants of implementation of the present invention, the dose can be entered in any acceptable way, but not necessarily can be administered subcutaneously.

In another object of the present invention found that the depletion of ICOS-expressing T cells and/or treatment of disorders mediated by T-cells, can be achieved at low doses of antibodies or antibody fragments used in modern methods. Thus, in another embodiment of the present invention present a method for the depletion of ICOS-expressing T cells and/or treatment-mediated T-cell disorders, comprising administering to the human an effective amount of an antibody that specifically binds to ICOS, in which the dosing about 500, 475, 450, 425, 400, 375, 350, 325, 300, 275, 250, 225, 200, 175, 150, 125, 100, 75, 60, 50, 37,5, 20, 10, 5, 2,5, 1, 0,5, 0,375, 0,25, 0,1, 0,075, 0,05, 0,001, 0,0005 mg/m2or less leads to East�the purication of ICOS-expressing T cells (circulating and/or tissue ICOS-expressing T cells) 25%, 35%, 50%, 60%, 75%, 80%, 85%, 90%, 95%, 98% or more for at least about 3, 5, 7, 10, 14, 21, 30, 45, 60, 75, 90, 120, 150, 180 or 200 days or longer. In typical embodiments of the present invention, the dose component about 125 mg/m2or 75 mg/m2or less, results in at least about 50%, 75%, 85% or 90% depletion of ICOS-expressing T cells for at least about 7, 14, 21, 30, 60, 75, 90, 120, 150 or 180 days. In other embodiments of the present invention a dosage of about 50, 37.5 or 10 mg/m2leads at least about 50%, 75%, 85% or 90% depletion of ICOS-expressing T cells for at least about 7, 14, 21, 30, 60, 75, 90, 120 or 180 days. In another embodiment of the dosing approximately 0,375 or 0.1 mg/m2leads at least about 50%, 75%, 85% or 90% depletion of ICOS-expressing T cells for at least about 7, 14, 21, 30, 60, 75 or 90 days. In other embodiments, the dose is approximately 0,075, of 0.01, or 0.001, or 0.0005 mg/m2leads at least about 50%, 75%, 85% or 90% depletion of ICOS-expressing T cells for at least about 7, 14, 21, 30 or 60 days.

In some embodiments of the present invention, the dose can be increased or decreased to maintain a constant dose in the blood or tissue, for example, in coast�th brain but not only there. In close to embodiments of the present invention increase the dose or reduce by about 2%, 5%, 8%, 10%, 15%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90% and 95% to maintain the required level of antibody in the compositions and methods of the present invention.

In some embodiments of the present invention, the dosage may be changed and/or the infusion rate can be reduced depending on the immunogenic response of the patient to compositions and methods of the present invention.

Testing toxicity

Stability, toxicity and/or efficacy of the compositions and/or regimens of the present invention can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, e.g. for determining the LD50 (the dose mortality, leading to the death of 50% of the population), ED50 (the dose therapeutically effective in 50% of the population) and IC50 (the dose effective to achieve 50% suppression). In one of the embodiments of the present invention, the dose means a dose to achieve a depletion of circulating ICOS-expressing T cells, of at least 60%, 70%, 80%, 90%, 95% or 99%. The ratio of doses that cause toxicity and therapeutic effects is therapeutic index and can be expressed in terms of the ratio LD50/ED50. Ways Le�t, which exhibit significant therapeutic results, might be preferred. Although there may be treatments available that exhibit toxic effects, should focus on the delivery system that targets such agents in ICOS-expressing cells, to minimize the strong destruction of the ICOS-negative cells and thus reduce side effects.

The data obtained in the study of cell cultures and animals, can be used in the processing of a range of doses of the compositions and/or treatment regimens for human. The dose of such agents can be in the range of circulating concentrations that include the ED50 value no toxicity or low toxicity. The dose may vary within this range depending on the dosage form and route of administration. For any treatment in the methods of the present invention a therapeutically effective dose can be installed using appropriate animal models. Depending on the animal species, the dose can be scaled for people under formulas adopted in this sphere, for example, developed Freireich, etc., Cancer Chemotherapy Reports, NCI40, 1966, cc.219-244. The data obtained in the study of cell cultures can be used to predict possible toxicity. Animal research can be used �La determination of specific doses to achieve a range of concentration in the circulating plasma, refers to the value of the IC50 (i.e., concentration of a compound that achieves the suppression of half the maximum occurring symptoms) according to the definition in cell culture. Such information can be used to more accurately determine useful for people doses. The levels of drugs in plasma can be measured, for example, by high performance liquid chromatography, ELISA or methods based on the study of cells.

Therapeutic use

Compositions comprising anti-ICOS antibody with enhanced effector function, can be used for the treatment of autoimmune diseases such as systemic lupus erythematosus, rheumatoid arthritis, multiple sclerosis, diabetes, immune thrombocytopenic purpura (immune thrombocytopenic purpura - ITP) and psoriasis, chronic inflammatory diseases, such as disease inflammatory bowel (Crohn's disease and ulcerative colitis), disease graves., Hashimoto's thyroiditis, and diabetes mellitus. Anti-ICOS composition described in the present invention can also be used to mitigate toxic shock syndrome, a disease of inflamed intestine, alloantibodies due to transfusion of blood, T-cell-dependent b cell-mediated diseases and treatment of the disease graft-versus-host. In addition, the compositions and methods according to the present from�briteney can be used in the indications for therapeutic use, required to suppress or enhance the production of antibodies.

Compositions comprising anti-ICOS antibody with enhanced effector function, can also be used as immunosuppressive agents in transplantation of bone marrow and organs and can be used to extend the functioning graft. Such compositions can provide a significant advantage over available treatment. Transplantation therapy bone marrow and organs must confront mediated T-cell rejection of foreign cells or host tissue. These therapeutic modes of suppression mediated T-cell rejection include treatment drugs cyclosporine or FK506. Although medicines are effective, patients suffer from severe side effects, including hepatotoxicity, nephrotoxicity and neurotoxicity. The target class of drugs cyclosporine/RKB is calcineurin, phosphatase, expressed everywhere in the body. Because the expression of ICOS limited to T-cells, depletion of ICOS-expressing T cells may lead to loss of severe side effects seen with use of these immunotherapeutic agents.

Hypersensitivity is the normal useful for the immune otveta�, which excessive or insufficient and leads to inflammatory reactions and tissue damage. Hypersensitivity reactions, mediated by antibody, may be particularly sensitive to antagonism by the depletion of ICOS-expressing cells. Allergy, hay fever, asthma, and acute edema cause hypersensitivity reactions type I, and these reactions can be suppressed by the depletion of ICOS-expressing cells.

Diseases that cause reactions are antibody-mediated hypersensitivity include systemic lupus erythematosus, arthritis (rheumatoid arthritis, reactive arthritis, psoriatic arthritis), nephropathies (glomerulonephritis, membranous, mesangiocapillary, focal segmental, focal necrotizing, crescentic, proliferative tubulopathy), skin disorders (pemphigus and pemphigoid, erythema nodosum), endocrinopathy (thyroiditis is a disease of graves., Hashimoto's disease - insulin-dependent diabetes mellitus), various pneumopathy (especially external alveolitis), various vasculopathy, has celiac disease, with impaired production of IgA, many anemia and thrombocytopenia, the Guillain-Barre syndrome and myasthenia gravis plus celiac can be treated using compositions comprising anti-ICOS antibody with enhanced effector function.

In addition, lymphoproliferative disorders, e.g.�p, multiple myeloma, waldenstrom's (waldenstrom's disease) and cryoglobulinemia may be suppressed by the introduction of a composition comprising an anti-ICOS antibody with enhanced effector function. In addition, when the disease graft-versus-host "artificial" immune disorder depletion of ICOS-expressing cells may be useful.

ICOS-dependent metabolic pathway joint stimulation is involved in the regulation of IgE production. Immunoglobulin IgE is the isotype that is involved in mediating allergic responses, for example, asthma, food Allergy, hay fever, hypersensitivity of the first type and the inflammation of cavities. When exposed to the allergen a process that involves the interaction of T cells and b cells, leads to the development of b-cells IgE specific against the allergen. Allergen-specific IgE is released into the bloodstream To cells associated with mast cells and basophils via the IgE receptor with high affinity (FceRI). Mast cells and basophils is associated with IgE, become sensitized and subsequent exposure to the allergen leads to cross-linking of surface receptors and release of histamines.

The present invention provides the use of anti-ICOS antibodies for regulation of the production of IgE and preventing or treating an IgE-Opera�created disorder. Examples of such disorders include allergic responses, such as asthma, food Allergy, hay fever, hypersensitivity and inflammation of the sinuses. In one embodiment of the present invention, anti-ICOS antibody of the present invention is used for partial or complete suppression of IgE production. Anti-ICOS antibody of the present invention can be used alone or in combination in treatment regimes for reducing IgE levels.

The present invention is also the use of anti-ICOS antibodies in combination with IgE antagonist to partial or complete suppression of IgE production and in the prevention and/or treatment of disorders characterized by excessive or inappropriate production of IgE. In the context of the present invention, the term "IgE antagonist" refers to a compound capable of disrupting or blocking the interaction of IgE with its receptor FceRI, high affinity, on the cells so that the response to allergen stimulus is weakened or destroyed. Antagonists include anti-IgE antibody and its fragments, soluble receptor FceRI and its fragments, anti-FceRI antibody and its fragments, IgE variants and fragments thereof, IgE binding peptides, FceRI receptor binding peptides and small molecules able to bind to IgE or to compete with IgE for the binding of Retz�ptogram FceRI. Anti-ICOS antibody of the present invention can also be used in combination with antihistamines, desensitization allergen, decreasing allergen exposure, etc. to treat allergic disorders.

The present invention also relates to preventing and/or treating asthma, comprising administering an anti-ICOS antibody of the present invention, one or together with one or more agents for the treatment of asthma. Examples of such agents include bronchodilators (anticholinergic agents, agonists beta-2 adrenergic receptor antagonists lincolniana D-4, antagonists of neurokinin, openers of potassium channels, antagonists of substance P, antagonists of thromboxane A-2 and xanthine), anti-inflammatory (an inhibitor of 5-lipoxygenase, inhibitors of protein that activates 5-lipoxygenase, phosphodiesterase IV inhibitors, antagonists of platelet-activating factor, respiratory SPULS, steroids and tyrosine kinase inhibitors), inhibitors of cytokines (CD4, IL-4 and IL-5 inhibitors) and IgE antagonists listed above.

Compositions and methods of the present invention can control (suppress or stimulate) proliferation of ICOS-expressing cells or production of cytokine (e.g., IL-17) ICOS-expressing cells, thereby enabling the suppression of various pathological conditions and l�the treatment or prevention of various disorders, due to various physiological phenomena associated with signal transduction, mediated ICOS.

Compositions comprising anti-ICOS antibody of the present invention, suppress, prevent and/or treat, for example, the following diseases, but their list is not limited to: rheumatoid arthritis, multiple sclerosis, autoimmune thyroiditis, allergic contact dermatitis, chronic inflammatory dermatosis (e.g. lichen planus), systemic lupus erythematosus, insulin-dependent diabetes mellitus, psoriasis, autoimmune or allergic disorders, autoimmune diseases and allergic reactions of the delayed type, called cell-mediated immunisation, arthropathy (for example, but their list is not limited to, rheumatoid arthritis (RA) and osteoarthritis (OA)), inflammation (e.g., hepatitis), graft-versus-host reaction TNX), the disease is graft-versus-host (BTP), immunological rejection associated with transplantation of a tissue (e.g., skin, cornea, bone) or organ (e.g., liver, heart, lung, kidney, pancreas), the immune response induced by a foreign antigen or autoantigen (e.g., production of antibodies against the antigen, cell proliferation, production of cytokines) and disorders, caused by disturbed Kish�tion immunity (for example, irritable bowel syndrome, Crohn's disease, ulcerative colitis, food Allergy).

In addition, the compositions and methods described in the present invention can be used for suppression/treatment of transplant rejection or BTP in combination with known immunosuppression agents, e.g., inhibitors of transcription of cytokine (e.g., cyclosporin a, tacrolimus), synthesis of nucleotides (for example, azathioprine, mycofenolate a mofetil), signal transduction of growth factor (e.g., sirolimus, rapamycin) and interleukin 2 receptor of T cells (e.g., daclizumab, basiliximab). In one of the embodiments of the present invention immunosuppression agent, used in combination with the compositions and methods of the present invention is one or more of the following agents: adriamycin, azathiopurine, busulfan, cyclophosphamide, cyclosporine a ("Sua"), cytoxin, fludarabine, 5-fluorouracil, methotrexate, mycophenolate mofetil (MOFETIL), nonsteroidal anti-inflammatory drugs (NCPLS), rapamycin and tacrolimus (FK506).

Compositions and methods of the present invention can be applied to inflammatory diseases, for example, related to the inflammation of arthritis (e.g. rheumatoid arthritis, osteoarthritis), pneumonia, hepatitis� (including viral hepatitis), related to inflammation of infectious diseases, inflammatory intestinal diseases, intestinal enteritis, nephritis (e.g. glomerular nephritis, neurofibroma), gastritis, angitis, pancreatitis, peritonitis, bronchitis, myocarditis, encephalitis, inflammation in postischemic reperfusion injury (myocardial ischemic reperfusion injury), inflammation associated with immune rejection after transplantation of tissue and organ, burns, various skin inflammation (psoriasis, allergic contact dermatitis, lichen planus), inflammation in multiple organ failure, inflammation after percutaneous transluminal coronary angiopathy (RTSA) or percutaneous transluminal coronary recanalization (PTCR)- associated arteriosclerosis inflammation and autoimmune thyroiditis.

The compositions of the present invention comprising anti-ICOS antibody with enhanced effekterna function as an active ingredient, can be used for the inhibition, treatment and/or prevention of various diseases, for example, but their list is not limited to, rheumatoid arthritis, multiple sclerosis, autoimmune thyroiditis, allergic contact dermatitis, lichen planus, systemic lupus erythematosus, insulin-dependent diabetes mellitus, psoriasis�, autoimmune diseases or allergic diseases, allergic reactions of the delayed type, called cell-mediated immunity, arthropathies (e.g., rheumatoid arthritis (RA), osteoarthritis (OA)), inflammation (e.g., hepatitis), a graft-versus-host reaction TNX), disease graft-versus-host (BTP), immune rejection associated with transplantation of tissues (e.g. skin, cornea, bone) or organs (e.g., liver, heart, lung, kidney, pancreas), irritable bowel syndrome, Crohn's disease, ulcerative colitis and food allergies.

Compositions in accordance with the present invention allows to treat or prevent some inflammation, which is used for various steroid as anti-inflammatory medicines, for example, inflammation associated with various arthritis (for example rheumatoid arthritis, osteoarthritis), pneumonia, hepatitis (including viral hepatitis), inflammation associated with infectious diseases, syndrome of inflamed bowel, enteritis, nephritis, glomerulonephritis, inflammation associated with kidney fibrosis, gastritis, vasculitis, pancreatitis, peritonitis, bronchitis, myocarditis, encephalitis, inflammation associated with ischemic reperfusion injury, myocardial ischemic reperfu�ion damage inflammation associated with immune rejection after transplantation tissues or organs, psoriasis, allergic contact dermatitis, lichen planus, inflammation in multiple organ failure, inflammation after percutaneous transluminal coronary angiopathy (RTSA) or percutaneous transluminal coronary recanalization (PTCR), inflammation accompanying arteriosclerosis, and autoimmune thyroiditis.

Broadcast

Some of the objects of the present invention applied to the treatment regimens and dose the compositions and methods of the present invention is selected based on a number of factors, including, for example, clinical manifestation that is available to the patient with the risk of transplant rejection, or clinical evidence that such a rejection occurs.

The present invention provides compositions, therapeutic compositions, methods and modes that are efficient in the case of frequency of occurrence, severity or duration BTP, in cases of rejection or posttranslational lymphoproliferative disorders. In some embodiments, the present invention compositions and methods of the present invention is effective to weaken the response of the host to ischemic reperfusion injury of transplant dense tissue or organ. In one embodiment implemented�of Tulane present invention, compositions and methods of the present invention is effective for prolonged graft survival in a recipient of a transplant.

The present invention includes the grafts are autologous, allogeneic or xenogeneic to the recipient. Types of transplants are covered by the present invention include transplants of tissues and organs, including, but not limited to, transplants, bone marrow transplants, peripheral stem cells, skin grafts, grafts arteries and veins that transplants islet cells of pancreas and kidney transplants, liver, pancreas, thyroid and heart. The term "implant" and "graft" in the present invention are interchangeable. In one embodiment of the present invention, the autologous graft is a bone marrow transplant, graft artery, vein or graft skin graft. In one embodiment of the present invention, the allograft is transplanted bone marrow, corneal transplant, kidney transplant, transplant of islet cells of Langerhans or a combined transplant of kidney and pancreas. In one embodiment of the present invention, the graft is xenotransplantation where possible animals-donors are, but not limited to, pigs. Compositions and methods according to the present izobreteny� can also be used to suppress harmful immune response to non-biological graft or implant including, but not limited to, artificial joints, stent or pacemaker.

Anti-ICOS antibodies, compositions and methods of the present invention can be used to treat or prevent BTP, rejection, or post-translational lymphoproliferative disorders, without regard to specific indicators that initially caused the need for the transplant or the particular type of the transplanted tissue.

Therapeutic formulations and modes of the present invention is described for the treatment of people diagnosed with autoimmune diseases or disorders, including, but not limited to, rheumatoid arthritis, SLE, immune thrombocytopenic purple (immune thrombocytopenic purpura - ITP), a disorder associated with pemphigus, diabetes, and scleroderma.

Appropriate modes of treatment may be determined by the person skilled in the art for a particular patient or group of patients. In certain embodiments of the present invention the treatment is cotransplantation certain treatment, post-transplant maintenance mode or treating post-transplant regime for cases of acute and chronic rejection. In some embodiments of the present invention, a specific mode varies for the patient, which is estimated at CA�ETS with high or moderate risk of development of response to the rejection, compared with the regime for the patient with a low risk of rejection.

In some embodiments of the present invention, a specific mode varies depending on the stage of rejection, with more aggressive therapy, assigned to patients in the later stages of rejection. Stage humoral rejection can be classified, based on the knowledge and experience gained in this field. For example, stage humoral rejection can be classified into stages I to IV according to the following criteria: stage I (latent), characterized circulating ALLO-antibodies against the donor, especially anti-HLA antibodies, stage II (occult reaction), characterized circulating ALLO-antibodies against the donor, especially anti-HLA antibodies, C4d deposition, but without histologic changes or graft dysfunction, stage III (subclinical rejection), characterized circulating ALLO-antibodies against the donor, especially anti-HLA antibodies, C4d deposition, and tissue pathology, but without graft dysfunction, stage IV (humoral rejection), characterized circulating ALLO-antibodies against the donor, especially anti-HLA antibodies, C4d deposition, tissue pathology, and graft dysfunction.

Anti-ICOS antibodies, compositions and methods according to the present every�the purchase can be used for treating or preventing BTP, rejection or post-translational lymphoproliferative disorders, either alone or in combination with other therapeutic agents or treatment regimens. Other therapeutic regimens for the treatment or prevention BTP, rejection, or post-translational lymphoproliferative disorders may include, for example, one or more variants antilimfocitarnyi therapy, steroid therapy, therapy aimed at depletion of antibodies, immunosuppressive therapy and plasmoforez.

Antilimfocitarnyi therapy may include the introduction of a recipient of a transplant anti-timecity globulin, also called thymoglobuline. Anti-lymphocyte therapy may also involve the introduction of one or more monoclonal antibodies directed against antigens on the surface of T cells. Examples of such antibodies include, but is not limited to, the product OKT3™ (muromonab-CD3), product SAMRAT™-1H (alemtuzumab), CAMPATH™-1G, the product SAMRAT™-1M, product, SIMULECT™ (basiliximab) and the product ZENAPAX™ (impact). In one of the embodiments of the present invention antilimfocitarnyi therapy includes one or more antibodies directed against b-cells, including, but not limited to, product RITUXAN™ (rituximab).

Steroid therapy may include the introduction of a recipient of a transplant comme� or more steroids, selected from the group consisting of hydrocortisone, prednisone, methylprednisolone, dexamethasone and indomethacin. From one or more steroids can be corticosteroids, including, but not limited to, cortisol, prednisone and methylprednisolone.

Therapy aimed at depletion of antibodies may include, for example, intravenous administration to a recipient of a transplant of immunoglobulin. Therapy aimed at depletion of antibodies, may also include immunoadsorption therapy applied to the graft ex vivo, prior to transplantation. Immunoadsorption may be performed using any appropriate technique, for example, the affinity to protein A or affine methods based on antibodies, using antibodies directed against markers on the surface of T-cells or b-cells, for example, anti-CD3 antibodies, anti-CD19 antibodies, anti-CD20 antibodies and anti-CD22 antibodies.

Immunosuppression therapy may include the introduction of one or more of immunosuppression agents, e.g., inhibitors of transcription of cytokines (e.g., cyclosporine A, tacrolimus), synthesis of nucleotides (for example, azathioprine, mycofenolate a mofetil), signal transduction of growth factor (e.g., sirolimus, rapamycin) and interleukin 2 receptor of T cells (e.g., daclizumab, basiliximab). In one embodiment osushestvlyaetsya invention of immunosuppression agent, used in combination with the compositions and methods of the present invention is one or more of the following agents: adriamycin, azathiopurine, busulfan, cyclophosphamide, cyclosporine a ("Sua"), cytoxin, fludarabine, 5-fluorouracil, methotrexate, mycophenolate mofetil (MOFETIL), nonsteroidal anti-inflammatory drugs (NCPLS), rapamycin and tacrolimus (FK506). Immunosuppression agents may also include inhibitors of complement, for example, soluble receptor-1 of complement, anti-C5 antibody or small molecule inhibitor of C1, for example, described in the work Buerke et (J. Immunol., 167, 2001, cc.5375-5380.

In one of the embodiments of the present invention compositions and methods of the present invention is used in combination with one or more therapeutic regimes to suppress rejection, including, but not limited to, treatment with tacrolimus and mycophenolate the mofetil, immunoadsorption, intravenous therapy immunoglobins and plasmoforez.

Inflammatory disorders

Anti-ICOS antibody of the present invention may be administered to a subject in need of this, for the prevention, monitoring, treatment or alleviation of inflammatory disorders (e.g., asthma) or one or more of its symptoms. The compositions of the present invention can also be entered in to�the combination with one or more other therapies, preferably used for the prevention, monitoring, treatment or alleviation of inflammatory disorders (including, but not limited to, listed in the present image prophylactic or therapeutic agents) to a subject in need, for the prevention, monitoring, treatment or alleviation of an inflammatory disorder or one or more of its symptoms. In one of the embodiments of the present invention provides a method for the prevention, monitoring, treatment or alleviation of an inflammatory disorder or one or more of their symptoms, said method comprises administering to a subject in need this, the dose of a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention. In another embodiment of the present invention provide a method for the prevention, monitoring, treatment or alleviation of an inflammatory disorder or one or more of their symptoms, with the specified method comprises administering to a subject in need this, the dose prophylactically or therapeutically effective amount of an anti-ICOS antibody with enhanced effector function of the present invention and a dose prophylactically or therapeutically effective amount of one or more drugs (e.g., preventive action.�them or therapeutic agents), non-human antibodies (and fragments of antibodies) that immunospecificity contact the ICOS polypeptide.

The present invention provides methods for monitoring, treating or alleviating one or more symptoms of the inflammatory disorder in a subject, not treatable by conventional methods (e.g., methotrexate and a TNF antagonist-alpha (e.g., foods REMICADE™ or ENBREL™)) for such an inflammatory disorder, said methods include the introduction of a specified subject a dose of a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function. The present invention also presents methods for monitoring, treating or alleviating one or more symptoms of the inflammatory disorder in a subject, not treatable on the basis of available single therapeutic agents intended for such inflammatory disorders, and these methods include the introduction of a specified subject a dose of a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function and dose of a prophylactically or therapeutically effective amount of one or more drugs (e.g., prophylactic or therapeuti�technical agent), non-antibody (including fragments of antibodies) that immunospecificity contact the ICOS polypeptide. The present invention also presents methods of control or treatment of inflammatory disorders by introducing anti-ICOS antibody of the present invention with enhanced effector function in combination with any other treatment of patients with treatment failure other drugs, and treatment with these drugs is discontinued. The present invention is also modified methods of treating inflammatory disorders, if installed or can be installed, what other treatment is too toxic, i.e., results in unacceptable or unbearable side effects for subject treatment of the subject. For example, a composition according to the present invention may be administered to a subject, wherein the subject is refractory to TNF antagonist or methotrexate. In addition, the present invention provides methods for the prevention of relapse of inflammatory disorders in patients who were treated and had no symptoms of the disease after administration of anti-ICOS antibody of the present invention with enhanced effector function.

To inflammatory disorders that can be treated by the methods described in the present invent�research Institute, include, but not limited to, asthma, encephalitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic disorders, septic shock, pulmonary fibrosis, undifferentiated spongy arthropathy, undifferentiated arthropathy, arthritis, osteoarthritis, spongy arthropathies (e.g., psoriatic arthritis, ankylosing spondylitis, Reiter's syndrome (reactive arthritis), inflammatory osteolysis, Wilson's disease, and chronic inflammation resulting from chronic viral or bacterial infections. As described in the present invention, some autoimmune disorders are associated with a state of inflammation.

Anti-inflammatory treatment, dosages, routes of administration and recommended usage are known in this field and described in the literature, for example, in the book: "Physician's Desk Reference", 2007, 61st ed.

Anti-inflammatory therapy

The present invention provides for methods of prevention, monitoring, treatment or alleviation of an inflammatory disorder or one or more symptoms of such disorders, and the said means, comprising administering to a subject in need of this, an anti-ICOS antibody of the present invention with enhanced effector function and one or more drugs (e.g., proph�ical or therapeutic agents, non-human antibodies or fragments of antibodies) that immunospecificity contact the ICOS polypeptide. Any agent or any treatment, the effectiveness of which is known, or which was used or is currently used for the prevention, monitoring, treatment or alleviation of an inflammatory disorder or one or more symptoms of such disorders, can be used in combination with anti-ICOS antibody of the present invention with enhanced effector function in accordance with the invention described in the present invention.

Any anti-inflammatory agent, including agents, applicable in the treatment of inflammatory disorders, known to specialists in this field and can be used in the compositions and methods of the present invention. Examples of antiinflammatory agents include, but are not limited to, anti-inflammatory agents, including nonsteroidal anti-inflammatory drugs (NCPLS), steroidal anti-inflammatories (SPLS), antiholinergicescoe agents (e.g., atropine sulfate, atropine methyl nitrate and ipratropium bromide (product ATROVENT™)), beta2-agonists (e.g., abuterol (VENTOLIN™ and PROVENTIL™), bitolterol (product TORNALATE™), levalbuterol (product XOPONEX™), metaproterenol (product ALUPENT™), pirbuterol (�the same time MAXAIR™), terbutalin (products BRETHAIRE™ and BRETHINE™), albuterol (PROVENTIL™, REPETABS™, and VOLMAX™), formoterol (product FORADIL AEROLIZER™), and salmeterol (SEREVEN products™ and SEREVENT DISKUS™)), and methylxanthines (e.g., theophylline (UNIPHYL™, THEO-DUR™, SLO-BID™, and TENO-42™)). Examples SPULS include, but not limited to, aspirin, ibuprofen, celecoxib (CELEBREX™), diclofenac (product VOLTAREN™), etodolac (product LODINE™), fenoprofen (product NALFON™), indomethacin (product INDOCIN™), ketoralac (product TORADOL™), oxaprozin (product DAYPRO™), nabumetone (product RELAFEN™), sulindac (product CLINORIL™), tolmetin (product TOLECTIN™), rofecoxib (VIOXX product™), naproxen (ALEVE™, NAPROSYN™), Ketoprofen (product ACTRON™) and nabumetone (product RELAFEN™). Such SPULS function by inhibiting the enzyme cyclooxygenase (for example, COX-1 and/or COX-2). Examples of steroidal anti-inflammatory drugs include, but is not limited to, glucocorticoids, dexamethasone (product DECADRON™), corticosteroids (e.g., methylprednisolone (product MEDROL™)), cortisone, hydrocortisone, prednisone (PREDNISONE™ and DELTASONE™), prednisolone (PRELONE™ and PEDIAPRED™), triamcinolone, azulfidin and inhibitors of eicosanoids (e.g., prostaglandins, thromboxanes and leukotrienes).

In one embodiment of the present invention, an effective amount of one or more of�their compositions of the present invention is administered in combination with a protease inhibitor fat cells to a subject at risk of an inflammatory disorder or inflammatory disorder. In another embodiment of the present invention protease inhibitor, a mast cell inhibitor is tryptamines, for example, but their list is not limited to, GW-45, GW-58, and genistin. In one of the embodiments of the present invention protease inhibitor, a mast cell inhibitor is phosphatidylinositide-3' (PI3)-kinase, for example, calphostin With, but the list is not limited. In another embodiment of the present invention protease inhibitor fat cells is an inhibitor of protein kinases, for example, the STS, but the list is not limited. In one embodiment of the present invention, the protease inhibitor of the fat cells injected locally in the damaged area.

Specific examples of immunomodulatory agents that may be administered in combination with anti-ICOS antibody of the present invention with enhanced effector function to a subject with an inflammatory disorder include, but not limited to, methotrexate, Leflunomide, cyclophosphamide, cytoxan, immuran, cyclosporine a, minocycline, azathioprine, antibiotics (e.g., FK506 (tacrolimus)), methylprednisolone (MP), corticosteroids, steroids, mycophenolate mofetil, rapamycin (sirolimus), mizoribine, desoxipeganine, brequinar, malononitrile (e.g. leflunamide), antibodies against Retz�torus T cells (e.g., anti-CD4 antibodies (e.g., cm-T (company Boeringer), IDEC-CE9.1.RTM. (IDEC and SKB), a monoclonal antibody 4162W94, ortolan and OKTcdr4a (company Janssen-Cilag)), anti-CD3 antibodies (e.g., nuvion (firm Product Design Labs), OKT3 (Johnson & Johnson) or Rituxan (IDEC)), anti-CD5 antibodies (e.g., anti-CD5 ricin-linked immunoconjugate), anti-CD7 antibodies (e.g., CHH-380 (firm Novartis)), anti-CD8 antibodies, anti-CD40 ligand monoclonal antibodies (e.g., IDEC-131 (IDEC)), anti-CD52 antibodies (e.g., product, CAMPATH 1H (Ilex)), anti-CD2 antibodies (e.g., MEDI-507 (MedImmune, Inc., WO 02/098370 and WO 02/069904), anti-CD11a antibodies (e.g., xanelim (firm Genentech)), and anti-B7 antibodies (e.g., IDEC-114) (IDEC)), antibodies against the cytokine receptor (e.g., antibodies to the IFN receptor, antibodies to the receptor of IL-2 (e.g., zenapax (firm Protein Design Labs)), antibodies to the receptor of IL-4, antibodies to the receptor of IL-6, antibodies to the receptor of IL-10 and antibodies to the receptor of the IL-12), antibodies to the cytokine (e.g., anti-IFN antibodies, anti-TNF-alpha antibodies, anti-IL-beta antibodies, anti-IL-6 antibodies, anti-IL-8 antibodies (e.g., amplitude-time characteristic-IL-8 (firm Abgenix)), and anti-IL-12 antibodies)), CTLA4-immunoglobulin, and LFA-3TIP (firm Biogen, WO 93/08656 and US 6162432), soluble cytokine receptors (e.g., the extracellular domain of the receptor TNF-alpha or its fragment, the extracellular domain of the receptor IL-beta or a fragment thereof, and the extracellular domain of the receptor of IL-6 or its fragment), a cytokine or fragment�options (for example, interleukin (IL)-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-112, IL-15, TNF-alpha, TNF-beta, interferon (IFN)-alpha, IFN-beta, IFN-gamma and GM-CSF) and an antibody to the cytokine (e.g., anti-IL-2 antibodies, anti-IL-4 antibody, anti-IL-6 antibodies, anti-IL-9 antibodies, anti-IL-10 antibodies, anti-IL-12 antibodies, anti-IL-15 antibodies, anti-IL antibodies, anti-TNF-alpha antibody, and anti-IFN-gamma antibodies).

Any antagonist of TNF-alpha, known to specialists in this field can be used in the compositions and methods of the present invention. Examples of antagonists of TNF-alpha, which the list is not limited, and may be administered in combination with anti-ICOS antibody of the present invention with enhanced effector function to a subject with an inflammatory disorder, are proteins, polypeptides, peptides, hybrid proteins, antibodies (e.g., human, humanized, chimeric, monoclonal, polyclonal, Fvs, ScFvs, Fab fragments, F(ab)2 fragments, and antigen-binding fragments), for example, antibodies that immunospecificity contact BACKGROUND-alpha, nucleic acid molecules (e.g., antimyeloma molecules or triple helices), organic molecules, inorganic molecules, and low molecular weight compounds that block, reduce, inhibit or neutralize a function, an action and/or� the expression of TNF-alpha. In some embodiments, the present invention is an antagonist of TNF-alpha reduces the function, activity and/or expression of TNF-alpha by at least 10%, at least 15%, at least 20%, at least 25%, by at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95% or at least 99% relative to control, for example, phosphate-saline buffer (FSB). Examples of antibodies that immunospecificity contact name-alpha include, but not limited to, infliximab (product REMICADE™, the firm Centacor), D2E7 (firm Abbott Laboratories/Knoll Pharmaceuticals Co., Mt. Olive, N. J.), CDP571 which is also referred to as the product HUMICADE™ and CDP-870 (both from the firm Celltech/Pharmacia, Slough, U.K.), and TN3-19.12 (Williams and others, Proc. Natl. Acad. Sci. USA 91, 1994, cc.2762-2766, Thorbecke, etc., Proc. Natl. Acad. Sci. USA 89, 1992, cc.7375-7379). The present invention also provides use of the antibodies, which immunospecificity FIO is associated with the alpha and are described in the following US patents in the compositions and methods of the present invention: 5136021, 5147638, 5223395, 5231024, 5334380, 5360716, 5426181, 5436154, 5610279, 5644034, 5656272, 5658746, 5698195, 5736138, 5741488, 5808029, 5919452, 5958412, 5959087, 5968741, 5994510, 6036978, 6114517 and 171787, the essence of each of which are included in the present invention by reference. Examples of soluble receptors of TNF-alpha are, but not limited to, sTNF-R1 (firm Amgen), etanercept (product ENBREL™, the firm Immunex) and its homologue from rat product RENBREL™, soluble inhibitors of TNF-alpha derived from TNFrI, TNFrII (Kohno et, Proc. Natl. Acad. Sci. USA 87, 1990, cc.8331-8335) and TNF-alpha Inh (Seckinger et al., Proc. Natl. Acad. Sci. USA 87, 1990, cc.5188-5192).

Other antagonists of TNF-alpha in the present invention include, but are not limited to, IL-10, which is known that it blocks the production of TNF-alpha via the interferon-gamma-activated macrophages (Oswald et, Proc. Natl. Acad. Sci. USA 89, 1992, cc.8676-8680), TNFR-IgG (Ashkenazi, etc., Proc. Natl. Acad. Sci. USA 88, 1991, cc.10535-10539), the product TBP-1 from rodents (firm Serono/Yeda), vaccine CytoTAb (firm Prics), antisense molecule 104838 (firm ISIS), a peptide RDP-58 (company SangStat), thalidomide (firm Celgene), CSC-801 (firm Celgene), DPC-333 (Dupont company), VX-745 (Vertex), AGIX-4207 (company AtheroGenics), ITF-2357 (company Italfarmaco), NPI-13021-31 (firm Nereus), SCIO-469 (firm Scios), TACE nicelevel (firm Immunix/AHP), CLX-120500 (firm Calyx), Tiotropium (firm Dynavax), auranofin (ridaura) (firm SmithKline Beecham Pharmaceuticals), quinacrine (Merkin a dihydrochloride), tenidap (enablex), melanin (firm Large Scale Biological) and anti -? 38 MARK agents company Uriach.

Non-restrictive examples of anti-inflammatory agents that may be administered in combination with anti-IOS antibody of the present invention with effector function to a subject with an inflammatory disorder, are non-steroidal anti-inflammatory medicines (NCPLS), steroidal anti-inflammatory drugs, beta-agonists, antiholinergicescoe agents and methylxanthines. Examples SPULS include, but not limited to, aspirin, ibuprofen, celecoxib (product CELEBREX™), diclofenac (product VOLTAREN™), etodolac (product LODINE™), fenoprofen (product NALFON™), indomethacin (product INDOCIN™), ketoralac (product TORADOL™), oxaprozin (product DAYPRO™), nabumetone (product RELAFEN™), sulindac (product CLINORIL™), tolmetin (product TOLECTIN™), rofecoxib (VIOXX product™), naproxen (ALEVE product™, product NAPROSYN™), Ketoprofen (product ACTRON™) and nabumetone (product RELAFEN™). Such SPULS function by inhibiting the enzyme cyclooxygenase (for example, COX-1 and/or COX-2). Examples of steroidal anti-inflammatory agents include, but are not limited to, glucocorticoids, dexamethasone (product DECADRON™), cortisone, hydrocortisone, prednisone (product DELTASONE™), prednisolone, triamcinolone, azulfidine and eicosanoids, for example, prostaglandins, thromboxanes and leukotrienes.

In some embodiments of the present invention to patients with osteoarthritis are administered prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function in combinations�AI with other agents or therapies applicable to the prevention, treatment, control or relief of osteoarthritis, including, but not limited to: analgesics (non-restrictive examples are, but not limited to, acetaminophen, in a dose up to 4000 mg/day, phenacetin and tramadol daily dose in the range of 200-300 mg), SPULS (non-restrictive examples are, but not limited to, aspirin, diflunisal, diclofenac, etodolac, fenamate, fenoprofen, flurbiprofen, ibuprofen, indomethacin, Ketoprofen, methyl salicylate, nabumetone, naproxen, oxaprozin, phenylbutazone, piroxicam, sulindac and tolmetin). Preferred are low-dose SPULS, for example, ibuprofen at a dose of 1200 mg/day, naproxen at a dose of 500 mg/day. The protection agent of the stomach, for example, misoprostol, famotidine or omeprazole, is preferred for use simultaneously with SPULS, deatsetilirovanie salicylates, including, but not limited to, salsalate, (Cox)-2-specific inhibitors (CSI) of cyclooxygenase, including, but not limited to, celecoxib and rofecoxib, inside or around articular injection of the drug depot glucocorticoid, intra-articular injection of hyaluronic acid, capsaicinoid ointment, extensive irrigation osteoarthritis knee for jet lavage of fibrin, pieces of cartilage and other residues, and reconstructive surgery joint replacement. Com�osili and methods of the present invention can also be used in combination with other non-pharmacological means to prevent, treatment, control and relief of osteoarthritis, including, but not limited to: reducing the load on the joint (non-restrictive examples are correction of poor posture, support for excessive lumbar lordosis, limitation of excessive stress on the damaged joint, the rejection of a long stay in a standing, kneeling and squatting), warming of the injured joint, breathing exercises and physical therapy.

In some embodiments of the present invention to patients with rheumatoid arthritis are administered a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function in combination with other agents or therapies useful in prevention, treatment, control and relief of rheumatoid arthritis, including, but not limited to: SPULS (non-limiting examples include, but are not limited to, aspirin, diflunisal, diclofenac, etodolac, fenamate, fenoprofen, flurbiprofen, ibuprofen, indomethacin, Ketoprofen, methyl salicylate, nabumetone, naproxen, oxaprozin, phenylbutazone, piroxicam, sulindac and tolmetin), analgesics (non-restrictive examples are acetaminophen, phenacetin and tramadol), CSI, including, but not limited to, celecoxib and rofecoxib, glyukokortiko�dy (preferably low-dose oral glucocorticoids, for example, <7.5 mg/d prednisone, or monthly imposing high pulse doses of glucocorticoids, or intraarticular injection of glucocorticoids), disease-modifying Antirheumatic drugs (MPLS), including, but not limited to, methotrexate (preferably typed intermittent low dose, e.g., 7.5 to 30 mg once weekly), gold compounds (e.g., gold salts), D-penicillamin, antimalarial drugs (e.g., chloroquine), and sulfasalazine, TNF-alpha neutralizing agents, including, but not limited to, etanercept and infliximab, immunosuppression and cytotoxic agents (examples include but not limited to, azathioprine, Leflunomide, cyclosporine, and cyclophosphamide) and surgery (examples include but not limited to, arthroplasty, total joint replacement, reconstructive hand surgery, open or arthroscopic synovectomy, and early excision of the synovial sheath of the tendons of the wrist). Compositions and methods of the present invention can also be used in combination with other agents for the prevention, treatment, control and relief of rheumatoid arthritis, including, but not limited to: rest, splint to reduce unwanted mobility of inflamed joints, exercises, etc�the use of various orthopedic and assistive devices and other methods of physiotherapy. Compositions and methods of the present invention can also be used in combination with some nontraditional approaches in prevention, treatment, control and relief of rheumatoid arthritis, including, but not limited to, diets (e.g., use of omega-3 fatty acids such as eicosapentaenoic acid found in certain varieties of fish oil for dietary omega-6 saturated fatty acids found in meat), vaccines, hormones and anasthesiologie drugs.

In some embodiments of the present invention to patients with chronic obstructive pulmonary disease (COPD) are administered a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function in combination with other agents and therapies that are applicable to the prevention, treatment, control and relief of COPD, including, but not limited to: a bronchodilator including but not limited to, short and long-acting beta2-adrenergic agonists (examples of short-acting beta2-adrenergicheskih agonists include, but not limited to, albuterol, pirbuterol, terbutaline and metaproterenol; examples of long-acting beta2-adrenergicheskih agonists include, but not limited to, oral�about the application of sustained-release albuterol and salmeterol inhalation use), anticholinergenic (their examples include, but are not limited to, ipratropium bromide), and theophylline and its derivatives (therapeutic range for theophylline is preferably 10-20 µg/ml), glucocorticoids, exogenous Alfat (e.g. Alfat derived from injected intravenously combined human plasma at a daily dose of 60 mg/kg), oxygen, lung transplantation, surgical removal of part of the lung, endotracheal intubation, mechanical ventilation, annual flu vaccine and the vaccination of pneumococcal 23-valent polysaccharide, physical activity and Smoking cessation.

In some embodiments of the present invention to patients with asthma are administered a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function in combination with an effective amount of one or more other agents used to treat asthma. For non-limiting examples of such agents include adrenergic stimulants (e.g., catecholamines (e.g., epinephrine, isoetharine), resorcin (e.g. metaproterenol, terbutaline and fenoterol) and saligenin (e.g. salutem)), adrenocorticoid, blackorwhite, corticosteroids (eg, reclamations, budesonide, drug, fluticasone, three�menalon, methylprednisolone, prednisolone and prednisone), other steroids, beta2-agonists (e.g., albuterol, bitolterol, fenoterol, isoetharine, metaproterenol, pirbuterol, salbutamol, terbutaline, formoterol, salmeterol and salbutamol terbutaline), anti-cholinergetic (e.g., ipratropium bromide oxitropium bromide), antagonists of IL-4 (including antibodies), antagonists of IL-5 (including antibodies), antagonists of IL-9 (including antibodies), antagonists of IL-13 (including antibodies), antagonists of IL-17 (including antibodies), ROE-inhibitor, NF-Kappa-beta inhibitor, VLA-4 inhibitor, CpG, anti-D23, selectin antagonists (TBC 1269), protease inhibitors fat cells (for example, inhibitors tryptamines (e.g., GW-45, GW-58, and genistin), inhibitors of phosphatidylinositide-3' (R) kinases (e.g., calphostin C) and other kinase inhibitors (e.g., STS) (see Temkin et, J Immunol, 169(5), 2002, cc.2662-2669, Vosseller, etc., Mol. Biol. Cell 8(5), 1997, cc.909-922, Nagai, etc., Biochem Biophys Res Commun 208(2), 1995, cc.576-581)), antagonists NW receptor (including antibodies), immunosuppression agents (e.g., methotrexate and gold salts), modulators of mast cells (e.g., cromolyn sodium (product INTAL™) and nedocromil sodium (product TILADE™)), and mucolytic agents (e.g., acetylcysteine). In some embodiments of the present invention anti-inflammatory agent is a leukotriene inhibitor (e.g., Monte�of ucast (product SINGULAIR™), zafirlukast (product ACCOLATE™), pranlukast (product ONON™), or zileuton (product ZYFLO™)).

In some embodiments of the present invention to patients with allergies lead prophylactically or therapeutically effective amount of an anti-ICOS antibody with enhanced feature of the present invention in combination with an effective amount of one or more other agents used for the treatment of allergies. For non-limiting examples of such agents include anti-mediator drugs (eg, antihistamines), corticosteroids, decongestants, sympathomimetics (eg, alpha-adrenergic and beta-dragalina medicines), TNX901 (Leung et, N Engl J Med 348(11), 2003, cc.986-993), IgE antagonists (e.g., antibodies rhuMAb-E25 omalizumab (see Finn et, J Allergy Clin Immuno 111(2), 2003, cc.278-284, Corren, etc., J Allergy Clin Immuno 111(1), 2003, cc.87-90, Busse and Neaville, Curr Opin Allergy Clin Immuno 1(1), 2001, cc.105-108, Tang and Powell, Eur J Pediatr 160(12), 2001, cc.696-704), HMK-12 and 6HD5 (see Miyajima, etc., Int Arch Allergy Immuno 128(1), 2002, cc.24-32) and a monoclonal antibody Hu-901 (see van Neerven, etc., Int Arch Allergy Immuno 124(1-3), 2001, p. 400), theophylline and its derivatives, glucocorticoids, and immunotherapies (e.g., repeated long-term administration of injections of allergen, short course desensitization, and venom immunotherapy).

Autoimmune diseases

Some of the objects of the present invention, the mode of treatment� and the dose applied to the compositions and methods of the present invention is selected, based on a number of factors, including, but not limited to, the stage of an autoimmune disease or disorder being treated. Appropriate modes of treatment may be determined by the person skilled in the art for specific stages of the autoimmune disease or disorder in a patient or group of patients. Curves dose can be obtained using standard protocols known in this field, to determine the effective amounts of the compositions of the present invention for the treatment of patients with different stages of autoimmune diseases or disorders. Usually patients with more active form of autoimmune diseases or disorders may require higher doses and/or more frequent doses of injection that can be administered over longer periods of time compared with patients with less active form of autoimmune diseases or disorders.

Anti-ICOS antibodies, compositions and methods may be used for the treatment of autoimmune diseases or disorders. The term "autoimmune disease or disorder" refers to the condition of a subject characterized by damage of cells, tissues and/or organs caused by immunologic reaction of the subject against its own cells, tissues and/or organs. The term "inflammation�positive disease" is used interchangeably with the term "inflammatory disorder" in relation to the condition of the subject, characterized by inflammation, including, but not limited to, chronic inflammation. Autoimmune disorders can be associated or not associated with inflammation. In addition, the inflammation may be caused or not caused by autoimmune disorder. Thus, certain disorders can be characterized as autoimmune and inflammatory disorders. Examples of autoimmune diseases or disorders include, but is not limited to: alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, disease Behcet, bullous pemphigoid, cardiomyopathy, religiously sprue-dermatitis, chronic fatigue syndrome and immune dysfunction, chronic inflammatory demyelinating polyneuropathy (CIDP) syndrome, Charge-Strauss, cicatricial pemphigoid, CREST syndrome, cold agglûtininovaâ disease, Crohn's disease, discoid lupus erythematosus, mixed cryoglobulinemia, diabetes, eosinophilic fasciitis, fibromyalgia-fibromyositis, glomerulonephritis, graves ' disease, Guillain-Barre syndrome, Hashimoto thyroiditis, purpura Henoch-Schonlein, idiopathic pulmonary fibrosis, idiopathic�die/autoimmune thrombocytopenic purpura (ITP), IgA neuropathy, juvenile arthritis, oral lichen planus, lupus erythematosus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, first type or mediated by the immune system diabetes mellitus, myasthenia gravis, a disorder of the type of pemphigus (e.g., vulgar pemphigus), pernicious anemia, polyarteritis nodosa, polyhedric, magazinecity syndrome, polymyalgia rheumatic, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Reynolds phenomenon, Reiter's syndrome, rheumatoid arthritis, sarcoidosis, scleroderma syndrome, Shengren syndrome, muscle stiffness, systemic lupus erythematosus (SLE), sweet syndrome, still's disease, systemic lupus erythematosus, Takayasu arteritis, transient arthritis/giant cell arteritis, ulcerative colitis, uveitis, vasculitis, for example, dermatitis herpetiformis vasculitis, vitiligo and Wegener's granulomatosis. Examples of inflammatory disorders include, but is not limited to, asthma, encephalitis, inflammatory bowel disease, chronic obstructive pulmonary disease (COPD), allergic disorders, septic shock, pulmonary fibrosis, undifferentiated spondyloarthropathy, undifferentiated arthropathy, arthritis, inflammatory osteolysis, disease TRANS�Lancet-versus-host, urticaria syndrome, Vogt-Koyanagi-Harada and chronic inflammation due to chronic viral or bacterial infection.

Treatment autoimmune disease

Anti-ICOS antibody of the present invention with enhanced effector function may be administered to a subject in need of this, for the prevention, monitoring, treatment or alleviation of an autoimmune disorder or one or more of their symptoms. The compositions of the present invention can also be administered in combination with one or more other therapies, preferably therapies, applicable to the prevention, control or treatment of autoimmune disorders (including, but not limited to, prophylactic or therapeutic agents) to a subject in need of them, for the prevention, monitoring, treatment or alleviation of an autoimmune disorder or one or more of their symptoms. In one of the embodiments of the present invention provides a method for the prevention, monitoring, treatment or alleviation of an autoimmune disorder or one or more of their symptoms, which comprises administering to a subject in need this, the dose prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function. In another embodiment of the present �of subramania is provided a method of preventing, monitoring, treatment or alleviation of an autoimmune disorder or one or more of their symptoms, comprising administering to a subject in need this, the dose prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function and dose of a prophylactically or therapeutically effective amount of one or more drugs (e.g., prophylactic or therapeutic agents), which are not antibodies or fragments of antibodies) that immunospecificity contact the ICOS polypeptide.

The present invention provides methods of control, treatment or relief of the condition at autoimmune disorder or one or more symptoms in a subject, untreatable by conventional methods intended for such an autoimmune disorder, said methods include the introduction of a specified subject a dose of a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function. The present invention also provides for methods of control, treatment or alleviation of an autoimmune disorder or one or more of their symptoms in a subject, untreatable only curative agent designated for such auto�Munich disorders, these methods, including the introduction of a specified subject a dose of a prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function and dose of a prophylactically or therapeutically effective amount of one or more drugs (e.g., prophylactic or therapeutic agents), which are not antibodies or fragments of antibodies) that immunospecificity contact the ICOS polypeptide. The present invention also presents methods of control, treatment or alleviation of an autoimmune disorder or one or more of their symptoms by injecting an anti-ICOS antibody of the present invention with enhanced effector function in combination with any other treatment for patients who have confirmed the ineffectiveness of other treatment and it no longer continues. The present invention also provides other methods of control or treatment of autoimmune disorders, it has been determined that other therapies too toxic or can prove too toxic, i.e., result in unacceptable or unbearable side effects in a subject exposed to treatment. In particular, the present invention provides other methods for the control or treatment of autoimmune disorders in which �acient rejects other therapies. In addition, the present invention provides methods of preventing relapse of autoimmune disorders in patients who were treated and had no symptoms of the disease after administration of anti-ICOS antibody of the present invention with enhanced effector function.

Examples of autoimmune disorders that can be treated by the methods of the present invention, include, but not limited to, alopecia areata, ankylosing spondylitis, antiphospholipid syndrome, autoimmune Addison's disease, autoimmune diseases of the adrenal gland, autoimmune hemolytic anemia, autoimmune hepatitis, autoimmune oophoritis and orchitis, autoimmune thrombocytopenia, disease Behcet, bullous pemphigoid, cardiomyopathy, religiously sprue-dermatitis, chronic fatigue syndrome and immune dysfunction, chronic inflammatory demyelinating polyneuropathy (CIDP) syndrome, Charge-Strauss, cicatricial pemphigoid, CREST syndrome, cold agglûtininovaâ disease, Crohn's disease, discoid lupus erythematosus, mixed cryoglobulinemia, diabetes, eosinophilic fasciitis, fibromyalgia-fibromyositis, glomerulonephritis, graves ' disease, Guillain-Barre syndrome, Hashimoto thyroiditis, purpura Henoch-Schonlein, idiopathic pulmonary fibrosis, idiopathic/autoimmune thrombocytopenic purpura (ITP), Ig neuropathy, juvenile arthritis, oral lichen planus, lupus erythematosus, Meniere's disease, mixed connective tissue disease, multiple sclerosis, first type or mediated by the immune system diabetes mellitus, myasthenia gravis, vulgar pemphigus, pernicious anemia, polyarteritis nodosa, polyhedric, magazinecity syndrome, polymyalgia rheumatic, polymyositis and dermatomyositis, primary agammaglobulinemia, primary biliary cirrhosis, psoriasis, psoriatic arthritis, Reynolds phenomenon, Reiter's syndrome, rheumatoid arthritis, sarcoidosis, scleroderma syndrome, Shengren syndrome, muscle stiffness, systemic lupus erythematosus, lupus erythematosus, sweet syndrome, still's disease, lupus erythematosus, Takayasu arteritis, transient arthritis/giant cell arteritis, ulcerative colitis, uveitis, vasculitis, for example, dermatitis herpetiformis vasculitis, vitiligo and Wegener's granulomatosis.

Autoimmune therapies and dosages, methods of administration and recommended usage are known in this field and are described, for example, in the book: "Physician's Desk Reference", 2007, 61st ed.

The treatment of autoimmune disorders

The present invention provides methods of prevention, control, treat, cure, or alleviate the condition at autoimmune disorder or one or more symptoms, said methods �fied introduction to the subject, in need of this, an anti-ICOS antibody of the present invention with enhanced effector function and one or more drugs (e.g., prophylactic or therapeutic agents), which are not antibodies or fragments of antibodies) that immunospecificity contact polypetides ICOS. Any agent or therapy, the usefulness of which are known and which are used or are currently used for the prevention, monitoring, treatment or alleviation of an autoimmune disorder or one or more of their symptoms, can be used in combination with anti-ICOS antibody of the present invention with enhanced effector function in accordance with the present invention. Examples of such agents include, but are not limited to, immunomodulatory agents, anti-inflammatory agents and antagonists of TNF-alpha. Typical examples of immunomodulatory agents, anti-inflammatory agents and antagonists of TNF-alpha, which can be used in combination with anti-ICOS antibody of the present invention with enhanced effector function, for the prevention, monitoring, treatment or alleviation of autoimmune disorders described in the present invention.

In some embodiments of the present invention to patients with multiple sclerosis enter n�fractions or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function in combination with other agents or therapies applicable to the prevention, control, treatment, or relief of the condition, in multiple sclerosis, including, but not limited to: IFN-beta1 (Betaseron) (e.g., 8.0 million international units (MIU) is administered by subcutaneous injection every other day), IFN-beta (Avonex) (for example, a 6.0 MIU is administered by intramuscular injection once a week), glatiramer acetate (Copaxone) (e.g., 20 mg is administered by subcutaneous injection daily), mitoxantrone (e.g., 12 mg/m2administered by intravenous infusion every third month), azathioprine (e.g., 2-3 mg/kg of body weight administered orally daily), methotrexate (e.g., 7.5 mg is administered orally weekly), cyclophosphamide, intravenous immunoglobulin (e.g., 0.15-0.2 g/kg body weight administered monthly for up to two years), glucocorticoids, methylprednisolone (e.g., administered every two months at high doses), 2-chloromethoxypropyl (cladribine), baclofen (e.g., 15-80 mg/day in several doses or orally in higher doses up to 240 mg/d, or intrathecally via an indwelling catheter), cyclobenzaprine hydrochloride (e.g., 5-10 mg twice a day or three times a day), clonazepam (e.g., 0.5-1.0 mg three times a day, including one dose at night), clonidine hydrochloride (e.g., 0.1-0.2 mg three times a day, including one dose before bedtime), carbamazepine (e.g., 100-1200 mg/day in the form of several increasing doses), ha�apenten (for example, 300 to 3600 mg/day), dilantin (for example, 300-400 mg/day), amitriptyline (for example, 25-150 mg/day), baclofen (for example, 10-80 mg/day), primidone (e.g., 125-250 mg twice a day or three times a day), ondansetron (for example, 4-8 mg twice a day or three times a day), isoniazid (e.g., up to 1200 mg in the form of several doses), oxybutynin (for example, 5 mg twice a day or three times a day), tolterodine (e.g., 1-2 mg twice a day), propantheline (e.g., 7.5 to 15 mg four times daily), bethanecol (e.g., 10-50 mg three times daily or four times daily), terazosin hydrochloride (e.g., 1-5 mg at bedtime), sildenafil citrate (e.g., 50-100 mg orally as needed), amantadine (for example, 100 mg twice a day), pemoline (e.g., 37.5 mg twice a day), high doses of vitamins, calcium orotate, ganciclovir, antibiotic and exchange transfusion plasma.

In some embodiments of the present invention to patients with psoriasis are administered a prophylactically or therapeutically effective amount of an anti-ICOS antibody with enhanced effector function of the present invention in combination with other agents or treatments, applicable to the prevention, treatment, control or relief of psoriasis, including, but not limited to, a cream or ointment with steroids for topical use, tar (examples are, but not limited to, esta�, pariel, ointment footer and LCD 10% in lotion Nwtraders or directly mixed with ointment triamcinolone 0,1%), occlusion, local analog of vitamin D (non-limiting example is the ointment calcitonin), UV, PUVA (psoralen plus ultraviolet A - photosensitizing agent psoralen plus long-wave radiation UV rays), methotrexate (e.g., up to 25 mg once weekly, or 25 mg as multiple doses every 12 hours for three doses once a week), a synthetic retinoid (non-limiting example is etretinate, for example, in doses of 0.5-1 mg/kg/day), immunomodulatory therapy (cyclosporine, but not only it), sulfasalazine (for example, in doses of 1 g three times a day).

In some embodiments of the present invention to patients with Crohn's disease is administered prophylactically and therapeutically effective amount of an anti-ICOS antibody with enhanced effector function of the present invention in combination with other agents or treatments, applicable to the prevention, treatment, control and alleviate the condition in Crohn's disease, including, but not limited to, protivodiabeticheskie tools (e.g., loperamide 2-4 mg up to 4 times a day, Diphenoxylate with atropine 1 tablet up to 4 times a day, tincture of opium in the amount of 8-15 drops up to 4 times a day, cholestyramine in the amount of 2-4 g or colestipol 5 g 1 or 2 times a day), anticonvulsant agents (eg, propantheline 15 mg, dicyclomine in an amount of 10-20 mg, or hyoscyamine in the amount of 0.125 mg before meals), the agents are 5-aminosalicylic acid (e.g., sulfasalazine, in an amount of 1.5-2 g twice a day, mesalamine (product ASACOL™) and its slowly released form (product PENTASA™), especially in high doses, for example, the product PENTASA™ 1 g four times a day and the product ASACOL™ 0.8-1.2 g four times daily), corticosteroids, immunomodulatory drugs (e.g., azathioprine (1-2 mg/kg), mercaptopurine (50-100 mg), cyclosporine and methotrexate), antibiotics, TNF inhibitors (e.g., inflixmab (product REMICADE™)), immunosuppressive agents (e.g., tacrolimus, mycophenolate mofetil, and thalidomide), anti-inflammatory cytokines (e.g., IL-10 and IL-11), nutritional therapies, enteral therapy with elemental diets (e.g., vivonex within 4 weeks) and total parenteral nutrition.

In some embodiments of the present invention to patients with lupus erythematosus are administered prophylactically or therapeutically effective amount of an anti-ICOS antibody of the present invention with enhanced effector function in combination with other agents or therapies that are applicable to the prevention, treatment, control and help with lupus erythematosus, including the Institute of Mineralogy limited to: antimalarial drugs (including, but not limited to, hydroxychloroquine), corticosteroids (for example, can be used with low dose, high dose or intravenous pulse therapy with high doses), immunosuppressive agents (including but not limited to, cyclophosphamide, chlorambucil, and azathioprine), cytotoxic agents (including but not limited to, methotrexate and mycophenolate mofetil), androgenic steroids (including but not limited to, danazol) and anticoagulants (including but not limited to, warfarin).

The compositions of the antibodies of the present invention or combination therapies of the present invention can be used as first, second, third, fourth, or fifth therapy to prevent, control, treat and/or alleviate an autoimmune disorder or one or more of its symptoms. The present invention also includes methods of prevention, treatment, control and/or alleviate an autoimmune disorder or one or more of its symptoms in patients exposed to treatment of other diseases or disorders. The present invention also relates to the development of methods of prevention, correction, treatment and/or alleviation of an autoimmune disorder or one or more of their symptoms in the patient before any adverse effects or resistance to treatment is different from treatment with antibodies to n�present invention. The present invention also relates to methods for the prevention, correction, treatment and/or alleviating autoimmune disorders or their symptoms in patients for whom other treatment is ineffective. The present invention also relates to methods for the prevention, correction, treatment and/or alleviating proliferative disorders or their symptoms in patients who have established that ineffective other treatments, other than antibodies, compositions or combined treatment of the present invention. Definition of immunity of the patient to treatment can be made or in vivo, or in vitro by any method known in this field to evaluate the effectiveness of treatment of autoimmune disorders using adopted in this sphere, the concept of "resistance to treatment", as used in this context. In some embodiments of the present invention a patient with an autoimmune disorder, treatment resistant, if one or more of the symptoms of autoimmune disorders was not warned, adjusted and/or lightweight. The present invention also encompasses methods of preventing, correcting, treating and/or alleviating autoimmune disorders or their symptoms in patients sensitive to side reactions associated with traditional FPIC�the means of treatment.

The present invention contemplates methods of prevention, treatment, correction and/or alleviating autoimmune disorders or one or more symptoms of their symptoms in as another option to the traditional methods of treatment. In some embodiments of the present invention, a correction or treatment in accordance with the methods of the present invention when resistance to other treatments or for those sensitive to side reactions resulting from such treatment. Patients who may have a suppressed immune system (for example, after surgery, chemotherapy, or bronchopulmonary dysplasia, congenital heart disease, cystic fibrosis, patients with acquired or congenital heart disease or in HIV-positive patients), and patients with impaired liver or kidney function, the elderly, children, newborns, premature babies, patients with neuropsychiatric disorders or patients taking psychotropic drugs, patients with epileptic seizure disorder, or patients undergoing medical treatment, which may negatively interact with conventional drugs used for the prevention, correction, treatment or alleviation of autoimmune diseases or disorders.

Methods for the treatment of auto�Munich diseases and dosage methods of administration and recommendations for use are known in this field and can be described in the literature in this area, for example, in the book: "Physician's Desk Reference", 2007, 61st ed.

Diagnosis of autoimmune diseases or disorders

Diagnosis of autoimmune diseases or disorders complicated by the fact that each type of autoimmune disease or disorder is manifest differently in different patients. The heterogeneity of symptoms is related to the fact that when you install the clinical diagnosis is usually used by a variety of factors. Usually doctors use certain signs, for example, the presence of autoantibodies, increased levels of cytokines, specific organ dysfunction, skin rash, joint swelling, pain, bone deformity and/or loss of mobility, as the primary indicators of an autoimmune disease or disorder. In this area for certain autoimmune diseases or disorders, e.g. rheumatoid arthritis and systemic lupus erythematosus diagnostic standards established. For some autoimmune diseases or disorders stage of the disease are described and are well known. In this field the methods of diagnosis of autoimmune diseases or disorders, as well as stages of disease and the scale of the activity and/or severity of a disease known in this field and can�enetica for identification of patients and groups of patients seeking treatment of autoimmune diseases or disorders using the compositions and methods of the present invention.

Clinical criteria for the diagnosis of autoimmune diseases or disorders

Diagnostic criteria for different autoimmune diseases or disorders known in this field. Historically, the diagnosis is usually based on a combination of physical symptoms. Recently molecular methods, for example, gene expression profiling, were used to develop molecular criteria of autoimmune diseases or disorders. Examples of methods of clinical diagnosis of certain autoimmune diseases or disorders are provided below. Other applicable methods may be known to specialists in this field.

In some embodiments of the present invention, patients with low levels of activity of autoimmune disease or patients at an early stage of an autoimmune disease (for diseases, stages of which are installed) can be identified for treatment using the compositions of anti-ICOS antibodies and methods. Early diagnosis of autoimmune diseases is difficult due to the fact that the symptoms are common symptoms of other diseases. In some embodiments of the present invention in the treatment of Bo�professional at an early stage or in the presence of low levels of manifestation of autoimmune disease symptoms include, at least one symptom of an autoimmune disease or disorder. In other embodiments of the present invention subjected to treatment of the patient at an early stage or at low levels of autoimmune disease has symptoms, among which there is at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14 or 15 symptoms of an autoimmune disease or disorder. Symptoms can belong to either an autoimmune disease or disorder, or their combinations. Examples of autoimmune diseases and disorders described below.

Immunotherapeutic protocols

Composition anti-ICOS antibody used in therapeutic modes/protocols are in the context of the present invention to an anti-ICOS immunotherapy" and can be "naked" antibodies, immunoconjugates and/or hybrid proteins. The compositions of the present invention can be applied as single therapeutic agent or in combination with other therapeutic agents or regimens. Anti-ICOS antibody or immunoconjugate may be administered before, concurrently or after administration of one or more therapeutic agents. Therapeutic agents that can be used in combination therapeutic regimens with the compositions of the present invention, include any compound that inhibits Il� prevents the function of cells and/or causes destruction of cells. Examples include, but are not limited to, radioactive isotopes, chemotherapeutic agents, and toxins such as toxins with enzymatic action of bacteria, fungi, plants or animals, or fragments thereof.

Therapeutic modes described in the present invention, or any desired regimen can be researched on the effectiveness of using a transgenic animal that expresses ICOS antigen human instead of native ICOS antigen. Thus, treatment with anti-ICOS antibody can be tested in animal models to determine the effectiveness before the introduction of man.

Anti-ICOS immunotherapy

In the present invention the term "anti-ICOS immunotherapy" refers to the introduction of any of the anti-ICOS antibody of the present invention in any of the treatment regimens described in the present invention. Anti-ICOS antibodies can be administered as "naked" antibodies, or immunoconjugates, or hybrid proteins. In one embodiment of the present invention, a patient with a disease or disorder mediated by T-cells, can be treated by introduction of anti-ICOS antibodies able to mediate human ADCC.

Antibody isotypes IgG1 or IgG3 human rights in some cases preferred for treatment. However, the isotypes IgG2 or IgG4 human also can be used in the event that if they have the appropriate effector function, e.g., ADCC person. Such effector function can be evaluated by measurement of the ability of investigational antibody to mediate lysis of target cells effector cells in vitro or in vivo.

In one of the embodiments of the present invention, the antibody dose used should be sufficient to depletion of circulating ICOS-expressing T cells. Successful treatment of the patient can be monitored by analysis of blood samples. Other signs of improvement in the clinical condition may be taken into account when monitoring the current.

Methods of measuring the depletion of ICOS-expressing T cells, which can be used in the compositions and methods of the present invention, are well known in this area, but are listed in the below embodiments, the list is not limited. In one embodiment of the present invention, the depletion of circulating ICOS-expressing T cells can be measured by the flow cytometry analysis, using a reagent that is different from anti-ICOS antibody that binds to ICOS-expressing T-cells, to determine the number of ICOS-expressing T cells. In another embodiment of the present invention, the depletion of ICOS-expressing T cells can be measured� immunochemical staining for identification of ICOS-expressing T cells. In some embodiments of the present invention ICOS-expressing T cells, or tissues, or serum, including ICOS-expressing T-cells isolated from the patient may be placed on glass slides for microscopy, they applied the label and carried out a study on the presence or absence. In other embodiments, the present invention is compared ICOS-expressing T-cells isolated before and after treatment to determine differences in the presence of ICOS-expressing T cells.

In embodiments of the present invention, if an anti-ICOS antibody is administered as a single therapeutic agent, represent different modes of treatment.

Some of the objects of the present invention, anti-ICOS antibody used in the compositions and methods of the present invention, is a naked antibody. In close to embodiments of the present invention is used, the dose of naked anti-ICOS antibody is at least about 0,1, 0,2, 0,3, 0,4, 0,5, 0,6, 0,7, 0,8, 0,9, 1, 1,5, 2, 2,5, 3, 3,5, 4, 4,5, 5, 5,5, 6, 6,5, 7, 7,5, 8, 8,5, 9, 9,5, 10, 10,5, 11, 11,5, 12, 12,5, 13, 13,5, 14, 14,5, 15, 15,5, 16, 16,5, 17, 17,5, 18, 18,5, 19, 19,5, 20, 20,5 mg/kg body weight of the patient. In some embodiments, the present invention is used, the dose of naked anti-ICOS antibody is at least about 1-10, 5-15, 10-20, 15-25 mg/kg of body weight of the patient. In some�x embodiments of the present invention, the dose used "naked" anti-ICOS antibody is at least about 1-20, 3-15 or 5-10 mg/kg of body weight of the patient. In other embodiments of the present invention, the dose used "naked" anti-ICOS antibody is at least about 5, 6, 7, 8, 9, or 10 mg/kg of body weight of the patient.

In some embodiments of the present invention, the dose comprises about 375 mg/m2anti-ICOS antibody, administered weekly for about 1, 2, 3, 4, 5, 6, 7 or 8 consecutive weeks. In some embodiments of the present invention, the dose is at least about 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 mg/kg of body weight of the patient and injected weekly for about 1, 2, 3, 4, 5, 6, 7 or 8 consecutive weeks.

Examples of doses of anti-ICOS antibodies described above can be entered as explained above. In one of the embodiments of the present invention, the above doses are one-time injections. In other embodiments of the present invention, the dose is administered over a period of time. In other embodiments of the present invention, the dose administered many times for some time. The time period may be calculated in days, weeks or months. Multiple dose anti-ICOS antibody may be administered at intervals suitable to achieve a useful therapeutic re�and the result is a balancing of toxic side effects. For example, when using multiple doses may be preferable to synchronize the timeframe to achieve the restoration of the number of monocytes in patients prior to re-treatment antibody. This dosing regimen can optimize the effectiveness of treatment, as the population of monocytes reflects the ADCC function in the patient.

In some embodiments of the present invention the compositions of the present invention is administered to a sick person as long as the patient responds to therapy. In other embodiments of the present invention the compositions of the present invention is administered to a sick person as long until the disease starts to progress. In close to embodiments of the present invention the compositions of the present invention is administered to a sick person as long until the disease starts to progress or not progressing in a certain period of time, after which the patient a composition of the present invention is not administered until, until the disease will not occur again or not will start to progress again. If the disease progression is stopped or revertive, the patient should not be administered compositions of the present invention as long as the patient will not have recurrence, i.e., while under-treated disease is not resurfaced or �e was progressing. If the disease occurred again or began to progress, the patient can again be treated in the same dosage that was used originally, or using other doses described above.

In some embodiments of the present invention the compositions of the present invention can be administered in the form of shock after multiple doses of lower doses (maintenance doses) over a certain period of time. In such embodiments of the present invention, the doses can be timed, and the number is chosen to maintain the depletion of ICOS-expressing T cells. In some embodiments of the present invention, a loading dose is about 10, 11, 12, 13, 14, 15, 16, 17 or 18 mg/kg of body weight of the patient, and the maintenance dose is at least about 5-10 mg/kg of body weight of the patient. In other embodiments of the present invention, the maintenance dose is administered once every 7, 10, 14 or 21 days.

Combination with chemotherapeutic agents

Anti-ICOS immunotherapy (using "naked" antibody, immunoconjugate or hybrid proteins) can be used together with other therapies, including, but not limited to, chemotherapy, radioimmunotherapy (RIT), chemotherapy and radioimmunotherapy external beam radiation (combined modality therapy, CM) or combination acting radioimmunotherapy one or in combination. In some embodiments of the present invention therapy anti-ICOS antibody of the present invention can be carried out together with the use of cyclophosphamide-hydroxydoxorubicin-oncovin (vincristine)-prednisolone. In the context of the present invention, the term "entered" means that the anti-ICOS immunotherapy may be performed before, during or after the other therapy applied.

In some embodiments of the present invention immunotherapy anti-ICOS used in conjunction with a cytotoxic radionuclide or radiotherapeutic isotope. For example, the alpha-emitting isotope, such as225AC,224Ac,211At,212Bi213Bi212Pb224Ra and223Ra. The cytotoxic radionuclide may also be a beta-emitting isotope, such as186Re,188Re,90Y131I,67Cu,177Lu,153Sm166Ho or64Cu. In addition, the cytotoxic radionuclide may emit and low-energy electrons and include the isotopes125I,123I or77Br. In other embodiments of the present invention, the isotope can be198Au,32P. In some embodiments of the present invention, the number entered is the subject of a radionuclide is from about 0,001 mcurie/kg to about 10 mcurie/kg.

� some embodiments of the present invention, the number entered is the subject of a radionuclide is from about 0.1 mcurie/kg to about 1.0 mcurie/kg. In other embodiments, implementation of the present invention, the amount administered to a subject of a radionuclide is from about 0.005 mcurie/kg to 0.1 mcurie/kg.

In some embodiments of the present invention, anti-ICOS immunotherapy is carried out in combination with a chemical toxin or chemotherapeutic agent. Chemical toxin or chemotherapeutic agent can be selected from the group consisting of enediyne, for example, calicheamicin and espiramicina, duocarmycin, methotrexate, doxorubicin, melphalan, chlorambucil, ARA-C, vindesine, mitomycin C, cisplatin, etoposide, bleomycin and 5-fluorouracil.

Appropriate chemical toxins or chemotherapeutic agents that can be used in combination therapy with anti-ICOS immunotherapy include representatives of the family of molecules enediyne, for example, calicheamicin and spiramycin. Chemical toxins can also be taken from the group consisting of duocarmycin (see, e.g., US 5703080 and US 4923990), methotrexate, doxorubicin, melphalan, chlorambucil, ARA-C, vindesine, mitomycin C, CIS-platinum, etoposide, bleomycin and 5-fluorouracil. Examples of chemotherapeutic agents include adriamycin, doxorubicin, 5-fluorouracil, citizenerased ("Ara-C"), cyclophosphamide, thiotepa, Taxotere (docetaxel), busulfan, cytoxin, Taxol, methotrexate, qi�Platin, melphalan, vinblastine, bleomycin, etoposide, ifosfamide, mitomycin C, mitoxantrone, vincristine, vinorelbine, carboplatin, teniposide, daunomycin, carminomycin, to produce remissions in childhood, dactinomycin, idamycin, espiramicina (see US 4675187), melphalan and other agents, related to the nitrogen mustard.

In other embodiments of the present invention, for example, "CVB" (1.5 g/m2cyclophosphamide, 200-400 mg/m2etoposide, and 150-200 mg/m2carmustine) can be used in the methods of combination therapy of the present invention. CVB mode is used for the treatment of non-Hodgkin's lymphoma. Patti, etc., Eur. J. Haematol. 51, 1993, p. 18. Other relevant modes combined chemotherapy known to specialists in this field. See, for example, the work of Freedman et al., "Non-Hodgkin's Lymphomas" in kN.: "CER MEDICINE", 1993, ed. by Holland and others, publ Lea & Febiger, 3rd ed., vol. 2, cc.2028-2068. Examples are chemotherapeutic regimes are the first generation to treat moderate stage non-Hodgkin's lymphoma, which include C-MORR (cyclophosphamide, vincristine, procarbazine and prednisone) and CHOP (cyclophosphamide, doxorubicin, vincristine and prednisone). Applicable chemotherapeutic regime of the second generation is an m-BACOD (methotrexate, bleomycin, doxorubicin, cyclophosphamide, vincristine, dexamethasone and leucovorin), and applicable third mode�Alenia mode is literally the-B (methotrexate, doxorubicin, cyclophosphamide, vincristine, prednisone, bleomycin and leucovorin). Additional relevant drugs are phenylbutyrate and bryostatin-1. In combination therapy, both chemotherapeutic medicinal agent and a cytokine is administered together with an antibody, immunoconjugate or hybrid protein according to the present invention. The cytokines, chemotherapeutic drugs and antibody immunoconjugate or fusion protein may be administered in any order or together.

Other toxins that may be applicable in the compositions and methods of the present invention include poisonous lectins, plant toxins, e.g., ricin, abrin, modeccin, botulinum and diphtheria toxins. Of course, combinations of the various toxins can also be bonded with one molecule of the antibody, thereby selecting different cytotoxicity. Examples of toxins suitable for use in the combined treatment of the present invention are ricin, abrin, ribonuclease, Tnkase I, staphylococcal enterotoxin-A, an antiviral protein, Phytolacca American (Phytolacca americana), gelonin, diphtheria toxin, Pseudomonas exotoxin, and Pseudomonas endotoxin. See, for example, the publication Pastan, etc., Cell 47, 1986, p. 641, Goldenberg and others, Cancer Journal for Clinicians, 44, 1994, p. 43. Can be PR�changed enzymatically active toxins and fragments thereof, including a chain of diphtheria toxin, non-binding active fragments of diphtheria toxin, a chain of exotoxin (from Pseudomonas aeruginosa), chain A of ricin, a chain And abrina, chain And modeccin, alpha sarcin, proteins Aleurites fordii, ventinove proteins, proteins from Phytolaca americana (PAPI, PAPII, and PAP-S), the inhibitor from Momordica charantia, Curtin, krotin, an inhibitor of Sapaonaria officinalis, gelonin, mitogillin, restrictocin, vanomycin, analyzin and trichothecene. See, for example, WO 93/21232.

Relevant toxins and chemotherapeutic agents described in the book: "Remington's Pharmaceutical Sciences, 1995, 19th ed., publishing house Mack Publishing Co., and in the book: "GOODMAN and GILMAN''S THE PHARMACOLOGICAL BASIS OF S", 7th ed., publishing house of MacMillan Publishing Co. Other relevant toxins and/or chemotherapeutic agents known to specialists in this field.

Anti-ICOS immunotherapy of the present invention may also be made with a prodrug-activating enzyme which converts a prodrug (e.g., pipidinny chemotherapeutic agent, see WO81/01145) to an active anti-cancer drug. See, for example, WO 88/07378 and US 4975278. The enzyme component of such combinations includes any enzyme capable of acting on a prodrug in such a way as to convert it into a more effective cytotoxic form. The term "prodrug" in the context of the present invention relates to the pre�nick or derivative form of pharmaceutically active substances that is less cytotoxic to tumor cells compared to the original prodrug is enzymatically activated or converted into the more active original form. See, for example, Wilman in the book: "Prodrugs in Cancer Chemotherapy. Biochemical Society Transactions", 1986, vol. 14, cc.375-382, 615 th Meeting Belfast, and Stella and others In kN. "Prodrugs: A Chemical Approach to Targeted Drug Delivery. Directed Drug Delivery", 1985, ed. by Borchardt and others, publ Humana Press, cc.247-267. The prodrug that may be used in combination with anti-ICOS antibodies include, but is not limited to, phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulfate-containing prodrugs, peptide-containing prodrugs, prodrug, modified by D-amino acids, glycosylated prodrugs, a-lactam-containing prodrugs, optionally substituted phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-containing prodrugs, 5-fertilizin and other 5-ferritin prodrug that can be converted into the more active cytotoxic free drug. Examples of cytotoxic drugs that can be converted into a prodrug form for use in the present invention are, but not limited to, chemotherapeutic agents described above.

In some embodiments, osushestvlenie� present invention, the introduction of the compositions and application methods of the present invention may help to avoid unwanted side effects and risks of complications, associated with chemotherapy, and delay the development of resistance to chemotherapy. In some embodiments of the present invention the treatment of the toxic agents and/or resistance to treatment by toxic agents delayed in patients administered compositions and in respect of which apply the methods of the present invention, up to about 6 months, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 years.

Combination with therapeutic antibodies

Agents anti-ICOS immunotherapy, as described in the present invention, may be administered in combination with other antibodies, including, but not limited to, anti-CD19 monoclonal antibody, anti-CD52 monoclonal antibody, anti-CD22 antibody and an anti-CD20 antibody, for example, the product RITUXAN™ (C2B8, RITUXIMAB product™, the company IDEC Pharmaceuticals). Other examples of therapeutic antibodies that can be used in combination with antibodies of the present invention or in the compositions of the present invention, include, but not limited to, the product HERCEPTIN™ (trastuzumab, firm Genentech) product MYLOTARG™ (gemtuzumab ozogamicin, firm Wyeth Pharmaceuticals), product SAMRAT™ (alemtuzumab, firm Berlex), ZEVALIN™ (ibritumomab tiuxetan, firm Biogen Idec), BEXXAR™ (it, the company GlaxoSmithK-line Corixa), ERBITUX™ (cetuximab, firm Imclone) and the product AVASTIN™ (bataticola, firm Genentech).

Combine compounds �have a quiet increase the function of monocytes or macrophages

In some embodiments, methods of the present invention a compound that enhances the function of monocytes or macrophages (e.g., at least about 25%, 50%, 75%, 85%, 90%, 95% or more), can be used together with anti-ICOS immunotherapy. Such compounds are known in this area, and these include, but are not limited to, cytokines, e.g., interleukins (e.g. IL-12), interferons (e.g., alpha or gamma interferon).

A compound that enhances the function of monocytes or macrophages, can be recycled in the same pharmaceutical composition, and antibody immunoconjugate or antigen-binding fragment. In the separate introduction of the antibody/fragment and the connection can be entered consistently (every few hours), during the General course of therapy or may be administered sequentially (i.e., first, the patient receives a course of treatment with antibody/fragment and then the course of treatment a compound that enhances the function of macrophages/monocytes, or Vice versa). In such embodiments of the present invention, the compound that promotes the function of monocytes or macrophages, is administered to the person prior to, simultaneously or after treatment with other therapeutic modes and/or compositions of the present invention. In one of the embodiments of the present Fig�communicating in a human patient blood levels of leukocytes, monocytes, neutrophils, lymphocytes and/or basophils is in the range of normal for people. Normal ranges for the blood content of human leukocytes (total) amount to approximately 3.5 to 10.5 (109/l). Normal ranges of content in human blood neutrophils constitute about 1.7-7,0 (109/l), monocytes - about 0,3-0,9 (109/l), lymphocytes - about 0,9-2,9 (109/l), basophils - about 0-0,3 (109/l), and eosinophils is about 0.05 to 0.5 (109/l). In other embodiments of the present invention in human blood contains leukocytes less than the range of normal for people, for example at least about 0,01, 0,05, 0,1, 0,2, 0,3, 0,4, 0,5, 0,6, 0,7 or 0.8 (109/l) leukocytes.

Combination with immunoregulatory agents

Anti-ICOS immunotherapy of the present invention may also be in combination with an immunoregulatory agent. The term "immunoregulatory agent" in the context of the present invention as applied to the combined treatment refers to substances that act, supressive, masking or enhancing the host immune system. Examples of immunomodulatory agents include, but are not limited to, proteinaceous agents, e.g., cytokines, peptide mimetics, and antibodies (e.g., human, humanized, chimeric, monoclonal, polyclonal, Fvs, ScFvs, Fab or F(ab)2fragments and�and epitope-binding fragments), molecules of nucleic acids (e.g., antisense molecules, nucleic acids, Rnci and trentepohlia spiral), low molecular weight agents, organic compounds and inorganic compounds. In particular, immunomodulatory agents include, but are not limited to, methotrexate, Leflunomide, cyclophosphamide, cytoxan, immuran, cyclosporine a, minocycline, azathioprine, antibiotics (e.g., FK506 (tacrolimus)), methylprednisolone (MP), corticosteroids, steroids, mycophenolate mofetil, rapamycin (sirolimus), mizoribine, desoxipeganine, brequinar, malononitrile (e.g. leflunamide), modulators of the receptor of T-cells and modulators of the receptor for the cytokine. Examples of immunosuppressants include, but not limited to, mycophenolate mofetil (product CELLCEPT™), D-penicillamin (products CUPRIMINE™, DEPEN™), methotrexate (RHEUMATREX™, TREXALL™), and hydroxychloroquine sulfate (product PLAQUENIL™).

To immunomodulatory agents can also include substances that suppress the production of cytokines, decrease or inhibit the expression of autoantigen or mask the antigens of major histocompatibility complex (GCG). Examples of such agents include 2-amino-6-aryl-5-substituted pyrimidines (see US 4665077), azathioprine (or cyclophosphamide, if there is an adverse reaction to azathioprine), bromocriptin, glutaraldehyde (which masks an�igeni GCG as described in US 4120649), anti-idiotypic antibodies against antigens GCG and fragments of GCG, cyclosporine a, steroids such as glucocorticosteroids, e.g., prednisone, methylprednisolone and dexamethasone, antagonists of cytokine or cytokine receptor, including anti-interferon-gamma, -beta or-alpha antibody, anti-tumor necrosis factor-alpha antibody, anti-tumor necrosis factor-beta antibodies, anti-interleukin-2 antibodies and receptor antibody anti-IL-2, anti-L3T4 antibodies, heterologous anti-lymphocyte globulin, pan-T antibodies, preferably anti-CD3 or anti-CD4/CD4a antibodies; soluble peptide containing a LFA-3 binding domain (WO 90/08187), streptokinase, TGF-.beta., streptodornase, RNA or DNA from the host organism, FK506, RS-61443, desoxipeganine, rapamycin receptor T-cells (US 5114721), fragments of the receptor of T cells (Offner, etc., Science 251, 1991, cc.430-432, WO 90/11294, WO 91/01133), antibodies to the receptor of T cells (EP 340109), for example, TV.

Examples of cytokines include, but is not limited to, lymphokines Monokini normal and polypeptide hormones. Among the cytokines are growth hormone, e.g., human growth hormone, N-Oh of the human growth hormone and HGH bull, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prolactin, glycoprotein hormones, for example, folliculo-stimulating hormone (FSH), the hormone of stimulation of the thyroid and lutei�serouse hormone (LH), the growth factor of hepatocytes, fibroblast growth factor, prolactin, placental lactogen, tumor necrosis factor alpha inhibitory substance Muller, gonadotropin-associated peptide mouse, inhibin, activin, vascular endothelial growth factor (vascular endothelial growth factor - VEGF), integrin, thrombopoietin (TPO), nerve growth factor (nerve growth factor - NGF), such as NGF-alpha, platelet growth factor (platelet-growth factor - PGF), transforming growth factors (transforming growth factor - (TGF), e.g., TGF-alpha and TGF-alpha, insulin-like growth factor-I and-II, erythropoietin (EPO), osteogenic factors, interferons, colony-stimulating factors (colony stimulating factor - CSF), e.g., colony stimulating factor macrophages (macrophage-CSF is M-CSF), colony stimulating growth factor granulocyte-macrophage (granulocyte-macrophage-CgP - GM-CSP) and colony-stimulating growth factor granulocyte (granulocyte-CSF - G-CSF), interleukins (IL) such as IL-1, IL-1A, IL-2, 1L-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-11, IL-12, IL-15, a tumor necrosis factor such as TNF-alpha or name-β, and other polypeptide factors including LIF and kit ligand (KL). In the context of the present invention, the term "cytokine" refers to fibers from natural sources or from a culture of recombinant cells and biologically active equivalents of sequences of natural cytokines. In some embodiments, the present izobreteny� to methods include the introduction to the subject one or more immunomodulatory agents, preferably cytokines. Preferred cytokines selected from the group consisting of interleukin-1 (IL-1), IL-2, IL-3, IL-12, IL-15, IL-18, G-CSF, GM-CSF, thrombopoietin and interferon-gamma.

In some embodiments, the implementation of the present invention, the immunomodulatory agent is a modulator of the receptor of the cytokine. Examples of modulators of a receptor of a cytokine includes, but is not limited to, soluble cytokine receptors (e.g., the extracellular domain of the receptor TNF-alpha or its fragment of the extracellular domain of the receptor IL-1 beta or its fragment and the extracellular domain of the receptor of IL-6 or its fragment), cytokines or fragments thereof (e.g., interleukin IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-15, TNF-alpha, TNF-beta, interferon (RM)-alpha, IFN-beta, IFN-gamma and GM-CSF), anti-cytokine receptor antibodies (e.g., anti-IL-2 receptor antibodies, anti-IL-4 receptor antibodies, anti-IL-6 receptor antibodies, anti-IL-10 receptor antibodies, and anti-IL-12 receptor antibodies), anti-cytokine antibodies (e.g., anti-IFN receptor antibodies, anti-TNF-alpha antibodies, anti-IL-beta antibodies, anti-IL-6 antibodies, anti-IL-9, anti-IL-17 antibody, antibodies, and anti-IL-12 antibodies). In one embodiment of the present invention, the modulator of the receptor is IL-4, IL-10 or a fragment. In another embodiment of the present subramaniyapuram cytokine receptor is an anti-IL-beta antibody, anti-IL-6 antibody, the antibody to the receptor of IL-12, anti-TNF-alpha antibody. In another embodiment of the present invention, the modulator of the cytokine receptor is the extracellular domain of the receptor FIO-alpha or its fragment. In some embodiments of the present invention the modulator of the cytokine receptor is an antagonist of TNF-alpha.

In some embodiments, the implementation of the present invention, the immunomodulatory agent is a modulator of the receptor of T cells. Examples of modulators of receptors of T-cells include, but is not limited to, antibodies to receptors of T cells (e.g. anti-C antibodies (e.g., cm-T (company Boeringer), IDEC-CE9.1 (IDEC and 8KB), a monoclonal antibody 4162W94, ortolan and OKTcdr4a (company Janssen-Cilag)), anti-CD3 antibodies, anti-CD5 antibodies (e.g., anti-CD5 ricin-linked immunoconjugate), anti-CD7 antibodies (e.g., CHH-380 (firm Novartis)), anti-CD8 antibodies, monoclonal antibodies to CD40 ligand, anti-CD52 antibodies (e.g., CAMPATH 1H (firm Ilex)), anti-CD2 monoclonal antibodies and CTLA4-immunoglobulin.

In some embodiments of the present invention, an immunomodulatory agent is an antagonist of TNF-alpha. Examples of antagonists of TNF-alpha include, but not limited to, antibodies (e.g., infliximab (product REMICADE™, the firm Centocor), D2E7 (firm Abbott Laboratories/Knoll Pharmaceuticals Co., Mt. live, New Jersey), antibody CDP571, also referred to as HUMIRA™ and CDP-870 (both antibodies from the firm Celltech/Pharmacia, Slough, U.K.), and TN3-19.12 (Williams and others, Proc. Natl. Acad. Sci. USA 91, 1994, cc.2762-2766, Thorbecke, etc., Proc. Natl. Acad. Sci. USA 89, 1992, cc.7375-7379)), soluble TNF-alpha receptors (e.g. sTNF-R1 (firm Amgen), etanercept (product ENBREL™, the firm Immunex) and its homologue from rat product RENBREL™, soluble inhibitors of TNF-alpha derived from TNFrI, TNFrII (Kohno et, Proc. Natl. Acad. Sci. USA, 87, 1990, cc.8331-8335) and TNF-alpha Inh (Seckinger et al., Proc. Natl. Acad. Sci. USA, 87, 1990, cc.5188-5192)), IL-10, TNFR-IgG (Ashkenazi, etc., Proc. Natl. Acad. Sci. USA, 88, 1991, cc.10535-10539), the product from rodents TBP-1 (firm Serono/Yeda), vaccine CytoTAb (firm Prics), antisense molecule 104838 (firm ISIS), a peptide RDP-58 (company SangStat), thalidomide (firm Celgene), CSC-801 (firm Celgene), DPC-333 (Dupont company), VX-745 (Vertex), AGIX-4207 (company AtheroGenics), ITF-2357 (company Italfarmaco), NPI-13021-31 (firm Nereus), SCIO-469 (firm Scios), TACE targeter (firm Immunix/AHP), CLX-120500 (firm Calyx), Thiazolopyrim (firm Dynavax), auranofin (product Ridaura) (firm SmithKline Beecham Pharmaceuticals), chingren (mepacrine a dihydrochloride), tenidap (firm Enablex), melanin (firm Large Scale Biological) and anti-p38 MARK agents company Uriach.

Anti-ICOS immunotherapy may also be used in conjunction with an immunoregulatory agent. This approach can be applied chimeric, a humanized anti-ICOS antibody or anti-ICOS antibody of the person. The term "immunoregulatory agent" in the context of the present invention will apply�flax to combination therapy refers to substances that that act, suppressing, masking or enhancing the host immune system. These can include substances that suppress cytokine production, reduce regulation or inhibit the expression of autoantigen, or mask the antigens GHA. Examples of such agents include 2-amino-6-aryl-5-substituted pyrimidines (see US 4665077), azathioprine (or cyclophosphamide, if azathioprine is manifested adverse reaction), bromocriptin, glutaraldehyde (which masks the antigens GCG as described in US 4120649), anti-idiotypic antibodies to antigens of GCG and fragments GCG, cyclosporine a, steroids such as glucocorticosteroids, e.g., prednisone, methylprednisolone and dexamethasone, antagonists of cytokine or cytokine receptor, including anti-interferon-γ, -β or-α antibodies, antibodies to tumor necrosis factor-α, antibodies to tumor necrosis factor-β, anti-interleukin-2 antibodies and anti-IL-2 receptor antibodies, anti-L3T4 antibodies, heterologous anti-lymphocyte globulin, pan-T antibodies, such as anti-CD3 or anti-CD4/CD4a antibodies; soluble peptide comprising a LFA-3 binding domain (WO 90/08187), streptokinase, TGF-β, streptodornase, RNA or DNA of the host, FK506, RS-61443, desoxipeganine, rapamycin, receptor T-cells (US 5114721), fragments of the receptor of T cells (Offner, etc., Science 251, 1991, cc.430-432, WO 90/11294 and WO 91/01133) and T-cell receptor antibodies (EP 340109), for example, TV. PR�actions of cytokines are, but not limited to, lymphokines, Monokini and traditional polypeptide hormones. Among the cytokines are growth hormone, e.g., human growth hormone, N-Oh of the human growth hormone and HGH bull, parathyroid hormone, thyroxine, insulin, proinsulin, relaxin, prolactin, glycoprotein hormones, for example, folliculo-stimulating hormone (FSH), the hormone of stimulation of the thyroid and luteinizing hormone (LH), growth factor hepatocyte, fibroblast growth factor, prolactin, placental lactogen, tumor necrosis factor alpha inhibitory substance Muller, gonadotropin-associated peptide mouse, inhibin, activin, vascular endothelial growth factor (vascular endothelial growth factor - VEGF), integrin, thrombopoietin (TPO), nerve growth factor (nerve growth factor - NGF), such as NGF-alpha, platelet growth factor (platelet-growth factor - PGF), transforming growth factors (transforming growth factor - TGF) such as TGF-alpha and TGF-alpha, insulin-like growth factor-I and-II, erythropoietin (EPO), osteogenic factors, interferons, colony-stimulating factors (colony stimulating factor - CSF), for example, colony stimulating factor macrophages (macrophage-CSF is M-CSF), colony stimulating growth factor granulocyte-macrophage (granulocyte-macrophage-CgP - GM-CSP) and colony-stimulating growth factor granulocyte (granulocyte-CSF - G-CSF), interleukins (IL) such as IL-1, IL-1A, IL-2, 1L-3, IL-4, IL-5, IL-6, �L-7, IL-8, IL-9, IL-11, IL-12, IL-15, a tumor necrosis factor such as TNF-alpha or TNF-β, and other polypeptide factors including LIF and kit ligand (KL). In the context of the present invention, the term "cytokine" refers to fibers from natural sources or from a culture of recombinant cells and biologically active equivalents of sequences of natural cytokines. In some embodiments of the present invention to methods include the introduction to the subject one or more immunomodulatory agents, preferably cytokines. Relevant cytokines can be selected from the group consisting of interleukin-1 (IL-1), IL-2, IL-3, IL-12, IL-15, IL-18, G-CSF, GM-CSF, thrombopoietin and interferon-gamma.

Such immunoregulatory agents administered simultaneously with anti-ICOS antibody or at another time. Preferred immunoregulatory agent may depend on many factors, including the type of disorder being treated and the medical history of the patient, but often the agent can be selected from cyclosporin a, A glucocorticosteroid (e.g. prednisone or methylprednisolone), azathioprine, bromocriptine, heterological anti-lymphocyte globulin, or a mixture thereof.

Combination with other therapeutic agents

Agents that act on the new formed vascular network of the tumor, may also p�to imeetsya together with anti-ICOS immunotherapy and include tubulin-binding agents for example, complestatin A4 (Griggs and others, Lancet Oncol. 2, 2001, p. 82), and angiostatin and endostatin (review Rosen, Oncologist 5, 2000, p. 20). Immunomodulators applicable for use in combination with anti-ICOS antibody, include, but are not limited to, α-interferon, γ-interferon and tumor necrosis factor alpha (TNF-a). In some embodiments of the present invention, therapeutic agents used in combination treatment using the compositions and methods of the present invention, are peptides.

In some embodiments of the present invention, anti-ICOS immunotherapy combined with one or more molecules calicheamicin. Antibiotics family calicheamicin able to produce double-stranded DNA breaks in subpicomolar concentrations. Structural analogues calicheamicin that can be applied include, but are not limited to, γ1I, γ2Ithat γ3IN-acetyl-γ1I, PSAG and 011 (Nnmap, etc., MCancer Research 53, 1993, cc.3336-3342, Lode, etc., Cancer Research 58, 1998, cc.2925-2928).

In some embodiments, the implementation of the present invention, the treatment regimen includes compounds that mitigate the cytotoxic effects of compositions with anti-ICOS antibody. Such compounds include analgesics (e.g., acetaminophen), bisphosphonate, antihistamines (such as chlorpheniramine maleate) and steroids (for example, d�camerason, retinoids, deltoids, betamethasone, cortisol, cortisone, prednisone, dehydrotestosterone, glucocorticoids, mineralocorticoids, estrogen, testosterone, progestins).

In some embodiments of the present invention, therapeutic agent used in combination with anti-ICOS immunotherapy, is a low molecular weight molecule (i.e., inorganic or organic compounds having a molecular weight less than about 2500 Days). For example, libraries of low molecular weight compounds can be purchased on a commercial basis to companies Specs and BioSpecs B. V. (Rijswijk, the Netherlands), Chembridge Corporation (San Diego, CA), Comgenex USA Inc. (Princeton, NJ) and Maybridge Chemicals Ltd. (Cornwall PL34 OHW, United Kingdom).

In some embodiments of the present invention, anti-ICOS immunotherapy can be performed in combination with an antibacterial agent. Examples of antibacterial agents may be proteins, polypeptides, peptides, hebridae proteins, antibodies, nucleic acid molecules, organic molecules, inorganic molecules, and low molecular weight molecules that inhibit and/or reduce bacterial infection, inhibit and/or reduce replication of the bacteria, or inhibit and/or reduce the spread of bacteria to other cells or subjects. Specific examples of antibacterial agents are but not limited to, antibiotics such as penicillin, cephalosporin, imipenem, extrenal, vancomycin, cycloserine, bacitracin, chloramphenicol, erythromycin, clindamycin, tetracycline, streptomycin, tobramycin, gentamicin, amikacin, kanamycin, neomycin, spectinomycin, trimethoprim, norfloxacin, rifampin, polymyxin, amphotericin b, nystatin, ketoconazole, isoniazid, metronidazole and pentamidine.

In some embodiments of the present invention, anti-ICOS immunotherapy can be performed in combination with antifungal agent. Specific examples of antifungal agents include, but are not limited to, drugs of the group of azoles (eg, miconazole, ketoconazole (NIZORAL product®), caspofungin acetate (product CANCIDAS®), imidazole, triazoles (e.g., fluconazole (DIFLUCAN product®) and Itraconazole (product SPORANOX®)), polien (e.g., nystatin, amphotericin b (product FUNGIZONE®), lipid complex amphotericin B (ABLC) (ABELCET product®), colloidal dispersion of amphotericin b ("ABCD") (product AMMOTEC®), liposomal amphotericin b (product AMBISONE®)), potassium iodid (KI), pyrimidine (for example, flucytosine (product ANCOBON®), and voriconazole (product VFEND®)). The introduction of antibacterial or antifungal agents may be provided in the methods of the present invention, can mitigate the effects of an infection or pileni� infectious diseases, in which the patient ICOS-expressing T cells are significantly depleted.

In some embodiments of the present invention, anti-ICOS immunotherapy may be the introduction in combination with one or more agents described above, to mitigate the toxic side effects that may accompany the introduction of the compositions of the present invention. In other embodiments of the present invention, anti-ICOS immunotherapy may be administered in combination with one or more agents that are known in this area for use to mitigate adverse effects from the introduction of antibodies, chemotherapy, toxins, or drugs.

In some embodiments of the present invention in immunotherapy anti-ICOS antibody is also administered in combination with another antibody or antibodies, and/or agent, and the additional antibody or antibodies and/or agents may be administered in any sequence regarding the introduction of antibodies according to the present invention. For example, the additional antibody or antibodies can be administered before, simultaneously and/or after the administration of anti-ICOS antibody or immunoconjugate person. Additional antibody or antibodies can be contained in the same pharmaceutical composition, the antibody according to the present invented�Yu, and/or contained in different pharmaceutical compositions. Dose and method of administration of the antibody of the present invention and the dose of the additional antibody or antibodies can be equal or different in accordance with any of the recommendations on the number of dosing and routes of administration as provided for in this application and as known in this field.

The use of anti-ICOS antibodies for the diagnosis of malignant lesions of T-cell

The present invention also provides an anti-ICOS antibodies and their compositions, which immunospecificity associated with ICOS antigen, with anti-ICOS antibody anywhereman with diagnostic or detectable agent. In some embodiments of the present invention antibodies are anti-ICOS antibodies with enhanced effector function. Such anti-ICOS antibodies can be used to monitor or predict the development or progression of malignant diseases associated with T-cells, as part of the methodology of clinical testing, for example, determining the effectiveness of a specific therapy. Such diagnosis and detection can be associated with anti-ICOS antibody, which immunospecificity binds ICOS antigen of a man with a detectable substance, examples of which include, but are list n� limited to, various enzymes, for example, but their list is not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase, prosteticescuu group, for example, but their list is not limited to, streptavidin/Biotin and avidin/Biotin, fluorescent materials, for example, but their list is not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinyl fluorescein, dansyl chloride or phycoerythrine, luminescent materials, for example, but their list is not limited to, luminol, bioluminescent materials, for example, but their list is not limited to, luciferase, luciferin, and acorin, radioactive materials, for example, but their list is not limited to, iodine (131I,125I,123I,121I,), carbon (14(C), sulfur (35S), tritium (3H), indium (115In113In112In111In), and technetium (99Tc), thallium (201Ti), gallium (68Ga67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F),153Sm177Lu,159Gd149Pm,140La,175Yb,166Ho90Y47Sc,186Re,188Re,142Pr105Rh,97EN,68Ge57Co,65Zn,85Sr,32P,153Gd169Yb,51Cr54Mn75Se113Sn and117Sn, emitting positrons metals, used�using various imaging positron emission non-radioactive ions of paramagnetic metals and molecules, radioactively labeled or conjugated to specific radioisotopes. Any detectable label that can be easily measured, can be combined with anti-ICOS antibody and can be used for the diagnosis of malignant T cells. Detectable substance may be combined or directly with the antibody, or indirectly through an intermediary (for example, a linker known in the art) using techniques known in this field. See, for example, US 4741900 by metal ions, which can be combined with antibodies for use as diagnostics according to the present invention. In some embodiments of the present invention, diagnostic kits include anti-ICOS antibody, anywhereman with diagnostic or detectable agent.

The use of anti-ICOS antibodies for monitoring of immune status

The present invention also provides an anti-ICOS antibodies and their compositions, which immunospecificity bind ICOS antigen, with anti-ICOS antibody combined with a diagnostic or detectable agent. Such anti-ICOS can be used to monitor immune reconstitution after immunosuppressive therapy or bone marrow transplantation. Taco� monitoring may be accompanied by the connection of an anti-ICOS antibody which immunospecificity binds ICOS antigen of a man with a detectable substance, exemplified by, but not limited to, various enzymes, for example, but their list is not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase, prosteticescuu group, for example, but their list is not limited to, streptavidin/Biotin and avidin/Biotin, fluorescent materials, for example, but their list is not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinyl fluorescein, dansyl chloride or phycoerythrine, luminescent materials, for example, but their list is not limited to, luminol, bioluminescent materials, for example, but their list is not limited to, luciferase, luciferin, and acorin, radioactive materials, for example, but their list is not limited to, iodine (131I,125I,123I,121I,), carbon (14C), sulfur (35S), tritium (3H), indium (115In113In112In111In), and technetium (99Tc), thallium (201Ti), gallium (68Ga67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F),153Sm177Lu,159Gd149Pm,140La,175Yb,166Ho90Y47Sc,186Re,188Re,142Pr105Rh,97EN,68Ge57Co,65/sup> Zn,85Sr,32P,153Gd169Yb,51Cr54Mn75Se113Sn and117Sn, emitting positrons metals using various positron tomography emission, non-radioactive ions of paramagnetic metals and molecules, radioactively labeled or conjugated to specific radioisotopes. Any detectable label that can be easily measured, can be combined with anti-ICOS antibody and can be used for the diagnosis of autoimmune diseases or disorders. Detectable substance may be combined or directly with the antibody, or indirectly through an intermediary (for example, a linker known in the art) using techniques known in this field. See, for example, US 4741900 by metal ions, which can be combined with antibodies for use as diagnostics according to the present invention. In some embodiments, the present invention provides diagnostic kits that include anti-ICOS antibody, anywhereman with diagnostic or detectable agent.

The use of anti-ICOS antibodies for the diagnosis of autoimmune diseases or disorders

The present invention also include anti-ICOS antibodies and their compositions, which immunospecificity contact ICOS antigen, with anti-IOS antibody connected to a diagnostic or detectable agent. In some embodiments of the present invention antibodies are anti-ICOS antibody with enhanced effector function. Such anti-ICOS antibodies can be used to monitor or predict the development or progression of autoimmune diseases or disorders as part of the methodology of clinical testing, for example, determining the effectiveness of a specific therapy. Such diagnosis and detection can be associated with anti-ICOS antibody, which immunospecificity binds ICOS antigen of a man with a detectable substance, examples of which are, but which the list is not limited to, various enzymes, for example, but their list is not limited to, horseradish peroxidase, alkaline phosphatase, beta-galactosidase, or acetylcholinesterase, prosteticescuu group, for example, but their list is not limited to, streptavidin/Biotin and avidin/Biotin, fluorescent materials, for example, but their list is not limited to, umbelliferone, fluorescein, fluorescein isothiocyanate, rhodamine, dichlorotriazinyl fluorescein, dansyl chloride or phycoerythrine, luminescent materials, for example, but their list is not limited to, luminol, bioluminescent materials, for example, but their list is not limited to, luciferase, luciferin, and acorin, radioactive materials, for example, n� their list is not limited to, iodine (131I,125I,123I,121I,), carbon (14(C), sulfur (35S), tritium (3H), indium (115In113In112In111In), and technetium (99Tc), thallium (201Ti), gallium (68Ga67Ga), palladium (103Pd), molybdenum (99Mo), xenon (133Xe), fluorine (18F),153Sm177Lu,159Gd149Pm,140La,175Yb,166Ho90Y47Sc,186Re,188Re,142Pr105Rh,97EN,68Ge57Co,65Zn,85Sr,32P,153Gd169Yb,51Cr54Mn75Se113Sn and117Sn, emitting positrons metals using various positron tomography emission, non-radioactive ions of paramagnetic metals and molecules, radioactively labeled or conjugated to specific radioisotopes. Any detectable label that can be easily measured, can be combined with anti-ICOS antibody and can be used for the diagnosis of autoimmune diseases or disorders. Detectable substance may be combined or directly with the antibody, or indirectly through an intermediary (for example, a linker known in the art) using techniques known in this field. See, for example, US 4741900 by metal ions, which can be combined with antibodies for use as diagnostics according to the present�ademu the invention. In some embodiments of the present invention, diagnostic kits include anti-ICOS antibody, anywhereman with diagnostic or detectable agent.

Sets

The present invention provides a pharmaceutical pack or kit comprising one or more containers filled compositions of the present invention for the prevention, treatment, control or facilitate mediated T-cell diseases and disorders, for example, but their list is not limited to, chronic infections, autoimmune diseases or disorders, inflammatory diseases or disorders, disease graft-versus-host (BTP), transplant rejection and proliferative disorder of T cells, or one or more of their symptoms that increase the disease or disorder that is mediated by T-cells.

The present invention provides for kits that can be used in the aforementioned ways. In one embodiment of the present invention, the kit comprises a composition of the present invention in one or more containers. In another embodiment of the present invention, the kit comprises a composition of the present invention in one or more containers and one or more other prophylactic or therapeutics�their agents, applicable to the prevention, control or treatment-mediated T-cell diseases and disorders or one or more of their symptoms that increase the disease or disorder that is mediated by T-cells, in one or more containers. The kit may optionally include instructions for the prevention, treatment, control, or alleviate mediated T-cell diseases and disorders, as well as information about side effects and dosages for the method of administration. Optionally associated with such container (containers) can be information in the form prescribed by the state Agency governing the receipt, use or sale of pharmaceutical or biological products, which information reflects the approval of a specified Agency of the receipt, application or sale for administration to humans.

Certain embodiments of the present invention

1. A dedicated anti-ICOS antibody comprising a VH domain, a VK domain and a variant Fc region, wherein the said antibody mediates increased activity of antigen-dependent cell-mediated cytotoxicity (ADCC) compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and the Fc region of the wild type.

2. The antibody according to embodiment of the present invention 1, in which the magnitude of the �S50 antibodies, measured in the analysis of ADCC in vitro, No. least approximately seven times below size EU50 original antibody.

3. The antibody according to variants of implementation of the present invention 1 or 2, wherein the variant Fc region has an increased affinity to the Fc receptor as compared with the Fc region of the wild type.

4. The antibody according to embodiment of the present invention 3, in which the Fc receptor is a human receptor FcRIIIA.

5. The antibody according to embodiment of the present invention 1, which variant Fc region comprises at least one substitution of an amino acid residue selected from the group consisting of: residue 239, 330 and 332, and the position of the amino acid residues determined in accordance with the European Convention.

6. The antibody according to embodiment of the present invention 1, which variant Fc region comprises at least one substitution of an amino acid residue selected from the group consisting of: residues S239D, A330L, and I332E, wherein the position of amino acid residues determined in accordance with the European Convention.

7. A dedicated anti-ICOS antibody comprising a VH domain, a VK domain and an engineered Fc region, wherein the antibody has complex N-glycoside-linked chains of Sugars linked to the Fc region in which fucose is not bound to N-acylglycerol reducible in the end to �ETUI sugar.

8. The antibody according to embodiment of the present invention 7, wherein the antibody mediates an increased ADCC activity compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and nekontroliruemoy Fc region.

9. The antibody according to embodiment of the present invention 8, wherein the size EU50, measured in the analysis of ADCC in vitro, at least approximately seven times below size EU50 original antibody.

10. The antibody according to one of the embodiments 1-7 of the present invention, in which the VH domain comprises the amino acid sequence of SEQ ID NO:7, and the VK domain includes the amino acid sequence of SEQ ID NO:2.

11. Nucleic acid that encodes the amino acid sequence antibodies, like any one of the embodiments of the present invention, 1-10.

12. Nucleic acid according to embodiment of the present invention 11, comprising a nucleotide sequence selected from the group consisting of sequences SEQ ID NO:28-31.

13. A vector comprising a nucleic acid according to embodiment of the present invention 11.

14. The vector according to embodiment of the present invention 13, which comprises a nucleotide sequence selected from the group consisting of sequences SEQ ID NO:28-31.

15. Vydeleny�e cells, comprising the vector according to embodiment of the present invention 13.

16. The isolated cells according to embodiment of the present invention 15, wherein the cells have lost the activity of the enzyme glycosylation.

17. Glycosylase the enzyme according to embodiment of the present invention 16, which is selected from the group consisting of FUT8 or GnTIII.

18. The isolated cells according to embodiment of the present invention 16, wherein the enzyme is selected from the group consisting of FUT8 or GnTIII, and in which the cells comprise a vector containing a nucleotide sequence selected from the group consisting of sequences SEQ ID NO:28-31.

19. The isolated cells expressing the antibody like any one of embodiments 1-10.

20. A method of producing the antibody comprising culturing the selected cells according to embodiment of the present invention 19 under conditions sufficient for the antibody and to isolate the antibody from the culture.

21. Pharmaceutical composition comprising the antibody, similar to any one of embodiments 1-10, in a pharmaceutically acceptable carrier.

22. Pharmaceutical composition according to embodiment of the present invention 21, in which the antibody belongs to the IgG1, IgG2, IgG3 or IgG4, the isotype of the person.

23. A method of treating autoimmune�diseases or disorders in humans, includes an introduction to someone else in need, a therapeutically effective amount of the antibody is similar to any one of embodiments 1-10.

24. A method according to embodiment of the present invention 23, in which the autoimmune disease or disorder is systemic lupus erythematosus or scleroderma.

25. A method for the treatment or prevention of rejection in a transplanted patient, comprising administering to a person in need, a therapeutically effective amount of the antibodies, like any one of embodiments 1-10.

26. A method for the treatment of malignancy of T cells in humans, comprising administering to a person in need, a therapeutically effective amount of the antibodies, like any one of embodiments 1-10.

27. A method of treating inflammatory diseases or disorders in humans, comprising administering to a person in need, a therapeutically effective amount of the antibody is similar to any one of embodiments 1-10.

28. A method according to embodiment of the present invention 27, in which the inflammatory disease or disorder is myositis.

29. A method according to embodiment of the present invention 28, myositis myositis is a included with Taurus� (MW), the polymyositis (PM) or dermatomyositis (DM).

30. A method for the depletion of ICOS-expressing T cells in a human patient, comprising administering to a person in need, a therapeutically effective amount of the antibody is similar to any one of embodiments 1-10.

31. A method according to embodiment of the present invention 30 in which the depletion is substantially maintained for a period of at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

32. A method according to embodiment of the present invention 30 in which at least about 95% of T cells are depleted.

33. A method according to embodiment of the present invention 30 in which ICOS-expressing T cells are T cells of memory.

34. A method according to embodiment of the present invention 30 in which ICOS-expressing T cells are circulating T-cells.

35. Method of destruction of the structure of the germinal center in secondary lymphoid organ of a Primate, comprising administering an effective amount of the antibody is similar to any one of embodiments 1-10.

36. A method according to embodiment of the present invention 35 in which the Primate is a monkey.

37. Method of depletion of b cells from germinal center W�hexadecimal lymphoid organ of a Primate, comprising administering an effective amount of the antibody is similar to any one of embodiments 1-10.

38. A method according to embodiment of the present invention 37, in which the Primate is a monkey.

39. A method according to embodiment of the present invention 37, in which the primacy of the person.

40. A method according to embodiment of the present invention 37, in which the depletion substantially persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

41. Method of exhaustion of the class of circulating switched b cells in a Primate, comprising administering an effective amount of the antibody is similar to any one of embodiments 1-10.

42. A method according to embodiment of the present invention 41, in which the Primate is a monkey.

43. A method according to embodiment of the present invention 41, in which the primacy of the person.

44. A method according to embodiment of the present invention 41, in which the depletion substantially persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

45. A method according to embodiment of the present the image�routes 41, wherein at least about 95% of the cells from the class of circulating switched b-cells are depleted.

46. A dedicated anti-ICOS antibody comprising a VH domain, a VK domain and a variant Fc region, which mediates an increased ADCC activity compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and the Fc region of the wild type, with the specified antibody is able to Deplete b cells of the germinal center of secondary lymphoid organ of a Primate.

47. The antibody according to embodiment of the present invention 46, in which the Primate is a monkey.

48. The antibody according to embodiment of the present invention 46, in which the primacy of the person.

49. The antibody according to embodiment of the present invention 46, in which the depletion substantially persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

50. A dedicated anti-ICOS antibody comprising a VH domain, a VK domain and a variant Fc region, which mediates an increased ADCC activity compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and the Fc region of the wild type, with the specified antibody can Deplete the grade of circulating switched b cells in a Primate.

51. The antibodies�of on embodiment of the present invention 50, which Primate is a monkey.

52. The antibody according to embodiment of the present invention 50 in which the primacy of the person.

53. The antibody according to embodiment of the present invention 50 in which the depletion substantially persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

54. The antibody according to embodiment of the present invention 50, which is depleted at least about 95% of the cells class switched To circulating cells.

55. A dedicated anti-ICOS antibody comprising a VH domain, a VK domain and an engineered Fc region, wherein the antibody has complex N-glycoside-linked chains of Sugars associated with engineered Fc region in which fucose is not bound with complex N-acylglycerol reducible in the end of the sugar chain, wherein the antibody mediates an increased ADCC activity compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and the Fc region which is not the result of design, moreover, the specified antibody is able to Deplete b cells of the germinal center of secondary lymphoid organ of a Primate.

56. The antibody according to embodiment of the present invention 55 in which the Primate is a monkey.

57. �ntitle according to embodiment of the present invention, 55, in which the primacy of the person.

58. The antibody according to embodiment of the present invention 55 in which the depletion substantially persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

59. A dedicated anti-ICOS antibody comprising a VH domain, a VK domain and an engineered Fc region, wherein the antibody has complex N-glycoside-linked chains of Sugars associated with engineered Fc region in which fucose is not bound to N-acylglycerol reducible in the end of the sugar chain, wherein the antibody mediates an increased ADCC activity compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and the Fc region which is not the result of design, and the said antibody able to Deplete cells class switched b cells in a Primate.

60. The antibody according to embodiment of the present invention 59, in which the primacy is not a person.

61. The antibody according to embodiment of the present invention 59, in which the primacy of the person.

62. The antibody according to embodiment of the present invention 59, in which the depletion substantially persists for at least about 1, at least about 2, at least about 3 or �of at least about 4 weeks after administration of the antibody.

63. The antibody according to embodiment of the present invention 59, which is depleted at least about 95% of the cells class switched To circulating cells.

Examples

Construction of anti-ICOS antibodies with enhanced magnitude of ADCC

In the subsequent sections describe anti-ICOS antibody with enhanced magnitude of ADCC, comprising a constant region IgHγ1 person. Anti-ICOS antibody with enhanced magnitude of ADCC may include options Fc region with enhanced effector function (see US 2007-0003546 A1, US 20060160996A9, US 2005-0054832 A1, US 2004-0132101 A1 and US 2004-0110226 A1). Anti-ICOS antibody with enhanced magnitude of ADCC may include a complex N-glycoside-linked chains of sugars linked to Asn297 of the Fc region in which fucose is not bound to N-acetylglucosamine in the end reducible (see US 6946292, US 2006-0223147 A1, US 2006-0021071 A1, US 2005-0272916 A1, US 2004-0259150 A1, US 2004-0132140 A1, US 2004-0110704 A1 and US 2004-0110282 A1). Anti-ICOS antibodies with enhanced magnitude of ADCC described in the examples, include the variable domains of the heavy and light chains of the JMab-136 anti-ICOS antibody described in US 6803039. Amino acid sequence of the VH and VK domains JMab anti-ICOS antibodies described in the present invention is in the form of sequences of SEQ ID NO:7 and 2, respectively. Anti-ICOS antibody comprising VH and VL domains of antibody JMab-136 and further comprising a constant region IgHγ2, denoted in the present invention "IC009�. Anti-ICOS antibody comprising domains JMab-136 VH and VL, and further comprising a constant region IgHγ1, denoted in the present invention "IC9G1". Specialists in this field it is obvious that the experimental methods described in the present invention can also be applied to any other antibodies in addition to anti-ICOS antibody, for example, described in US 6803039, but their list is not limited.

Sequence optimization

Amino acid sequence: amino acid sequence of the VK domain (SEQ ID NO:1) comprises the following motifs: a potential site of o-glycosylation at amino acid position 5 and a potential motive for deliciouse at amino acid position 92 in VK CDR3. Amino acid sequence of VH domain (SEQ ID NO:6) includes the following domains: potential site of o-glycosylation at amino acid position 17 and a potential motive in the formation of isoaspartate at amino acid position 99 in the VH CDR3. The position of the amino acids defined according to the Kabat system. Amino acid sequence of the VH domain or VK may be modified to eliminate any of these sequence motifs and thus eliminates the possibility of post-translational modification based on the modified sequence. For example, the motif of NG potential diaminononane can be eliminated by�of edenia residue N on the balance of Y, D or G. Below describe how the introduction of substitution in the amino acid sequence of an anti-ICOS antibody. The antigen-binding properties of amino acid substitution comprising an anti-ICOS antibody, can be ascertained using the methods described in the present invention.

A nucleic acid sequence: polynucleotides encoding heavy and light chain of anti-ICOS antibodies can be optimized nucleic acid sequence. The ultimate objective of the optimization process is the creation of a coding region that is transcribed and translated with the greatest possible efficiency. Optimization of the sequence achieved by combining: (i) optimization of codon usage, (ii) adapting the content of G/C, (iii) elimination of internal sites of splicing sites and early polyadenylation, (iv) the gap stable secondary structures of RNA, (v) elimination sequences are direct repeats, (vi) eliminate sequences that can form stable dcrk with transcripts of host cells, (vii) elimination of sequences that instruct the micro RNA host cells, and (viii) introducing a stabilizing RNA and from RNA translocation. Methods a detailed optimization of the sequence described in WO2004059556A2, WO2006015789A2, Bradel-Tretheway, etc., J. Virol. Methods 111, 2003, cc.145-156, Valencik, McDonald, Transgenic Res. 3,2001, cc.269-275. In another embodiment, the sequence can be optimized by a commercial provider (e.g., company GENEART Inc.).

Nucleotide sequences that encode VH, VK, heavy and light chain IC9G1, optimize the methods described in the present invention. Optimized nucleotide sequence encoding the VH, VK, heavy and light chain IC9G1, describe in the form of sequences of SEQ ID NO:28 to 31, respectively.

Gene Assembly and cloning of expression

Designs can be produced by the method of gene Assembly based on PCR, first described by Stemmer (Stemmer W. R. et al., Gene, 164, 1995, cc.49-53). This method comprises the following four stages: synthesis of oligonucleotides, gene Assembly, gene amplification and cloning. Eight specific VH gene primers and six specific gene VK primers that can be used for PCR-mediated gene Assembly, are shown in table.2. Sets of primers for variants regions VH and VK, which includes specific amino acid substitution can be obtained by modification of the nucleic acid sequence of primer encoding this amino acid residue. The primers are designed so that they overlap 15-20 nucleotides and liverwurst in the full variable region due to thermal Cycling. In the case of VH more specific about vector primer (Universal VH FW in table.2.) include in a process mediated PCR gene Assembly. External 5' and 3' primers for the VH region include unique website recognition for the restriction endonucleases XbaI and ApaI, respectively, to facilitate subsequent stages of cloning. External 5' and 3' primers for VK include a unique website recognition for the XmaI restriction endonucleases and BsiWI, respectively, which facilitates the subsequent stages of cloning. The PCR reaction products of a certain size is obtained by cleavage by restriction enzyme and be ligated in frame into the expression vector, wherein the VH region is cleaved by the restriction enzymes XbaI and ApaI, and the VK is cleaved by the restriction enzymes XmaI and BsiWI to the manufacturer's recommendations. The vector Assembly of the heavy chain comprises the three elements of control of eukaryotic transcription, operatively associated with a polynucleotide coding leader sequence MGDNDIHFAFLSTGVHS VH (SEQ ID NO:26) and the constant region IgHγ1, with these elements control transcription include early promoter of cytomegalovirus (CMV) and poly-A additional signal of the SV40 virus. The use of appropriately designed primers for Assembly of VH ensures that the polynucleotide sequence encoding the leader sequence of the VH, VH region and a constant region IgHγ1 United in the final frame with the expression vector of the heavy chain. The vector Assembly light chain comprises a eukaryotic elements to�trol of transcription, operatively associated with a polynucleotide coding leader sequence of human VKI-L12 (amino acid sequence MDMRVPAQLLGLLLLWLPGAKC (SEQ ID NO:27), Bentley, D. L. &Rabbitts, T. H., Nature 288, 1980, cc.730-733) and a constant region IgLK, with these elements control transcription include early promoter of cytomegalovirus (CMV) and poly-A additional signal of the SV40 virus. The use of appropriately designed primers for VK build ensures that the polynucleotide sequence that encodes a leader VKI-L12, VK region and a constant region IgLK United in the final frame with the expression vector light chain. The ligation product used to transform DH10B competent E. coli cells according to the manufacturer's protocols. Colonies containing the plasmid and the insert of a certain size can be identified using various methods known in the art (for example, restriction cleavage of the preparation of vector DNA, PCR amplification of vector sequences). Plasmid clones with inserts of a certain size can be sequenced using the reaction dimethoxyisoquinoline (for example, the product BigDye® Terminator v3.0 Cycle Sequencing Ready Reaction Kit, ABI). Plasmid DNA prepared from selected clones using mini and Maxi kits reagents QIAGEN, according to manufacturer's protocols.

The DNA preparations PLA�pyramid of the expression vector, encoding polypeptides anti-ICOS heavy chain and light chain, used for co-transfection of HEK293 cells. Jointly transfected HEK293 cells cultured in standard conditions. Antibody-containing conditioned environment harvested after 72 and 144 h after transfection. Secreted soluble human IgG purified from the conditioned media directly using the column volume 1 ml HiTrap protein a on the recommendations of the manufacturer (firm APBiotech, Inc., Piscataway, New Jersey). Purified human IgG (usually purity >95% judging by the results of SDS-PAGE) deleteroute against phosphate-saline buffer (FSB), ultra fast frozen and stored at -70°C.

The concentration of IgG in the purified drug is determined quantitatively using analysis of receptor-trap ELISA. Briefly, the IgG molecules are captured in the wells of 96-hole tablet using immobilized goat anti-human IgG (H+L specific antibody and is detected with HRP conjugated antibody light chain human Kappa. The analysis is calibrated using a control IgG1 monoclonal antibody with a different specificity.

Table 2
Characteristic sets of primers for the Assembly of the regions VH and VK. Specific genes nucleotides denoted by capital letters�, specific for the vector nucleotides indicated in lowercase letters. The recognition sites for restriction endonucleases used for cloning fragments of VH and VK, are underlined
Univ VH FWtatatatatctagacatatatatgggtgacaatgacatccactttgcctttctctcc (SEQ ID NO:11)
VH FW1tccactttgcctttctctccacaggtgtccactcccaggtgcagctggtgcagtctgg GGCTGAGGTGAAGAAGCCTGGGGCCTCAGTG (SEQ ID NO:12)
VH RE2CATATAGTAGCCGGTGAAGGTGTATCCAGAAGCCTTGCAGGAGA CCTTCACTGAGGCCCCAGGCTTC (SEQ ID NO:13)
VH FW3CACCGGCTACTATATGCACTGGGTGCGACAGGCCCCTGGACAAG GGCTTGAGTGGATGGGATGGATC (SEQ ID NO:14)
VH RE4CTGCCCTGAAACTTCTGTGCATAGTTTGTGCCACCACTGTGAGGG TTGATCCATCCCATCCAC (SEQ ID NO:15)
VH FW5CAGAAGTTTCAGGGCAGGGTCACCATGACCAGGGACACGTCCAT CAGCACAGCCTACATGGAGCTGAG (SEQ ID NO:16)
VH RE6GTCCTCGCACAGTAATACACGGCCGTGTCGTCGGATCTCAGCCTG CTCAGCTCCATGTAGGCTG (SEQ ID NO:17)
VH FW7GTATTACTGTGCGAGGACGTATTACTATGATAGTAGTGGTTATTA CCATGATGCTTTTGATATCTG (SEQ ID NO:18)

VH RE8tatatatagggcccttggtggaggcCTGAAGAgacggtgaccattgtcccttggccccagatatcaaaagcatc (SEO ID NO:19)
VK FW1tatatataccccggggccaaatgtGACATCCAgatgacccagtctccatcttcc GTGTCTGCATCTGTAGGAGACAGAG (SEQ ID NO:20)/td>
VK RE2GATACCAGGCTAACAACCTGCTAATACCCTGACTCGCCCGACAA GTGATGGTGACTCTGTCTCCTACAGA (SEQ ID NO:21)
VK FW3GTTAGCCTGGTATCAGCAGAAACCAGGGAAAGCCCCTAAACTCC TGATCTATGTTGCATCCAGTTTGCAAAGTG (SEQ ID NO:22)
VK RE4GTGAAATCTGTCCCAGATCCACTGCCGCTGAACCTTGATGGGAC CCCACTTTGCAAACTGGATG (SEQ ID NO:23)
VK FW5CTGGGACAGATTTCACTCTCACCATCAGCAGCCTGCAGCCTGAA GATTTTGCAACTTACTATTGTCAACAG (SEQ ID NO:24)
VK RE6tatatatacgtacgTTTGATTTCCACCTTGGTcccttggccgaacgtccac GGGAAACTGTTAGCCTGTTGACAATAGTAAG (SEQ ID NO:25)

Anti-ICOS antibody with enhanced ADCC comprising variant Fc domain

The expression vector of the antibody encoding an anti-ICOS antibody with enhanced ADCC having a variant Fc domain comprising amino acid substitution S239D, A330L and I332E (which in the present invention is designated "IC9G1-3M"), may be generated using methods described in US 2004/0132101 and 2005/0054832. Briefly, the above-described expression vector, encoding the domains JMab136 VH and VL, modify, using a kit for site-directed mutagenesis (e.g., QuickChange (firm Promega)) to implement the necessary substitutions of nucleotides in the polynucleotide sequence encoding the constant region of the heavy chain, to obtain the expression vector of the antibody IC9G1-3M. The purified antibody IC9G1-3M produced by transfection TC�current HEK239F the expression vector of the antibody IC9G1-3M. Transfected cells feed on 3 and 6 days, and containing the antibody conditioned environment gather on the 9th day. The antibody is purified from conditioned medium using a column of protein a factory manufacturing (firm GE Healthcare). The antibody is eluted with column buffer with a low pH, neutralized and deleteroute against the FSB. The concentration of purified antibody count in solution by optical density at 280 nm.

Anti-ICOS antibody with zero ADCC containing variant Fc region

The expression vector of the antibody encoding an anti-ICOS antibody with reduced ADCC activity, having a Fc region comprising amino acid substitution L234F, L235E and P331S (referred to in the present invention "IC9G1-TM") receive, using the methods described in US 2004/0132101 and US 2005/0054832. Briefly, the expression vector described above antibody encoding JMab136 VH and VL domains, modify, using the set of mutagenic site-directed action (e.g., QuickChange (firm Promega)) to implement the necessary substitutions of nucleotide residues in a polynucleotide sequence encoding a constant region of the heavy chain to generate the expression vector of the antibody IC9G1-TM. The purified antibody IC9G1-TM produced by transfection of cells HEK239F vector expressing the antibody IC9G1-TM. Transfected cells feed off of 3 and 6 a day and the antibody-containing standard�ing the medium collected on day 9. The antibody is purified from a standard environment, using a column of protein a factory manufacturing (firm GE Healthcare). The antibody is eluted with column buffer with a low pH, neutralized and deleteroute against the FSB. The concentration of purified antibody count in solutions by optical density at 280 nm.

Fucosylation anti-ICOS antibody with enhanced ADCC

The antibody composition IC9G1 (denoted in the present invention "IC9G1-aFuc") comprising a plurality of antibodies having complex N-glycoside-linked chains of sugars linked to Asn297 of the Fc region in which fucose is not bound to N-acetylglucosamine in the end reducible, prepared by methods described in US 6946292. Briefly, modified by fucosyltransferase cells SSS transferout the preparation of DNA plasmid expression vector encoding heavy and light chain antibody JMab136. Transfected cells feed off of 3 and 6 a day and the antibody-containing standard medium collected on day 9. The antibody is purified from a standard environment, using a column of protein a factory manufacturing (firm GE Healthcare). The antibody is eluted with column buffer with a low pH, neutralized and deleteroute against the FSB. The concentration of purified antibody count in solutions by optical density at 280 nm.

Description of the profile of the binding of anti-ICOS antibodies with a-level for professional�th ADCC

Profile of the binding of anti-ICOS antibodies with enhanced ADCC can be described using a number of methods known to specialists in this field. Antibodies may be described using, for example, but not limited to, ELISA assays of cell-based, ELISA tests using recombinant molecule ICOS as reagent-traps, liquid cytometry, Biacore analysis.

The ability of anti-ICOS antibodies with enhanced ADCC can be assessed by analysis of binding of ICOS-based cells, using stably transfected cells expressing recombinant protein ICOS on the cell surface as a reactant trap. In US 6803039 describe the line ICOS transgenic cells SSS line and ICOS transgenic cells HPB-ALL, each of which can be used in ELISA method based on cells. Method ELISA-based cells may be accomplished using any of the techniques known to experts in this field. For example, HPB-ALL h-ICOS+ cells are cultured according to standard protocols in the medium RPMI 1640 containing L-glutamine and enriched with 10% fetal calf serum. Individual wells of round bottom 96-well plates seeded with stably transfected cells HPB-ALL hICOS in an amount of 1×105and incubated over night. Cells are washed once with ELISA buffer before incubation on ice with different amounts of anti-ICOS antibodies. Reaction with�of Azania carried out in three replicates for each study the antibody concentration. The study should include the negative control wells, which is used for izotopicheskii selected antibody with a different specificity. Additional negative control wells, planted atransferrinemia HPB-ALL cells, can be used to further demonstrate the binding specificity of an anti-ICOS antibody. After incubation with antibody, the cells HPB-ALL hICOS washed three times with 200 μl of ELISA buffer. The amount of anti-ICOS antibodies associated with the cells HPB-ALL hICOS, can be determined using goat anti-human kappa antibody, anywhereman with horseradish peroxidase, according to standard protocols. ICOS-specific antibody should give a dose-dependent ELISA signal with cells HPB-ALL hICOS, but not with the original cells HPB-ALL. Expect the ELISA signal reaches a maximum when the concentration of antibody at which the available epitopes on the cell surface are cross-linked.

Anti-ICOS antibodies can also be characterized by the method of ELISA, which use ICOS-Fc fusion protein (R&D Systems) as a reactant trap. The tests using ELISA can be performed on any one of the installed protocols, known to specialists in this field. For example, tablets for micrometrology cover hybrid protein ICOS-Fc (e.g., 100 μl of 0.25 μg/ml ICOS-Fc protein) and incubated at 4°C over night. Ka�their any remaining binding sites blocked with 4% skimmed milk in buffer PBS (blocking buffer) for 1 h at 37°C. Approximately 25-50 μl of a solution of anti-ICOS antibodies of different concentrations is added to each well and incubated for 1 h at 37°C. After washing the wells goat anti-human Kappa antibody, combined with horseradish peroxidase is used for detection of the hybrid protein ICOS-Fc, bound anti-ICOS antibody according to the manufacturer's recommendations. Detection is carried out by adding 30 μl of the substrate tetramethylbenzidine (TMB) (firm Pierce) followed by neutralization with 30 μl of 0.2 M H2SO4. The absorption is read at 450 nm. In this study, should be included as a negative control to wells combined for the isotype of the antibody of irrelevant specificity. In addition, the negative control wells without ICOS-Fc protein can also be included in the study. ICOS-specific antibody can be produced by a dose-dependent ELISA signal in the hole, covered with ICOS-Fc, but not in the holes without causing, which is the negative control. Expect the ELISA signal reaches a maximum when the concentration of the antibody, when all available epitopes are employed.

The antigen specificity of an anti-ICOS antibody with enhanced ADCC can also be characterized using the flow cytometry analysis. Highlighted cells expressing human ICOS on the cell surface (for example, stable transfectant cells SSS hICOS, activated T-lymph�ITES), incubated with fluorescently conjugated anti-ICOS antibody according to standard protocols. The negative control cells that do not exhibit ICOS on its surface, stained with the same Protocol. Immuno-stained cells are analyzed on the liquid cytometer. Cells incubated with the negative control antibody of unrelated specificity, can also be included in the present study. ICOS - expressing cells, stained with a fluorescently conjugated anti-ICOS antibody should have the average fluorescence intensity higher than that of cells not expressing ICOS, which were stained with the same antibody, or than ICOS-expressing cells stained with a negative control antibody with unrelated specificity.

Binding affinity of anti-ICOS antibodies with enhanced ADCC can also be set using the Biacore system (see US 6803039).

The antigen-binding affinity delegirovano anti-ICOS antibody

Delicioasa aspartic residues can significantly affect the chemical destruction of pharmaceutical antibodies (see Chelius, etc., Anal. Chem. 77, 2005, cc.6004-6011). Delicioasa can be particularly important if the site potential deliciouse is located in the CDR regions of the antibody. CDR3 variable domain of the light chain of the antibody JMAM36 includes NS site potential DEAT�of hydrovane position 92 on Kabat numbering. The effect of deliciouse on the antigen-binding affinity of anti-ICOS antibodies can be determined using well-known specialists in this field methods. Briefly, an anti-ICOS antibody stored in conditions that are used to improve chemical process deliciouse. For example, an anti-ICOS antibody can be stored for two weeks at 40°C in a buffer with a pH value of 8.5 or 9.5 to increase the process of deliciouse. Since Delicioasa asparagine residue alters the overall charge of the protein, the degree of deliciouse this purified sample of antibodies can be assessed using a number of analytical methods, for example, but their list is not limited to, ion exchange chromatography, isoelectrofocusing, liquid chromatography/mass spectrometry. The effect of deliciouse on ICOS-binding affinity can be established by comparing the binding properties of antibody drugs IC9G1 with high and low levels of deliciouse. The binding affinity of various drugs antibodies can be analyzed, for example, the study of cells based on the ELISA method, ELISA method using recombinant molecule ICOS as reagent-trapped using liquid cytometry, Biacore method. A significant reduction in ICOS-binding affinity of drugs IC9G1 anti-ICOS antibody in connection with deliberatorium plays an important role in the chemical�whom the destruction of antibodies. In another embodiment, the ICOS-binding effect of drugs redeliberating and delegirovano IC9G1 antibodies may be very similar, therefore, delicioasa is not an important measure in assessing the metabolic pathways of destruction of antibody. If delicioasa a problem for long-term stability IC9G1 anti-ICOS antibody, then the site of deliciouse can be eliminated from the amino acid sequence by obtaining variants with single amino acid substitutions, using the methods described above. ICOS-binding affinity of any insignificant deliciousyou option anti-ICOS antibodies can be characterized using the methods described in the present invention.

The effect of ADCC in vitro anti-ICOS antibodies with enhanced ADCC

The ADCC activity of various anti-ICOS antibodies can be determined by the study of ADCC in vitro, for example, described in US 5500362 or 5821337. Analysis of ADCC can be performed using a commercially available kit, for example, a set CytoTox 96® Non-Radioactive Cytotoxicity Assay (firm Promega), and others. Product CytoTox 96® Non-Radioactive Cytotoxicity Assay (firm Promega) is a colorimetric alternative methods of determination of cytotoxicity by the release of5lCr. Method CytoTox 96® quantitatively measures lactate dehydrogenase (LDH), a stable cytosolic enzyme that visuo�ostaetsya when lysis. Released LDH in culture supernatants is measured in 30-minute study with a coupled enzyme in the conversion of tetrazolium salt into a product of red formazan. Quantitatively determined the intensity of the color formed is proportional to the number lidirovavshy cells.

The study was conducted according to the manufacturer's instructions. Briefly, target cells are washed with buffer FSB, was resuspended in medium RPMI-5 without phenol up to a cell density of 0.4×106/ml. NK Effector cells washed once in PBS and was resuspended in medium RPMI-5 without phenol up to a cell density of 1×106/ml. Studies carried out in 96-well plates with round bottom wells. Each tablet contains experimental and control wells. Pilot holes are filled by combining 50 µl of a solution of the corresponding antibodies, 50 μl of a suspension of effector cells. Described above, the density of cells lead to the ratio of target cells to cells-effectors of 1:2.5, the original solution effector cells may, in addition to divorce or to concentrate, if you require different ratios of target cells to cells-effectors. Several different types of control wells are used to calculate: (i) spontaneous release of LDH from target cells (spontaneous target), (ii) spontaneous in�of osvobojdenie LDH from cells-effectors (spontaneous effectors), (iii) the maximum release of LDH from target cells (maximum target), and (iv) the presence of contaminants in the culture medium (background). All wells using a 96-hole tablet contains equal to the final volume. The reaction is carried out in three replicates. After you install the plates centrifuged in a mode of 120 g for 3 min to precipitate cells. The plates were incubated at 37°C in atmosphere of 5% CO2for 4 h. 45 min before the completion of incubation 15 µl supplied to the producer lyse buffer is made in the control wells for maximum release of target cells. After incubation centrifuge cups mode 120 g for 4 min, 50 µl of supernatant from each well is transferred to a new 96-well plate with flat bottom holes. 50 µl of substrate mixture (established manufacturer who supply components) contribute to plate wells and incubated at room temperature for 10-20 minutes without access of light. Make 50 µl of stop buffer from the manufacturer and measure the absorbance at a wavelength of 490 or 492 nm with a reader for tablets. The percent of cytotoxicity is (experimental - effector spontaneous - target spontaneous) / (target maximum - target spontaneous). Before the calculation of the percentage cytotoxicity of all other variables is reduced to the background level.

Potential target cells for anti-ICOS antibody-�avisimas cytotoxicity include, but not limited to, stable transfectant hICOS expressing cell lines (e.g., human ICOS expressing cell lines Cho and human ICOS expressing cell line HPB-ALL, described in US 6803039). In another embodiment, the freshly isolated cells expressing human ICOS on the surface (e.g., activated T-cells), can also be used as target cells. To the relevant cells-effectors include, but not limited to, freshly isolated natural killer cells (NK cells) and mononuclear cells of peripheral blood (PBMC). The NK cell line expressing transgenic Fc receptor (e.g. CD 16) and associated signaling polypeptide (e.g., FCεRI-γ), can also act as cell-effectors (see, e.g., WO 2006/023148).

The ADCC research is carried out in parallel using an unmodified anti-ICOS antibody (e.g., IC9G1), an anti-ICOS antibody with enhanced ADCC (e.g., IC9G1-aFuc, IC9G1-3M). Expect that antibodies with improved ADCC mediates the greater percentage lysis of target cells compared with the corresponding figure mediated unmodified antibody. Anti-ICOS antibody with reduced ADCC activity (e.g., IC9G1-TM) may also be included in the study as negative control. The specificity towards the target of the study anti-ICOS Opera�agreed ADCC can be shown, using target cells not expressing hICOS. Expect background cytotoxicity ADCC research that is carried out using target cells not expressing hICOS, similar in reactions using anti-ICOS antibody with enhanced ADCC and unmodified anti-ICOS antibody.

The protein expression of ICOS person in transgenic mice

Transgenic mice with a gene ICOS person, which can be obtained using methods known to experts in this field, or other transgenic animals expressing human ICOS, can be used for the evaluation of different therapeutic regimens, including anti-ICOS antibody, for example, variations in the concentrations of dispensing, quantity and timing. Efficiency to people of different therapeutic regimes can be anticipated, for example, the two indicators described below, i.e. the depletion of T cells in certain body fluids and/or tissues and the ability of anti-ICOS antibodies to bind T cells. Certain embodiments of the present invention is effective in transgenic mice with a gene ICOS person, can be used in the compositions and methods of the present invention for the treatment of disorders and diseases of T cells, including, but not limited to, autoimmune diseases or disorders, inflammatory diseases or disorders and PLN�qualitative lesion T cells.

To determine whether expression of ICOS person in the subpopulations of T-cells from transgenic mice (lines hICOStg), which includes the transgene ICOS human T cells can be extracted from thymus, peripheral blood, spleen, lymph nodes and rinsate abdominal cavity of these mice. Expression of human ICOS and ICOS expression of the mouse can be determined in these cells by their contact with anti-ICOS antibodies that specifically bind human ICOS (e.g., IC9G1) or mouse ICOS (mICOS) (for example, clone 15F9, firm BioLegend, CA). The binding of an antibody with the lines of subpopulations of T cells can be detected using four-color fluorescent staining in the analysis of the flow cytometry analysis. The relative expression levels of mICOS and hICOS then can be evaluated by measuring the mean intensity of fluorescence (anti-hICOS for hICOS and anti-mICOS for mICOS), respectively.

Anti-ICOS antibody mediates the depletion of T cells in vivo

Anti-ICOS antibody of the present invention that bind to the protein human ICOS, can be evaluated according to its ability to Deplete a subpopulation of T cells in the thymus, peripheral blood, spleen and lymph nodes in mice of the hICOStg in vivo. For example, each antibody can be administered to mice in amounts of 250 or 50 μg/mouse, a single dose about 10 to 50 times lower dose of 375 mg/m2that is inserted to the people. �lomenie T cells from the thymus, blood, spleen and lymph nodes in mice of the hICOStg can be determined by immunofluorescence staining method the flow cytometry analysis. The results of the application of anti-ICOS antibodies identified in the form of depletion of T-cells, can be correlated with the use of people, and antibodies with the properties of the identified antibodies can be used in the compositions and methods of the present invention for the treatment of disorders and diseases associated with T-cells, including, but not limited to, autoimmune diseases or disorders, inflammatory diseases or disorders and malignant lesions of T cells.

To determine the possible dependence of the tissue depletion of T cells from FCγR

To establish whether the introduction of anti-ICOS monoclonal antibody of the present invention to lead to depletion of T-cells, can be produced by the following studies to show the dependence on the expression of FcγR. By interbreeding mice hICOStg with mice that have lost the expression of certain FcγR receptor, can be obtained mice that Express hICOS and lost the expression of certain FcγR receptor. Such mice can be used in studies to assess the ability of anti-ICOS antibodies to Deplete T cells through metabolic pathways that include the expression of FcγR, e.g., ADCC. Thus, anti-ICOS EN�of icela, identified as a result of such studies, can be used to design anti-ICOS antibodies with enhanced effector function, using the methods described above. These antibodies in turn can be used in the compositions and methods of the present invention for the treatment of disorders and diseases associated with T-cells, including, but not limited to, autoimmune diseases or disorders, inflammatory diseases or disorders and malignant lesions of T cells.

Effector cells of the mouse Express four different classes FcγR to IgG, FcγRI (CD64) is a high affinity and FcγRII (CD32), FcγRIII (CD 16) and FcγRIV molecules with low affinity. FcγRI, FcγRIII and FcγRIV are heterooligomeric complexes, in which the corresponding ligand is connected and the circuit associated with the common γ chain (FcRγ). The expression of FcRγ chain required for Assembly of FcγR and to initiate FcγR effector functions, including phagocytosis by macrophages. Because mouse FcRγ-/-lost molecules of high affinity FcγRI (CD64) and low-affinity FcγRIII (CD16) and FcγRIV, mouse FcRγ-/-expressing hICOS, can be used to assess the role of FcγR in the depletion of T cells in the tissue after treatment with anti-ICOS antibody.

The duration of the depletion of T cells induced by anti-ICOS antibody

To evaluate the effectiveness and duration of the depletion of T cells, mice hICOStg �can be introduced by injection of a low dose (for example, 250 µg) anti-ICOS antibody, and the duration and dose-response of T cells occur as a function of time. Assume that the results will show depletion for a considerable period of time (e.g., from one week and up to six months) ICOS-expressing T cells with subsequent gradual recovery.

Therapeutic efficacy of subcutaneous administration of anti-ICOS antibody of the present invention

The research described in the present invention may be used to determine whether subcutaneous administration of anti-ICOS antibody of the present invention effectively Deplete a subpopulation of T-cells. The results of the effectiveness of different methods of drug delivery in animal models can be restated for people ways known in this field.

For example, mice hICOStg can be treated with anti-ICOS antibody of the present invention in quantities of 250 mcg subcutaneous, intraperitoneal or intravenous injection. Value is determined by the average number (± average deviation) in ml ICOS-positive T cells in the blood, thymus, spleen, lymph nodes and abdomen on the seventh day according to the flow cytometry analysis. Expect subcutaneous, intraperitoneal and intravenous administration of anti-ICOS antibody of the present invention can effe�tive to Deplete ICOS-expressing circulating and tissue T cells in vivo.

The use of anti-ICOS antibodies to reduce tumor growth in models of lymphoma in vivo

Anti-ICOS antibody of the present invention that bind to human ICOS, can be evaluated by their inherent ability to reduce tumor growth in animal models in vivo. For example, SCID mice can be injected by the injection lines ICOS-expressing cells to obtain the graft tumors (e.g., stably transfected HBP-ALL hICOS cells). Then, the mice can enter multiple doses of an anti-ICOS antibody of the present invention (e.g., 100 μg antibody/mouse 5 times). Tumor growth can be monitored using standard methods (e.g., tumor volume, body weight of the animal, paralysis). The impact of treatment with anti-ICOS antibody on tumor growth can be determined by comparing animals receiving treatment with anti-ICOS antibody or a control antibody. The results obtained with the use of anti-ICOS antibodies, assessed as able to reduce tumor growth, can be correlated with use in humans, and antibodies that can reduce the growth of tumors, can be used in the compositions and methods of the present invention for the treatment of disorders and diseases associated with T cells, including but not limited to, autoimmune diseases or disorders, inflammatory diseases or disorders and malignant�s defeat of T cells.

To determine the ability of anti-ICOS antibodies to reduce tumor growth density from ICOS, tumour cell lines with different profiles of expression of ICOS can be analyzed by the above-described methods for evaluation of tumor growth in vivo. The results can show whether the density of ICOS on the surface of tumor cells can affect tumor growth, lowering the effect of anti-ICOS antibodies. The results can be correlated with the treatment of people with varying levels of expression of ICOS. Thus, methods to investigate the presence and density ICOS described in the present invention can be used to identify patients or patient populations for which certain anti-ICOS antibody may reduce the growth of malignant T-cells and/or to determine appropriate doses.

To determine the ability of anti-ICOS antibodies to reduce tumor growth from FcγR described above, the study of tumor growth in vivo can be performed using SCID mice with compromises activity of Fcγ receptor (e.g., FcRγ-/-). Using the process of interbreeding SCID mice with mice that have lost the expression of certain FcγR, can be obtained SCID mouse, which has also lost the expression of certain FcγR (e.g., SCID, FcRγ-/-mouse). Such mice can be used in studies to assess the ability of anti-ICOS antibodies pony�AMB tumor growth through a metabolic pathway, which includes the expression of FcγR, e.g., ADCC. Based on these results, anti-ICOS antibodies with enhanced ADCC, can be constructed using the methods described above. These antibodies in turn can be used in the compositions and methods of the present invention for the treatment of T-cell disorders and diseases, including, but not limited to, autoimmune diseases or disorders, inflammatory diseases or disorders and malignant lesions of T cells.

Binding IC9G1-aFuc with receptors Fc

The constants of the equation linking IC009, IC9G1 and IC9G1-aFuc with FcγRIIIA-V158, FcγRIIIA-F158, FcγRIIA and FcγRIIB humans and macaques of graboid measured on the instrument BIAcore 3000 (Uppsala, Sweden). The measurements are carried out according to standard protocols. In short, all IgG immobilized on separate flow-through cuvettes two CM 5 sensor chip using standard chemical methods compounds of amino acids according to the manufacturer's recommendations. The levels of immobilized IgG vary from 8194 to 8725 EN. Source solutions recombinante expressed extracellular domains of all FcγR at 4000 or 16000 nm is prepared and then serially diluted to the required concentrations using the working buffer (50 mm BBS buffer containing 0.01 M HEPES, pH 7.4, 0.15 M NaCl, 3 mm EDTA and 0.005% P-20). Double injections of each concentration FcγR then stab on top POV�of Resta total IgG in the flow rate of 5 µl/min. Data binding is harvested after about 50 minutes, then at 30 injected with 5 mm HCl between injections to regenerate the IgG surfaces. Several buffer injections was also dissipate through the series of injections. One such injection buffer used separately along with the data control cells for adjusting the sets of the data. After collecting all the data binding separately determine the average data for each concentration, and then compared with the 1:1 binding isotherm, which define constants (KD) equation linking. The analysis is carried out using the BIAevaluation software. Factor KD(nm) shown in Fig.2.

IC9G1-aFuc inhibits anti-CD3/ICOSL induced proliferation of T-cells

96-well tablets for tissue culture is covered with 25 μl of protein B7h-Fc at a concentration of 2 μg/ml and 25 μl of anti-CD3 antibodies (OKT3) in a concentration of 0.2 μg/ml. Selected T cells were placed on plates with pre-applied coating in the presence of various concentrations (0.1-20 μg/ml) IC009, IC9G1 and IC9G1-aFuc antibody. The proliferation of T-cells is confirmed by measurement after 72 h of incubation the number of viable cells in each well using a luminescence method. Proliferation of T cells in uncoated wells and wells coated with either anti-CD3 antibody, or only one protein B7h-Fc, determine as to�of control.

An example of the results obtained is shown in Fig.3. T cells without stimulation or T cells after stimulation with anti-CD3 antibody or B7h-Fc separately shown very limited initial level of cell proliferation. Induction of T-cells associated with the surface anti-CD3 and B7h-Fc in the presence of 0.01 mg/ml of the antibody leads to cell proliferation, which is significantly above the initial level. Anti-CD3/B7h-Fc induced proliferation of T-cells is suppressed by all three investigated anti-ICOS antibodies (IC009, IC9G1 and IC9G1-aFuc) dose-dependent manner. In the present study, the inhibitory effect IC009, IC9G1 and IC9G1-aFuc antibody substantially identical.

IC9G1-aFuc is not inhibited anti-CD3/anti-CD28-induced proliferation of T-cells

96-well tablets for tissue culture coated anti-CD3 (OKT3) and anti-CD28 antibodies. Isolated from tonsillar T cells were placed on plates with pre-applied coating in the presence of 10 μg/ml antibody IC9G1-aFuc. The proliferation of T-cells is confirmed by measurement after 72 h of incubation the number of viable cells in each well using a luminescence method. Proliferation of T cells in uncoated wells and wells coated with either anti-CD3 antibody, or only one anti-CD28 antibody is determined as a control.

An example of the results obtained is shown in Fig.4. T cells without stimulation or T cells after stim�lation of anti-CD3 antibody or anti-CD28 antibody separately shown very limited initial level of cell proliferation. Induction of T-cells associated with the surface anti-CD3 and anti-CD28 antibodies leads to cell proliferation, significantly above baseline (αCd3+αCD28). Antibody IC9G1-aFuc (10 μg/ml) did not inhibit anti-CD3/ anti-CD28 induced T-cell proliferation (αCd3+αCD28+IC9G1-aFuc).

IC9G1-aFuc has an enhanced ADCC effect

The ADCC activity of the antibody IC9G1-aFuc set method ADCC in vitro, using a variety of ICOS expressing primary cells and cell lines. Research ADCC carried out according to standard protocols. Briefly, target cells and effector cells (e.g., transgenic NK cells expressing CD16 and associated signaling polypeptide FCεRI-γ) are sown in a certain ratio (for example, in the ratio of 2.5:1 effector cells to target cells) in the presence of antibodies IC9G1-aFuc. The plates were incubated for a predetermined time (e.g. 4 hours). Cell death is determined by measuring the release of LDH in the supernatant using a commercially available kit for detection of LDH. Mediated antibody cytotoxicity count by subtracting from the LDH levels in the wells containing antibody baseline levels of LDH from control levels without antibodies. Mediated antibody cytotoxicity is expressed as percentage of the maximum attainable cytotoxicity. The maximum value of cytoto�lichnosti proizvodi from LDH levels, measured in the wells containing chemically dosed cells (e.g., in the wells treated with Triton-X 100). The ADCC activity expressed by plotting the curve of cytotoxicity, antibody-mediated, as a function of the antibody concentration. Size EU50 correspond to the antibody concentration resulting in 50% maximal antibody-mediated cytotoxicity in a specific study.

Fig.5A shows an example of ADCC activity measurements performed using stably transfected cells HPB-ALL hICOS as target cells. Getting ICOS transgenic cell line of human HPB-ALL described in US 6803039. The ADCC analysis was carried out using CD16/FCεRI-γ transgenic NK cells as effector cells at a ratio of effector to the target. The ADCC reaction was carried out for 4 h. Set the ADCC activity of antibodies IC009, IC9G1 and IC9G1-aFuc. The effect of ADCC, antibody-mediated IC009, below the level of detection by this method. The ADCC activity of the antibody IC9G1-aFuc is significantly higher compared with the action of antibodies IC9G1. In the present study, size EU50 antibodies IC9G1-aFuc and IC9G1 be 138 648 PM and PM, respectively.

Fig.5B shows an example of measurement of the action of ADCC made using line ICOS transgenic Jurkat cells as target cells. The ADCC analysis was carried out using CD16/FCεRI-γ transgenic NK �Letki as effector cells at a ratio of effector to target of 2.5:1. The ADCC reaction was carried out for 4 h. Set the ADCC activity of antibodies IC009, IC9G1 and IC9G1-aFuc. All three antibodies show a measurable effect ADCC. The maximum percentage of the action of ADCC antibodies IC9G1-aFuc and IC9G1 higher than that of antibodies IC009. The maximum percent of the action of ADCC antibodies IC9G1-aFuc and IC9G1 almost identical. In the present study, size EU50 antibodies IC9G1-aFuc and IC9G1 is 5.7 PM and 61 PM, respectively.

Fig.7 shows an example of measurement of the action of ADCC, made from the extracted T-cells from human tonsils as target cells. The expression of ICOS in T-cells in the tonsils of a person to limit populations of CD4+CD45RO+CD45RA-CXCR5+ TFH-memory cells (Fig.6). T cells in the tonsils of a person is isolated using a commercially available kit (Miltenyi MACS human PanT cell isolation kit). The ADCC research was carried out using selected NK cells as effector cells at a ratio of effector to target 2:1, the reaction was incubated over night. Set the ADCC activity of antibodies IC009, IC9G1 and IC9G1-aFuc. The ADCC activity mediated IC009, below the level of detection. In the present study, antibodies IC9G1-aFuc and IC9G1 show a dose-dependent ADCC activity. The ADCC activity of the antibody IC9G1-aFuc is significantly higher compared with the action of antibodies IC9G1. In the present study, size EU50 antibodies IC9G1-aFuc and IC9G1 be 8.2 PM and 60.4 PM, respectively�idents.

Fig.8 shows an example of measurement of the action of ADCC, made from the extracted T cells from the spleen of macaques graboid as target cells. The expression of ICOS substantially limited to the population of CD4+CD45RA - T-memory cells in the spleen (Fig.8A). T-target cells of macaque graboid allocate using a set of firm Miltenyi for the isolation of T cells from primates (but not humans). The ADCC research was carried out using selected NK cells as effector cells at a ratio of effector to target 2:1, the reaction was incubated over night. Set the ADCC activity of antibodies IC009, IC9G1 and IC9G1-aFuc. The ADCC activity mediated IC009, below the level of detection. In the present study, antibodies IC9G1-aFuc and IC9G1 show a dose-dependent ADCC activity. The ADCC activity of the antibody IC9G1-aFuc is significantly higher compared with the action of antibodies IC9G1. In the present study, size EU50 antibodies IC9G1-aFuc and IC9G1 be 14.6 PM 236 and PM, respectively.

Fig.8 shows an example of measurement of the action of ADCC, made from the extracted T cells from mesenteric lymph nodes (BLUE) of macaque graboid as target cells. The expression of ICOS substantially limited to the population of CD4+CD45RA-activated T-cells in BLUE (Fig.9A). Isolated T-target cells from the spleen of macaques graboid using the set of firms for Miltenyi �of adelene T cells from primates (but not humans). The ADCC research was carried out using selected NK cells as effector cells at a ratio of effector to target 2:1, the reaction was incubated over night. Set the ADCC activity of antibodies IC009, IC9G1 and IC9G1-aFuc. The effect of ADCC, antibody-mediated IC009, manifested at the level of detection by this method. In this study, antibodies IC9G1-aFuc and IC9G1 exhibit dose-dependent ADCC activity. The ADCC activity of the antibody IC9G1-aFuc significantly higher ADCC activity antibody IC9G1. In this study, size EU50 antibodies IC9G1-aFuc and IC9G1 make 17,1 PM and 198 PM, respectively.

The pharmacokinetic profile IC9G1-aFuc in macaques of Griboedov

Makaka rabadam administered intravenously a single dose IC9G1-aFuc antibody at 0 day of the experiment. The scheme of experiment is shown in table.3.

Table 3
Experimental design of in vivo studies IG9G1-aFuc in the rhesus grabado.
GroupAgentDose (mg/kg)Number
1Only media05 males
2 IC9G1-aFuc0,015 males
3IC9G1-aFuc0,15 males

GroupAgentDose (mg/kg)Number
4IC9G1-aFuc15 males
5IC9G1-aFuc105 males
6IC009105 males

The pharmacokinetic profile IC9G1-aFuc analyzed by a single dose of the antibody and monitoring the concentration in serum over time. The concentration of antibody IC9G1-aFuc in serum measured by ELISA method according to standard protocols. The concentration of antibodies IC9G1-aFuc in serum as a function of time is shown in Fig.10. Systemic exposure based on estimates of the AUCLASTfor IC9G1-aFuc and Cmax increased in proportion to the dose with increasing dose, reflecting the linearity of the pharmacokinetic St.�right antibodies. Final average value of the half-life (t½ lz), which is 4.36±1.52 days, system 6.34±1.44 days and a 7.87±1.09 days, see after bolus infusion of 0.1 mg/kg, 1 mg/kg and 10 mg/kg, respectively.

In vivo depletion of T cells after a single dose of the antibody IC9G1-aFuc

Makaka rabadam administered intravenously a single dose of antibody IC9G1-aFuc. Dose antibodies are introduced to different animals, are presented in table.3. Two animals from each group were sacrificed on the 8th day after dosing. Three animals from each group were sacrificed 29 days after dosing. The level of circulating ICOS+ T cells from the spleen and mesenteric lymph node (BLUE) is subjected to monitoring for four weeks after a single dose of the antibody. ICOS+ T cells subjected to monitoring by the method of the flow cytometry analysis.

Fig.11 shows changes in the level of circulating ICOS+ T-cell memory after a single dose IC9G1-aFuc antibody. Circulating T cells denote memory CD3+CD4+CD45RA-ICOS+ cells for the purposes of this study. Absolute revealed the number of circulating T-cell memory to normalize the number of circulating T-cell memory, identified by 0 days prior to administration of the antibody. The introduction of a single dose of 0.01 mg/kg IC9G1-aFuc antibody resulted in the significant reduction in the number of circulating T-cell memory to 4 days. The introduction of a single dose of 0.1 mg/kg, 1 mg/kg or 10 mg/kg IC9G1aFuc antibodies leads to complete elimination of circulating T cell memory to 4-th day of the experiment. The restoration component of the circulating T-cell memory over time is dose-dependent.

Fig.13 is an example of the results of the depletion observed in the compartment of T cells of the mesenteric lymph node (BLUE). T-BLUE cells isolated from animals slaughtered on 8 and 29, the day of the experiment. The absolute numbers of ICOS+ Halperin T cell memory allocated out of the BLUE, determined by the method of the flow cytometry analysis. Calpernia T-memory cells denote "CD3+CD4+CD45RA-" for the purposes of this experiment. The absolute numbers of ICOS+ T cells of memory allocated from the BLUE for 8 days, show in Fig.13A. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg IC9G1-aFuc antibody leads to a significant dose-dependent depletion of ICOS+ Halperin T-memory cells from mesenteric lymph node (BLUE). Similar depletion of ICOS+ Halperin T-memory cells detected in the tonsils and lymph node in the submandibular lymph node. Fig.13B represents the percentage of the depletion of ICOS+ Halperin T-memory cells in the mesenteric lymph node on the 8th day. Percentage depletion score by normalizing the absolute numbers of ICOS+ Halperin T-memory cells, found in IC9G1-aFuc treated animals, relative to the number of cells detected in control animals, which were treated only with the carrier. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg antibody IC9G1-aFuc leads to the depletion of more than 60% and 90%, respectively, COS+ Halperin T-memory cells from mesenteric lymph nodes for 8 days.

Fig.14 is an example of the results of the depletion observed in the compartment of T cells in the spleen. T cells isolated from spleen of animals slaughtered on 8 and 29, the day of the experiment. The absolute numbers of ICOS+ Halperin T-memory cells from the spleen determined by the method of the flow cytometry analysis. Calpernia T-memory cells denote "CD3+CD4+CD45RA-" for the purposes of this experiment. The absolute numbers of ICOS+T cells of memory allocated from the BLUE on 8 and 29 days, show in Fig.14A. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg IC9G1-aFuc antibody leads to a significant dose-dependent depletion of ICOS+ Halperin T-memory cells from the spleen for 8 days. The restoration of ICOS+ T-memory cells of the spleen is dose - dependent, restoration of ICOS+ T cells at 28 days is more pronounced in animals that were administered 0.1 mg/kg IC9G1-aFuc, compared to animals that were administered 10 mg/kg IC9G1-aFuc. Fig.14B represents the percentage of the depletion of ICOS+ Halperin T-memory cells of the spleen in the mesenteric lymph node at 8 and 29 days. Percentage depletion score by normalizing the absolute numbers of ICOS+ Halperin T-memory cells, found in IC9G1-aFuc treated animals, relative to the number of cells detected in control animals, which were treated only with the carrier. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg antibody IC9G1-aFuc leads to the depletion of more than 60% of ICOS+ Halperin T cells �Amati spleen for 8 days. On the 29th day of ICOS+Halperin T cell memory compartment in the spleen of animals that were administered a dose of 0.1 mg/kg IC9G1-aFuc, begin to recover. ICOS+ helpername T-cell memory compartment in the spleen of animals, which were injected with a dose of 10 mg/kg IC9G1-aFuc, more depleted in 29 days compared to 8 days.

In vivo administering one dose IC9G1-aFuc leads to the breakdown of already formed germinal centers

Makaka rabadam administered intravenously a single dose IC9G1-aFuc antibody. Dose antibodies are introduced to different animals, describe in table.3. Two animals from each group were sacrificed on the 8th day after dosing. Three animals from each group were sacrificed on the 29th day after the dose. The configuration of the white pulp of the spleen were examined for 8 and 29 days using standard histological protocols. The number of b-cells of the mesenteric lymph nodes and germinal center of lymph node spleen measured on 8 and 29, the day by liquid cytometry.

Fig.15 is an example of structural changes in the white pulp of the spleen induced by intravenous injection single dose IC9G1-aFuc. Shown low (10x) and high (20-fold) increase in histological sections of white pulp isolated from control and dosed IC9G1-aFuc animals for 8 days (Fig.15A) and on the 29th day of the experiment (Fig.15B). The follicles of the spleen atrophy at 29 days after a single dose EN�of icela IC9G1-aFuc makaka rabadam. The morphology of the white pulp of the spleen are investigating after a single dose IC9G1-aFuc antibody. Shown are histological sections of the spleen, the selected 8 (A) and 29 days (B) after the introduction IC9G1-aFuc antibody. Introduction IC9G1-aFuc leads to severe atrophy of the follicles of the spleen on the 29th day.

Fig.12 shows the flow cytometry analysis Protocol, which is used to identify germinal center b cells. Lymphocytes isolated from lymph bodies of dead animals according to standard protocols. The selected lymphocytes stained with immunochemically with anti-CD3, anti-CD20, anti-IgM and anti CD95 or anti-S antibodies. Dead cells excluded from the analysis using 7AAD staining. Germinal center N-cells determine or as CD3-CD20+IgM-CD95+, or CD3-CD20+IgM-CD27+ cells.

Fig.13 shows an example of the impact on the compartment of the germinal center b-cells of the mesenteric lymph node, caused by the introduction of a single dose IC9G1-aFuc. Lymphocytes BLUE isolated from animals slaughtered on 8 and 29, the day of the experiment. Determine the absolute number of b cells of the germinal center by the method of the flow cytometry analysis. B cells of the germinal center is determined in the form of CD20+IgM - CD95+ cells for the purposes of this experiment. The absolute number of b cells of the germinal center, isolated from the BLUE for 8 days, is shown in Fig.13A. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg antibody IC9G1-aFuc p�igodit to a significant dose-dependent decrease in b-cell germinal center from mesenteric lymph node. The introduction of a single dose of antibody IC009 leads to a commensurate loss of b-cells of the germinal center of the BLUE for 8 days. Fig.13B represents the percentage of dissolution of germinal centers in the mesenteric lymph node on the 8th day. The percentage of decay count by normalizing the absolute number of b cells of the germinal center, was detected in animals treated IC9G1-aFuc, to the number of cells detected in the control animals treated only with the carrier. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg IC9G1-aFuc antibody leads to the collapse of more than 75% and 90%, respectively, of the germinal centers in the mesenteric lymph node on the 8th day. The introduction of a single dose of 10 mg/kg of IC009 antibodies leads to the collapse of more than 80% of germinal centers in the mesenteric lymph node on the 8th day. B cells of the germinal center in this model system are present in the BLUE before the introduction IC9G1-aFuc antibody. The loss of b-cells of the germinal center of the BLUE, therefore, is an indication that the depletion of ICOS+ T-Halpern memory cells leads to the disintegration of previously formed germinal centers.

Fig.14 shows an example of effects on the oxidation of b-cells of the germinal centers of the spleen, caused by the introduction of a single dose of antibody IC9G1-aFuc. The spleen lymphocytes isolated from animals slaughtered on 8 and 29, the day of the experiment. The absolute number of b cells germinal centers determine liquid citom�Tria. B cells of the germinal center identified as CD20+IgM - CD95+ cells for the purposes of this experiment. The absolute number of b cells of the germinal center, isolated from the spleen of 8 and 29 days, shown in Fig.14A. The introduction of a single dose of 0.1 mg/kg and 10 mg/kg antibody IC9G1-aFuc has not had a significant effect on the number of b cells in the germinal centers of the spleen for 8 days. To 29 days, however, the number of b cells in the germinal centers of the spleen was significantly reduced in animals that were administered the antibody IC9G1-aFuc, and on the contrary, significant changes in the number of b cells in the germinal centers of the spleen was not detected in animals that were administered the antibody IC009. Fig.14B represents the percentage of dissolution of the germinal centers of the spleen on 8 and 29 days. The percentage of decay of the count by the ratio of the absolute number of b cells germinal centers were detected in animals that were administered the antibody IC9G1-aFuc, with the number of cells in animals that were administered only control. The introduction of a single dose of antibody IC9G1-aFuc does not lead to a significant collapse of the germinal centers in the spleen 8 days. To 29 days; however, approximately 80% of germinal centers in the spleen was destroyed in animals, which were injected with antibody IC9G1-aFuc. No significant destruction of the germinal centers in the spleen nor 8, nor at 29 days after administration of 10 mg/kg antibody IC009. B cells germinal� centers in the spleen of this model system are present before the introduction of antibodies IC9G1-aFuc. The absence of b cells in the germinal centers of the spleen demonstrates that the depletion of ICOS+ T-Halpern memory cells leads to the destruction of previously formed germinal centers.

The expression of ICOS and ICOSL mRNA is increased in patients with inflammatory and autoimmune diseases.

ICOS is a target for treatment of systemic lupus erythematosus

The induced costimulator (Inducible costimulator is ICOS) is involved in the regulation of autoimmune and Pro-inflammatory responses and may play an important role in the pathogenesis of systemic lupus erythematosus (SLE). Was used a genomic approach to assess the expression levels of mRNA panel of cytokines and immune regulators in the damaged skin of patients with active form of SLE affecting the skin.

Profile skin damage and whole blood (CC) from a large panel of patients with SLE with skin lesions, using the platform Affymetrix® analysis of the entire genome (whole genome array - WGA). Use the TaqMan® QRT-PCR with dynamic near BioMarkTM 48.48 company Fluidigm to measure the levels of mRNA and long, and short alternative splicing forms ICOS along with a large panel of cytokines.

Happens overexpression of ICOS mRNA in damaged skin in approximately 50-60% of SLE patients studied in the present work (Fig.20). Observe positive correlations between ICOS and sverkhekspressiya mRNA ligand ICOS and between ICOS and IL-10 mRNA by sverkhekspressiya. Strong sverkhekspressiya such mRNA is not observed in unaffected peripheral tissues of patients with SLE. In addition, using the method of TaqMan QRT-PCR to determine whether short or long otherwise playeronly form to ICOS sverkhekspressiya SLE patients, and evaluate the expression of miR-101 in ICOS+ T-memory cells, purified from whole blood of SLE patients.

Two protein isoforms ICOS were identified from a database of cDNA (see Fig.16). Full length ICOS (SEQ ID NO:32) comprises 199 amino acids. This sequence contains a signal peptide, extracellular domain, transmembrane domain and cytoplasmic domain. In the cytoplasmic domain contains YMFM (residues 180-183 sequence SEQ ID NO:32) conservative motif for binding PI3K. A short form of ICOS (SEQ ID NO:33) contains 168 amino acids. The short form has a framework truncation in the cytoplasmic domain, caused by the skipping of exon 4. Truncation gives a much shorter cytoplasmic domain and loses the binding site of PI3K, which may have a functional impact on the function of ICOS.

In silico analyzes ICOS 3' UTR (residues 238-2284 sequence SEQ ID NO:34) using MiRanda revealed several alleged sites of micro-RNA targets (Fig.17). Target area one microRNA (MTR1), area of 47 p. O. containing the target sequence for miR-101, 103/107 and 338, and �ICRO-RNA target region two (MTR2), the area of 47 p. O. containing the target sequence for miR-149. Complementarity ICOS cDNA and identified molecules micro-RNA is shown in Fig.17. (Di Yu, & Carola G. Vinuesa, etc., Nature, 450, 2007, cc.299-303).

Affymetrix GeneChip and qRT-PCR profiling of SLE: profile of skin damage and whole blood (CC) from a large panel of patients with SLE with skin lesions, using the platform Affymetrix® analysis of the entire genome (whole genome array - WGA). Use the TaqMan® QRT-PCR with dynamic near BioMarkTM 48.48 company Fluidigm to measure the levels of ICOS mRNA in a large panel of cytokines.

Fig.20A shows the relative expression of ICOS and ICOSL mRNA (log2 scale) in samples of damaged skin of patients with SLE (systemic lupus erythematosus). The magnitude of the fold change is determined relative to a control sample of normal skin. Data receive dynamic range BioMarkTM 48.48 company Fluidigm. Strokes observed relative expression (fold change) for each investigated transcript (ICOS or ICOSL).

The raw value of signal intensity (log2 scale) for CD4 (Fig.20B) and CD3ε mRNA (Fig.20B) in samples of normal skin and skin of patients with SLE (systemic lupus erythematosus). Data (GC-RMA normalizeangle) get on the matrix Affymetrix Human Genome U133 Plus 2.0. Strokes observed average intensity value of the raw signal samples for normal skin ICOI patients with SLE.

Fig.21A: relative expression of CD28, CTLA4, ICOS and ICOSL mRNA (log2 scale) in patients with SLE (systemic lupus erythematosus) in whole blood samples. The magnitude of the individual fold changes determined relative to the control sample combined normal whole blood. Data receive dynamic range BioMarkTM 48.48 company Fluidigm. Strokes observed average relative expression (fold change) for each analyzed transcript (CD28, CTLA4, ICOS or ICOSL).

The raw value of signal intensity (log2 scale) for CD4 (Fig.21B) and CD3ε mRNA (Fig.21V) in samples of normal skin and skin of patients with SLE (systemic lupus erythematosus). Data (GC-RMA normalizeangle) get on the matrix Affymetrix Human Genome U133 Plus 2.0. Strokes observed average intensity value of the raw signal for samples of normal skin and skin of SLE patients.

The expression of ICOS in myositis included with calves (MW) and dermatomyositis (DM)

The induced costimulator (Inducible costimulator is ICOS), a receptor activated T cells, plays a Central role in humoral immunity. Elevated levels of ICOS are present in patients with autoimmune diseases (e.g. rheumatoid arthritis and systemic lupus), and also found that effector cytokines correlate with elevated levels of this protein. In the present invention and�use genomic techniques to study sverkhekspressiya ICOS and ICOS ligand (ICOSL) in muscle tissue, taken from patients with myositis with included cells (MW), dermatomyositis (DM) and polymyositis (PM) and present results that are consistent with the regulatory mechanism of ICOS at the expense of a murine T-cells micro-RNA, miR-101.

In the present invention, the muscle samples of patients with myositis, using the TaqMan® QRT-PCR (BioMarkTM 48.48 dynamic matrix company Fluidigm). Molecules of micro-RNA (non-coding RNA molecules expressed by T-lymphocytes and regulate gene expression) that potentially regulate ICOS, identified by two criteria: (1) their sequences complementary to the 3' UTR region ICOS and (2) they are significantly differently expressed in the opposite direction ICOS mRNA in muscles of patients MW, PM, and DM compared with the control normal muscle samples.

Regulation of ICOS mRNA in muscle samples of patients MW increased on average 40 times, in the regulation of mRNA molecules ICOSL, increased on average 3.5 times, compared with normal controls. In muscle samples of patients with DM increased regulation of ICOS mRNA in average 5 times, ICOSL mRNA does not show a significant increase in regulation compared with normal controls. Regulation of ICOS mRNA in muscle samples of patients MWT increased significantly (more than 70 times), in the regulation of mRNA molecules ICOSL in ~2-fold compared with normal controls. Sverkhekspressiya mRNA ICOS and ICOSL mRNA is not �ablaut in the whole blood from the muscles of patients with MW or DM. CD4 and CD3ε mRNA expressed sverkhekspressiya in muscle samples of patients MW, and only CD4 mRNA sverkhekspressiya in muscle samples of patients with DM. Sites ARE (AU rich region for binding protein) and the sequence complementarity between the 3' UTR domain in ICOS and miR-101 indicates that miR-101 is a potent regulator of ICOS. In the present invention subsequently assess the level of expression of miR-101, and the ability of such a micro-RNA to regulate the transcript. Regulation of expression of miR-101 was significantly reduced, on average, 4 and 2.5 times, respectively, in the muscles of patients with MW and DM compared with normal control muscles.

ICOS mRNA sverkhekspressiya in muscle tissue of patients MW, DM and PM. Strong overexpression of mRNA molecules CD4 and CD3ε means increased infiltration of CD4+ T cells in the affected location patients MW, according to the previously described. A significant decrease in expression of miR-101 in the muscles of patients with MW and DM confirms the observation made earlier in Sanroque mice.

Affymetrix GeneChip, qRT-PCR and microRNA profiling myositis: profile muscle biopsy and whole blood (CC) from the panel of patients with myositis, using the platform of the matrix of the whole genome(WGA) Affymetrix®. In addition, the profile samples of muscle from patients with myositis, using platforms and TaqMan® qRT-PCR (with dynamic near BioMarkTM 48.48 company Fluidigm), and Applied Biosystem MicroRNA TaMan Human MicroRNA Array v1.0. Molecules of Micro-RNA (non-coding RNA molecules, expressed by T-lymphocytes and regulate gene expression) that potentially regulate ICOS, identified by two criteria: (1) their sequence of complementary region, 3' UTR in ICOS, and (2) they significantly differently expressed in different directions ICOS mRNA in muscles of patients MW, PM, and DM, compared with normal control samples of muscles.

Fig.18 shows miR-101 relative expression in muscle samples of patients with myositis (MW = myositis with included cells, PM = polymyositis, DM = dermatomyositis). The individual value of the expression is determined relative to a normal control sample of the muscle. Data are obtained on the platform ABI's Human MicroRNA Array v1.0. The dashes represent the average relative expression for each subtype of the disease.

Fig.19A shows the relative expression of ICOS and ICOSL mRNA (log2 scale) in muscle samples of patients with myositis (MW = myositis with included cells, PM = polymyositis, DM = dermatomyositis). Individual multiples expression is determined relative to a normal control sample of the muscle. Data are obtained via dynamic matrix BioMarkTM 48.48 company Fluidigm. The dashes represent the average relative expression (fold change) for each subtype of the disease and the combination of transcript (ICOS or ICOSL).

the Value of the intensity of the raw signals (log2 scale) for CD4 (Fig.19B) and CD3ε (Fig.19B) mRNA in samples of normal muscle tissue and in the presence of myositis (MW = myositis with included cells, PM =polymyositis, DM = dermatomyositis). Data (normalized with GC-RMA) is produced on the matrix Human Genome U133 Plus 2.0 Array. The dashes represent the average value of the intensity of the raw signal for the norm and each subtype of the disease.

Fig.19G shows the relative expression of ICOS and ICOSL mRNA (log2 scale) in whole blood samples in myositis (MW = myositis with included cells, PM = polymyositis, DM = dermatomyositis). Individual fold change values determined relative to a control sample of normal muscle. Data were obtained on the device Fluidigm's BioMarkTM 48.48 dynamic array. Traits indicate the average relative expression levels (fold change) for the subtype of the disease and the combination of the transcripts (ICOS or ICOSL).

Specialists in this field can find out or is able to detect using standard experiments, a large number of equivalents in relation to certain variants of implementation of the present invention. Such equivalents also belong to the scope of the formula of the present invention.

In the present invention cited publication, the essence of which is included in the present invention in the form of links to their integrity. In addition, provisional applications US 60/916400 and 61/049131 included in the present invention in the form of links to their essence.

Although the above description n�standing of the invention is described in detail with illustrations and examples for the clarity of his understanding, it is obvious that certain changes and modifications may be made within the scope of the following claims.

1. A dedicated anti-ICOS antibody having a heavy chain encoded by a nucleotide sequence of SEQ ID NO:30, and comprising a VH domain which contains the amino acid sequence of SEQ ID NO:7, VK domain which contains the amino acid sequence of SEQ ID NO:2, and the Fc region IgGl, wherein the antibody has an N-glycoside-linked chains of sugars related to the field of IgG1 Fc, in which fucose is not bound to N-acylglycerol reducible in the end in the sugar chain, where the specified antibody is able to Deplete T cells from the patient, which is man.

2. The antibody according to claim 1, which mediates an increased ADCC activity compared to the level of action ADCC, mediated source antibody comprising the VH domains and VK and nekontroliruemoy region IgG1 Fc.

3. The highlighted cell to obtain the antibody according to claim 1, comprising a vector that contains a nucleic acid molecule that encodes the said antibody, where these cells lack the glycosylation enzyme selected from the group which consists of FUT8 or GnTIII.

4. A method of producing the antibody comprising culturing the selected cells of claim 3 under conditions sufficient to generate the antibody according to claim 1 and highlight the antibodies�and culture.

5. Pharmaceutical composition comprising a pharmaceutically effective amount of the antibody according to claim 1 in a pharmaceutically acceptable carrier for the treatment of autoimmune diseases or disorders.

6. A method of treating an autoimmune disease or disorder in humans, comprising administering to a person in need, a therapeutically effective amount of the antibody according to claim 1.

7. A method according to claim 6, wherein the autoimmune disease or disorder is systemic lupus erythematosus (SLE) or scleroderma.

8. Method of treating or preventing transplant rejection in humans, comprising administering to a person in need, a therapeutically effective amount of the antibody according to claim 1.

9. A method for the treatment of malignancy of T cells in humans, comprising administering to a person in need, a therapeutically effective amount of the antibody according to claim 1.

10. A method of treating inflammatory diseases or disorders in humans, comprising administering to a person in need, a therapeutically effective amount of the antibody according to claim 1.

11. A method according to claim 10, wherein the inflammatory disease or disorder is myositis.

12. A method according to claim 11, wherein the myositis is a myositis-enabled cells (MW), polymyositis (PM) or dermatomyositis (DM).

13. A method for the depletion of ICOS-stock�contribution of T cells in humans, includes an introduction to someone else in need, a therapeutically effective amount of the antibody according to claim 1.

14. A method according to claim 13, in which the depletion mainly persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

15. A method according to claim 13, wherein at least about 95% of T cells are depleted.

16. A method according to claim 13, in which ICOS-expressing T cells are T cells of memory.

17. A method according to claim 13, in which T cells expressing ICOS, are T-cells circulating in the bloodstream.

18. Method of destruction of the structure of the germinal center in secondary lymphoid organ of a Primate, comprising administering an effective amount of the antibody according to claim 1.

19. A method according to claim 18, wherein the Primate is a human.

20. Method of depletion of b-cells of the germinal center of secondary lymphoid organ of a Primate, comprising administering an effective amount of the antibody according to claim 1.

21. A method according to claim 20, in which the depletion mainly persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

22. Method of exhaustion of the class of circulating switched b cells in a Primate, comprising administering an effective amount of �ntitle according to claim 1.

23. A method according to claim 22, in which the depletion largely persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

24. A method according to claim 22, wherein at least about 95% of the cells from the class of circulating switched b-cells are depleted.

25. A dedicated anti-ICOS antibody having a heavy chain encoded by a nucleotide sequence of SEQ ID NO:30, and comprising a VH domain which contains the amino acid sequence of SEQ ID NO:7, VK domain which contains the amino acid sequence of SEQ ID NO:2, and the Fc region IgG1, wherein the antibody has an N-glycoside-linked chains of sugars associated with the IgG1 Fc in which fucose is not bound to N-acylglycerol reducible in the end of the sugar chain, wherein the antibody mediates an increased ADCC activity compared to the level of action ADCC, indirect source antibody comprising the domains VH and VK region and IgG1 Fc, which are not the result of design, moreover, the specified antibody is able to Deplete b cells of the germinal center of secondary lymphoid organ of a Primate.

26. The antibody according to claim 25, wherein the Primate is a human.

27. The antibody according to claim 25, wherein the Primate is a human.

28. The antibody according to claim 25, wherein the depletion substantially ROC�aneesa for a period of at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

29. A dedicated anti-ICOS antibody having a heavy chain encoded by a nucleotide sequence of SEQ ID NO:30, and comprising a VH domain which contains the amino acid sequence of SEQ ID NO:7, VK domain which contains the amino acid sequence of SEQ ID NO:2, and the Fc region IgG1, wherein the antibody has an N-glycoside-linked chains of sugars associated with the IgG1 Fc in which fucose is not bound to N-acylglycerol reducible in the end of the sugar chain, wherein the antibody mediates an increased ADCC activity compared to the level of action ADCC, indirect source antibody comprising the domains VH and VK region and IgG1 Fc, which are not the result of design, and the said antibody able to Deplete cells class switched b cells in a Primate.

30. The antibody according to claim 29, wherein the Primate is human.

31. The antibody according to claim 29, wherein the Primate is a human.

32. The antibody according to claim 29, wherein the depletion substantially persists for at least about 1, at least about 2, at least about 3 or at least about 4 weeks after administration of the antibody.

33. The antibody according to claim 29, wherein depleted at least about 95% of the cells class of circulating p�reclycing b-cells.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to immunology. Presented are anti-Dickkopf 1 (anti-Dkk-1) antibodies and their functional fragments specified among the antibodies: 1) containing CDR1 VH containing the amino acid sequence SSYAIS, SYAIS or GFTFSSY; CDR2 VH containing the amino acid sequence SVSGTGLGFGTYYPDSVKG or SVSGTGLGFGTY; and CDR3 VH, containing the amino acid sequence TSLENYAFDY or SLENYAFDY; and CDR1 VL containing the amino acid sequence RASESVDDFGISFIN; CDR2 VL containing the amino acid sequence AGSKQGS; and CDR3 VL containing the amino acid sequence QQLKEVPPT; and 2) the antibodies disclosed in Table 4 presented in the application materials. Described are: nucleic acids coding the above antibodies or their functional fragments; expression vectors containing the above nucleic acids; and cells used for expression of the above antibodies or their functional fragments and containing the above expression vectors. Presented is a method for producing the antibody or its functional fragment involving the stage of culturing the above expression cell. Disclosed is a composition possessing Dkk-1 binding activity, containing the antibody or its functional fragment in a therapeutically effective amount and a pharmaceutically acceptable excipient, thinner or carrier.

EFFECT: invention enables extending the range of products for treating the diseases associated with Dkk-1 and LRP5/6 excessive reaction, which cause Wnt activation.

14 cl, 14 dwg, 14 tbl, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, more specifically to a monoclonal antibody (mAb), and can be used in medicine. The above antibody binds to the fibroblast growth factor receptor 2-IIIb (FGFR2IIIb) and contains three CDRs of the light chain and three CDR of the heavy chain presented in Fig.13A and 13B, respectively. The engineered antibody or its humanised analogue is used as an ingredient of a pharmaceutical composition for treating a malignant disease.

EFFECT: invention enables producing the anti-FGFR2IIIb antibody promoting the most effective and complete inhibition of the human tumour heterograft growth in mice.

12 cl, 16 dwg, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry, particularly to a monoclonal antibody or its antigen-binding fragment, which specifically binds to AD1 region of human cytomegalovirus (HCMV) gB glycoprotein, as well as to a nucleic acid coding it. What is disclosed is a pharmaceutical composition for preventing or treating a HCMV-related disease containing an effective amount of the above antibody or its antigen-binding fragment. There are also described an expression vector containing the above nucleic acid and a host cell containing the above vector. A method for producing the above antibody or antigen-binding fragment consisting of the stages 1) culturing the above host cell and 2) purifying the produced antibody from the culture supernatant.

EFFECT: invention enables treating the HCMV-related diseases effectively.

10 cl, 11 dwg, 8 tbl, 11 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of immunology and biotechnology. Described are: humanised antibody and its antigen-binding fragment (Fab), which selectively bind human IFN-γ and contain variable site of heavy chain (VH) and variable site of light chain (VL), where VH and VL have sequences of amino acids respectively SEQ ID NO:1 and 2, presented in description. Also disclosed are fragments of DNA, which code said antibody and its Fab-fragment; plasmid DNA for expression of said specific proteins; and modified cells of bacteria and eukaryotes, which contain said plasmid DAN and intended for expression of said antibody and its Fab-fragment. Claimed are methods of obtaining said antibody and its Fab-fragment, which include cultivation of said modified cells in nutritional medium and isolation of antibody and its Fab-fragment by claimed invention from cultural liquid.

EFFECT: invention makes it possible to obtain humanised antibody or its Fab-fragment, binding with IFN-γ with kD 4,6 and IC50 not less than 1,5 nM in test on cells U937, with preservation of affinity of initial mouse monoclonal antibody.

13 cl, 3 dwg, 1 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes a molecule that is specifically combined with CD37 and that contains the following from N-end to C-end: (a) CD37-specific scFV containing the following from N-end to C-end: (i) humanized variable region of a heavy chain, which contains CDR1 GYNMN, CDR2 NIDPYYGGTTYNRKFKG and CDR3 SVGPFDS, (ii) linker having 5 to 30 aminoacids inclusive, and (iii) humanized variable region of an easy chain containing CDR1 RASENVYSYLA, CDR2 FAKTLAE and CDR3 QHHSDNPWT; (b) a link region; and (c) immunoglobulin regions CH2 and CH3. The following is described: The following is described: nucleic acid coding the above binding molecule; an expression vector containing the above nucleic acid; and a host cell for production of a binding molecule, which contains the above vector. The invention proposes use of the above binding molecule to obtain a medicinal agent to reduce the number of B-cells, treatment of a disease or an illness, which is related to abnormal activity of B-cells. Besides, the invention describes compositions containing effective number of the above binding molecule to reduce the number of B-cells, treatment of a disease or an illness related to abnormal activity of B-cells.

EFFECT: invention allows obtaining scFV molecule binding CD37, having orientation of variable regions VHVL, with high yield and efficiency in comparison to scFV molecule against CD37, which has orientation of variable regions VLVH.

31 cl, 17 dwg, 13 tbl, 12 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to immunology and biotechnology. There are presented version recombinant human VEGF antibodies containing variable regions of heavy and light chains containing complementarity-determining regions (CDR) of rabbit antibodies. There are also presented: recovered molecules of nucleic acids coding the above antibodies; an expression vector containing the above molecule of nucleic acid; and a host cell for expression of the antibody according to the invention, containing the above expression vector. What is disclosed is a pharmaceutical composition containing a therapeutically effective amount of the above antibody and a pharmaceutically acceptable carrier.

EFFECT: invention enables extending the range of human VEGF antibodies recovered from a rabbit.

24 cl, 15 dwg, 12 tbl, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to biochemistry, in particular to a monoclonal human antibody, specific to alpha-toxin of S. aureus. The claimed invention additionally relates to pharmaceutical compositions for treatment of prevention of the abscess formation in an organ, which contains at least one antibody or one nucleic acid, which codes the said antibody.

EFFECT: invention makes it possible to extend an assortment of antibodies, specific to alpha-toxin of S aureus.

23 cl, 7 dwg, 4 tbl, 6 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of immunology and biotechnology. Presented are isolated artificial or recombinant antibody or its functional part, capable of specific binding F-antigen of respiratory-syncytial virus, which include: variable sequence of heavy chain, containing CDR1 NYIIN (SEQ ID NO:1), CDR2 GIIPVLGTVHYAPKFQG (SEQ ID NO:2), CDR3 ETALVVSTTYLPHYFDN (SEQ ID NO:3), and variable sequence of light chain, containing CDR1 QASQDIVNYLN (SEQ ID NO:4), CDR2 VASNLET (SEQ ID NO:5), CDR3 QQYDNLP (SEQ ID NO:6); as well as nucleotide sequence coding said antibody. Described is isolated mammalian cell, including said nucleic acid, where said cell expresses said nucleic sequence. Disclosed is method of obtaining antibody or its functional part, including: cultivation of said cell in vitro; and obtaining antibody or its functional fragment, produced by said cell. Described is composition for treatment or prevention of RSV-associated disorder, or preventing or counteracting unfavourable effect of RSV infection on humans, including therapeutically efficient quantity of said antibody or its functional part and pharmaceutically acceptable carrier, solvent or excipient. Claimed is application of said antibody or coding it nucleic sequence for obtaining medication for treatment or prevention of RSV-associated disorder, or preventing or counteracting unfavourable effect of RSV infection on humans.

EFFECT: invention makes it possible to extend arsenal of means for treatment or prevention of RSV-associated disorders.

22 cl, 16 dwg, 3 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology and immunology. Described are versions of antibodies, binding the GRM molecule, as well as their antigen-binding fragments, amino acid sequences of variable parts of which are presented in the claim materials. Nucleic acid, coding the said antibodies, is presented. Claimed is a method of obtaining the RGM-binding protein, which includes cultivation of a host cell in a culture medium under conditions suitable for obtaining the binding protein, capable of binding with RGM, where the host cell contains an expression vector, containing the separated nucleic acid, coding the said antibody. Described is a pharmaceutical composition for treating a disease, in which the SGM A activity produces a negative impact, which contains a therapeutically efficient quantity of the said antibody and a pharmaceutically acceptable carrier. Claimed is an application of the said antibody for obtaining a medication, used for a) reduction of hRGM A binding with a patient's Neogenin receptor; or b) for reduction of hRGM A binding with BMP-2 and BMP-4 in the patient.

EFFECT: invention makes it possible to obtain antibodies against GRM, which are used for treating diseases, associated with excessive interaction of RGM with the Neogenin receptor, BMP-2 and BMP-4.

13 cl, 16 dwg, 10 tbl, 11 ex

FIELD: medicine.

SUBSTANCE: invention relates to biochemistry. A method of immunoassay of human protein CXCL1 is described. Human CXCL1 or its fragment is measured in a sample with application of two or more types of monoclonal antibodies to human CXCL1 or their fragments. Each of two or more types of the monoclonal antibodies to human CXCL1 or their fragments specifically identifies any of regions of a sequence of amino acid sequences, represented in SEQ ID NO:1-3, which represent partial sequences of an amino acid sequence, constituting human protein CXCL1. Two or more types of the monoclonal antibodies to human CXCL1 or their fragments specifically identify regions of the sequence, different from each other. Claimed are the monoclonal antibodies or their fragments, each of which specifically identifies any region of the amino acid sequence, represented in SEQ ID NO:1-3, and has a new amino acid sequence.

EFFECT: invention makes it possible to determine human protein CXCL1 with high sensitivity.

15 cl, 9 dwg, 1 tbl, 21 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and immunology. There are presented optimised genes of light and heavy chains of Infliximab, an anti-tumour necrosis factor alpha (TNF-alpha) antibody, as well as a cell line VKPM-N-131, and a method for antibody biosynthesis. Nucleotide sequences of the genes coding the light and heavy chains of Infliximab are optimised in order to provide the content of codones most specific for mammals; the G/C content is expected to make 50-60% of the total composition; the absence of expanded tracts of a degenerate composition and the absence of RNA secondary structures.

EFFECT: Chinese hamster ovary cell line (CHO) produced by transfection by expression structures containing the genetic sequences according to the invention, enables producing at least 50 mg/l of the monoclonal antibody Infliximab.

4 cl, 3 dwg, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology and represents anti-nerve growth factor (NGF) antibodies. The present invention also discloses a pharmaceutical composition for relieving pain associated with a disease or a condition, wherein pain progression or persistence is mediated by NGF, containing the above antibodies, as well as a kit for treating a HGF-related disease, such as e.g. osteoarthritis, nucleic acids coding a heavy or light chain of the antibody, an expression vector, a host cell for preparing the above antibodies, a method for expressing the above anti-NGF antibodies, as well as using the above antibodies in managing pain and for preparing a therapeutic agent for managing pain associated with the disease or condition, wherein pain progression or persistence is mediated by NGF.

EFFECT: present invention enables producing the anti-NGF antibodies characterised by high stability in vivo.

16 cl, 7 dwg, 13 tbl, 8 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology. Presented is an antibody able to bind to an amplified epidermal growth factor receptor (EGFR) and to de2-7 EGFR, a truncated version of EGFR, and characterised by sequences of variable domains. There are also disclosed a kit for diagnosing a tumour, an immunoconjugate, pharmaceutical compositions and methods of treating a malignant tumour based on using the antibody according to the invention, as well as a single-cell host to form the antibody according to the present invention.

EFFECT: invention can find further application in diagnosing and treating cancer.

43 cl, 98 dwg, 20 tbl, 26 ex

FIELD: biotechnology.

SUBSTANCE: synthetic DNA is proposed, encoding human erythropoietin, having the sequence Seq ID No. 1, comprising its expression vector, the method of production of erythropoietin producer strain, and a strain of a Chinese hamster ovary cells - producer of recombinant human erythropoietin, deposited under the number RKKK(P) 761 D.

EFFECT: invention enables to increase the expression level of recombinant human erythropoietin.

5 cl, 1 tbl, 8 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology. Presented is a molecule of bispecific single-chain antibody containing a first binding domain able to bind to epitope of CD3-epsilon-chain of human and Callithrix jacchus (tamarin), Saguinus oedipus (cotton-top tamarin) and Saimiri sciureus (squirrel monkey), and a second binding domain able to bind to an antigen specified in a group consisting of: PSCA, CD19, C-MET, endosialin, EGF-like domain 1 EpCAM coded by exon 2, FAP-alpha or IGF-IR (or IGF-1R) or a human and/or a primate. The epitope CD3e contains an amino acid sequence disclosed in the description. Disclosed are a nucleic acid coding the above molecule of the bispecific single-chain antibody, an expression vector, a host cell and a method for producing the antibody, as well as the antibody produced by the method. Described is a based pharmaceutical composition containing the molecule of the bispecific single-chain antibody and a method for preventing, treating or relieving cancer or an autoimmune antibody. Presented is using the above molecule of the bispecific single-chain antibody for making the pharmaceutical composition for preventing, treating or relieving cancer or the autoimmune disease.

EFFECT: using the invention provides the clinical improvement in relation to T-cell redistribution, reducing it, and the improved safety profile.

23 cl, 74 dwg, 17 tbl, 33 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to antibodies including human antibodies and their antigen-binding portions, which specifically bind to CCR2, in particular to human CCR2, and can act as CCR2 inhibitors. Anti-CCR2 antibodies are those binding to first and/or second extra-cellular CCR2 loops. The present invention also refers to human anti-CCR2 antibodies and to their antigen-binding portions. The present invention refers to the recovered heavy and light chains of immunoglobulin initiated from human anti-CCR2 antibodies, and to nucleic acid molecules coding such immunoglobulins. The present invention also refers to methods for preparing human anti-CCR2 antibodies and their antigen-binding portions, to compositions containing such antibodies or their antigen-binding portions, and to methods for using antibodies and their antigen-binding portions, and compositions for diagnosing and treating.

EFFECT: invention refers to methods for gene therapy with the use of nucleic acid molecules coding molecules of heavy and light chains of immunoglobulin, wherein the above molecules contain anti-CCR2 antibodies and their antigen-binding portions.

25 cl, 24 dwg, 8 tbl, 17 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. Presented are antibodies targeting integrin α2β1 containing humanised anti-integrin alpha-2 (α2) antibodies, as well as a method of treating by the integrin α2 antibodies. The humanised integrin α2 antibodies comprise a variable region of a light chain domain, a constant human light chain domain and a variable constant heavy chain domain of human IgG1, which exhibit the altered effector function. The variable constant heavy chain domain of human IgG1 comprises an S324N substitution. The invention can be used in medicine.

EFFECT: antibodies exhibit complement-dependent cytotoxicity, improved antibody-dependent cell-mediated cytotoxicity and improved CDC and ADCC.

33 cl, 3 dwg, 1 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology.

EFFECT: bispecific anti-human vascular endothelial growth factor VEGF and human angiopoietin-2 ANG-2 antibodies, methods for producing them, pharmaceutical compositions containing the above antibodies, and using them are described.

13 cl, 26 dwg, 15 tbl, 19 ex

Siglec-15 antibody // 2539790

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is described is a pharmaceutical composition used for treating and/or preventing pathological bone metabolism and containing this antibody. The invention can be used in medicine.

EFFECT: antibody and its functional fragment specifically recognising human Siglec-15 and possessing the osteoclast inhibitory activity are described.

73 cl, 57 dwg, 4 tbl, 33 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is described is a recovered human antibody or its antigen-binding fragment. The antibody binds to human interleukin-4 alpha-receptor (hlL-4R). There are also described a nucleic acid molecule coding this antibody, an expression vector, a host cell, a method for producing such antibody and a therapeutic composition containing this antibody.

EFFECT: presented group of inventions can be used in medicine for treating asthma and atopic dermatitis.

15 cl, 3 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented group of inventions concerns fused proteins, nucleic acids coding these proteins, an expressing cartridge providing nucleic acid expression, a vector comprising this cartridge, a diagnostic technique for in vitro borreliosis, a kit for this diagnostic technique, which use these proteins, as well as a vaccine composition for preventing borreliosis containing these proteins. The characterised fused proteins contain (i) at least one sequence of DbpA protein of the species Borrelia specified in B. afzelii, B. burgdorferi sensu stricto and B. garinii, and (ii) least one sequence of OspC protein of the species Borrelia specified in B. afzelii, B. burgdorferi sensu stricto and B. garinii.

EFFECT: presented group of inventions enables performing more sensitive and specific analyses related to the presence of certain pathogenic species Borrelia.

11 cl, 8 tbl, 7 ex

Up!