Specific binding proteins and applications thereof

FIELD: medicine.

SUBSTANCE: present invention refers to immunology. Presented is an antibody able to bind to an amplified epidermal growth factor receptor (EGFR) and to de2-7 EGFR, a truncated version of EGFR, and characterised by sequences of variable domains. There are also disclosed a kit for diagnosing a tumour, an immunoconjugate, pharmaceutical compositions and methods of treating a malignant tumour based on using the antibody according to the invention, as well as a single-cell host to form the antibody according to the present invention.

EFFECT: invention can find further application in diagnosing and treating cancer.

43 cl, 98 dwg, 20 tbl, 26 ex

 

DATA RELATED APPLICATIONS

This international PCT application for patent claims priority to patent application U.S. No. 12/388504, filed February 18, 2009, the description of which in its entirety thereby incorporated by reference. The present international application PCT patent also incorporates by reference the description in its entirety each of the following applications: patent application U.S. No. 10/145598, filed may 13, 2002 (now U.S. patent No. 7589180 issued on 15 September 2009); provisional application for U.S. patent No. 60/290410, filed may 11, 2001; provisional application for U.S. patent No. 60/326019, filed September 28, 2001; provisional application for U.S. patent No. 60/342258, filed September 21, 2001; international application PCT for patent no PCT/US02/15185, filed may 13, 2002 (published as WO 02/092771 21 November 2002); international application PCT for patent no PCT/US2008/009771, filed August 14, 2008 (published as WO 2009/023265 19 February 2009); and provisional application for U.S. patent No. 60/964715, filed August 14, 2007.

AREA of TECHNOLOGY

The present invention relates to the members of the specific binding, in particular, antibodies and their fragments that bind to amplified receptor epidermal growth factor (EGFR) and EGFR with mutations within the reading frame of the exons 2-7 of the EGFR, leading to usecan�mu receptor EGFR, omits 267 amino acids extraclean domain (de2-7 EGFR). In particular, the epitope recognized by members of the specific binding, in particular, antibodies and their fragments, enhanced or pronounced as a result of aberrant posttranslational modifications. These members of the specific binding is useful in the diagnosis and treatment of cancer. Binding members of the present invention can also be used in therapy in combination with chemotherapeutic or anticancer agents and/or with other antibodies or their fragments.

A SUMMARY OF RELATED TECHNOLOGIES

Treatment of proliferative diseases, in particular cancer chemotherapeutic agents is often based on the use of differences in proliferating target cells and other normal cells in the human body or animal. For example, developed a variety of chemical agents that are included in quickly replicated DNA, resulting in the process of DNA replication and cell division is disrupted. Another approach is the identification of antigens on the surface of tumor cells or other abnormal cells that are not expressed under normal conditions in Mature human tissue, such as tumor antigens or embryonic antigens. Such antigens may St�th target binding proteins such as antibodies that can block or neutralize the antigen. In addition, binding proteins, including antibodies and fragments thereof, can deliver a toxic substance or other substance that can directly or indirectly activate the toxic substance at the site of the tumour.

EGFR is an attractive target in the case of therapy directed to tumor antibodies, as he expressed in many types of epithelial tumors (Voldborg et al. (1997). Epidermal growth factor receptor (EGFR) and EGFR mutations, function and possible role in clinical trials. Ann Oncol. 8, 1197-1206; den Eynde, B. and Scott, A. M. Tumor Antigens. In: P. J. Delves and I. M. Roitt (eds.), Encyclopedia of Immunology, Second Edition, pp. 2424-2431. London: Academic Press (1998)). In addition, expression of EGFR is correlated with poor prognosis in several types of tumors, including gastric, colon, bladder, breast, prostate, endometrium, kidney, and brain (for example glioma). Consequently, the literature describes a variety of antibodies against EGFR with ongoing individual clinical assessment (in Baselga et al. (2000) Phase I Studies of Anti-Epidermal Growth Factor Receptor Chimeric Antibody C225 Alone and in Combination With Cisplatin. J. Clin. Oncol. 18, 904; Faillot et al. (1996): A phase I study of an anti-epidermal growth factor receptor monoclonal antibody for the treatment of malignant gliomas. Neurosurgery. 39, 478-483; Seymour, L. (1999) Novel anti-cancer agents in development: exciting prospects and new challenges. Cancer Treat. Rev. 25, 301-312)).

The results of the research designs�Itanium of MAB against EGFR in patients with head and neck cancer, squamous cell carcinoma of the lung, brain gliomas and malignant astrocytomas has brought hope. Antitumor activity of most of the antibodies against EGFR increases their ability to block ligand binding (Sturgis et al. (1994) Effects of antiepidermal growth factor receptor antibody 528 on the proliferation and differentiation of head and neck cancer. Otolaryngol. Head Neck. Surg. 111, 633-643; Goldstein et al. (1995) Biological efficacy of a chimeric antibody to the epidermal growth factor receptor in a human tumor xenograft model. Clin. Cancer Res. 1, 1311-1318). The effectiveness of such antibodies can be achieved both through modulation of cell proliferation and via antibody-dependent immune functions (e.g., activation of complement). However, the use of these antibodies may be limited by absorption in organs that have high endogenous levels of EGFR, such as the liver and skin (in Baselga et al, 2000; Faillot et al., 1996).

A significant portion of tumors with EGFR gene amplification (i.e. multiple copies of the EGFR gene), also coexpression truncated variant of the receptor (Wikstrand et al. (1998) The class III variant of the epidermal growth factor receptor (EGFR): characterization and utilization as an immunotherapeutic target. J. Neurovirol. 4, 148-158), known as the de2-7 EGFR, ΔEGFR or Δ2-7 (terms used herein interchangeably) (Olapade-Olaopa et al. (2000) Evidence for the differential expression of a variant EGF receptor protein in human prostate cancer. Br. J. Cancer. 82, 186-194). Rurangirwa observed in de2-7 EGFR, results in Mature mRNA reading frame that lacks 801 nucleotide, Zap�Inaudi exons 2-7 (Wong et al. (1992) Structural alterations of the epidermal growth factor receptor gene in human gliomas. Proc. Natl. Acad. Sci. U. S. A. 89, 2965-2969; Yamazaki et al. (1990) A deletion mutation within the ligand binding domain is responsible for activation of epidermal growth factor receptor gene in human brain tumors. Jpn. J. Cancer Res. 81, 773-779; Yamazaki et al. (1988) Amplification of the structurally and functionally altered epidermal growth factor receptor gene (c-erbB) in human brain tumors. Mol. Cell Biol. 8, 1816-1820; Sugawa et al. (1990) Identical splicing of by aberrant epidermal growth factor receptor transcripts from amplified rearranged genes in human glioblastomas. Proc. Natl. Acad. Sci. U. S. A. 87, 8602-8606). The corresponding protein EGFR is characterized by a deletion of 267 amino acids comprising residues 6-273 extraclean domain, and has a novel glycine residue at the join point (Sugawa et al., 1990). This deletion together with an insertion of a glycine residue generates a unique connective peptide at the junction deletions (Sugawa et al., 1990).

de2-7 EGFR has been described in several types of tumors, including glioma, tumors of the breast, lung, ovarian and prostate cancer (Wikstrand et al. (1997) Cell surface localization and density of the tumor-associated variant of the epidermal growth factor receptor, EGFRvIII. Cancer Res. 57, 4130-4140; Olapade-Olaopa et al. (2000) Evidence for the differential expression of a variant EGF receptor protein in human prostate cancer. Br. J. Cancer. 82, 186-194; Wikstrand, et al. (1995) Monoclonal antibodies against EGFRvIII in are tumor specific and react with breast and lung carcinomas and malignant gliomas. Cancer Res. 55, 3140-3148; Garcia de Palazzo et al. (1993) Expression of mutated epidermal growth factor receptor by non-small cell lung carcinomas. Cancer Res. 53, 3217-20). Although this truncated receptor does not bind ligand, it has low unregulated activity and provides a significant advantage�growth in the glioma cells, developed in the form of tumor xenografts in Nude thymus mice (Nishikawa et al. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc. Natl. Acad. Sci. U. S. A. 91, 7727-7731), and is able to transform NIH3T3 cells (Batra et al. (1995) Epidermal growth factor ligand independent, unregulated, cell-transforming potential of a naturally occurring human mutant EGFRvIII gene. Cell Growth Differ. 6, 1251-1259) and MCF-7 cells. The cellular mechanisms used by the de2-7 EGFR in glioma cells, is not fully established, but, as reported, they include reduction of apoptosis (Nagane et al. (1996) A common mutant epidermal growth factor receptor confers enhanced tumorigenicity on human glioblastoma cells by increasing proliferation and reducing apoptosis. Cancer Res. 56, 5079-5086) and increased cell proliferation (Nagane et al., 1996).

Because the expression of this truncated receptor is limited to tumor cells, it is highly specific target in the case of treatment using antibodies. Accordingly, a number of laboratories reported the establishment of both polyclonal (Humphrey et al. (1990) Anti-synthetic peptide antibody reacting at the fusion junction of deletion mutant epidermal growth factor receptors in human glioblastoma. Proc. Natl. Acad. Sci. U. S. A. 87, 4207-4211) and monoclonal (Wikstrand et al. (1995) Monoclonal antibodies against EGFRvIII are tumor specific and react with breast and lung carcinomas and malignant gliomas; Okamoto et al. (1996) Monoclonal antibody against the fusion junction of deletion-mutant epidermal growth factor receptor. Br. J. Cancer. 73, 1366-1372; Hills et al. (1995) Specific targeting of a mutant, activated EGF receptor found in glioblastoma using a monoclonal antibody. Int. J. Cancer. 63, 537-543) antibodies specific against unikalna� peptide de2-7 EGFR. All of the range of mouse Mat, selected after immunization with a unique peptide de2-7, demonstrated the selectivity and specificity against a truncated receptor and target, which is positive de2-7 EGFR xenografts developed in Nude thymus mice (Wikstrand et al. (1995); Reist et al. (1997) Improved targeting of an anti-epidermal growth factor receptor variant III monoclonal antibody in tumor xenografts after labeling using N-succinimidyl 5- - iodo-3-pyridinecarboxylate. Cancer Res. 57, 1510-1515; Reist et al. (1995) Tumor-specific anti-epidermal growth factor receptor variant III monoclonal antibodies: use of the tyramine-cellobiose radioiodination method enhances cellular retention and uptake in tumor xenografts. Cancer Res. 55, 4375-4382).

However, one potential drawback of antibodies against de2-7 EGFR is that only part of the tumors showing amplification of the EGFR gene also expresses de2-7EGFR (Ekstrand et al. (1992) Amplified and rearranged epidermal growth factor receptor genes in human glioblastomas reveal deletions of sequences encoding portions of the N - and/or C-terminal tails. Proc. Natl. Acad. Sci. U. S. A. 89, 4309-4313). The exact percentage of tumors containing the de2-7 EGFR, is not completely set, as the use of different methods (i.e. PCR in comparison with immunohistochemical analysis) and various antibodies has generated a wide range of values defined for the frequency of his presence. Published data indicate that approximately 25-30% of gliomas Express de2-7 EGFR, wherein the expression is the lowest in the anaplastic astrocytomas and highest in glioblastome multiforme (Wong et al. (1992); Wkstrand et al. (1998) The class III variant of the epidermal growth factor receptor (EGFR): characterization and utilization as an immunotherapeutic target. J. Neurovirol. 4, 148-158; Moscatello et al. (1995) Frequent expression of a mutant epidermal growth factor receptor in multiple human tumors. Cancer Res. 55, 5536-5539). It was reported that the percentage of positive cells expressing the de2-7 EGFR gliomas ranges from 37% to 86% (Wikstrand et al. (1997)). Found that 27% of breast cancers and 17% of lung cancers are positive for de2-7 EGFR (Wikstrand et al. (1997); Wikstrand et al. (1995); Wikstrand et al. (1998); and Hills et al., 1995). Thus, one would expect that specific against de2-7 EGFR antibodies will be useful only on the positive for EGFR tumors.

Thus, despite the fact that existing data on the activity of antibodies against EGFR are encouraging, remain observed limits in the region of applicability and effectiveness, as reflected above. Accordingly, it would be desirable to develop such antibodies and agents that demonstrate efficacy against a wide range of tumors, and that to achieve this goal the present invention is directed.

Bringing the links here should not be considered as an admission that they are prior art to the present invention.

A BRIEF SUMMARY of the INVENTION

The present invention provides selected members of the specific binding, in particular, the antibody or fragment�options, which recognize the epitope of EGFR, which is not detected any changes or substitutions in the amino acid sequence as compared to that of EGFR wild-type, and which is found in forming a tumor, hyperproliferative or abnormal cells and is usually not detectable in normal cells or wild-type cells. (As used herein, the term "wild-type cell" is the cell that expresses endogenous EGFR, but not de2-7EGFR, and the term excludes, in particular, a cell that sverkhekspressiya EGFR gene; the term "wild type" refers to the genotype or the phenotype or some other feature, which is present in normal cells but not in abnormal or forming a tumor cell). In further aspect of the present invention include members of the specific binding, in particular, antibodies or fragments thereof that recognize an EGFR epitope which is found in forming a tumor, hyperproliferative or abnormal cells and is usually not detectable in normal cells or wild-type cells, and this epitope is enhanced or pronounced as a result of aberrant posttranslational modifications or aberrant expression. In specific non-limiting example provided herein, the EGFR epitope is enhanced or pronounced where posttrans�alonna modification is not complete or complete to the extent that which occurs during normal EGFR expression in wild-type cells. In one aspect, the epitope of EGFR is amplified or expressed as a result of the initial modification or modifications as a result of joining simple carbs, or early glycosylation, in particular modification with the accession of a large number of mannose residues, and is weakened or is not expressed in the presence of modifications in the accession of complex carbohydrates.

The members of the specific binding, which may be antibodies or their fragments, such as their immunogenic fragments, essentially do not bind to normal cells or wild-type cells containing normal EGFR epitope or epitope of EGFR wild-type, or recognize them in the absence of the aberrant expression and in the presence of normal posttranslational modifications of EGFR.

More specifically, the members of the specific binding of the present invention can be antibodies or their fragments, which recognize an epitope of EGFR, which is present in cells, sverkhekspressiya EGFR (e.g., EGFR gene amplified) or expressing de2-7 EGFR, especially in the presence of aberrant posttranslational modifications, and which is usually not detectable in cells expressing EGFR in normal conditions, especially in the presence of normal� posttranslational modifications.

The authors of the present invention discovered novel monoclonal antibodies, examples of which are the antibodies designated as Mat, ch806, and hu806, Mat, Mat and Mat that specifically recognize aberrant expressed EGFR. In particular, antibodies of the present invention recognize an epitope of EGFR, which is found in forming a tumor, hyperproliferative or abnormal cells and is usually not detectable in normal cells or wild-type cells, and this epitope is enhanced or pronounced as a result of aberrant posttranslational modifications. New antibodies of the present invention also recognize amplified EGFR wild-type and de2-7 EGFR, although contact with the epitope that is different from the unique connective peptide mutated de2-7 EGFR. The antibodies of the present invention specifically recognize aberrant expressed EGFR, including amplified EGFR and mutant EGFR (an example of which is a mutation of the de2-7), in particular, result in aberrant posttranslational modifications. In addition, despite the fact that these antibodies do not recognize EGFR in its presentation on the cell surface line glioma cells expressing normal amounts of EGFR, they do connect with extraclean domain of EGFR (sEGFR), immobilized �and surface tablets for ELISA, indicating recognition of a conformational epitope. These antibodies bind to the surface of A431 cells, which have the gene amplification of EGFR, but does not Express de2-7 EGFR. Importantly, these antibodies do not bind to a significant extent in normal tissues, such as liver and skin, which Express endogenous EGFR wild-type (wt) at levels that exceed those in most of other normal tissues, but in which EGFR is not aberrant expressed or amplified.

The antibodies of the present invention can specific way to outrun positive nature on EGFR forming tumors or tumor cells, by staining or other recognition of these tumors or cells that have aberrant expression of EGFR, including EGFR amplification and/or mutation of EGFR, in particular de2-7EGFR. In addition, the antibodies of the present invention demonstrate significantin vivoantitumor activity against tumors containing amplificatory EGFR, and against positive de2-7 EGFR xenografts.

The unique binding specificity of these antibodies with de2-7 EGFR and amplified EGFR but not with normal EGFR wild-type, provides diagnostic and therapeutic applications for the identification, characterization and effects on several types of tumors, nab�emer, tumors of the head and neck, breast or prostate cancer and glioma, without the problems associated with the absorption of normal tissues, which can be observed when using previously known antibodies against EGFR.

Accordingly, the present invention provides specific binding of proteins, such as antibodies that bind to de2-7 EGFR in the epitope that is distinct from the connecting peptide, but which essentially do not bind to EGFR on the surface of normal cells in the absence of EGFR gene amplification. The term "amplification", as implied, implies that the cell has many copies of the EGFR gene.

Preferably, the epitope recognized by antibodies of the present invention, is located in a region comprising residues 273-501 sequence of the Mature normal EGFR or EGFR wild type, and preferably includes residues 287-302 (SEQ ID NO: 14) sequences of the Mature normal EGFR or EGFR wild-type. Therefore, also provided are specific binding proteins, such as antibodies that bind to de2-7 EGFR in the epitope, which is located in the region comprising residues 273-501 and/or 287-302 (SEQ ID NO: 14) sequences of EGFR. The epitope can be determined using any of the conventional methods of mapping of epitopes, known to skilled in the art of special�that. Alternatively, you could split the DNA sequence encoding residues 273-501 and/or 287-302 (SEQ ID NO: 14), and the resulting fragments to Express in a suitable host. Antibody binding could be defined as above.

In a preferred aspect, the antibodies are antibodies that have the characteristics of antibodies that have been identified and characterized by the authors of the present invention, in particular, recognizes aberrant expressed EGFR, as determined in the case of amplified EGFR and de2-7EGFR.

In another aspect the present invention provides antibodies that can compete with the antibodies of the present invention under conditions in which binding of at least 10% of an antibody having the sequence of VH and VL of antibody of the present invention, with de2-7EGFR blocked as a result of competition with such an antibody in the ELISA analysis. Provides, in particular, antiidiotypic antibodies, and examples are presented here. Here are idiotypic antibodies LMH-11, LMH-12 and LMH-13.

The binding of an antibody with its target antigen is mediated through the complementarity determining areas (CDR) of its heavy and light chain, CDR3 plays a particularly important role. Accordingly, the members of the specific binding based on the plots CDR3 of the heavy or light �ETUI, and preferably both chains of the antibody of the present invention will be useful members of the specific binding forin vivotherapy.

Accordingly, the members of the specific binding, such as antibodies, which are based on CDR identified antibodies of the present invention, particularly sections CDR3, will be applicable for impact on tumors with amplified EGFR, regardless of their de2-7 EGFR status. As the antibodies of the present invention do not bind significantly with normal wild-type receptor, there will be no significant absorption in normal tissue, the limitations of antibodies against EGFR, which are currently developed.

In another aspect, provided is capable of binding EGFR on the cell surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumor cells expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that does not bind with the connecting peptide de2-7 EGFR, consisting of the amino acid sequence SEQ ID NO: 13, which binds to the epitope within the sequence of residues 287-302 (SEQ ID NO: 14) EGFR wild-type person, and which does not include the sequence of the variable regions of the heavy chain, the corresponding amino acid sequence represented � SEQ ID NO: 2, and does not include the sequence of variable region light chain corresponding to the amino acid sequence represented in SEQ ID NO: 4.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has the amino acid sequence represented in SEQ ID NO: 42 and the light chain has the amino acid sequence represented in SEQ ID NO: 47.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has the amino acid sequence represented in SEQ ID NO: 129, and the light chain has the amino acid sequence represented in SEQ ID NO: 134.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has the amino acid sequence represented in SEQ ID NO: 22, and the light chain has the amino acid sequence represented in SEQ ID NO: 27.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has the amino acid sequence represented in SEQ ID NO: 32, and the light chain has the amino acid sequence represented in SEQ ID NO: 37.

In another aspect is provided the selected antibodies�, which includes the light chain and heavy chain, variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 44, 45 and 46.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 49, 50 and 51.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 130, 131 and 132.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 135, 136 and 137.

In another and�aspect is selected antibody, that includes a heavy chain and a light chain, the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 23, 24 and 25.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 28, 29 and 30.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 33, 34 and 35.

In another aspect is provided the selected antibody that comprises a heavy chain and a light chain, variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 38, 39 and 40.

In another ASPE�those provided with a dedicated antibody which is the form of an antibody F(ab')2, scFv-fragment, diatesom, triathlon or tetrathlon.

In another aspect is provided the selected antibody, optionally comprising a detectable or functional label.

In another aspect, the detectable or functional label is a covalently attached drug.

In another aspect, the label is a radioactive label.

In another aspect is provided the selected antibody that is Paglierani.

In another aspect provides isolated nucleic acid that includes sequence encoding the selected antibody described herein.

In another aspect is provided a method for preparing the selected antibodies which enable expression of the nucleic acid described above and in the conditions that lead to expression of the antibody, and removing antibodies.

In another aspect is provided a method of treating tumors in which a human patient, which comprises administering to the patient an effective amount of a selected antibody described herein.

In another aspect is provided a kit for diagnosing tumors in which EGFR aberrant expressed or in which EGFR is expressed in the shape of a truncated protein comprising the selected antibody described herein.

In other� aspect set, in addition, includes reagents and/or instructions regarding use.

In another aspect is provided a pharmaceutical composition comprising a selected antibody described herein.

In another aspect, the pharmaceutical composition also includes pharmaceutically acceptable excipient, carrier or diluent.

In another aspect, the pharmaceutical composition additionally comprises an antitumor agent selected from the group consisting of chemotherapeutic agents, antibodies against EGFR, radioimmunotherapeutic means and their combinations.

In another aspect, the chemotherapeutic agents is selected from the group consisting of tyrosine kinase inhibitors, inhibitors of the cascade of phosphorylation reactions, modulators of post-translational modifications, inhibitors of growth or cell division (e.g., antimitotic funds), inhibitors of signal transmission, and their combinations.

In another aspect, the tyrosine kinase inhibitors selected from the group consisting of AG1478 effect, ZD1839, STI571, OSI-774, SU-6668, and combinations thereof.

In another aspect, the antibody against EGFR selected from the group consisting of antibodies against EGFR 528, 225, SC-03, DR8.3, L8A4, Y10, ICR62, ABX-EGF, and combinations thereof.

In another aspect is provided a method of preventing and/or treating cancer in mammals, comprising administering to the mammal a therapeutically effective�active amount of the pharmaceutical composition, described here.

In another aspect is provided a method of treatment inherent in the brain cancers that produce aberrant expressed EGFR in a mammal, comprising administering to the mammal a therapeutically effective amount of the pharmaceutical composition described herein.

In another aspect inherent to the brain cancer is selected from the group consisting of glioblastomas, medulloblastomas, meningiomas, neoplastic and neoplastic astrocytes arteriovenous malformations.

In another aspect is provided a unicellular host transformed with a recombinant DNA molecule which encodes a selected antibody described herein.

In another aspect, the unicellular host is selected from the group consisting ofE. coli, Pseudomonas, Bacillus, Streptomyces, yeast, CHO cells, YB/20, NSO, SP2/0, Rl.1, B-W, L-M, COS 1, COS 7, BSC1, BSC40, and BMT10, plant cells, insect cells and human cells in tissue culture.

In another aspect is provided a method of detecting the presence amplificatoare EGFR, de2-7EGFR or EGFR, glycopyranose with the accession of a large number of mannose residues, in which the EGFR is measured by (a) bringing a biological sample from the mammal, which assumes the presence amplificatoare EGFR, de2-7EGFR or EGFR, glycopyranose with the accession of a large number�and mannose residues, in contact with the selected antibody under item 1 under conditions that allow the occurrence of binding of EGFR with the selected antibody; and (b) detecting whether binding between EGFR from the selected sample and the antibody; wherein the detection of binding is indicative of the presence or activity of EGFR in the sample.

In another aspect, the method of detecting the presence amplificatoare EGFR, de2-7EGFR or EGFR, glycopyranose with the accession of a large number of mannose residues, the detection of the presence of the EGFR is a sign of the presence of a tumor or cancer in a mammal.

In another aspect, provided is capable of binding EGFR on the cell surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumor cells expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 42 and the light chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 47.

In another aspect, the heavy chain of the antibody comprises the amino acid posledovatelno�ü, presented in SEQ ID NO: 42 and a light chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 47.

In another aspect, provided is capable of binding EGFR on the cell surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumor cells expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 44, 45 and 46, and a variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 49, 50 and 51.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has an amino acid sequence which is substantially homologous amino acid sequence, presented in SEQ ID NO: 129, and the light chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 134.

In another aspect, the heavy chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 129, and the light chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 134.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 130, 131 and 132, and a variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 135, 136 and 137.

In another aspect is provided capable of binding to EGFR on the surface of tumors with gene amplification� EGFR, when malignant cells have many copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 22, and the light chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 27.

In another aspect, the heavy chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 22, and the light chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 27.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 23, 24 and 25, and vari�Belina region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 28, 29 and 30.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 32, and the light chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 37.

In another aspect, the heavy chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 32, and the light chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 37.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that includes a heavy�th chain and light chain, moreover, the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 33, 34 and 35, and a variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 38, 39 and 40.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that does not bind with the connecting peptide de2-7 EGFR, consisting of the amino acid sequence SEQ ID NO: 13, which binds to the epitope within the sequence of residues 287-302 EGFR human wild-type,

in this case, the antibody includes a heavy chain and light chain, and variable area light chain includes the first binding site, the polypeptide domain that has an amino acid sequence corresponding to the amino acid sequence represented by the formula I:

HSSQDIXaa1SNIG (I)

where Xaa1is the amino acid residue�located the whereabouts, having uncharged polar group R (SEQ ID NO: 151);

the second phase binding polypeptide domain having an amino acid sequence corresponding to the amino acid sequence represented by formula II:

HGTNLXaa2D (II)

where Xaa2is the residue of an amino acid with a charged polar group R (SEQ ID NO: 152);

and the third phase binding polypeptide domain having an amino acid sequence corresponding to the amino acid sequence represented by formula III:

VQYXaa3QFPWT (III)

where Xaa3selected from the group consisting of A, G and amino acid balance, which is a conservative substitution of A or G (SEQ ID NO: 153); and

the variable region of the heavy chain includes the first binding site, the polypeptide domain that has an amino acid sequence corresponding to the amino acid sequence represented by formula IV:

SDXaa4AWN (IV)

where Xaa4selected from the group consisting of F, Y, and amino acid residues, which is a conservative substitution of F or Y (SEQ ID NO: 154);

the second phase binding polypeptide domain having an amino acid sequence corresponding to the amino acid sequence represented by formula V, formula VI or formula VII:

YISYSGNTRYXaa5PSLKS (V)

where Xaa5is�tsya the amino acid residue, having uncharged polar group R (SEQ ID NO:155),

YISYSXaa6NTRYNPSLKS (VI)

where Xaa6selected from the group consisting of G, A, and amino acid residues, which is a conservative substitution of G or A (SEQ ID NO: 156),

YISYSGNTRYNPSLXaa7S (VII)

where Xaa7is the remainder of the basic amino acids (SEQ ID NO: 157); and

the third phase binding polypeptide domain having an amino acid sequence corresponding to the amino acid sequence represented by formula VIII:

Xaa8TAGRGFPY (VIII)

where Xaa8selected from the group consisting of V, A, and amino acid residues, which is a conservative substitution of V or A (SEQ ID NO: 158),

and wherein the antibody does not include the sequence of the variable regions of the heavy chain corresponding to the amino acid sequence represented in SEQ ID NO: 2, and includes a sequence of variable region light chain corresponding to the amino acid sequence represented in SEQ ID NO: 4.

In another aspect, Xaa1is N; Xaa2is D; Xaa3is A; Xaa4is F; Xaa5is an amino acid residue having an uncharged polar group R; Xaa6is G; Xaa7is K; and Xaa8is V.

In another aspect, Xaa5is N or Q.

In another aspect, Xaa1is N or S.

In each�m aspect Xaa 2is D or E.

In another aspect, Xaa3is A or G.

In another aspect, Xaa4is F or Y.

In another aspect, Xaa5is N or Q.

In another aspect, Xaa6is G or A, and Xaa7independently represents K or R

In another aspect, Xaa8is V or A.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that does not bind with the connecting peptide de2-7 EGFR, consisting of the amino acid sequence SEQ ID NO: 13, which binds to the epitope within the sequence of residues 273-501 human EGFR wild type,

in this case, the antibody includes a heavy chain and light chain, and variable area light chain includes the first binding site, the polypeptide domain that has the amino acid sequence of HSSQDINSNIG (SEQ ID NO: 18); the second phase binding polypeptide domain having the amino acid sequence HGTNLDD (SEQ ID NO: 19); and the third phase binding polypeptide domain having the amino acid sequence VQYAQFPWT (SEQ ID NO:20), and

the variable region of the heavy chain includes a first section connecting the floor�peptide domain having the amino acid sequence SDFAWN (SEQ ID NO: 15); the second phase binding polypeptide domain having an amino acid sequence corresponding to the amino acid sequence represented by formula IX:

YISYSGNTRYXaa9PSLKS (IX)

where Xaa9is an amino acid residue having an uncharged polar group R (SEQ ID NO: 159); and

the third phase binding polypeptide domain having the amino acid sequence VTAGRGFPY (SEQ ID NO: 17).

In another aspect, the antibody binds to an epitope within the sequence of residues 287-302 (SEQ ID NO: 14) of human EGFR wild-type.

In another aspect, Xaa9is N or Q.

In another aspect, the binding domain plots are supported by a skeleton of a human antibody.

In another aspect, the skeleton of a human antibody is the skeleton of a human antibody IgG1.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the heavy chain has an amino acid sequence that is substantially homologous to the amino acid sequence, predstavljen�th in SEQ ID NO: 2, a light chain has an amino acid sequence that is substantially homologous to the amino acid sequence represented in SEQ ID NO: 4.

In another aspect, the heavy chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 2 and a light chain of the antibody comprises the amino acid sequence represented in SEQ ID NO: 4.

In another aspect is provided capable of binding to EGFR on the surface of tumors with amplification of the EGFR gene, wherein cells of the tumors have multiple copies of the EGFR gene, and on the surface of tumors expressing a truncated version of the receptor de2-7 EGFR, the selected antibody that comprises a heavy chain and a light chain, wherein the variable region of the heavy chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 15, 16 and 17, and a variable region light chain includes sites linking polypeptide domain having amino acid sequences that are highly homologous amino acid sequences presented in SEQ ID NO: 18, 19 and 20.

Other objects and advantages will be apparent skilled in the art specialists as a result of consideration shadowmegamanexe description of the invention, which is carried out with reference to the following illustrative figures and accompanying claims.

BRIEF DESCRIPTION of FIGURES

Fig. 1 shows the results of flow-cytometric analysis of lines of glioma cells. The U87MG cells (light gray histograms) and U87MG.Δ2-7 (dark gray histogram) were stained with irrelevant IgG2b antibody (not shaded histogram) and the other antibody is selected from DH8.3 (specific for the de2-7 EGFR), met or 528 (associated with EGFR wild-type and de2-7 EGFR), as indicated.

Fig. 2A-D presents the results of ELISA Mat, DH8.3 and Mat. (A) Binding of increasing concentrations Matantibodies DH8.3 (●) or 528with sEGFR coated tablets for ELISA. (B) Inhibition of binding of Mat and Mat with sEGFR coated tablets for ELISA with increasing concentrations of soluble EGFR (sEGFR) in solution. (C) Binding of increasing concentrations of DH8.3 with the connecting peptide de2-7. (D) Illustrates the curves of binding of Mat and Mat with immobilized wild-type sEGFR.

Fig. 2E and 2F graphically presents the results of BIAcore binding, using the C-terminal biotinylating peptide and which includes a monoclonal antibody of the present invention, together with other known antibodies, including the ant�body L8A4, which recognizes the connecting peptide mutant de2-7 EGFR, and controls.

Fig. 3 shows the internalization math and antibodies DH8.3. The U87MG cells.Δ2-7 pre-incubated with metor DH8.3 (●) at 4°C, transferred to 37°C, and internalization was determined using FACS. Data represent the average internalized at each time point ± standard error in case 3 (DH8.3) or 4 (Mat) separate experiments.

Fig. 4A and 4B illustrates bioespeleo (% of Injected dose (ID)/g of tumor tissue) of radiolabelled antibodies: (a)125I-Mat and (b)131I-DH8.3 the Nude thymus of mice with xenograft U87MG and U87MG.Δ2-7. Each point represents the average of 5 mice ± standard error, with the exception of 1 h, when n=4.

Fig. 5A and 5B illustrates bioespeleo radiolabelled antibodies:125I-Mat (not shaded column) and131I-DH8.3 (shaded column), presented in the form of relations localizations (a) the tumor: blood or (b) the tumor: liver, Nude thymus of mice with U87MG xenograft.Δ2-7. Each bar represents the average of 5 mice ± standard error, with the exception of 1 h, when n=4.

Fig. 6A-C illustrates a flow-cytometric analysis of cell lines available EGFR gene amplification. Cells of A431 okrashivanie or other antibody choose from Mat, DH8.3 and 528, (black histograms) and compared with staining irrelevant IgG2b antibody (open histograms).

Fig. 7A and 7B illustrates bioespeleo (% ID/g tumor tissue) of radiolabelled antibodies: (a)125I-Mat and (b)131I-528 the Nude thymus of mice with U87MG xenograft.Δ2-7 and A431.

Fig. 8A-D illustrates bioespeleo radiolabelled antibodies:125I-Mat (empty column) and131I-528 (shaded column), presented in the form of relations locations (A, B) tumor: blood or (C, D) tumor: liver the Nude thymus of mice with xenograft (A, C) U87MG.Δ2-7 and (B, D) A431.

Fig. 9A and 9B illustrates the antitumor effect Mat on the growth rate of xenografts (A) and U87MG (B) U87MG.Δ2-7 in a preventive model. 3×106cells U87MG or U87MG.Δ2-7 were injected subcutaneously in both flanks of Nude thymus of mice BALB/c age 4-6 weeks (n=5) on day 0. Mice were injected intraperitoneally or components of a 1 mg dose met (●), components of the 0.1 mg dose Mateither medium (◯), starting with the day before inoculation of tumor cells. Injections were carried out three times a week for two weeks as indicated by the arrows. Data are presented as the average volume of tumors ± standard error.

Fig. 10A, 10B � 10C illustrates the antitumor effect Mat on xenograft (A) U87MG, (B) U87MG.Δ2-7 and (C) U87MG.wtEGFR in the model-seated tumors. 3×106cells U87MG, U87MG.Δ2-7 or U87MG.wtEGFR were injected subcutaneously in both flanks of Nude thymus of mice BALB/c age 4-6 weeks (n=5). Mice were injected intraperitoneally or components of a 1 mg dose met (●); the components of the 0.1 mg dose Mateither medium (◯), starting from the day when the average volume of tumors reached 65-80 mm3. Injections were carried out three times a week for two weeks as indicated by the arrows. Data are presented as the average volume of tumors ± standard error.

Fig. 11A and 11B illustrates the antitumor effect Mat on the A431 xenograft in (A) preventive model and (B) model-seated tumors. 3×106the A431 cells were injected subcutaneously in both flanks of Nude thymus of mice BALB/c age 4-6 weeks (n=5). Mice were injected intraperitoneally or components of a 1 mg dose met (●); or medium (◯), starting with the day before inoculation of tumor cells, in a preventive model, or when the average volume of tumors reached 200 mm3. Injections were carried out three times a week for two weeks as indicated by the arrows. Data are presented as the average volume of tumors ± standard error.

Fig. 12 illustrates the antitumor effect of treatment Mat in combination treatment with AG1478 effect on A431 xenograft in pre�antinoi model. Data are presented as the average volume of tumors ± standard error.

Fig. 13 shows the binding Mat with A431 cells in the presence of increasing concentrations of AG1478 effect (0.5 µm and 5 µm).

Fig. 14A and 14B illustrates (A) a nucleic acid sequence and (B) resulting from the translated amino acid sequences of the 806 VH (SEQ ID NO: 1 and SEQ ID NO: 2, respectively).

Fig. 15A and 15B illustrates (A) a nucleic acid sequence and (B) resulting from the translated amino acid sequence of the VL gene 806 (SEQ ID NO: 3 and SEQ ID NO: 4, respectively).

Fig. 16 shows the sequence VH (SEQ ID NO: 2), numbered according to Kabat, with underlined CDR (SEQ ID NO: 15, 16 and 17). Important residues of the VH sequence (SEQ ID NO: 2) are 24, 37, 48, 67 and 78.

Fig. 17 shows the sequence of the VL (SEQ ID NO: 4), numbered according to Kabat, with underlined CDR (SEQ ID NO: 18, 19 and 20). Important residues of the VL sequence (SEQ ID NO: 4) are 36, 46, 57 and 71.

Fig. 18A-18D presents the results of in vivo studies designed to determine therapeutic effect of combined therapy using antibodies that specifically, math and antibody 528. Mice were inoculable U87MG cells.D2-7 (A and B), U87MG.DK (C) or A431 (D).

Fig. 19 A-D shows the analysis of the internalization of using an electron microscope�I. The U87MG cells.Δ2-7 pre-incubated with met or DH8.3, and then conjugated with gold antibody against mouse IgG at 4°C, transferred to 37°C, and internalization was tested at various time points using electron microscopy: (A) localization of the antibody DH8.3 bordered in the fossa (arrow) after 5 min; (B) internalization Mat using macropinocytosis (arrow) after 2 min; (C) localization of DH8.3 in the lysosomes (arrow) after 20 min; (D) localization Mat in the lysosomes (arrow) after 30 min. Original magnification for all images - X30000.

Fig. 20 shows radioautography cutoff xenotransplanted U87MG.Δ2-7 obtained 8 hours after the injection of125I-labeled Mat.

Fig. 21 shows a flow-cytometric analysis of cell lines with EGFR gene amplification. HN5 cells and MDA-468 were stained irrelevant IgG2b antibody (open histogram with dashed lines), Mat (shaded histogram) or 528 (unfilled histogram with closed lines). Both cell lines were completely negative for reactivity with the antibody DH8.3 (data not presented).

Fig. 22 shows immunoprecipitate EGFR from cell lines. The immunoprecipitation were subjected to EGFR of35S-labeled U87MG cells.Δ2-7 or A431 using Mat, antibody sc-03 or matching isotype control IgG2b. The arrows on the side indicate the position� de2-7 EGFR wild type. An identical pattern of bands were obtained in three independent experiments.

Fig. 23 shows autoradiography cutoff xenotransplanted A431 obtained 24 h after injection of125I-labeled Mat, localization viable tissue is indicated by arrows.

Fig. 24A and 24B shows the increased survival of Nude thymus of mice with intracranial U87MG xenograft.ΔEGFR (A) and LN-Z308.ΔEGFR (B) systemic treatment Mat. The U87MG cells.EGFR (1×105) or cells LN-Z308.ΔEGFR (5×105) were implanted into the brain of Nude thymus mice and animals were treated either met, PBS, or matching isotype IgG from day 0 to day 14 after implantation.

Fig. 24C and 24D shows the suppression of the growth of intracranial tumors with treatment Mat. Nude thymus of mice (five in each group) subjected to treatment or Mat or matching isotype IgG as a control, was euthanized on day 9 in the case of U87MG.EGFR (C) and at day 15 in the case of LN-Z308.ΔEGFR (D) and the brain was removed, fixed and made the cuts. Data were calculated at the adoption of the tumor volume of the control as 100%. Values represent mean ± standard error. ***, P<0,001; control in comparison with Mat. Arrows, tumor tissue.

Fig. 24E shows the increased survival of Nude thymus of mice with intracranial xenotransplant�ATA U87MG.ΔEGFR, with the help of treatment via injections of tumors inside Mat. The U87MG cells.ΔEGFR implanted as described. 10 mg Mat or matching isotype IgG as a control in a volume of 5 µl were injected in the injection of tumor cells through the day, starting with day 1, five times.

Fig. 25A, 25B and 25C shows that Mat increases the survival of mice with brain tumors U87MG.EGFR wild type, but not with brain tumors U87MG.DK or U87MG. Cells U87MG (A), U87MG.DK (B) or U87MG.EGFR wild type (C) (5×105) were implanted into the brain of Nude thymus mice and animals were treated Mat from day 0 to day 14 after implantation with follow-up after cessation of therapy.

Fig. 26A presents the analysis using FACS reactivity Mat with lines U87MG cells. Cells U87MG, U87MG.ΔEGFR, U87MG.DK and U87MG.wtEGFR were stained with monoclonal antibodies against EGFR 528, EGFR.1, and an antibody against ΔEGFR, Mat. Monoclonal antibody EGFR.1 recognizes only the EGFR wild type and of monoclonal antibody 528 reacted with EGFR wild-type and ΔEGFR. Mat reacted strongly with U87MG.ΔEGFR and U87MG.DK and weakly with U87MG.wtEGFR.The bars on the abscissamaximum staining cells in the absence of the first antibody. The results were reproduced in three independent experiments.

Fig. 26B shows immunoprecipitate using Mat forms of EGFR. Mutant EGFR and the EGFR wild type� was isolated using antibodies against EGFR, 528, EGFR.1, or antibodies against ΔEGFR, Mat, cells (track 1) U87MG, (track 2) U87Δ.EGFR, (track 3) U87MG.DK and (track 4) U87MG.wtEGFR, and then were revealed by Western blotting using antibodies against all EGFR, C13.

Fig. 27A and 27B shown that systemic treatment Mat reduces the phosphorylation of ΔEGFR and the expression of Bcl-XL in brain tumors U87MG.ΔEGFR. The U87MG tumor.ΔEGFR dissected on day 9 of treatment Mat, immediately frozen in liquid nitrogen and stored at -80°C until preparation of tumor lysates.

(A) Analysis by Western blotting of expression and the degree of autophosphorylation ΔEGFR. Thirty micrograms of tumor lysates were subjected to electrophoresis in SDS-polyacrylamide gels, transferred onto nitrocellulose membranes and probed using the Mat against phosphotyrosine, then this antibody is desorbed, and the membrane re-probed, but using antibodies against EGFR, C13.

(B) Western blotting of Bcl-XL with the same tumor lysates used in (A). The membrane was probed with polyclonal antibodies against Bcl-X person. Tracks 1 and 2, a brain tumor U87MG.ΔEGFR, subjected to the same treatment isotype control; lanes 3 and 4, brain tumor U87MG.ΔEGFR the treated Mat.

Fig. 28 shows that the treatment Mat reduces growth and vasculosa�ESA and increase of apoptosis and accumulation of macrophages in the U87MG tumors.ΔEGFR. Sections of tumors were stained for Ki-67 antigen. The index of cell proliferation was determined using the percentage of all cells that were Ki-67-positive, from four randomly selected fields of view under high magnification (X400) in intracranial tumors from four mice of each group. Data represent the mean value ± standard error. Apoptotic cells were revealed by analysis using the TUNEL (terminal deoxyuridine tagging all). The index of apoptosis was determined by determining the ratio of the number of the TUNEL-positive cells to the total number of cells from four randomly selected fields of view under high magnification (X400) in intracranial tumors from four mice of each group. Data represent the mean value ± standard error. Sections of tumors were subjected to immunoablative antibody against CD31. MVA (plaça microvascularization) were analyzed using performed using computing machine analysis of images from four randomly selected fields of view (X200) of intracranial tumors from four mice of each group. Infiltrates of macrophages around the tumor in the treated Mat U87MG tumors.ΔEGFR. Sections of tumors were stained with antibodies against F4/80.

Fig. 29 shows a flow-cytometric analysis of parental lines and transfected HL�Ohm U87MG cells. Cells were stained either irrelevant IgG2b antibody (open histogram) or antibody 528 or Mat (shaded histogram), as indicated.

Fig. 30 shows immunoprecipitate EGFR from cell lines. The immunoprecipitation were subjected to EGFR of35S-labeled U87MG cells.wtEGFR, U87MG.Δ2-7 and A431 using Mat (806), antibody sc-03 (c-term) or matching isotype control IgG2b (con). Arrows, position of the de2-7 EGFR wild-type.

Fig. 31 shows representative painted H&E, filled with paraffin sections of U87MG xenografts.Δ2-7 and U87MG.wtEGFR. The U87MG xenograft.Δ2-7 (extracted after 24 days after inoculation of tumor cells) and U87MG.wtEGFR (extracted after 42 days after inoculation of tumor cells) was extracted from mice treated as described above in the explanation for Fig. 10, and stained with H&E. the treated carrier U87MG xenograft.Δ (retrieved 18 days after inoculation of tumor cells) and U87MG.wtEGFR (learned after 37 days after inoculation of tumor cells) showed a very small zone of necrosis (left panel), whereas extensive necrosis (arrows) observed in the treated Mat the as xenograft U87MG cells.Δ2-7 and U87MG cells.wtEGFR (right panel).

Fig. 32 shows immunohistochemical analysis of EGFR expression in frozen sections obtained from Xen�grafts U87MG, U87MG.Δ2-7 and U87MG.wtEGFR. The sections were doing at the time points described above in the explanation for Fig. 31. Sections of the xenograft was subjected to immunoablative antibody 528 (left panel) and Mat (right panel). The decrease of immunoreactivity with either EGFR wild type, amplified EGFR or de2-7 EGFR was not observed in the xenograft of the treated Mat. In accordance within vitrodata parental xenograft U87MG cells were positive for reactivity with the antibody 528, but were negative in staining Mat.

Fig. 33 is a schematic diagram created bicistronic gene-expression constructs. Transcription chains of the chimeric antibody is initiated by a promoter factor-1 elongation terminated and strong artificial sequence termination. The IRES sequence is introduced between encoding regions of the light chain and NeoR and between the coding regions of the heavy chain and dhfr gene.

Fig. 34A and 34B shows the analysis of bearsdley ch806 labeled with either (A)125I, or (B)111In, which was carried out on the Nude thymus mice BALB/c with the xenograft tumor cells U87MG-de2-7. Mice injected with 5 µg labeled with radiolabeled antibodies, and they were killed in groups of four mice at each time point is after 8, 24, 48 or 74 hours. The organs removed, weighed and �radioactively was measured in the gamma counter.

Fig. 35A and 35B shown (A) % ID/gram of tumor tissue and (B) the ratio of the tumor:blood. In the case of111In-labeled antibody is detected in approximately 30% ID/gram tissue and a gap of 4.0 against a tumor:blood.

Fig. 36 displayed therapeutic efficacy of chimeric antibody ch806 in the model-seated tumors. 3×106of U87MG cells.Δ2-7 in l00 µl PBS was inoculable subcutaneously in both flanks of female Nude thymus of mice aged 4-6 weeks. As a positive control included Mat. Treatment was started when the average volume of tumors reached 50 mm3and it consisted of only 5 intraperitoneal injections of 1 mg ch806 or Mat every injection performed on the specified days. Data were presented as the average volume of tumors ± standard error for each subject in the treatment group.

Fig. 37 presents the activity in the form of CDC in respect of target cells (A) U87MG.de2-7 and (B) A431 in the case of a chimeric antibody against EGFR in the form of IgG1 - ch806 and control cG250. Presents the average values ("boxes"; ± standard error) of cytotoxicity percentage in the definition three times.

Fig. 38 shows ADCC against target cells (A) U87MG.de2-7 and (B) A431 when the ratio of effector:target cells of 50:1, achieved with the help of ch806 and matching isotype control antibody cG250 (0-10 μg/ml). The results presented�Lena as average values ("boxes"; ± standard error) of cytotoxicity percentage in the definition three times.

Fig. 39 shows ADCC achieved using 1 mg/ml source Mat and ch806 in respect of target cells U87MG.de2-7 in the range of ratios of effectors:targets. Presents the average values ("boxes"; ± standard error) in the definition three times.

Fig. 40 shows that, initially, we selected twenty-five hybridomas producing antibodies, which were associated with ch806, but not with huIgG. In four of these hybridomas producing antibodies against ch806 with high binding affinity (clone 3E3, 5B8, 9D6 and 4D8), subsequently performed a clonal expansion from single cells by limiting dilution, and they were called the Ludwig Institute for Cancer Research Melbourne Hybridoma (LMH)-11, -12, -13, and - 14, respectively. In addition, were also cloned and further characterized by two hybridomas, which had produced the Mat, in specific relation to huIgG: the clone 2C10 (LMH-15) and 2B8 (LMH-16).

Fig. 41A, 41B and 41C shown that after clonal expansion, the supernatants of cultures of hybrid cells were tested in three replicates using ELISA for the ability to neutralize the activity of binding ch806 or Mat with antigen - sEGFR621. Results as mean values (± standard error) testified antagonistic activity of anti-m�t LMH-11, -12, -13 and -14 with blocking solution binding as ch806 and mouse Mat with tablets, coated with sEGFR (LMH-14 not shown).

Fig. 42A, 42B and 42C are shown titration microplates, which were coated with 10 μg/ml of purified (A) LMH-11, (B) LMH-12 and (C) LMH-13. Three purified clone were compared for their ability to sequester ch806 or Mat in serum or 1% FCS/environments, and then the detection of the associated ch806 or Mat. Matching isotype control antibody hu3S193 and m3S193 serum and 1% FCS/environments were included in addition to the controls on the second conjugate avidin-HRP and ABTS substrate. The results are presented as mean (± standard error) of samples measured in three replicates, using biotinylation LMH-12 (10 μg/ml) for detection, and show that LMH-12, used for capture and detection, provided the greatest sensitivity to ch806 in serum (3 ng/ml) with negligible background binding.

Fig. 43 demonstrated the validation of the optimal conditions for pharmacokinetic analysis using ELISA using 1 µg/ml of anti-LMH-12 and 1 µg/ml biotinylated LMH-12 for capture and detection, respectively. Three separate ELISA were performed in four repetitions to measure ch806 in serum of three healthy donors (●) or 1% BSA/mediawith matching isotype �control hu3S193 in serum or 1% BSA/mediaUsing each ELISA were also included controls for a second conjugate avidin-HRPand the substrate ABTS (hexagon) by itself. Results as mean values (± standard error) demonstrate highly reproducible binding curves for the determination of ch806 (2 µg/ml - 1.6 ng/ml) in sera with constituents 3 ng/ml limit of detection (n=12; 1-100 ng/ml, coefficient of variation <25%; 100 ng/ml - 5 μg/ml, coefficient of variation <15%). There was no appreciable background binding to any of the three tested sera, and there was a slight binding with matching isotype control hu3S193.

Fig. 44 shows the immunoblotting of recombinant sEGFR, expressed in CHO cells, probed using Mat. Recombinant sEGFR treated PNGaseF (peptide-N-glycanase F) to eliminate N-linked glycosylation (diglycolamine) or not subjected to this treatment, the protein was subjected to electrophoresis in SDS-page, transferred onto membrane and subjected to hybridization with Mat.

Fig. 45 shows immunoprecipitate line EGFR35S-labeled cells (U87MG.Δ2-7, U87MG-wtEGFR and A431) using different antibodies (antibody SC-03, 806 and 528).

Fig. 46 shows immunoprecipitate EGFR from different cells (A431 and U87MG.Δ2-7) at different points of time (moments�and time = 0 to 240 minutes) after pulse labeling with 35S methionine/cysteine. For immunoprecipitation of antibodies used and 806 528.

Fig. 47 shows immunoprecipitate EGFR from different cell lines (U87MG.Δ2-7, U87MG-wtEGFR and A431) using different antibodies (SC-03, 806 and 528) in the absence of cleavage of Endo H (-) and after cleavage of the Endo H (+) to uninstall type carbohydrates with a high content of mannose.

Fig. 48 displayed iodination of surface structures of the cell lines A431 and U87MG.Δ2-7, followed by immunoprecipitation using antibody 806, and the cleavage of Endo H or without him, which is evidence that EGFR is associated 806, on the surface of A431 cells is sensitive to EndoH form.

Fig. 49 presents the vector of the pREN ch806 LC Neo (SEQ ID NO: 7).

Fig. 50 presents the vector of the pREN ch806 HC DHFR Vector (SEQ ID NO: 8).

Fig. 51A-D shows the sequence of nucleic acids of the VH - and VL-regions met (SEQ ID NO: 21 and 26, respectively) and their amino acid sequence (SEQ ID NO: 22 and 27, respectively).

Fig. 52A-D provides the nucleic acid sequences VH - and VL-regions met (SEQ ID NO: 31 and 36, respectively) and their amino acid sequence (SEQ ID NO: 32 and 37, respectively).

Fig. 53 graphically represented DNA-plasmid - United Lonza plasmid with two genes, including pEE12.4, containing a cassette for the expression of (VH+CH) hu806H, and pEE6.4, containing a cassette for the expression of (VL+CL) hu806L.

Fig. 54 presents the DNA sequence (SEQ ID NO: 41; the complementary sequence of SEQ ID NO: 162) United Lonza plasmid shown in Fig. 53. This figure also shows all of the resulting broadcasts amino acid sequence (SEQ ID NO: 42-51 and 163 to 166) relating to the hu806 antibody. The sequence of the plasmid was subjected to verification, and were checked coding sequence and resulting broadcast amino acid sequence. For the identification of interest areas, the portions of the sequence were hatched; the dashed areas correspond to the actual locations of connections when splicing. Use the following color code:

(gray): signal plot, the initial coding sequence found in the variable region of the heavy and light chains;

(pale lilac): VH-region hu806, vinirovna variable region of the heavy chain;

(pink): CH-region hu806, optimized in relation to the frequency of use of codons of the constant region of the heavy chain.

(green): VL-region hu806, vinirovna variable region light chain; and

(yellow): CL-region hu806, optimized in relation to the frequency of use of codons constant region light chain.

Fig. 55A and 55B presents transli�created amino acid sequence hu806 (VH - and VL-region SEQ ID NO: 164 and 166 and their associated signal peptide SEQ ID NO: 163 and 165; CH - and CL-region SEQ ID NO: 43 and 48), and presents the numbering according to Kabat VH - and VL-regions (SEQ ID NO: 164 and 165, respectively), CDR (SEQ ID NO: 44 to 46 and 49 to 51) are underlined.

Fig. 56A, 56B, 56C, 57A, 57B and 57C shows the initial stage in terms of generowania, evaluation of amino acid residues in the sequence Mat (VH-region SEQ ID NO: 167 and VL region of SEQ ID NO: 12) in relation to a platen on the surface. Assessment equal to the number of asterisks (*) above each residue, with the most exposed residues have three stars. Three figures include a map on which are indicated as initial overlap oligonucleotides (for VH-region: Fig. 56C and SEQ ID NO: 52 and 169-177; for VL-region: Fig. 57C and SEQ ID NO: 62, 66, 68 and 181-187) with the formation of the first generowania product (VH-region SEQ ID NO: 168 and VL region of SEQ ID NO: 180).

Fig. 58 presents the map is optimized in relation to the frequency of use of codons of the DNA sequence huIgG1 heavy chain (SEQ ID NO: 80; the complementary sequence of SEQ ID NO: 178) and resulting translated amino acid sequence (SEQ ID NO: 43).

Fig. 59 presents the combination of proteins for comparing amino acid sequences of VH+CH hu806 (VH+CH 8C65AAG hu806; SEQ ID NO: 81) with the source reference file for the VH-region met (SEQ ID NO: 167). Highlighted areas indicate conserved amino acid sequences in VH. CDR are underlined. Asterisks OTP�reflect the changes planned and were carried out in the initial process of generowania. Numbered sites refer to subsequent modifications.

Fig. 60 presents the corresponding alignment of the amino acid sequence of VL+CL hu806 (signal sequence + VL + CL 8C65AAG hu806; SEQ ID NO: 83) with the source reference file for the VL-region met (SEQ ID NO: 179). It contains an optional file (signal sequence + VL + CL r2vkl hu806; SEQ ID NO: 82), the design of the predecessor, which was included to illustrate the changes made in the modification #7.

Fig. 61 shows the alignment of nucleotide and amino acid sequence of the signal sequence+VL and CL hu806 (VL+CL 8C65AAG hu806; SEQ ID NO: 190 and 188) with the corresponding sequences of ch806 (pREN ch806 LC Neo; LICR; SEQ ID NO: 189). Were modifications made, and the notes thereto are given in the explanation to Fig. 62.

Fig. 62 presents the alignment of the nucleotide sequence of the signal sequence + hu806 VH (VH-region 8C65AAG hu806; SEQ ID NO: 192) with the appropriate sequence Mat [VH-region met to change codons (cc) and generowania (ven); SEQ ID NO: 191]. Illustrated by replacement of nucleotides that underlie the changes of amino acids in Fig. 59 and 60, as well as conservative substitutions in the sequences of nucleic acids that do not lead to changes in amine�acid. The intron between the signal sequence and the VH-region in hu806 has been removed for easier viewing. The signal sequence and the CDR are underlined. The corresponding amino acid sequence (SEQ ID NO: 42) was added to the combination.

Fig. 63 shows the binding of purified hu806 antibody obtained from transiently transfected 293 cells with recombinant EGFR-ECD, determined by Biacore. Binding to the EGFR-ECD was not observed with purified control antibody in the form of a human IgG1.

Fig. 64 submitted to GenBank formatted text document, on the sequence (SEQ ID NO: 41) plasmid 8C65AAG encoding hu806 in the form of IgG1, and annotations thereto.

Fig. 65 presents the combination of the amino acid sequences of CDR of Mat (SEQ ID NO: 15-18, 20 and l93) and Mat (SEQ ID nos: 130-132, 135, 194-195). Differences in the sequences of the two antibodies are shown in bold.

Fig. 66A and 66B demonstrated by immunohistochemical staining of cell lines and normal human liver antibody Mat. (A) Biotinylating Mat was used for staining of sections prepared from arrays containing A431 cells (which sverkhekspressiya EGFR wild-type), U87MG cells.Δ2-7 (which Express Δ2-7EGFR) and U87MG cells (which Express EGFR wild type on medium levels). (B) Staining of nor�screening of a human liver (400x) antibody met (left panel), matching isotype control antibody (middle panel) and the control of the second antibody (right panel). Was not observed specific staining of sinusoidal or hepatocytes.

Fig. 67A, 67B and 67C demonstrated reactivity Mat and Mat with EGFR fragments presented on the surface of yeast. (A) Representative obtained by flow-cytometric analysis of the histogram, which presents the average fluorescent signal of the tagged antibodies Mat and Mat EGFR fragments presented on the surface of yeast. When using the view on the surface of the percentage of yeast cells does not reflect the protein on their surface, resulting 2 peak in the histogram. Antibody 9E10 was used as a positive control, since all fragments containing the linear C-terminal c-myc tag. (B) summary of antibody binding with different EGFR fragments. (C) EGFR Fragments were subjected to denaturation by heating precipitation of yeast cells up to 800°C for 30 min. In all cases, the antibody against c-myc I still recognize C-myc-tag, demonstrating that thermal treatment does not endanger the protein presented on the surface of yeast. Sensitive to the conformation of the antibody against EGFR - Mut was used to confirm denaturation.

Fig. 8A, 68B, below 68c and 68D shown antitumor effects Mat on xenograft cells brain cancer and prostate cancer. (A) Mice (n=5) having a U87MG xenograft.Δ2-7, intraperitoneally injected with PBS, 1 mg Mat or Mat (positive control), three times a week for two weeks on days 6, 8, 10, 13, 15 and 17 from the day when the initial tumor volume was 100 mm3. Data are presented as the average volume of tumors ± standard error. (B) Cells were stained with two irrelevant antibodies (blue marking,not hollowandgreen marking, hollow), Mat on overall EGFR (rose marking,not hollow), Mat (pale bluemarking, hollowand math (orange marking, hollow), and then analyzed by FACS. (C) DU145 Cells were subjected to lysis and immunoprecipitation with Mat, Mat, Mat or two independent irrelevant antibody, followed by immunoblotting to detect EGFR. (D) Mice (n=5) with DU145 xenograft, intraperitoneally injected with PBS, 1 mg Mat or Mat, daily on days 18-22, 25-29 and from 39-43 days, when the initial tumor volume was 85 mm3. Data are presented as the average volume of tumors ± standard error.

Fig. 69A, 69B, 69C, 69D, 69E, and 69F presents the crystal structure of the peptide 287-302 EGFR is associated with Fab-fragments: (A) figure 806 Fab, Mar�Iruka light chain is red; heavy chain - blue; associated peptide - yellow; and imposed EGFR287-302from EGFR - purple. (B) figure Fab 175, wherein the marking light chain is yellow; heavy chain - green; associated peptide - lilac; and EGFR287-302of EGFR(DI-3) - purple. (C) Detail of image (B) shows the similarity EGFR287-302in the receptor with a peptide, associated with Fab 175. The basics of the peptides shown in the form of strips Cα, and the interacting side chains in the form of twigs. The O atoms are red; N - blue; S - orange, and C as the main chain. (D) the Imposition of EGFR c education complex Fab175:peptide demonstrating spatial overlap. Coloring as in (C), wherein the surface EGFR187-286 has a turquoise color. (E) Perpendicular (D); moreover, EFR187-286 shown opaque blue paint, and the surface light chain and heavy chain transparent orange and green colors, respectively. (F) a Detailed spatial representation of the complex with Fab 175 for the study of the antigen-binding site. Coloring as in (C), and hydrogen bonds formed by the side chains are indicated with black dots. Water molecules, immersed inside after the formation of the complex, represented as red spheres.

Fig. 70A, 70B, 70C and 70D demonstrates the effect linkages between cysteines 271 and 283 on the binding Mat with EGFR. (A) Cells, transfetsirovannyh EGFR wild t�PA mutant EGFR-C271A, EGFR-C283A or C271A/C283A, was subjected to staining Mat (solid pink histogram), Mat (blue line) or only the second antibody (Magenta), and then analyzed by FACS. The increase was determined using the same class irrelevant antibody. (B) BaF3 Cells expressing EGFR-C271A or C271/283A of EGFR was investigated in relation to their response to EGF in the analysis based on the MTT, as described. EC50Sdeduced using the alignment Boltzmann private values of observations. Data represent the mean and standard deviation of definitions in three replicates. (C) BaF3 Cells expressing EGFR wild-type or EGFR-C271A/C283A, deprived of IL-3 and serum, and then exposed to EGF or media as control. Polnocvetnye lysates were separated by electrophoresis in SDS-page and subjected to hybridization with an antibody against phosphotyrosine (upper panel) or an antibody against EGFR (lower panel). (D) BaF3 Cells expressing EGFR wild type (left panel) orC271A/C283AEGFR (rightpanel), were subjected to stimulation increasing concentrations of EGF in the absence of antibodies (open symbols) in the presence Mat (grey circles) or Mat (black triangles), both at a concentration of 10 μg/ml Data are presented as mean and standard deviation of definitions in three�Torah.

Fig. 71A, 71B and 71C are demonstrated: (A) obtained in the gamma camera image of bearsdley111In-ch806 over the body of a patient with metastatic squamous cell carcinoma of the vocal cords, demonstrating high in quantitative terms the degree of absorption by the tumor in the right neck (arrow). Also visible activity in a pool of blood and a slight catabolism free111In the liver. (B) Obtained by single photon emission computed tomography (SPECT) image of the neck of this patient, showing absorption111In-ch806 viable tumor (arrow), with reduced absorption in the centre is a sign of necrosis. (C) Corresponding image of the neck obtained by CT (computed tomography) scan showing a large tumor mass in the right neck (arrow) with necrosis in the center.

Fig. 72A and 72B shows the spatial structure model neautoriziranom EGFR1-621. The skeleton of the receptor has a blue marking, and the ligand TGF-α red. The epitope for Mac/175 has turquoise markings, and disulfide bonds in yellow. Atoms of the disulfide bonds, which tightens again epitope in the receptor are represented in space-filling format. The model was constructed through the joining of the CR2 domain of EGFR-ECD from autoinhibitory conformation with the structure neautoriziranom� EGFR monomer in the presence of its ligand.

Fig. 73 shows reactivity Mat with fragments of the EGFR. Lysates of 293T cells transfected with vectors expressing soluble fragment 1-501 EGFR or fusion proteins of the GH/EGFR fragment (GH-274-501, GH-282-501, GH-290-501 and GH-298-501) were separated by electrophoresis in SDS-page, transferred onto membrane and subjected to hybridization with Mat (left panel) or an antibody against myc 9B11 (right panel).

Fig. 74A and 74B presents the nucleic acid sequence (SEQ ID NO: 128) and amino acid sequence(I) (SEQ ID NO: 129), respectively, the VH-region Mat.

Fig. 75A and 75B presents the nucleic acid sequence (SEQ ID NO: 133) and amino acid sequence(I) (SEQ ID NO: 134), respectively, VL-region Mat.

Fig. 76A, 76B and 76C are presented (A) refer to the volume concentration of the product and (B) the concentration of viable cells in the case of hu806-transfectants GS-CHO (14D8, 15B2 and 40A10) and GS-NS0 (36) for small-scale cultivation in shake flasks (100 ml). The product concentration was determined using ELISA, using idiotypic (anti-806) antibody as an antibody for coating and ch806 (clinical series: J06024) as standard; (C) cell growth-transfectants GS-CHO 40A10 and volume production in a bioreactor - a mixing VAT of 15 L. the Concentration of viable cells (×105cells/ml), life�the ability of cells and products (mg/l).

Fig. 77A, 77B, 77C, 77D and 77E shows the analysis using chromatography with the exception of size (Biosep SEC-S3000) subjected to purification using protein A constructs hu806 antibody obtained as a result of small-scale cultivation, and control ch806 and mate 806. In the upper and lower panels of each figure presents chromatograms with OP nm and OP nm, respectively.

Fig. 78 shows the analysis using chromatography with the exception of size (Biosep SEC-S3000) subjected to purification using protein A constructs hu806 antibody from 40A10 after vysokomaslichnoy production and purification using protein A. Presents the chromatogram when OP nm, indicating component to 98.8% purity from 1.2% the presence of the unit.

Fig. 79 shows what the finished 4-20% gels in Tris/glycine buffer from Novex, USA was used under standard conditions for electrophoresis in SDS-page analysis of purified from transfectants GS-CHO (14D8, 15B2 and 40A10) and GS-NS0 (36) drugs hu806 (5 µg) in reducing conditions. Proteins were revealed by staining Kumasi blue.

Fig. 80 shows that the finished 4-20% gels in Tris/glycine buffer was used under standard conditions for electrophoresis in SDS-page for analysis of preparations of purified hu806 (5 µg) from transfectant CHO GS (14D8, 15B2 and 40A10) and GS-NS0 (36) in Sevostyanov�actual operation conditions. Proteins were revealed by staining Kumasi blue.

Fig. 81 it is shown that the finished 4-20% gels in Tris/glycine buffer was used under standard conditions for electrophoresis in SDS-page analysis purified from transfectant GS-CHO hu806 40A10 product (5 g) after vysokomaslichnoy products. Proteins were revealed by staining Kumasi blue.

Fig. 82 shows the analysis using isoelectrofocusing in the gel plate is cleared from transfectant GS-CHO hu806 40A10 product (5 g) after 15 liters of products. Proteins were revealed by staining Kumasi blue. Lane 1, pI-markers; lane 2, hu806 (three isoforms, pI 8.66 roubles from to of 8.82); lane 3, pI-markers.

Fig. 83 shows the binding to A431 cells: a flow-cytometric analysis of treated with protein And drugs hu806 antibody (20 μg/ml) and matching isotype control huA33 (20 μg/ml). The controls include only the second antibody (green marking) and ch806 (red marking). Design Hu806 were produced as a result of small-scale cultivation.

Fig. 84 shows the binding to A431 cells: a flow-cytometric analysis of purified preparations Mat, ch806, and hu806 antibody 40A10 (20 μg/ml), which bind to ~10% EGFR wild-type cell surface, 528 (which is associated with EGFR wild-type and de2-7 EGFR) and irrelevant control antibody (20 μg/ml) as indicated.

Fig. 85 shows the binding to glioma U87MG cells.de2-7: flow-cytometric analysis of purified preparations Mat, ch806, and hu806 antibody 40A10 (20 μg/ml), antibodies against EGFR 528 and irrelevant control antibody (20 μg/ml).

Fig. 86 shows the specific binding is labeled with a radioactive isotope125I structures of antibody 806 (A) glioma U87MG cells.de2-7 and (B) carcinoma cells A431.

Fig. 87 shows an analysis of Scatchard: binding is labeled with a radioactive isotope125I structures of antibody ch806 (A) and hu806 (a) U87MG cells.de2-7.

Fig. 88 shows an analysis of Scatchard: binding is labeled with a radioactive isotope125I structures of antibody ch806 (A) and hu806 (In) with A431 cells.

Fig. 89A and B demonstrated by BIAcore analysis of the binding epitope in the form of a peptide from amino acids 287-302 for EGFR antibody 806 (A) hu806 and (B) ch806, passed over the immobilized peptide in increasing concentrations of components of 50 nm, 100 nm, 150 nm, 200 nm, 250 nm and 300 nm.

Fig. 90A and 90B shown achieved with the help of ch806, and hu806 antibody-dependent cretaceouspaleogene cytotoxicity against which targets A431 cells, as defined (A) at a concentration of 1 μg/ml of each antibody in a range of cells-effectors/target cells (E:T=0,78:1 - 100:1); (B) at E:T=50:1 in the range of concentrations of each antibody (3,15 ng/ml -10 µg/ml).

Fig. 91 demonstrated treatment-rooted A431 xenografts in Nude thymus of mice BALB/c. Groups of 5 mice received 6×1 mg dose over a 2-week treatment with antibodies, as indicated (arrows). Presented the volume of tumors in the form of mean value ± standard deviation prior to the completion of the study.

Fig. 92 demonstrated treatment-rooted U87MG xenografts.de2-7 in Nude thymus of mice BALB/c. Groups of 5 mice received 6×1 mg dose over a 2-week treatment with antibodies, as indicated (arrows). Presented the volume of tumors in the form of mean value ± standard deviation prior to the completion of the study.

Fig. 93 presents the deviations from the values of chemical shift in a random spiral for Mat-peptide: (A) N (B) HN and (C) HA. The peptide was prepared in an aqueous solution containing 5%2H2O, 70 mm NaCl and 50 mm NaPO4at a pH of 6.8. All spectra used for subsequent allocations compared, were obtained at 298K in a Bruker Avance500.

Fig. 94A, 94B, 94C, 94D, 94E and 94F demonstrated obtained in the gamma-camera images of the whole body of the patient 7, A) front and B) rear, 5 days after infusion111In-ch806. There is a high degree of absorption111In-ch806 metastatic lesions lesions in the lungs (arrows). (C) and (D) demonstrate metastatic lesions (arrows) on the image receiving�nom by CT. (E) three-Dimensional, obtained by single photon emission computed tomography (SPECT) images of the thorax and (F) combined transaxial images obtained by SPECT and CT showing the specific absorption111In-ch806 metastatic lesions.

Fig. 95A, 95B, 95C, 95D, 95E and 95F shown lying in a single plane image of the head and neck of the patient 8 received in (A) day 0, (B) day 3 and (C) day 7 after infusion111In-ch806. The initial activity in a pool of blood on day 0, and the absorbance111In-ch806 anaplastic astrocytoma in the right frontal lobe is evident by day 3 (arrow) and increased to day 7. Specific absorption111In-ch806 is confirmed in (D) obtained with the SPECT image of the brain (arrow), is evident in the location of the tumor (arrow), E)18F-FDG positron emission tomography and F) magnetic resonance imaging.

Fig. 96A, 96B, 96C and 96D shown that there is a similar absorption111In-ch806 tumor in patient 3 compared to patient 4, despite the differences in antigen expression for 806 is subjected to screening tumor samples. (A) Localization111In-ch806 in metastasis to the lung (arrow) obtained with SPECT, the transaxial image of the patient 4, with apparent activity in cardiac pool of blood (B). (B) Corresponding image obtained by CT. It is established that shareview�nnaya the tumor had component < 10% positivity regarding antigen expression for 806. (C) Localization111In-ch806 in metastasis to the lung (arrow) in patient 3, with apparent activity in cardiac pool of blood. (D) Corresponding image obtained by CT. It is established that the archived tumor had component 50-75% positivity regarding antigen expression for 806.

Fig. 97 shows the pharmacokinetics of ch806 protein, determined by ELISA, for the combined population. Observed and projected % ID/l in the case of ch806 depending on time after infusion (hours).

Fig. 98A and 98B are presented are specific to an individual patient results for (A) the removal from the body and (B) excretion by the liver111In-ch806 at dose levels comprising 5 mg/m210 mg/m2(Δ), 20 mg/m2(s) and 40 mg/m2Linear regression for the data set indicated in each panel [(A) r2=0,9595; (B) r2=0,9415].

DETAILED description of the INVENTION

In accordance with the present invention can be used conventional methods of molecular biology, Microbiology and recombinant DNA within the knowledge in the art. Such techniques are explained fully in the literature. See, for example, Sambrook et al., "Molecular Cloning: A Laboratory Manual" (1989); "Current Protocols in Molecular Biology" Volumes I-E [Ausubel, R. M., ed.(1994)]; "Cell Biology: A Laboratory Handbook" Volumes I-III [J. E. Celis, ed. (1994))]; "Current Protocols in Immunology" Volumes I-III [Coligan, J. E., ed. (1994)]; "Oligonucleotide Synthesis" (M. J. Gait ed. 1984); "Nucleic Acid Hybridization" [B. D. Hames &S. J. Higgins eds. (1985)]; "Transcription And Translation" [B. D. Hames &S. J. Higgins, eds. (1984)]; Animal Cell Culture [R. I. Freshney, ed. (1986)]; "Immobilized Cells And Enzymes" [IRL Press, (1986)]; B. Perbal, "A Practical Guide To Molecular Cloning" (1984).

It is believed that used herein the following terms shall have, without limitation, the definitions.

The term "member of the specific binding" describes a member of a pair of molecules having binding specificity to each other. Members of the specifically binding pair can be obtained from a natural source or be wholly or partially synthetically derived. One member of the pair of molecules has an area on its surface, or a cavity, which specifically binds to a particular spatial and polar structure of another member of the pair of molecules and, therefore, complementary to this structure. Thus, the members of the pair have the ability to communicate specifically with each other. Examples of types of specific binding pairs are antigen-antibody, Biotin-avidin, hormone-hormone receptor, receptor-ligand, enzyme-substrate. This application is related to reactions of the type a antigen-antibody.

The term "aberrant expression" in its various grammatical forms can mean and include any Uwe�Ioannou or altered expression or sverkhekspressiya protein in the tissue, for example, increasing the amount of protein, caused by any method, including as a result of increased expression or translation, modulation of the promoter or regulator protein, amplification of the gene of the protein, or increasing the half-period of the existence or stability, so that at any time there is or can be detected more protein than in a state without sverkhekspressiya. Aberrant expression includes and involves any script or change, in which the mechanism of expression or posttranslational modification of the protein in the cell is excessively stiff or otherwise impaired due to increased expression or increased levels or quantities of protein, including those in which the altered protein is expressed, for example, a mutated protein or a variant due to changes in sequence, deletions from, or insertions or modified installation.

It is important to understand that the term "aberrant expression" was specifically chosen here to reach a condition in which there are abnormal (usually increased) the number/levels of protein, regardless of the current causes of this abnormal quantity or level. Thus, an abnormal protein may be the result of sverkhekspressiya protein in the absence of gene amplification, which is the case, for example, many samples of klyachina, taken from head and neck subjects with cancer, while other samples show abnormal levels of a protein associated with gene amplification.

In connection with the latter of these two cases, some of the work of the authors of the present invention, which is presented here to illustrate the present invention, includes the analysis of samples, some of which demonstrate abnormal levels of the protein resulting from gene amplification EFGR. So this is the reason for presenting experimental data in reference to amplification, and the use of the terms "amplification/amplificatory" etc. when describing abnormal levels of EFGR. However, it is the measurement of abnormal amounts or levels of the protein determines the condition or event, which will provide clinical intervention, for example, by reference to the binding members of the present invention, and for this reason, the authors present invention believe that the term "aberrant expression" reflects wider causal factors that give rise to the corresponding abnormalities in the levels EFGR.

Accordingly, although the terms "overexpression" and "amplification" in their various grammatical forms, as implied, are of great technical importance, they should be considered equivalent�mi each other, because they reflect a state in which there are abnormal levels of protein EFGR, in connection with the present invention. Accordingly, the term "aberrant expression" was selected because it was believed to include the terms "overexpression" and "amplification" in its scope the purpose of the present invention, whereby all of the terms, as used here, may be deemed to be equivalent to each other.

The term "antibody" describes an antibody, or natural or partly or wholly synthetically derived. The term also covers any polypeptide or protein having a binding domain that is a binding domain of an antibody or homologous to this domain. This term is also assumed to be antibodies to the transplanted CDR.

As antibodies can be modified in a number of ways, the term "antibody" should be considered as a term that encompasses any member or specific binding substance having(her) binding domain with the required specificity. Thus, the term includes fragments of antibodies, derivatives, functional equivalents and homologues of antibodies, including any polypeptide comprising a binding domain of an immunoglobulin, either natural or wholly or partially synthetic. Therefore, included a chimeric molecule comprising linked�the third immunoglobulin domain, or equivalent, fused to another polypeptide. Cloning and expression of chimeric antibodies are described in EP-A-0120694 and EP-A-0125023, and in U.S. patents No. 4816397 and 4816567.

It was found that fragments the holistic antibody can perform the function of binding antigens. Examples of binding fragments include (i) Fab fragment consisting of VL, VH, CL and CH1 domains; (ii) Fd fragment consisting of the VH and CH1 domains; (iii) Fv fragment consisting of the VL and VH domains of a single antibody; (iv) the dAb fragment (Ward, E. S. et al. (1989) Nature 341, 544-546), which consists of a VH domain; (v) allocated CDR-areas; (vi) F(ab')2-fragment, a bivalent fragment comprising two linked Fab-fragment (vii) single chain Fv molecules (scFv), in which the VH domain and VL domain linked by a peptide linker which allows the two domains to associate with the formation of the antigen-binding site (Bird et al. (1988) Science. 242, 423-426; Huston et al. (1988) PNAS USA. 85, 5879-5883); (viii) multivalent fragments of antibodies (dimers, trimers and/or tetramers of scFv (Power and Hudson (2000) J. Immunol. Methods 242, 193-204); (ix) bespecifically the dimer of single-chain Fv molecules (PCT/US92/09965) and (x) "diately", polyvalent or polyspecific fragments created by fusing genes (W094/13804; P. Holliger et al. (1993) Proc. Natl. Acad. Sci. USA 90, 6444-6448).

"Site connection of an antibody" is a structural part of the molecule antibodies consisting of light chain or variable regions and hyperv�iabeling areas of heavy and light chain, that specifically binds the antigen.

The phrase "antibody molecule" in its various grammatical forms, as used here, implies both an intact immunoglobulin molecule and immunologically active portion of an immunoglobulin molecule.

Given as examples of antibody molecules are intact molecules of immunoglobulins, essentially intact molecules of immunoglobulins and such parts of the immunoglobulin molecule that contain Pratap (antigen-binding center), including those portions known in the art as Fab, Fab', F(ab')2 and F (v), which are the preferred parts for use in therapeutic methods described herein.

Antibodies may also be bespecifically, wherein one binding domain of an antibody is a member of the specific binding of the present invention, and the other binding domain has excellent specificity, for example, to enhance the effector function or etc. Bespecifically antibodies of the present invention include those wherein one binding domain of an antibody is a member of the specific binding of the present invention, including its fragment, and the other binding domain is an excellent antibody or its fragment, including fragment of excellent antibodies against EGFR, e.g.�, antibody 528 (U.S. patent No. 4943533), chimeric and humanized antibody 225 (U.S. patent No. 4943533 and WO/9640210), antibodies against de2-7, such as DH8.3 (Hills, D. et al. (1995) Int. J. Cancer. 63(4), 537-543), antibody L8A4 and Y10 (Reist, C. J. et al. (1995) Cancer Res. 55 (19): 4375-4382; C. F. Foulon et al. (2000) Cancer Res. 60 (16): 4453-4460), ICR62 (Modjtahedi, H., et al. (1993) Cell Biophys. Jan-Jun; 22 (1-3): 129-46; Modjtahedi et al. (2002) P. A. A. C. R. 55 (14): 3140-3148) or antibodies described Wikstrand, etc. (Wikstrand, C. et al. (1995) Cancer Res. 55 (14): 3140-3148). Other binding domain may be an antibody that recognizes or directed against specific cell type, as for example, in specific relation to neural or glial cells antibody. In bespecifically the antibodies of the present invention one binding domain of an antibody of the present invention may be combined with other binding domains or molecules that recognize specific receptors of cells and/or modulate cells in a special way, for example, an immunomodulator (e.g., interleukin(s)), a modulator of growth or cytokine (e.g., tumor necrosis factor (TNF), and, in particular, with TNF bespecifically modality demonstrated in the application for U.S. patent No. 60/355838, filed February 13, 2002, which is incorporated here in its entirety) or toxin (e.g., ricin), or antimitotic agent or apoptotic agent or factor.

Fab and F(ab')2-part of the antibody molecules can be prepared�you using proteolytic reaction of papain and pepsin, accordingly, essentially intact antibody molecules using methods that are well known. See, for example, U.S. patent No. 4342566 issued Theofilopolous, etc. Fab'-part of the antibody molecules are also well known and are produced from F(ab')2 portions followed by reduction of the disulfide bonds linking the two parts of the heavy chains, for example, mercaptoethanol, and followed by alkylation of the resulting protein mercaptan with a reagent, as jodatime. Here preferred is an antibody containing intact antibody molecules.

The expression "monoclonal antibody" in its various grammatical forms refers to an antibody having only one species of site compounds are antibodies that are able to join immunoreaction with a specific antigen. Thus, the monoclonal antibody typically exhibits a single binding affinity for any antigen with which it comes into immunoreaction. A monoclonal antibody may also contain an antibody molecule having a plurality of connection sites of the antibody, each of which is immunospecificity against an antigen; for example, bespecifically (chimeric) monoclonal antibody.

The term "antigen-binding domain" describes the portion of the antibody, which includes a portion which is specifically suasive�with part Xia of the antigen or antigen and complementary specified part or the entire antigen. If the antigen is large, an antibody can bind only to a particular part of the antigen called the epitope. Antigen-binding domain may be provided by one or more variable domains of the antibody. Preferably, when the antigen-binding domain comprises a variable region light chain of an antibody (VL) and variable region of the heavy chain of an antibody (VH).

"Posttranslational modification" may include any one of the modification or combination of modifications including covalent modification, protein which is exposed in the video and after disconnecting from the ribosome or at the time of formation of the polypeptide cotranslation. Post-translational modification includes, but without limitation, phosphorylation, miesterioasa, ubiquitination, glycosylation, accession of coenzyme, methylation and acetylation. Posttranslational modification may modulate or influence the activity of the protein, intracellular or extraclean target position, its stability or half-life existence, and/or recognition of ligands, receptors or other proteins. Post-translational modification may occur in cellular organelles, the nucleus or the cytoplasm, or extraclean.

The term "specific" may be used to �of brasenia to the situation in which one member of the specifically binding pair will not show any significant binding to molecules other than its partner(s) by specific binding. The term is also applicable where, for example, antigen-binding domain is specific for a particular epitope, which has a number of antigens, in this case the member of the specific binding with the antigen-binding domain is capable of binding to different antigens with the epitope.

The term "comprise(s)" is usually used in the sense of include, in other words, assuming the presence of one or more signs or components.

The term "essentially consisting of" refers to the product, in particular peptide sequence, of a certain number of residues that are not covalently attached to a larger product. In the case of the peptide of the present invention mentioned above, skilled in the art specialists recognize that it is possible, however, expect minor modifications to the N - or C-end of the peptide, such as chemical modification of the end to add a protective group or the like, for example, amidation of the C-end.

The term "dedicated" refers to the state where you reside, in accordance with the present invention, the members of the specific binding nastojasih� of the invention or a nucleic acid encoding members with such linking. Members and nucleic acid will not contain or essentially will not contain the material with which they are combined in a natural state, such as other polypeptides or nucleic acids with which they are found in its natural environment, or the environment in which they are prepared (e.g. cell culture) when such preparation is carried out using recombinant DNA technology, implemented byin vitroorin vivo. Members and nucleic acid can be prepared in a mixture with diluents or adjuvants and still for practical results to be highlighted - for example, members will normally be mixed with gelatin or other carriers if using to cover the titration microplates for use in immunoassays, or will be mixed with pharmaceutically acceptable carriers or diluents when used for diagnosis or therapy. The members of the specific binding can be glycosylated, either naturally, or by systems of heterologous eukaryotic cells, or they may be (for example, in the case of production by expression in a prokaryotic cell) deglycosylation.

Also, as used here, the term "glycosylation" and "glycosylated" include� and cover post-translational modification of proteins, called glycoproteins by attaching oligosaccharides. Attaching oligosaccharides, in particular comprising N-bound oligosaccharides and O-binding oligosaccharide is at the glycosylation sites in glycoproteins. N-bound oligosaccharides will join the Asn residue, especially when the Asn residue is located in the sequence N-X-S/T, where X cannot be Pro, or Asp, and oligosaccharides are often found in glycoproteins. The biosynthesis of N-linked glycoproteins, first in the endoplasmic reticulum (ER) glycoprotein formed, including the type of oligosaccharide with a high content of mannose (usually consisting of dolichol, N-acetylglucosamine, mannose and glucose). Glycoproteins, including the type oligosaccharides with high mannose content, then moves from the endoplasmic reticulum to the Golgi apparatus where further processing and modification of oligosaccharides. O-binding oligosaccharides join the hydroxyl group of residue Ser or Thr. In the case of O-linked glycoproteins with N-acetylglucosamine is first transferred on the balance of Ser or Thr with N-acetylglucosaminyltransferase in the endoplasmic reticulum. Then the protein travels to the Golgi apparatus, where further modification and extension chain. About the CBE�data modification can occur by simply attaching only the monosaccharide OGlcNAc in those places Ser or Thr, which can also, in great conditions, be subjected to phosphorylation, rather than glycosylation.

As used here, "PG" means picogram, "ng" means nanogram, "ug" means microgram, "mg" means milligram, "µl" means microliter, "ml" means milliliter, "l" means liter.

The terms "antibody 806", "Mat", "ch806" and any variants not specifically listed may be used here interchangeably, and as used throughout the present application and in the claims, refer to melkovodnom substance comprising one or a plurality of proteins, and apply to those proteins that have characteristics and amino acid sequences described herein and presented in SEQ ID NO: 2 and SEQ ID NO: 4, and the parameters of activities set forth herein and in the claims, and the chimeric antibody ch806, which is included in SEQ ID NO: 7 and 8 and forms a portion of SEQ ID NO: 7 and 8. Accordingly, proteins having substantially equivalent or altered activity are also provided. These modifications may be deliberate, for example, in the case of modifications, implemented through site-directed mutagenesis, or may be random in the case of modifications occurring through mutations in hosts that are producers of the complex or its mentioned subunits. Meanwhile�Xia, the terms "antibody 806", "Mat and ch806 also include within its scope proteins mentioned in particular here, as well as all substantially homologous analogs and allelic variants.

The terms "humanized antibody 806", "hu806 and generowanie antibody 806" and any variants not specifically listed may be used here interchangeably, and as used throughout the present application and in the claims, refer to melkovodnom substance comprising one or a plurality of proteins, and apply to those proteins that have characteristics and amino acid sequences described herein and presented in SEQ ID NO: 42 and SEQ ID NO: 47, and the parameters of activities set forth herein and in the claims. Accordingly, proteins having substantially equivalent or altered activity are also provided. These modifications may be deliberate, for example, in the case of modifications, implemented through site-directed mutagenesis, or may be random in the case of modifications occurring through mutations in hosts that are producers of the complex or its mentioned subunits. It is assumed that the terms "humanized antibody 806", "hu806 and generowanie antibody 806 also include within its scope proteins mentioned in particular here, as well�e, all substantially homologous analogs and allelic variants.

The terms "antibody 175" and "Mat" and any variants not specifically listed may be used here interchangeably, and as used throughout the present application and in the claims, refer to melkovodnom substance comprising one or a plurality of proteins, and apply to those proteins that have characteristics and amino acid sequences described herein and presented in SEQ ID NO: 129 and SEQ ID NO: 134, and the parameters of activities set forth herein and in the claims. Accordingly, proteins having substantially equivalent or altered activity are also provided. These modifications may be deliberate, for example, in the case of modifications, implemented through site-directed mutagenesis, or may be random in the case of modifications occurring through mutations in hosts that are producers of the complex or its mentioned subunits. It is assumed that the terms "antibody 175" and "Mat also include within its scope proteins mentioned in particular here, as well as all substantially homologous analogs and allelic variants.

The terms "antibody 124" and "Mat" and any variants not specifically listed may be used here interchangeably, and as used throughout the present application and in the claims is invent�tion, refer to melkovodnom substance comprising one or a plurality of proteins, and apply to those proteins that have characteristics and amino acid sequences described herein and presented in SEQ ID NO: 22 and SEQ ID NO: 27, and the parameters of activities set forth herein and in the claims. Accordingly, proteins having substantially equivalent or altered activity are also provided. These modifications may be deliberate, for example, in the case of modifications, implemented through site-directed mutagenesis, or may be random in the case of modifications occurring through mutations in hosts that are producers of the complex or its mentioned subunits. It is assumed that the terms "antibody 124" and "Mat also include within its scope proteins mentioned in particular here, as well as all substantially homologous analogs and allelic variants.

The terms "antibody 1133" and "Mat" and any variants not specifically listed may be used here interchangeably, and as used throughout the present application and in the claims, refer to melkovodnom substance comprising one or a plurality of proteins, and apply to those proteins that have characteristics and amino acid sequences described herein, and n�zestawienie in SEQ ID NO: 32 and SEQ ID NO: 37, and the parameters of activities set forth herein and in the claims. Accordingly, proteins having substantially equivalent or altered activity are also provided. These modifications may be deliberate, for example, in the case of modifications, implemented through site-directed mutagenesis, or may be random in the case of modifications occurring through mutations in hosts that are producers of the complex or its mentioned subunits. It is assumed that the terms "antibody 1133" and "Mat also include within its scope proteins mentioned in particular here, as well as all substantially homologous analogs and allelic variants.

Preferably, when the amino acid residues described herein are isomeric "L"-shape. However, isomeric residues in the "D"-form can be substituted for any L-amino acid residue, if the polypeptide retains the desired functional property of binding of immunoglobulin. NH2refers to the free amino group present on aminocore polypeptide. COOH refers to the free carboxyl group present at the carboxyl end of the polypeptide. In accordance with the standard nomenclature of polypeptides, J. Biol. Chem., 243: 3552-3559 (1969), abbreviations for amino acid residues are presented in the following table corresponds to the�via:

Table of compliance

You should note that all the sequence of amino acid residues represented by formulae orientation from left to right corresponds to a common direction from aminobenzo to the carboxyl end. In addition, you should note that a dash at the beginning or end of the sequence of amino acid residues indicates a peptide bond with an additional sequence of one or more amino acid residues. The table above is presented for linking the three-letter and one-letter images which can, alternatively, be included here.

A "replicon" is any genetic element (e.g., plasmid, chromosome, virus) that functions as an Autonomous unit of DNA replicationin vivo; i.e., capable of replication under its own control.

"Vector" is a replicon, such as plasmid, phage or cosmid to which can be attached to another piece of DNA in order to cause the replication of the attached segment.

"DNA molecule" refers to a polymeric form of deoxyribonucleotides (adenine, guanine, thymine, or cytosine) in its either single stranded form, or the form of a double-stranded helix. This term refers only to the primary and secondary with�ructure molecule, and it is not limited to any particular tertiary forms. Thus, this term includes double-stranded DNA found, in particular, in linear DNA molecules (e.g., restriction fragments), viruses, plasmids, and chromosomes. When discussing the structure of particular double-stranded molecules of DNA sequences can be described in accordance with the usual rule of providing only the sequence in the direction from 5' to 3' along retranscribing the DNA chain (i.e. chain having a sequence homologous to the mRNA).

"Start replication" refers to those DNA sequences that participate in DNA synthesis.

"Coding sequence" is a DNA sequence is double-stranded DNA, which undergoes transcription and translation to polypeptidein vivoonce placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by the initiating codon at the 5' (amino)end and a codon translation termination at the 3' (carboxyl) end. Coding sequence can include, but are not limited to, prokaryotic sequences, cDNA-based eukaryotic mRNA, genomic DNA sequence from eukaryotic DNA (e.g., DNA of a mammal) and even by synthetic�DNA sequence. The polyadenylation signal and the sequence termination of transcription will usually be located 3' from the coding sequence.

Control the transcription and translation sequences are regulatory DNA sequences, such as promoters, enhancers, polyadenylation signals, terminators, etc., which provide expression of the coding sequence in the host cell.

"Promotor sequence" is a regulatory region of DNA capable of contact with RNA polymerase in a cell and initiating transcription in the direction of the gene (3'-direction) coding sequence. With the aim of defining the present invention, the promoter sequence is limited at its 3'-end of the site of transcription initiation and extends in the opposite direction of expression (5'-direction), with the inclusion of the minimum number of bases or elements necessary to initiate transcription at detectable levels exceeding background. Within the promoter sequence will meet the site of initiation of transcription (usually defined by mapping with nuclease S1), as well as binding proteins domains (consensus sequences) responsible for the binding of RNA polymerase. Eukaryotic Pro�otori will often, but not always, contain "TATA"boxes and "CAT"boxes. Prokaryotic promoters contain sequences Shine-Dalgarno in addition to the -10 and -35 consensus sequences.

"Control expression sequence" is a DNA sequence that controls and regulates the transcription and translation of another DNA sequence. Coding sequence is "under control" control the transcription and translation sequences in a cell when RNA polymerase transcribes the encoding sequence in an mRNA which is then translated into the protein encoded by the coding sequence.

Before the coding sequence can be switched "signal sequence". This sequence encodes a signal peptide which is N-terminal relative to the polypeptide, which sends a cage-owner a message about the direction of the polypeptide on a cell surface or secretion of the polypeptide into the environment, and this signal peptide is cut off by the host cell before the protein leaves the cell. The signal sequence can be detected associated with a number of proteins that are characteristic of prokaryotes and eukaryotes.

The term "oligonucleotide" as used here when referring to the probe of the present invention, is defined as a molecule consisting of two or more ribonucleotides, preferably more than three. Its exact size will depend on many factors, which, in turn, depend upon the ultimate function and use of the oligonucleotide.

Used here, the term "primer" refers to an oligonucleotide, or found in nature, such as the purified product of cleavage by restriction enzymes, or created synthetically, which is capable of acting as a point of initiation of synthesis of the conditions in which synthesis is induced by the product of the elongation of the primer, which is complementary strands of nucleic acid, i.e. in the presence of nucleotides and an inducing agent such as DNA polymerase and at a suitable temperature and pH. The primer may be either single-stranded or double-stranded and must be sufficiently long to serve as a primer for synthesis of the desired product elongation in the presence of the inducing agent. The exact length of the primer will depend on many factors, including temperature, source of primer and use of the method. For example, for diagnostic applications, depending on the complexity of the target sequence, the primer is in the form of oligonucleotide typically contains 15-25 or more nucleotides, although it may contain fewer nucleotides.

Primers is chosen so as to be "substantially" complementary� various specific circuits, the targeted DNA sequence. This means that the primers must be sufficiently complementary to gibridizatsiya with their corresponding circuits. Therefore, you do not want the sequence of primer reflect the exact sequence of the matrix. For example, to the 5'-end of the primer may be attached complementary nucleotide fragment, with the remaining portion of the sequence of the primer is complementary strands. Alternatively, the primer may be located at intervals complementary bases or longer sequences, provided that the sequence of the primer is sufficiently complementary to the sequence circuit to gibridizatsiya with her and, thereby, to form a template for synthesis of the product of elongation.

As used herein, the terms "restriction endonuclease" and "restriction enzymes (restrictase)" refer to bacterial enzymes, each of which cut double-stranded DNA at specific nucleotide sequences or close to it.

A cell is "transformed" by exogenous or heterologous DNA when such DNA introduced into the cell. The transforming DNA may be integrated or may not be integrated (covalently to contact) in chromosomal DNA component of the genome of the cell. In procar�Utah, yeast and mammalian cells, for example, the transforming DNA may persist in episomal element, such as a plasmid. With regard to eukaryotic cells, a stably transformed cell is a cell in which the transforming DNA has become integrated into the chromosome, whereby it is inherited by daughter cells with replicated chromosomes. This stability is manifested in the ability of the eukaryotic cell to establish cell lines or clones comprised of a population of daughter cells containing the transforming DNA. "Clone" is a population of cells derived from a single cell or common predecessor as a result of mitosis. "Cell line" is a clone of a primary cell that is capable of stable growth ofin vitroover many generations.

Two DNA sequences are "substantially homologous" when at least about 75% (preferably at least about 80% and most preferably at least about 90 or 95%) of the nucleotides match over the full defined length of the DNA sequences. Sequences that are substantially homologous can be identified by comparing the sequences available in data banks consistently�threads, using standard software, or by comparing the sequences in the experiment using Southern hybridization, for example, stringent conditions as defined for that particular system. The determination of an appropriate hybridization conditions is within the limits of knowledge in the art. See, for example, Maniatis et al., above; DNA Cloning, Vols. I & II, supra; Nucleic Acid Hybridization, supra.

You should take into account that within the scope of the present invention are DNA sequences encoding members of the specific binding (antibodies) of the present invention that encode antibodies having the sequence presented here, but which are degenerate with respect to such sequences. By "relatively degenerate" means that uses a different three-letter codon to determine the specific amino acid. In the art it is well known that the following codons can be used interchangeably to code each specific amino acid:

It should be understood that the codons specified above are present in the case of RNA sequences. The corresponding codons in the case of DNA have a T instead of U.

For example, in the described sequence anti�eaten of the present invention can be carried out mutation of the conditions to a specific codon was replaced with a codon that encodes an excellent amino acid. This mutation is usually carried out through the implementation of least number of possible nucleotide changes. The mutation with the replacement of this type can be used to replace amino acids in the resulting protein non-conservative manner (i.e., by replacing codons with replacement of amino acids belonging to the group of amino acids having a particular size or characteristics, to an amino acid belonging to another group) or in a conservative way (i.e., by replacing codons with replacement of amino acids belonging to the group of amino acids having a particular size or characteristics, to an amino acid belonging to the same group). Such conservative substitution generally leads to less change in the structure and function of the resulting protein. In all likelihood, a non-conservative substitution change the structure, activity or function of the resulting protein. Should take into account that the present invention includes sequences containing conservative substitutions that do not alter significantly the activity or properties of the contact of the resulting protein.

One example of various groupings of amino acids is the following example:

Amino acids with nonpolar R groups:

alanine, valine, leucine, ISO�Azin, Proline, phenylalanine, tryptophan, methionine;

Amino acids with uncharged polar R groups:

glycine, serine, threonine, cysteine, tyrosine, asparagine, glutamine;

Amino acids with charged polar R groups(negatively charged at pH 6.0):

aspartic acid, glutamic acid;

Essential amino acids(positively charged at pH 6.0):

lysine, arginine, histidine (at pH 6.0).

Another group may be those amino acids, which have phenyl groups:

phenylalanine, tryptophan, tyrosine.

Another grouping can be made according to molecular weight (i.e., size of R groups):

Glycine75
Alanine89
Serine105
Proline115
Valine117
Threonine119
Cysteine121
Leucine131
IsoleucineAsparagine132
Aspartic acid133
Glutamine146
Lysine146
Glutamic acid147
Methionine149

Histidine (at pH 6.0)155
Phenylalanine165
Arginine174
Tyrosine181
Tryptophan204

Particularly preferred substitutions are:

- Lys instead of Arg and Vice versa, so that a positive charge may be maintained;

- Glu instead of Asp and Vice versa, so that a negative charge may be maintained;

- Ser instead of Thr so that a free-OH can be maintained; and

- Gln Asn instead, so that a free NH2 can be maintained.

Replacement of amino acids can also result in the substitution of amino acids with especially predpochtitel�tion property. For example, the introduction of Cys may lead to a potential site for the formation of disulfide bridges with another Cys. A His may be introduced as a particularly "catalytic" site (i.e., His can act as an acid or base and is the most common amino acid in biochemical catalysis). Pro may be introduced because of its particularly planar structure, which generates troeckie turns in the protein structure.

Two amino acid sequences are "substantially homologous" when at least about 70% (preferably at least about 80% and most preferably at least about 90 or 95%) amino acid residues are identical, or represent conservative substitutions.

"Heterologous" region of DNA constructs is an identifiable segment of DNA within a larger DNA molecule that is not found in connection with the larger molecule in nature. Thus, when the heterologous region encodes a gene of a mammal, the gene will usually be flanked by DNA that does not fenceroy genomic DNA of a mammal in the genome of the organism of its source. Another example of a heterologous coding sequence is a structure, which itself encodes a sequence not found in nature (for example�EP, cDNA, if the genomic coding sequence contains introns, or synthetic sequences having codons different from those of the natural gene). Allelic variation or naturally occurring mutational events do not give rise to a heterologous region of DNA, are described here.

The expression "pharmaceutically acceptable" refers to molecular objects and compositions that are physiologically portable and usually do not cause allergic or similar adverse reaction, such as gastric upset, dizziness, etc., after the introduction of the person.

The expression "therapeutically effective amount", as used here, means an amount sufficient to prevent, and preferably reduce by at least about 30 percent, preferably at least 50%, preferably at least 70%, preferably at least 80%, preferably at least 90% of clinically significant change, growth or progression or mitotic activity of a target cellular mass, a group of cancer cells or tumor, or other pathologic features. Can be reduced, for example, the degree of activation or activity of EGFR, or the number or the number of EGFR-positive cells, in particular, engage in �aimogasta with antibodies or binding members or positive cells.

A DNA sequence is "functionally connected" with control expression sequence, when controls expression of the sequence controls and regulates the transcription and translation of this DNA sequence. The term "functionally linked" includes having an appropriate initiation signal (e.g., ATG) in front of the DNA sequence, suitable for expression, and the preservation of the correct reading frame to permit expression of the DNA sequence under the control of regulatory expression sequences and production of the desired product encoded by the DNA sequence. If the gene that you want to embed in a recombinant DNA molecule does not contain suitable initiation signal, the initiation signal can be embedded before the genome.

The term "standard hybridization conditions" refers to related to salt and temperature conditions substantially equivalent to 5×SSC and 65°C for hybridization and washing. However, the skilled in this technical field specialist will be clear that such "standard hybridization conditions" are dependent on particular conditions including the concentration of sodium and magnesium in the buffer, the length and concentration of the nucleotide sequences, the percentage of discrepancies, percent formamide, etc. the definition of "standard�conditions of hybridization" is also important are two gibridizatsiya sequence RNA-RNA, DNA-DNA or RNA-DNA. Skilled in the art specialist can easily determine such standard hybridization conditions in accordance with a well-known formula, and hybridization is carried out at a temperature, which is typically 10-20°C below the predicted or certain Tm, using more stringent washes, if desired.

The present invention provides a new member of the specific binding, in particular, an antibody or a fragment thereof, including immunogenic fragments, which recognizes an EGFR epitope which is found in forming a tumor, hyperproliferative or abnormal cells in which the epitope is enhanced or pronounced as a result of aberrant posttranslational modifications and is not detectable in normal cells or wild-type cells. In specific, non-limiting embodiment of the connecting member, such as an antibody that recognizes an EGFR epitope which is amplified or expressed as a result of modification with the joining of simple carbohydrates or early glycosylation and is weakened or is not expressed in the presence of a glycosylation modification or the addition of complex carbohydrates. The member of the specific binding, such as ant�body or a fragment thereof, not associated with normal cells or wild-type cells containing normal EGFR epitope or epitope of EGFR wild-type, or recognize them in the absence of sverkhekspressiya and in the presence of normal posttranslational modifications of EGFR.

The present invention additionally provides new antibody 806, 175, 124, 1133, ch806, and hu806 and fragments thereof, including immunogenic fragments, which recognizes an EGFR epitope, in particular, the EGFR peptide (287CGADSYEMEEDGVRKC302(SEQ ID NO: 14)), which is found in forming a tumor, hyperproliferative or abnormal cells in which the epitope is amplified, detected or expressed, and is not detectable in normal cells or wild-type cells. In particular, but not limiting embodiment of the antibody recognizes an EGFR epitope which is amplified or expressed as a result of modification with the joining of simple carbohydrates or early glycosylation and is weakened or is not expressed in the presence of a glycosylation modification or the addition of complex carbohydrates. The antibody or fragment does not bind to normal cells or wild-type cells containing normal EGFR epitope or epitope of EGFR wild-type, or recognize them in the absence of sverkhekspressiya, amplification or carcinogenesis.

In a particular aspect of the present invention, and as mentioned above, the authors of the present invention have discovered a new monoclonal antibody 806, 175, 124, 1133, ch806, and hu806 that specifically detect amplified EGFR wild-type and de2-7 EGFR, although contact with the epitope that is different from the unique connective peptide mutated de2-7 EGFRn. In addition, despite the fact that Mat, Mat, Mat, Mat hu806 and do not recognize normal EGFR wild type presented on the cell surface of glioma cells, they do connect with extraclean domain of EGFR immobilized on the surface of tablets for ELISA, which is indicative of a conformational epitope from the perspective of a polypeptide.

It is important that Mat, Mat, Mat, Mat, ch806, and hu806 do not bind significantly to normal tissues such as liver and skin, which Express endogenous EGFR wild type at levels that exceed those in most of other normal tissues, but in which EGFR is not expressed or amplified. Thus, Mat, Mat, Mat, Mat hu806 and demonstrate new and useful specificity, recognizing de2-7 EGFR and amplificatory EGFR, while not discerning normal EGFR wild-type or unique connecting peptide, which is a characteristic feature of de2-7 EGFR. In a preferred aspect Mat, Mat, Mat, Mat and hu806 infusion�of the invention include the amino acid sequence of CDR of VH and VL domains, shown in Fig. 14B and 15B; 74B and 75B; 51B and 51D; 52B and 52D; and 55A and 55B, respectively (SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively; SEQ ID NO: 42 comprising the signal peptide hu806 VH, and VH sequence SEQ ID NO: 163 and 164, respectively, and SEQ ID NO: 47, comprising the signal peptide hu806 VL, and VL sequence SEQ ID NO: 165 and 166, respectively).

In another aspect the present invention provides an antibody capable of competing with the 175 antibody under conditions in which binding of at least 10% of an antibody having the sequence of VH and VL of the antibody 175 (SEQ ID NO: 129 and 134, respectively), with de2-7EGFR blocked as a result of competition with such an antibody in the ELISA analysis. As stated above, there is a plan idiotypic antibodies.

The present invention relates to the members of the specific binding, in particular antibodies or their fragments, which recognizes an EGFR epitope which is present in cells expressing amplificatory EGFR gene or expressing de2-7 EGFR, and is not detectable in cells expressing normal EGFR or EGFR wild type, especially in the presence of normal post-translational modification.

In addition, attention is drawn here and it is demonstrated that additional non-limiting result of observation or characteristic of the antibodies of the present invention is located�navanee their epitope in the presence of a large number of mannose residues, which is a characteristic feature of the early glycosylation or modification is the addition of simple carbs. Thus, altered or aberrant glycosylation provides the presence and/or recognition of the epitope by the antibody is or comprises a portion of the detected antibody epitope.

Glycosylation and includes covers of posttranslational modification of proteins, called glycoproteins by attaching oligosaccharides. Attaching oligosaccharides, in particular comprising N-bound oligosaccharides and O-binding oligosaccharide is at the glycosylation sites in glycoproteins. N-bound oligosaccharides will join the Asn residue, especially when the Asn residue is located in the sequence N-X-S/T, where X cannot be Pro, or Asp, and oligosaccharides are often found in glycoproteins. The biosynthesis of N-linked glycoproteins, first in the endoplasmic reticulum glycoprotein formed, including the type of oligosaccharide with a high content of mannose (usually consisting of dolichol, N-acetylglucosamine, mannose and glucose). Glycoproteins, including the type oligosaccharides with high mannose content, then moves from the endoplasmic reticulum to the Golgi apparatus, where they are usually further processor�tion and modification of oligosaccharides. O-binding oligosaccharides join the hydroxyl group of residue Ser or Thr. In the case of O-linked glycoproteins with N-acetylglucosamine is first transferred on the balance of Ser or Thr with N-acetylglucosaminyltransferase in the endoplasmic reticulum. Then the protein travels to the Golgi apparatus, where further modification and extension chain.

In a particular aspect of the present invention, and as indicated above, the authors of the present invention discovered novel monoclonal antibodies, examples of which are antibodies, called Mat (and its chimeric form of ch806), Mat, Mat, Mat and hu806 that specifically recognize amplificatory EGFR wild-type and de2-7 EGFR, although contact with the epitope that is different from the unique connective peptide mutated de2-7 EGFR. The antibodies of the present invention specifically recognize expressed EGFR, including amplificatory EGFR and mutant EGFR (an example of which is a mutation of the de2-7), in particular, result in aberrant posttranslational modifications. In addition, despite the fact that these antibodies do not recognize normal EGFR wild type presented on the cell surface of glioma cells, they do connect with extraclean domain of EGFR immobilized on the surface of tablets for ELISA, what is PR�sign conformational epitope from the perspective of the polypeptide. Importantly, these antibodies do not bind to a significant extent in normal tissues, such as liver and skin, which Express endogenous EGFR wild type at levels that exceed those in most of other normal tissues, but in which EGFR is not expressed or amplified. Thus, these antibodies demonstrate new and useful specificity, recognizing de2-7 EGFR and amplificatory EGFR, while not discerning normal EGFR wild-type or unique connecting peptide, which is a characteristic feature of de2-7 EGFR.

In a preferred aspect, the antibodies are antibodies that have the characteristics of antibodies that have been identified and characterized by the authors of the present invention, in particular, recognizes amplificatory EGFR and de2-7EGFR. In especially preferred aspects, the antibodies are met, Mat, Mat, Mat and hu806 or their active fragments. In a further preferred aspect the antibody of the present invention includes amino acid sequences of VH and VL shown in Fig. 16 and 17; 74B and 75B; 51B and 51D; 52B and 52D; and 55A and 55B, respectively.

Preferably, the epitope recognized by a member of the specific binding or antibody is within the region comprising residues 273-501 sequence of the Mature normal EGFR EGFR wild-type, and preferably, the epitope includes residues 287-302 (SEQ ID NO: 14) sequences of the Mature normal EGFR or EGFR wild-type. Therefore, also provided are specific binding proteins, such as antibodies that bind to de2-7 EGFR in the epitope, which is located in the region comprising residues 273-501 EGFR sequence and comprising residues 287-302 EGFR sequence (SEQ ID NO: 14). The epitope can be determined using any of the conventional methods of mapping of epitopes, known to skilled in the art specialist. Alternatively, one could cleave the DNA sequence encoding residues 273-501 and 287-302 (SEQ ID NO: 14), and the resulting fragments to Express in a suitable host. Antibody binding could be defined as above.

In particular, the member will bind to the epitope comprising residues 273-501, and more particularly comprising residues 287-302 (SEQ ID NO: 14) Mature normal EGFR or EGFR wild-type. However, the aspect of the present invention also comprise other antibodies that demonstrate the same or a substantially similar pattern of reactivity. They can be identified by comparing such members with an antibody comprising VH and VL domains presented in SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively. The comparison will usually be held, used�isua Western blotting, in which connecting members are subjected to binding to the blot in two repetitions, prepared from nuclear drug of cells, which can directly compare the pattern of linking.

In another aspect the present invention provides an antibody capable of competing with Mat under conditions in which binding of at least 10% of an antibody having the sequence of VH and VL of one of such antibodies, with de2-7EGFR blocked as a result of competition with such an antibody in the ELISA analysis. As described above, and illustrated here are provided idiotypic antibodies.

In another aspect the present invention provides an antibody capable of competing with Mat, Mat and/or Mat under conditions in which binding of at least 10% of an antibody having the sequence of VH and VL of one of such antibodies, with de2-7EGFR blocked as a result of competition with such an antibody in the ELISA analysis. As described above, and illustrated here are provided idiotypic antibodies.

In another aspect the present invention provides an antibody capable of competing with Mat, Mat, Mat, Mat and/or hu806 under conditions in which binding of at least 10% of an antibody having the sequence of VH and VL of one of such antibodies, with de2-7EGFR blocked as a result of competition with such an�iteam in the ELISA analysis. As described above, and illustrated here are provided idiotypic antibodies.

The selected polypeptide essentially consisting of epitope comprising residues 273-501, and more particularly comprising residues 287-302 (SEQ ID NO: 14) of the Mature EGFR wild type, is another aspect of the present invention. The peptide of the present invention, in particular, is applicable in diagnostic studies or sets, and a therapeutically or prophylactically, including as anti-tumor or anti-cancer vaccine. Thus, the peptide compositions of the present invention include pharmaceutical compositions and immunogenic compositions.

Diagnostic and therapeutic use

The unique specificity of the members of the specific binding, in particular antibodies or fragments thereof, of the present invention, whereby the binding members(member) detect EGFR epitope which is found in forming a tumor, hyperproliferative or abnormal cells and is usually not detectable in normal cells or wild-type cells, and this epitope is enhanced or pronounced as a result of aberrant post-translational modification, and wherein the members(member) contact de2-7 EGFR and amplified EGFR but not with EGFR wild-type, provides diagnostic and therapeutic applied�I for identification, characterization and transformation in the target and treatment, reduction or elimination of a number of types comprising the tumor cells and types of tumors, such as tumors of the head and neck, breast, lung, bladder or prostate cancer and glioma, without the problems associated with the absorption of normal tissues, which can be observed when using previously known antibodies against EGFR. Thus, cells sverkhekspressiya EGFR (e.g., as a result of amplification or expression of a mutant or variant EGFR), especially those who demonstrate aberrant post-translational modification, can be recognized, selected, described, and transformed into a target and subjected to treatment or elimination, using a connecting member(s), in particular, the antibody(a) or fragments thereof, of the present invention.

In a further aspect the present invention provides a method of treating a tumor, a cancerous condition, a precancerous condition, and any state associated with the growth of hyperproliferative cells or consequential of such growth, including the introduction Mat, Mat, Mat, Mat and/or hu806.

The antibodies of the present invention can, thus, specific way to determine the nature of positive EGFR forming tumors or tumor cells by staining or other recognition �Pacific tumors or cells in which there is overexpression of EGFR, including amplification and/or mutation of EGFR, in particular de2-7EGFR. In addition, the antibodies of the present invention, examples of which are met (and chimeric antibody ch806), Mat, Mat, Mat and hu806, showing significantin vivoantitumor activity against tumors containing amplificatory EGFR, and against positive de2-7 EGFR xenografts.

As outlined above, the authors present invention found that the member of the specific binding of the present invention detects associated with tumors of the forms of the EGFR (de2-7 EGFR and amplificatory EGFR), but not the normal wild-type receptor, expressed in normal cells. Suppose that the detection antibody is dependent on aberrant post-translational modification (for example, a unique variant glycosylation, acetylation or phosphorylation) of EGFR are presented in the cells, demonstrating sverkhekspressiya EGFR gene.

As described below, the antibodies of the present invention have been used in therapeutic studies and are found to inhibit the growth sverkhekspressiya (e.g. amplification) EGFR xenografts and expressing de2-7 EGFR human xenografts of human tumors and cause significant necrosis in these tumors.

In addition, antibodies �altoadige of the invention inhibit the growth of intracranial tumors in a preventive model. This model involves the injection of glioma cells expressing de2-7 EGFR, Nude thymus of mice, and then intracranial injection of antibodies either on the same day, or within 1-3 days, optionally using multiple doses. Fittingly, when the dose of approximately 10 μg. Mice, which were injected antibody, compared with controls, and it was found that the survival rate of the treated mice is significantly increased.

Therefore, in a further aspect the present invention provides a method of treating a tumor, a cancerous condition, a precancerous condition, and any state associated with the growth of hyperproliferative cells or resulting from such growth, including the introduction of a member of the specific binding of the present invention.

The antibodies of the present invention are intended for use in the methods of diagnosis and treatment of tumors in which human or animal subjects, particularly epithelial tumors. These tumors can be primary or secondary solid tumors of any type, including, but not limited to, glioma, breast tumor, lung, prostate, head or neck.

The creation of a binding member or antibody

The General methodology for making monoclonal antibodies using hybridomas x�well known. Line of immortal, of antibody-producing cells can also be created using methods other than fusion, such as direct transformation of B-lymphocytes oncogenic DNA, or transfection with Epstein-Barr. See, e.g., M. Schreier et al., "Hybridoma Techniques" (1980); Hammering et al., "Monoclonal Antibodies And T cell Hybridomas" (1981); Kennett et al., "Monoclonal Antibodies" (1980); see also U.S. patents№ 4341761, 4399121, 4427783, 4444887, 4451570, 4466917, 4472500, 4491632 and 4493890.

Panels of monoclonal antibodies, developed against EFGR, can be screened for various properties; i.e., isotype, epitope, affinity, etc. of Particular interest are monoclonal antibodies that mimic the activity of EFGR or its subunits. Such monoclonal antibodies can easily be identified in the analysis of activity of the members of the specific binding. Also applicable antibodies with high affinity, when possible immunoaffinity purification of natural or recombinant member of the specific binding.

Methods of obtaining polyclonal antibodies against EFGR well known in the art. Cm. U.S. patent No. 4493795 issued to Nestor, etc. a Monoclonal antibody, typically containing Fab and/or F(ab')2-parts of an effective antibody molecules, can be prepared using hybrid technology described in Antibodies-A Laboratory Manual, Harlow and Lane, eds., Cold Spring Harbor Laboratory, New York (1988), which is included here through�your links. Briefly, to generate hybridomas, from which the structure in the form of monoclonal antibodies, the cell lines of myeloma or other may persist indefinitely cells fused with lymphocytes obtained from the spleen of a mammal hyperimmunized with relevant EGFR.

Splenocytes are typically fused with myeloma cells using polyethylene glycol (PEG) 6000. The resulting fusion hybrids are selected according to their sensitivity to HAT. The hybridomas producing a monoclonal antibody useful for the implementation of this invention, will be identified by their ability to join immunoreaction with the antibody or binding member of the present invention and their ability to inhibition of a specific oncogenic or hyperproliferative activity in the target cells.

A monoclonal antibody useful for the implementation of the present invention, can be produced through the initiation of culture producing monoclonal antibody hybridomas comprising a nutrient medium containing a hybridoma that secretes antibody molecules with the specificity of the corresponding antigen. The culture is maintained at conditions and for a time period sufficient for secretion by hybridoma antibody molecules on Wednesday. Containing antibodies environment then collect. Then Molek�crystals antibodies can distinguish further by using well-established methods.

Regulations for the preparation of these structures, and are widely known in the art and commercially available and include synthetic culture media, inbred mice, etc. Cited as an example of a synthetic environment is minimal supportive environment of Dulbecco (DMEM; Dulbecco et al., Virol. 8: 396 (1959)) supplemented with 4.5 g/l glucose, 20 mm glutamine and 20% fetal calf serum. Cited as an example of the inbred line of mice is Balb/c.

In this field of technology is also widely known methods of producing monoclonal antibodies against EGFR. Cm. Niman et al., Proc. Natl. Acad. Sci. USA, 80: 4949-4953 (1983). As an immunogen typically use EGFR or peptide analogue either by itself or in combination with immunogenic carrier in the previously described procedure for producing monoclonal antibodies against EGFR. The hybridomas are screened for the ability to produce antibodies, which comes into immunoreactive with EGFR present in forming a tumor, or abnormal hyperproliferative cells. Other antibodies against EGFR include, but are not limited to, antibody HuMAX-EGFr from Genmab/Medarex, the 108 antibody (ATCC HB9764 and U.S. patent No. 6217866) and antibody 14E1 from Schering AG (U.S. patent No. 5942602).

Recombinant binding members, chimeric molecules, bespecifically molecules and fragments

Usually CDR1-memb�Ki, comprising the amino acid sequence essentially presented as CDR1-areas with SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively, will be contained in the structure, which allows CDR1-sites to bind to the tumor antigen. In the case of CDR1-phase with SEQ ID NO: 4, for example, it preferably contains a plot of VL SEQ ID NO: 4 (and similarly for other sequences listed).

Usually CDR2-areas comprising the amino acid sequence essentially presented as CDR2-areas with SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively, will be contained in the structure, which allows CDR2-sites to bind to the tumor antigen. In the case of CDR2-phase with SEQ ID NO: 4, for example, it preferably contains a plot of VL SEQ ID NO: 4 (and similarly for other sequences listed).

Usually CDR3-areas comprising the amino acid sequence essentially presented as CDR3-areas with SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively, will be contained in the structure, which allows CDR3-regions to bind to the tumor antigen. In the case of CDR3-phase SEQ ID NO: 4, for example, it preferably contains a plot of VL SEQ ID NO: 4 (and similarly for other sequences listed).

By "essentially presented" means that CDR-areas, e.g.� CDR3-areas, the present invention will be either identical or highly homologous to certain areas of SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively. The term "highly homologous" is meant that one or more CDRs can be carried out only a small number of substitutions, preferably from 1 to 8, preferably from 1 to 5, preferably from 1 to 4, or from 1 to 3, or 1 or 2 substitutions. It is also assumed that such terms include truncation CDR, provided that the resulting antibody exhibits unique properties of a class of antibodies discussed here, for example, to show Mat, Mat, Mat, Mat and hu806.

Usually the structure containing the CDR of the present invention, in particular CDR3, the structure with sequence of the heavy or light chain of the antibody or its significant part, in which CDR-stations are located at places corresponding to the locations of CDR-plots occurring variable domains of the heavy and light chains of the antibody VH and VL domains encoded subjected rearrangeable genes of immunoglobulins. The structure and location of variable domains of antibodies can be determined, based on Kabat, E. A. et al., Sequences of Proteins of Immunological Interest. 4th Edition. US Department of Health and Human Services. 1987, and updates currently available on the Internet (). In addition, this is known as the qual�Spain and Portugal in the art specialists the definitions of CDR can be done in many different ways. Can be used, for example, the analysis to determine domains by Kabat, Chothia and combined tests. In this regard, see, for example, .

Preferably, the amino acid sequence is essentially presented as the remains of VH CDR in the antibody of the present invention reside in the variable domain of the heavy chain of a human antibody or a substantial part thereof, and the amino acid sequence is essentially presented as the remains of the VL CDR in the antibody of the present invention reside in the variable domain light chain antibodies or a substantial part thereof.

The variable domains may be derived from a variable domain of the germ line or subjected rearrangeable variable domain of a human or may be a synthetic variable domain based on consensus sequences of known variable domains of a human. Originating from the CDR3 sequences of the present invention, for example described in the preceding paragraph, may be embedded in a set of variable domains lacking a CDR3-areas, using recombinant DNA technology.

For example, Marks et (Bio/Technology, 1992, 10: 779-783) describe methods of creating sets of variable domains of antibodies that use consensus PR�emery, targeting the 5'-end of the variable domain or the adjacent region, in conjunction with consensus primers to the third frame region VH genes of a person to provide a set of variable domains VH, missing CDR3. Marks, etc., in addition, describe how this set can be combined with a CDR3 of a particular antibody. Using similar methods, originating from the CDR3 sequences of the present invention may be shuffled with sets of VH or VL domains lacking CDR3, and the shuffled complete VH or VL domains may be combined with a cognate VL or VH domain to provide members of the specific binding of the present invention. Then the set can be represented in a suitable host system such as the phage display system W092/01047, which might be a selection of suitable members of the specific binding. The set can consist of anything ranging from 104individual members, for example, from 106up to 108or 1010members.

Similar ways of shuffling or combinatorial techniques are also described by Stemmer (Nature, 1994, 370: 389-391), who describes the technique in relation to the gene of β-lactamases, but argues that this approach can be used to generate antibodies.

An additional alternative is the creation of new VH - or VL-regions, sod�rasih originating from the CDR3 sequences of the present invention, using non-specific mutagenesis, for example, genes of the VH or VL Mat to generate mutations within the whole variable domain. This method is described Gram and others (1992, Proc. Natl. Acad. Sci., USA, 89: 3576-3580), who used allowing PCR errors.

Another method that can be used, the mutagenesis is directed to CDR-sections of genes of VH or VL. Such methods are described by Barbas and others (1994, Proc. Natl. Acad. Sci. USA, 91: 3809-3813) and Schier et al (1996, J. Mol. Biol. 263: 551-567).

All methods described above are known as such in the art and do not themselves form part of the present invention. A qualified technician will be able to use such methods to ensure that members of the specific binding of the present invention, using conventional in the art methodology.

A substantial part of the variable domain of the immunoglobulin will include at least three CDR-site together with in-between frame areas. Preferably, this portion will also include at least about 50% of either one of the two or both of the following areas: first and fourth frame areas, and these 50% are C-terminal 50% of the first frame region and the N-terminal 50% of the fourth frame region. Additional residues at the N-end or C-end of a significant part of the variable domain can be that way, Coto�s not usually found attached to nature variable domains. For example, the construction of the members of the specific binding of the present invention carried out using the methods of recombinant DNA, may lead to the introduction of N - or C-terminal residues encoded by linkers that are embedded to facilitate cloning or other stages of the manipulation. Other handling steps include the incorporation of linkers to connect the variable domains of the present invention to further protein sequences including heavy chains of immunoglobulins, other variable domains (for example, when you create diatel) or proteins which marks discussed in more detail below.

Although in a preferred aspect of the present invention, the members of the specific binding comprising a pair of binding domains based on sequences, essentially represented in SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; and 42 and 47, respectively, are preferred, single binding domains based on these sequences constitute additional aspects of the present invention. In the case of binding domains based on sequences, essentially represented in VH domains, such binding domains may be used as agents, targets which are tumor antigens, since it is known that the VH domains of immunoglobulins STRs�obny contact with antigens on target specific way.

In the case of any of the single chain specific binding domains, these domains may be used to screen for complementary domains capable of forming a dual-domain specifically binding member that has ain vivocharacteristics, like any, or equal to those of antibodies Mat, ch806, Mat, Mat, Mat and hu806 described here.

This can be done using the methods of screening of molecules of phage display using a so-called hierarchical dual combinatorial approach described in U.S. patent No. 5969108 in which an individual clone containing either H-or L-chain is used to infect a complete library of clones encoding the other chain (L or H), and the resulting double-stranded specifically binding member are selected in accordance with phage display methods such as those described in this reference. This method is also described Marks, etc., ibid.

The members of the specific binding of the present invention can also include a constant region of the antibody or part thereof. For example, members of the specific binding based on the sequences of the VL domain may be attached at its C-end to the constant domains of the light chain of the antibody, including Cκ or Cλ person, preferably Cλ. The members of the specific binding based on the pic�of egovernance VH domain may be attached at its C-end to all or portions of the heavy chain of the immunoglobulin, derived from any isotype antibodies, e.g., IgG, IgA, IgE, IgD and IgM and any of the subclasses isotypes, particularly IgG1, IgG2b, and IgG4. IgG1 is preferred.

The creation of the technology of monoclonal antibodies (MAB) 25 years ago made a tremendous set of applicable research reagents and created the possibility of using antibodies as permitted pharmaceutical substances for the treatment of cancer, autoimmune diseases, rejection of transplants, antiviral prophylaxis and as antithrombotic agents (Glennie and Johnson, 2000). The use of molecular engineering for conversion of Mat mouse chimeric Mat (murine V-region of the human C-region) and humanized substances, in which only the complementarity determining regions (CDR) of the Mat are of murine origin, was crucial to the clinical success of the treatment Mat. Created Mat had markedly reduced immunogenicity or didn't have it, had an increased half-life existence in the serum, and the Fc-part of human rights in Mat increases the possibility of involvement of immunoelectro of complement and cytotoxic cells (Clark 2000). For studies of bearsdley, pharmacokinetics, and any induction of an immune response to clinically introduce Mat is necessary to develop tests to differentiate pharmaceutical proteins from endogenous proteins.

Antibodies or any fragments thereof may also be anywhereman or recombinante merged with any cellular toxin, bacterial or other, for example, Pseudomonas exotoxin, ricin or diphtheria toxin. Used part of the toxin may be the entire toxin or any specific domain of the toxin. Such molecules are antibody-toxin have been successfully used for the targeted delivery and treatment of various types of cancers, see, e.g., Pastan, Biochim. Biophys. Acta. 1997 Oct. 24; 1333 (2): C1-6; Kreitman et al., N. Engl. J. Med. 2001 Jul. 26; 345 (4): 241-247; Schnell et al., Leukemia. 2000 Jan.; 14 (1): 129-135; Ghetie et al., Mol. Biotechnol. 2001 Jul.; 18 (3): 251-268.

Bi - and thespecifics of multimer you can create by connecting different scFv molecules, and they were designed as cross-shivaxi reagents for recruitment of T-cells in tumors (immunotherapy), viral reorientation (gene therapy) and as reagents for agglutination of red blood cells (immunodiagnostics), see, e.g., Todorovska et al., J. Immunol. Methods. 2001 Jan. 1; 248 (l-2): 47-66; Tomlinson et al., Methods Enzymol. 2000; 326: 461-479; McCall et al., J. Immunol. 2001 May 15; 166 (10): 6112-6117.

Fully human antibodies can be prepared by immunization of transgenic mice containing a large portion of the heavy and light chains of human immunoglobulins. These mice are XenomouseTM(Abgenix, Inc.) (U.S. patent No. 6075181 and 6150584), HuMAb-MouseTM(Medarex, Inc./GenPharm) (patents SSH� No. 5545806 and 5569825), TransChromo Mouse (Kirin) and KM Mouse (Medarex/Kirin), commonly known in the art.

Antibodies can also be prepared, for example, using a standard hybridomas technology or by using phage display. These antibodies will in this case contain only fully human amino acid sequence.

Fully human antibodies can also be created using phage display human libraries. Phage display can be performed using methods well known to a qualified specialist, such as methods Hoogenboom, etc., and Marks, etc. (Hoogenboom H. R. and G. Winter (1992) J. Mol. Biol. 227 (2): 381-388; Marks, J. D. et al. (1991) J. Mol. Biol. 222 (3): 581-597; and U.S. patent No. 5885793 and 5969108).

Therapeutic antibodies and application

In vivocharacteristics, in particular as regards the relationship of the localization of the tumor:blood and the rate of excretion, the members of the specific binding of the present invention will be at least comparable with those met. After the introduction which a human or animal subject such member of the specific binding will be to maximize the ratio of the tumor:blood gap of >1:1. Preferably in this regard, the member of the specific binding will also show the ratio of the localization of the tumor:organ greater than 1:1, preferably greater than :1, more preferably greater than 5:1. Preferably in this regard, the member of the specific binding will also show the ratio of the localizations of the body:blood, amounting to <1:1 in the bodies away from the site of the tumor. These relations exclude bodies catabolism and excretion entered member of the specific binding. Thus, in the case of scFv and Fab (as shown in the accompanying examples), connecting members is excreted through the kidneys, and their presence here more than in other organs. In the case of whole IgG excretion will be, at least partly occur through the liver. Maximum respect to the localization of intact antibodies will typically be achieved through 10-200 hours after administration of the member of the specific binding. More specifically, the ratio can be determined in tumor xenotransplantation weighing approximately 0.2-1.0 g established subcutaneously in the side of the Nude mouse.

The antibodies of the present invention can be marked detectable or functional label. Detectable labels include, but are not limited to, a radioactive label, such as isotopes3H,14C,32P,35S,36Cl51Cr57Co,58Co,59Fe90Y121I,124I,125I,131I,111In211At,198Au,67Cu,225Ac,213Bi99Tc and186Re that can join�you to the antibodies of the present invention, using conventional chemical technology, well-known in the field of visualization of antibodies. Labels may include fluorescent labels and tags, commonly used in the art to produce images using NMR tomography. They also include enzyme labels such as horseradish peroxidase. The labels also include the chemical constituents, such as Biotin that can be detected via binding to a specific cognate detectable component, for example, labelled Avidya.

Functional labels include substances that are intended for targeted delivery to the site of the tumour to call the destruction of tumor tissue. Such functional labels include cytotoxic drugs such as 5-fluorouracil or ricin, and enzymes such as bacterial carboxypeptidase or nitroreductase that are capable of conversion of prodrug to active drug at the site of the tumour.

Also, antibodies including both polyclonal and monoclonal antibodies, and drugs that modulate the production or activity of members of the specific binding of antibodies and/or their subunits may possess certain diagnostic applications and may for example be used to detect and/or determine such status�of any, as cancer, pre-cancerous lesions, a condition associated with the growth of hyperproliferative cells or resulting from such growth, or etc. for Example, members of specific binding of antibodies or their subjudice can be used to produce both polyclonal and monoclonal antibodies against them in a number of cellular media, by known techniques such as hybrid technology, which uses, for example, fused with myeloma cells of lymphocytes from the spleen of the mouse. Small molecules that mimic or cause a reaction activity(s) are members of the specific binding of the present invention, can be used to detect or synthesize, and they can be used in diagnostic and/or prophylactic protocols.

Radiolabelled members of the specific binding, particularly antibodies and fragments thereof that are applicable in the methodsin vitrodiagnosis and in the methodsin vivovisualization based on radioactive isotopes, and in radioimmunotherapy. In the case ofin vivoimaging members of the specific binding of the present invention can be anywhereman with imaging means, and not with a radioactive isotope(s), including, but without limitation, the agent for enhancing a magnetic resonance image, wherein, for example, in mo�ekulu antibodies injected a large number of paramagnetic ions through chelating groups. Examples of chelating groups include EDTA, porphyrins, polyamines, crown ethers and polyxeni. Examples of paramagnetic ions include gadolinium, iron, manganese, rhenium, europium, the lanthanides, holmium and erbium. In a further aspect of the present invention labeled with radioactive isotopes, the members of the specific binding, particularly antibodies and fragments thereof, in particular radioimmunoconjugates applicable in radioimmunotherapy, particularly in the form of labeled with radioactive labels antibodies for cancer treatment. Again, in a further aspect of radiolabelled members of the specific binding, particularly antibodies and fragments thereof that are applicable in the methods of radioimmuno-napravlennoi surgery, in which they can identify and indicate the presence and/or location of cancer cells, precancerous cells, tumor cells, and hyperproliferative cells, prior to, during or after surgical intervention to remove these cells.

Immunoconjugate or fused with the antibody proteins of the present invention, in which the members of the specific binding, particularly antibodies and fragments thereof, of the present invention anywherevery or attached to other molecules or agents also include, but without limitation, to binding members conjugated to a chemical agent to destroy, the toxin, immunolog�the fan motors, a cytokine, a cytotoxic agent, chemotherapeutic agent or drug.

Radioimmunotherapy (RAIT) entered the clinic and demonstrated efficacy when used immunoconjugates on the basis of different antibodies. Evaluation labeled with131I humanized antibody hMN-14 against carcinoembryonic antigen (CEA) was performed on colorectal cancer (Behr, T. M. et al. (2002) Cancer 94 (4 Suppl): 1373-1381), and the evaluation of the same antibody labeled90Y was held on medullary carcinoma of the thyroid gland (R. Stein et al. (2002) Cancer 94 (1): 51-61). Radioimmunotherapy using monoclonal antibodies was also evaluated in non-Hodgkin's lymphoma and pancreatic cancer, and a report on it was submitted (Goldenberg, D. M. (2001) Crit. Rev. Oncol. Hematol. 39 (l-2): 195-201; Gold D. V. et al. (2001) Crit. Rev. Oncol. Hematol. 39 (1-2) 147-154). Radioimmunotherapeutic methods using specific antibodies is also described in U.S. patents No. 6306393 and 6331175. Radioimmuno-napravlennaya surgery (RIGS) has also entered the clinic and demonstrated the effectiveness and usefulness, including using antibodies against CEA and antibodies directed against associated with tumor antigens (J. C. Kim et al. (2002) Jut. J. Cancer 97(4): 542-547; Schneebaum, S. et al. (2001) World J. Surg. 25(12): 1495-1498; Avital, S. et al. (2000) Cancer 89(8): 1692-1698; D. G. McIntosh et al. (1997) Cancer Biother. Radiopharm. 12 (4): 287-294).

Antibodies present from�retenu can be administered in need of treatment to the patient by any suitable means, usually by injection into the bloodstream or cerebrospinal fluid, or directly into the tumor. The exact dose will depend on several factors, including the intended whether the antibody is for diagnosis or for treatment, the size and location of the tumor, the specific nature of the antibodies (whether it is a whole antibody, fragment, diatesom, etc.) and the nature of the detectable or functional label attached to the antibody. In the case of using a radionuclide suitable maximum single dose is from about 45 MCI/m2up to a maximum of about 250 MCI/m2. The preferred dose is in the range of 15 to 40 MCI, with the preferred dose range is between 20 to 30 MCI, or 10 to 30 MCI. In the case of such therapy may require replacement of bone marrow or stem cells. Typical dose for either visualization of the tumor or treatment of the tumor will be in the range of 0.5 to 40 mg, preferably from 1 to 4 mg of antibody in the form F(ab')2. Preferably a "naked" antibody is administered in doses of from 20 to 1000 mg protein per dose, or 20 to 500 mg protein per dose, or 20 to 100 mg protein per dose. This dose is a dose for a single treatment of an adult patient, which may be proportional to the lips�Olena for children and babies and also installed for other antibody forms in proportion to molecular weight. Treatment can be repeated with daily, Prunedale, weekly or monthly intervals, at the discretion of the physician.

These drugs may include a second binding protein, such as binding EGPR proteins described above. In a particularly preferred form of this second binding protein is a monoclonal antibody, such as 528 or 225, as discussed below.

Pharmaceutical and therapeutic compositions

The members of the specific binding of the present invention will usually be administered in the form of pharmaceutical compositions which may comprise at least one component in addition to the member of the specific binding.

Thus, pharmaceutical compositions according to the present invention and for use in accordance with the present invention may include, in addition to the active ingredient, pharmaceutically acceptable excipient, carrier, buffer, stabilizer or other substances, are well known to skilled in the art specialists. Such substances should be nontoxic and should not affect the efficacy of the active ingredient. The precise nature of the carrier or other substance will depend on the route of administration, which may be oral �whether by injection, for example, intravenously.

Pharmaceutical compositions for oral administration can be in the form of tablets, capsules, powder and liquid form. The tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, sulphonated, animal or vegetable oils, mineral oil or synthetic oil. This can also include physiological saline solution, dextrose or other saccharide or glycols such as ethylene glycol, propylene glycol or polietilenglikol.

For intravenous injection, or injection at a location that is exposed to the disease, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is non-pyrogenic and has the appropriate pH, izotonichnost and stability. Specialists with relevant knowledge in the art is fully capable to prepare suitable solutions using, for example, isotonic media, such as an injectable solution of sodium chloride, injectable solution ringer's injection ringer's solution with addition of lactate. May also be included, if necessary, preservatives, stabilizers, buffers, antioxidants and/or other products.

The composition may be administered alone or in Combi�tion with other treatments, therapeutic drugs or agents, either simultaneously or sequentially depending on the subject to treatment status. In addition, the present invention provides and includes compositions comprising the binding member, particularly antibody or a fragment thereof, described herein, and other agents or therapeutic agents such as anti-cancer drugs or therapeutic agents, hormones, agents or antibodies against the EGFR, or immunomodulators. In General, these anticancer agents may be tyrosine kinase inhibitors, inhibitors of the cascade of phosphorylation reactions, modulators of post-translational modifications, inhibitors of growth or cell division (e.g., antimitotic agents) or inhibitors of signal transmission. Other treatment or a therapeutic agent can include the introduction of suitable doses of medicines for pain relief like non-steroidal anti-inflammatory drugs (e.g. aspirin, paracetamol, ibuprofen or Ketoprofen) or opiates such as morphine, or antiemetics. The composition may be administered in combination (either sequentially (i.e., before or after) or simultaneously) with tyrosine kinase inhibitors (including, but without limitation, AG1478 effect, and ZD1839, STI571, OSI-774, SU-6668), doxorubicin, temozolomide, cisplatin, carbopol�tin, nitrosoanatabine, procarbazine, vincristine, hydroxyurea, 5-fluorouracil, citizenerased, cyclophosphamide, epipodophyllotoxin, carmustine, lomustine and/or other chemotherapeutic agents. Thus, these agents can be specific agents against EGFR or tyrosine kinase inhibitors such as AG1478 effect, ZD1839, STI571, OSI-774 or SU-6668, or, in General, can be anticancer and antineoplastic agents such as doxorubicin, cisplatin, temozolomide, nitrosamine, procarbazine, vincristine, hydroxyurea, 5-fluorouracil, citizenerased, cyclophosphamide, epipodophyllotoxin, carmustine or lomustine. Furthermore, the composition may be administered together with hormones such as dexamethasone, immune modulators, such as interleukins, tumor necrosis factor (TNF) or other growth factors or cytokines which stimulate the immune response and reduce or eliminate cancer cells or tumor.

Immunomodulator, such as TNF, can be combined with a member of the present invention in the form especificacao antibody recognizes an EGFR epitope recognized by antibodies of the present invention, as well as binding to the TNF receptors. The composition may also be administered together with, or may include combinations along with other antibodies against EGFR, including, but without og�of anichini, antibodies against EGFR 528, 225, SC-03, DR8.3, L8A4, Y10, ICR62 and ABX-EGF.

Previously, the use of agents such as doxorubicin and cisplatin, in combination with antibodies against EGFR produced enhanced antitumor activity (Fan et al., 1993; in Baselga et al., 1993). The combination of doxorubicin and Mat 528 led to the complete elimination of entrenched A431 xenografts, whereas treatment with either of two agents separately caused only a temporary suppression ofin vivogrowth (in Baselga et al., 1993). Similarly, the combination of cisplatin and any of math or 225 also led to the elimination of quite deep-rooted A431 xenografts, which was not observed when treatment was used by any one of the two agents (Fan et al., 1993).

Standard radiotherapy

In addition, the present invention provides and includes therapeutic compositions in the case of application of the connecting member in combination with standard radiotherapy. It has been shown that treatment with antibodies directed against the EGF receptor, can enhance the effects of standard radiotherapy (Milas et al., Clin. Cancer Res. 2000 Jan.: 6(2): 701, Huang et al., Clin. Cancer Res. 2000 Jun.: 6(6): 2166).

As shown here, the combination of a binding member of the present invention, in particular, the antibody or its fragment, preferably Mat, ch806, Mat, Mat, Mat or hu806 or its fragment, and anticancer drugs, in particular,therapeutic agents against EGFR, including other antibodies against EGFR, is an illustration of effective therapy, and, in particular, synergies, against xenotransplantation tumors. In the examples, for example, it is shown that the combination of AG1478 effect and Mat led to a significantly higher reduction of xenotransplanted A431 tumor cells compared with treatment with either of two agents separately. AG1478 effect (4-(3-chloroanilino)-6,7-dimethoxyquinazoline) is a potent and selective inhibitor of EGF receptor kinase and, in particular, is described in U.S. patent No. 5457105, included here by reference in its entirety (see also Liu, W. et al. (1999) J. Cell Sci. 112: 2409; Eguchi, S. et al. (1998) J. Biol. Chem. 273: 8890; Levitsky, A. and Gazit, A. (1995) Science 267: 1782). In the examples describe the present invention, also shown therapeutic synergism of antibodies of the present invention with other antibodies against EGFR, in particular, with the antibody against EGFR 528.

The present invention also encompasses therapeutic compositions applicable in the implementation of therapeutic methods of this invention. The object of the present invention, a therapeutic composition includes, in admixture, a pharmaceutically acceptable excipient (carrier) and one or more members of the specific binding, polypeptide analogs or fragments thereof, described herein as the active ingredient.In a preferred embodiment of the composition comprises an antigen, capable of modulating the specific binding of a binding member/antibodies of the present invention with cell-target.

The preparation of therapeutic compositions which contain polypeptides, analogs or active fragments as active ingredients is quite established in the art. Typically, such compositions are prepared in the form of injectable drugs, either as liquid solutions or suspensions. However, it is also possible to prepare solid forms suitable for dissolution or suspension in liquid prior to injection. The preparation can also be emulsified. The active therapeutic ingredient is often mixed with excipients that are pharmaceutically acceptable and compatible with the active ingredient. Suitable excipients are, for example, water, saline, dextrose, glycerol, ethanol or the like, and combinations thereof. In addition, if desirable, the composition may contain small amounts of auxiliary substances such as wetting reagents or emulsifying agents, pH buffering agents which enhance the effectiveness of the active ingredient.

Polypeptide, analog or active fragment can be in a therapeutic composition in the form of neutral forms pharmaceutically acceptable salts. Pharmaceutically acceptable salts include the acid-add�tive salts (formed as a result of reactions of free amino groups of the polypeptide or antibody molecule), and which are formed by the joining of inorganic acids such as, for example, hydrochloric or phosphoric acids, or such organic acids as acetic, oxalic, tartaric, mandelic acid, etc. Salts formed during the reaction by a free carboxyl groups can also be prepared from inorganic bases, such as, for example, hydroxides of sodium, potassium, ammonium, calcium or iron, and such organic bases as Isopropylamine, trimethylamine, 2-ethylaminoethanol, histidine, procaine, etc.

Therapeutic compositions containing the polypeptide, analog or active fragment, usually administered intravenously, for example, by injection of a unit dose, for example. The term "unit dose" when used in connection with therapeutic composition of the present invention refers to physically discrete units suitable as single doses for humans, each unit contains a predetermined quantity of the active substance, calculated to call up the desired therapeutic effect, together with the required diluent; i.e., carrier or excipient.

The composition is administered in a manner consistent with the preparation of doses, and in therapeutically effective amounts. Enter the amount depends on the subject to treatment of the subject, ability of the immune system of a subject to and�the use of the active ingredient and the desired degree of ability to bind EFGR. The exact amount of the active ingredient that you should use, depends on an assessment of the practitioner and are peculiar to each individual. However, suitable dosages may range from approximately 0.1 to 20, preferably from about 0.5 to about 10 and more preferably from one to several milligrams of active ingredient per kilogram bodyweight of individual per day and depend on the route of administration. Suitable schemes for the initial administration and booster doses are also adjustable, but they are a typical example involves an initial introduction followed by repeated doses of the components of one or more clock intervals entered with the subsequent injection or other administration. Alternative provides for continuous intravenous infusion sufficient to maintain ten mu - ten micromolar concentrations in the blood.

Pharmaceutical compositions for oral administration can be in the form of tablets, capsules, powder and liquid form. The tablet may include a solid carrier such as gelatin or an adjuvant. Liquid pharmaceutical compositions generally include a liquid carrier such as water, sulphonated, animal or vegetable oils, mineral oil or synthetic oil. Can be� also included physiological saline solution, the solution of dextrose or other saccharide or glycols such as ethylene glycol, propylene glycol or polietilenglikol.

For intravenous injection, or injection at a location that is exposed to the disease, the active ingredient will be in the form of a parenterally acceptable aqueous solution which is non-pyrogenic and has the appropriate pH, izotonichnost and stability. Specialists with relevant knowledge in the art is fully capable to prepare suitable solutions using, for example, isotonic media, such as an injectable solution of sodium chloride, injectable solution ringer's injection ringer's solution with addition of lactate. May also be included, if necessary, preservatives, stabilizers, buffers, antioxidants and/or other products.

Diagnostic studies

The present invention also relates to a number of diagnostic applications, including methods for detecting the presence of stimuli such as aberrant expressed EGFR, on the basis of their ability to be recognized by the member of the specific binding of the present invention. As noted earlier, the EGFR can be used to generate antibodies to himself with the help of a number of known techniques, and such antibodies could be identified and used, for example, in studies on the presence of persons�th activity of EGFR in questionable target cells.

Diagnostic applications of the members of the specific binding of the present invention, particularly antibodies and fragments thereof includein vitroandin vivoapplications that are well known and conventional to a qualified professional and based on the description of the present invention. Diagnostic tests and kits forin vitrodefinition and assessment of EGFR, particularly in relation to the aberrant expression of EGFR can be used to diagnose, evaluate and monitor sampling populations of patients, including those who are known to have or suspected cancer, precancerous state, of a condition associated with the growth of hyperproliferative cells, or on the basis of a sample of the tumor. The definition and assessment of EGFR is also useful for determining the possibility of using the patient for clinical trials of medicinal products and for the introduction of specific chemotherapeutic agents or a member of the specific binding, in particular antibodies of the present invention, including combinations thereof, in comparison with a different agent or binding member. In the case of breast cancer are already used in practice, antibodies against the protein HER2 (Hercep Test, Dako Corporation) with this type of diagnostic monitoring and determining in which research� also used to assess patients for therapy using antibody Herceptin. In vivoapplications include visualization of tumors or determining the cancerous status of individuals, including visualization, based on radioactive isotopes.

As suggested above, the diagnostic method of the present invention includes the study of the cellular sample or medium by means of the analysis comprising an effective amount of an EFGR antagonist/protein such as an antibody against EFGR, preferably subjected to affinity purification of the polyclonal antibody, and more preferably the Mat. In addition, preferably, when used herein, molecules are antibodies against EFGR are in the form of parts of Fab, Fab', F(ab')2or F(v) or whole antibody molecules. As previously discussed, patients who may benefit from this method include those suffering from cancer, precancerous pathological changes, viral infection, abnormalities involving the growth of hyperproliferative cells or which are the result of such growth, or other similar pathological disorders. All methods, including methods for isolating EFGR and induction of production of antibodies against EFGR, and determining and optimizing the ability of antibodies against EFGR to promoting the study of target cells, are well known in the art.

Preferably, when the antibody against EFGR used in diagnostic �the means of this invention, is subjected to affinity purification of polyclonal antibody. More preferably, when the antibody is a monoclonal antibody (MAB). Also, used here the molecules of antibodies against EFGR can be in the form of parts of Fab, Fab', F(ab')2or F(v) molecules of whole antibodies.

As described in detail above, antibody(a) against EGFR can be produced and isolated by standard methods including the well-known hybrid technology. For convenience, the antibody(a) against EGFR, induced in one view will be referred to here as Al1and antibody(a), which is induced in another form, the At2.

The presence of EGFR in the cells can be determined using the usualin vitroorin vivoimmunological methods applicable for such definitions. A number of applicable methods. In three of those ways, which is particularly applicable, is used or EGFR labeled with a detectable label, antibody At, labeled with a detectable label, or Al2labeled with a detectable label. The methods can be summarized in the following equations, in which the asterisk indicates that the particle is labeled, and "R" mean EGFR:

A. R*+Al1=R*Al1

B. R+At*=R1*

C. R+Al1+At2*=R1The at2*

And methods, and their application known qualified in this area �Ethniki specialists and, accordingly, can be used within the scope of the present invention. "Competitive" method, a method described in U.S. patent No. 3654090 and 3850752. Method C, the "sandwich"method, described in U.S. patent No. RE 31006 and 4016043. Known, however, other methods such as a method using a double antibody" or technique of radioimmunoassay using a solid phase with two antibodies ("DASP").

In each above case, the EGFR forms complexes with one or more antibody(ies) or binding partners and one member of the complex is labeled with a detectable label. The event of the formation of the complex and, if desired, the amount can be determined using known methods, applicable for the detection of labels.

Based on the above it will be understood that a characteristic property of At2is that it will interact with the At1. This is because the At1induced in one type of mammal that was used in another form as an antigen for the induction of antibodies of the At2. For example, the At2it is possible to induce in goats using rabbit antibodies as antigens. Consequently, the At2will anticalcium antibody induced in goats. For purposes of this description and claims the At1will be called the first antibody�m or antibody against EGFR, and Al2will be called the second antibody or the antibody against the At1.

The labels most commonly used for these studies are radioactive elements, enzymes, chemical substances that fluoresce after exposure to UV light, and others.

Many fluorescent substances known and can be used as the label. They include, for example, fluorescein, rhodamine, auramine, Texas red, AMCA blue and luciferine yellow. A particular substance for detection is entirelife antibody obtained in goats and anywhereman with fluorescein through isothiocyanate.

EGFR or its partner(s) binding, such as a member of the specific binding of the present invention can also mark a radioactive element or with an enzyme. The radioactive label can be detected using any of the currently available methods of counting. The preferred isotope, you can choose from3H,14C,32P,35S,36Cl51Cr57Co,58Co,59Fe90Y121I,124I,125I,131I,111In211At,198Au,67Cu,225Ac,213Bi99Tc and186Re.

Just as enzymatic labels, and they can be detected using any of the currently used colorimetric, �spektrofotometricheskikh, fluorospectrometer, amperometric or gasometrical methods. Enzyme kongugiruut with the selected particle by reaction of crosslinking of these molecules, as carbodiimides, diisocyanates, glutaraldehyde, etc. a Variety of enzymes that can be used in these methods, it is known and can be used. The preferred are peroxidase, β-glucuronidase, β-D-glycosidase, β-D-galactosidase, urease, glucose oxidase plus peroxidase and alkaline phosphatase. U.S. patent No. 3654090, 3850752 and 4016043 are indicated as examples in the description of the alternative substances and methods for tagging.

A particular system of study, which may advantageously be applied in accordance with the present invention, is known as receptor analysis. In receptor analysis of the substance being analysed, such as a member of the specific binding, appropriately labeled and then certain cellular studied colonies contribute as the number of labeled and unlabeled substances, followed by a research associate to determine the extent to which the labeled substance binds to cell receptors. This way you can identify differences in affinity between substances.

Accordingly, the number subjected to the cleaning member of the specific binding can p�be labeled with a radioactive isotope and unite, for example, with antibodies or other inhibitors, after which there will be research associate. Then be prepared with solutions that contain various quantities of labeled and unlabeled, are not integrated member of the specific binding, and then they will bring in samples of cells and subsequently will be carried out incubation. The resulting cell monolayers are then washed, solubilizers and then counted in a gamma counter for period of time sufficient for obtaining standard errors, component <5%. These data are then subjected to analysis of Scatchard, after which can be made of the observations and conclusions regarding the activity of the substance. Although the foregoing is provided as an example, it illustrates the way that the receptor analysis can be performed and used in the case where the ability of the analyte to the binding to cells can serve as a distinctive feature.

The analysis, which is applicable and provided for in accordance with the present invention, known as a "CIS/TRANS-analysis. Briefly, this analysis employs two genetic constructs, the first of which is typically a plasmid that continually expresses a particular receptor of interest, after transfection into an appropriate Lin�th cells and the second of which is a plasmid that expresses a reporter such as luciferase, under the control of a complex of receptor/ligand. Thus, for example, if the desired is to evaluate compounds as a ligand for a specific receptor, the first of plasmin could be design, which leads to expression of the receptor in the chosen cell line, while the second plasmid would possess a promoter linked to luciferase gene that is sensitive to a specific receptor element. If the investigational compound is an agonist of the receptor, the ligand will form a complex with the receptor, and the resulting complex will be contacted with the sensor element and initiate the transcription of the luciferase gene. Then photometrically measuring the resulting chemiluminescence, and plot the response on the dose is built and compared with those of known ligands. The above Protocol is described in detail in U.S. patent No. 4981784 and international application PCT no WO 88/03168, which is sent to the specialist.

In a further embodiment of the this invention can be prepared with industrial test kits suitable for use by a specialist in medicine, to determine the presence or absence of the aberrant expression of EGFR, including, but without limitation, um�lefficacia EGFR gene and/or mutation of EGFR in potential target cells. In accordance with the methods discussed above testing one class of such kits will contain at least the labeled EGFR or its binding partner, e.g., antibody specific against him, and instructions, of course, depend on the method selected, e.g., "competitive", "sandwich", "DASP" and etc. the Kits may also contain additional reagents such as buffers, stabilizers, etc.

Accordingly, a test kit may be prepared for detecting the presence of aberrant expression or posttranslational modifications of EGFR or the ability of cells and includes

(a) a predetermined number of at least one labeled immunochemical active component resulting from direct or indirect connection of member of the specific binding of the present invention or its partner by specific binding to the detectable label;

(b) other reagents; and

(c) instructions regarding the use of the specified collection.

More specifically, the diagnostic test kit may include

(a) a known amount described above, the member of the specific binding (or binding partner) generally bound to a solid phase to form immunosorbent or, in the alternative, associated with a suitable accurately�th, or numerous such end products, etc. (or their binding partners) one of each type;

(b) if necessary, other reagents; and

(c) instructions regarding the use of the specified test set.

In a further embodiment, the test kit may be prepared and used with the above-mentioned purpose, the set is operated in accordance with the predetermined Protocol (e.g. "competitive", "sandwich", "double antibody", etc.) and includes

(a) a labeled component which has been obtained by means of the connection member of the specific binding with a detectable label;

(b) one or more additional immunochemical reagents of which at least one reagent is a ligand or an immobilized ligand, which is selected from the group consisting of

(i) a ligand capable of binding with the labeled component (a);

(ii) a ligand capable of binding to the binding partner of the labeled component (a);

(iii) a ligand capable of binding to at least one of the defined components; and

(iv) a ligand capable of binding to at least one of the binding partners of at least one of the defined components; and

(c) instructions regarding the implementation of the Protocol for the detection and/or determination of one or more co�components of an immunochemical reaction between EFGR, a member of the specific binding and its partner in the specific binding.

In accordance with the above, can be prepared analytical system for screening potential drugs effective to modulate the activity of EFGR, the aberrant expression or posttranslational modifications of EGFR and/or the activity or binding member specific binding. Receptor or binding member can be introduced into the test system, and in the resulting cell culture may also be put into the alleged drug culture and subsequently examined to commit any changes in the activity of cells in S-phase, or as a result of merely adding the alleged drugs, or due to the effect of added quantities of the known agent(s).

Nucleic acids

The present invention additionally provides isolated nucleic acid that encodes a member of the specific binding of the present invention. Nucleic acid comprises DNA or RNA. In a preferred aspect the present invention provides a nucleic acid which encodes the polypeptide of the present invention defined above, including a polypeptide represented as remnants of a VH CDR and VL domains of the antibodies of the present invention.

Real picture�taniam also provides constructs in the form of plasmids, vectors, transcription or expression cassettes which comprise at least one polynucleotide as above.

The present invention also provides a recombinant cell host, which includes one or more of the structures listed above. Aspect of the present invention is a nucleic acid that encodes any member of the specific binding provided by itself, as a method of producing a member of the specific binding, which comprises expression from encoding the nucleic acid. Expression can appropriately be achieved by culturing under appropriate conditions recombinant host cells containing the nucleic acid. After production by expression of a member of the specific binding can be identified and/or clean using any suitable method, and then use according to circumstances.

The members of the specific binding and coding nucleic acid molecules and vectors according to the present invention may be provided isolated and/or purified, e.g. from their natural environment, in essentially pure or homogeneous form, or, in the case of nucleic acid, not containing or essentially not containing nucleic acid or genes, different in origin from serial�activities encodes a polypeptide with the required function. A nucleic acid according to the present invention may include DNA or RNA and may be wholly or partially synthetic.

Systems for cloning and expression of polypeptide in a number of different host cells are well known. Appropriate cell hosts include bacteria, mammalian cells, yeast and baculovirus systems. Lines of mammalian cells applicable in the art for expression of a heterologous polypeptide, cells include Chinese hamster ovary, HeLa cells, kidney cells baby hamster, cage mouse myeloma NSO and many others. Running, preferred bacterial host isE. coli.

The expression of the antibodies and fragments of antibodies in prokaryotic cells, such asE. coliwidely known in the art. For review see, e.g., Pluckthun, A. Bio/Technology 9: 545-551 (1991). At the disposal of the skilled in the art specialists also found expression in eukaryotic cells as an alternative product of a member of the specific binding, see recent reviews, for example, Raff, M. E. (1993) Curr. Opinion Biotech. 4: 573-576; Trill, J. J. et al. (1995) Curr. Opinion Biotech 6: 553-560.

You can select or construct suitable vectors containing the appropriate regulatory sequences, including seq�the dedication of promoters, sequence terminators, polyadenylation sequences, enhancer sequences, marker genes and other sequences as appropriate. Vectors can be plasmids, viral vectors, such as phage or phagemids, according to circumstances. For more details see, for example, in Molecular Cloning: a Laboratory Manual: 2nd edition, Sambrook et al., 1989, Cold Spring Harbor Laboratory Press. Many known techniques and protocols for manipulation of nucleic acid, for example for the preparation of structures of nucleic acids, mutagenesis, sequencing, introduction of DNA into cells and gene expression, and protein analysis are described in detail in Short Protocols in Molecular Biology, Second Edition, Ausubel et al. eds., John Wiley & Sons, 1992. Description Sambrook et al. and Ausubel et al. included here by reference.

Thus, in a further aspect the present invention provides a host containing a nucleic acid described herein. Again in a further aspect provides a method comprising introducing such nucleic acid into a host cell. For the introduction you can use any available method. In the case of eukaryotic cells, suitable techniques may include transfection using calcium phosphate, DEAE-dextran, electroporation, transfection using liposomes and transduction using pet�of overuse or another virus, for example, vaccinia virus or, in the case of insect cells, baculovirus. In the case of bacterial cells, suitable techniques may include transformation using calcium chloride, electroporation and transfection using bacteriophage.

The introduction may be followed by the call or allowing expression of the nucleic acid, e.g. by culturing host cells under conditions suitable for gene expression.

In one embodiment of the nucleic acid of the present invention integrated into the genome (e.g. chromosome) of the host cell. Integration can facilitate the inclusion of sequences that activate recombination with the genome, in accordance with standard methods.

The present invention also provides a method that involves using a construction described above, in gene-expression system to Express the member of the specific binding or polypeptide as specified above.

As indicated above, the present invention also relates to a recombinant DNA molecule or cloned gene, or its vyrozhdennom option, which(th) encodes a member of the specific binding, in particular, an antibody or a fragment thereof that has an amino acid sequence represented in SEQ ID NO: 2 and 4; 129 and 134; 22 and 27; 32 and 37; �/or 42 and 47, preferably, the nucleic acid molecule, in particular a recombinant DNA molecule or cloned gene, encoding a binding member or antibody has a nucleotide sequence encoding one of these sequences, or is a complementary DNA sequence that encodes one of these sequences.

Another feature of this invention is the expression of the DNA sequences disclosed here. As is well known in the art, DNA sequences can be Express by means of their functional binding controls expression of the sequence in a suitable expression vector and expression vector for transformation of the appropriate unicellular host.

Such functional binding of the DNA sequence of this invention with a control expression sequence, of course, includes, if it is not already part of the DNA sequence, the provision of an initiation codon, ATG, in the correct reading frame 5' of the DNA sequence.

A wide range of combinations of host/expression vector can be used for expression of the DNA sequences of this invention. Applicable gene-expression vectors, for example, may consist of segments of Chr�extrachromosomal, achromosome and synthetic DNA sequences. Suitable vectors include derivatives of SV40 and known bacterial plasmids, e.g., plasmids col E1E. coli, pCR1, pBR322, pMB9 and their derivatives, such plasmids, as RP4; phage DNA, e.g., the numerous derivatives of phage X, e.g., NM989, and other phage DNA, e.g., M13 and filamentous single-stranded DNA phage; yeast plasmids such as the 2u plasmid or derivatives; vectors applicable to eukaryotic cells, such as vectors, applicable for cells of insects or mammals; the vectors obtained as a result of Association of plasmids and phage DNA, such as plasmids that have been modified, to employ phage DNA or other controls expression of the sequence; and so on.

Any of a wide range of regulatory expression sequences - sequences that control expression of DNA sequences that are functionally associated with it - can be used in these vectors to Express DNA sequences of the present invention. Such applicable regulatory expression sequences include, for example, the early and late promoters of SV40, CMV, vaccinia virus, polyomavirus or adenovirus,lacsystem,trcsystem,TACsystem,TRCsystem,LTRsystem, the major operator�R and promoter regions of phage λ, regulatory regions of the gene integumentary fd protein, the promoter of the gene 3-fosfogliceratkinazy or promoters of other genes of the enzymes of glycolysis, the gene promoters of acid phosphatase (e.g., Pho5), the promoters of the genes of the mating factors of yeast and other sequences known to control expression of genes of prokaryotic or eukaryotic cells or their viruses, and various combinations.

Wide variety of unicellular host cells are also suitable for expression of the DNA sequences of this invention. These hosts may include widely known eukaryotic and prokaryotic cells-hosts, such as strains ofE. coli,Pseudomonas, Bacillus, Streptomyces, fungi such as yeasts, and animal cells, cells such as CHO, YB/20, NSO, SP2/0, Rl.1, B-W and L-M, kidney cells of the African green monkey (e.g., COS 1, COS 7, BSCl, BSC40, and BMT10), insect cells (e.g., Sf9), and human cells and plant cells in tissue culture.

It will be understood that not all vectors controlling the expression of sequences and hosts will function equally well in the expression of DNA sequences of this invention. Also not all hosts will function equally well with the same expression system. However, the skilled in the art specialist will be able to choose appropriate �ectory, control expression sequences and hosts without undue experimentation to perform the desired expression without departing from the scope of this invention. For example, the choice of the vector must be taken into account is the master, since the vector needs to function in it. Also will take into account the number of copies of the vector, the ability to control that copy number and the expression of any other proteins encoded by the vector, such as which antibiotic markers.

When selecting controls expression of the sequence into account usually will be a number of factors. They include, for example, the relative strength of the system, its adjustability and its compatibility with the particular DNA sequence or gene of subject(s) of expression, in particular, with regard to potential secondary structures. Suitable unicellular hosts will be chosen based on, e.g., their compatibility with the chosen vector, their secretion properties, their ability to correct packing of proteins and necessary conditions for the fermentation and toxicity to the host of the product encoded by the DNA sequences that undergo expression, and ease of purification of expression products.

Given these and other factors, skilled in the art specialist will be the way� to create a number of combinations of vector/controls expression of the sequence/host, that will Express the DNA sequences of this invention in fermentation or in vysokomaslichnoy animal culture.

In addition, it is assumed that can be prepared analogs of the members of the specific binding based on the nucleotide sequences of the protein complex/subunit derived within the scope of the present invention. Analogs, such as fragments, can be obtained, for example, by pepsin digestion of the substance of the member of the specific binding. Other analogs, such as mutiny can be created using standard site-directed mutagenesis encoding members of the specific binding sequences. Counterparts, demonstrating the activity of the member of the specific binding, such as small molecules, functioning either as activators or as inhibitors can be identified using knowninvivoand/orin vitrotests.

As mentioned above, the DNA sequence encoding the member of the specific binding, can be prepared synthetically rather than cloned. The DNA sequence can be designed with the appropriate codons for the amino acid sequence of a member of the specific binding. In General, will be selected preferred for the intended host codons, if the sequence will�to use for expression. The complete sequence consists of overlapping oligonucleotides prepared by standard methods and compiled in a complete encoding sequence. See, for example, Edge, Nature, 292: 756 (1981); Nambair et al., Science, 223: 1299 (1984); Jay et al., J. Biol. Chem., 259: 6311 (1984).

Synthetic DNA sequences allow convenient way to design genes that will Express the analogs of the members of the specific binding or "mutiny". Alternatively, DNA encoding mutiny, can be prepared using site-directed mutagenesis of the natural genes of the members of the specific binding or cDNA, and mutiny can be prepared directly using normal synthesis of polypeptides.

General method for the site-specific incorporation of unnatural amino acids into proteins is described in Christopher J. Noren, Spencer J. Anthony-Cahill, Michael C. Griffith, Peter G. Schultz, Science, 244: 182-188 (April 1989). This method can be used to create analogs with unnatural amino acids.

The present invention extends to the preparation of antisense oligonucleotides and ribozymes that may be used to prevent EGFR expression on the translational level. This approach uses antisense nucleic acid and ribozymes to block translation of a specific mRNA, either by masking that mRNA antisense n�kleinova acid, either her cleavage by the ribozyme.

Antimyeloma nucleic acids are DNA molecules or RNA that are complementary to at least part of a specific mRNA molecule (see Weintraub, 1990; Marcus-Sekura, 1988.). In the cage they gibridizatsiya with this mRNA, forming a double-stranded molecule. The cell translates an mRNA in this double-stranded form. Therefore, antisense nucleic acids inhibit the expression of mRNA into protein. Oligomers of about fifteen nucleotides and molecules that hybridized with the initiating AUG codon will be particularly efficient, since they are easy to synthesize, and they probably have fewer problems than larger molecules when administered in producing cells. Methods using antisense molecules were used to inhibit the expression of many genesin vitro(Marcus-Sekura, 1988; Hambor et al., 1988).

Ribozymes are RNA molecules possessing the ability to specifically cleave other single-stranded RNA molecules by a method somewhat similar to that in the case of DNA endonucleases-restriction. Ribozymes were discovered on the basis of the observation that certain mRNAs have the ability to teletravail their own introns. By modifying the nucleotide sequence of these RNAS, researchers could� to construct molecules, that recognize specific nucleotide sequence in the RNA molecule and cleave it (Cech, 1988.). Because they are specific regarding the sequence, inactivated, only mRNAs with particular sequences.

Researchers have identified two types of ribozymes, type Tetrahymena and type "hammer head" (Hasselhoff and Gerlach, 1988). Ribozymes type Tetrahymena recognize the sequence of the four bases, while type ribozymes "hammer head" recognize the sequence of eleven to eighteen grounds. The longer recognizable sequence, the more likely that it is found only in species of mRNA targets. Thus, ribozymes type "hammer head" is preferable to Tetrahymena ribozymes-type for inactivating a specific mRNA species, and recognizable sequence of eighteen bases preferably shorter recognizable sequences.

Described herein is a DNA sequence can thus be used to prepare antisense molecules against mRNA for EFGR and their ligands, and ribozymes that cleave these mRNAs.

The present invention can be better understood by the following non-limiting examples are provided to illustrate the present invention. Following in�measures are presented to more fully illustrate preferred embodiments and should in no way be considered however, as limiting the broad scope of the present invention.

Example 1

The creation and selection of antibodies

Cell line

For immunization and specificity studies were used several cell lines, natural or transfected or normal gene of EGFR wild-type or the ΔEGFR gene having a deletion mutation Δ2-7: line of mouse fibroblasts NR6, NR6ΔEGFR(kyota line transfected with ΔEGFR) and NR6wtEGFR(kyota line transfected with EGFR wild type) cell line human glioblastoma U87MG (expressing low levels of endogenous EGFR wild-type), U87MGwtEGFR(transfetsirovannyh EGFR wild-type), U87MGΔEGFR(kyota line transfected with ΔEGFR) and squamous cell line A431 human cancer (expressing high levels of EGFR wild type).

For immunization and specificity studies were used several cell lines, natural or transfected or normal gene of EGFR wild-type or "wtEGFR" or the ΔEGFR gene having a deletion mutation de2-7 or Δ2-7: line of mouse fibroblasts NR6, NR6ΔEGFR(kyota line transfected with ΔEGFR) and NR6wtEGFR(kyota line transfected with EGFR wild type) cell line human glioblastoma U87MG (expressing low levels of endogenous EGFR wild-type), U87MGwtEGFRor U87MG.wtEGFR" (kyota line transfected with EGFR wild-type), U87MGΔEGFRor U87MG.Δ2-7" (transfer�rowanna ΔEGFR) and squamous cell line A431 human cancer (expressing high levels of EGFR wild-type). Cell line NR6, NR6ΔEGFRand NR6wtEGFRwere previously described (Batra et al. (1995) Epidermal Growth Factor Ligand-independent, Unregulated, Cell-Transforming Potential of a Naturally Occurring Human Mutant EGFRvIII Gene. Cell Growth Differ. 6(10): 1251-1259). In cell line NR6 is not the normal endogenous EGFR (Batra et al., 1995). Cell line U87MG and their transfetsirovannyh have been described previously (Nishikawa et al. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc. Natl. Acad. Sci. U. S. A. 91, 7727-7731).

Line cell astrocytoma U87MG (Ponten, J. and Macintyre, E. H. (1968) Long term culture of normal and neoplastic human glia. Acta. Pathol. Microbiol. Scand. 74, 465-486), which endogenously expresses low levels of EGFR wild-type, was infected with the retrovirus containing the de2-7 EGFR, with the establishment of the cell line U87MG.Δ2-7 (Nishikawa et al., 1994). Line transfetsirovannyh U87MG cells.EGFR wild type was created, as described in Nagane et al. (1996) Cancer Res. 56, 5079-5086. Whereas U87MG cells Express approximately 1×105EGFR, U87MG cells.wtEGFR Express approximately 1×106EGFR, and thus mimic the situation observed in gene amplification. Line Pro-B-lymphocytes mouse BaF/3, which does not expresses any known EGFR related molecules, was also transfected by de2-7 EGFR, leading to the creation of a cell line BaF/3.Δ2-7 (Luwor et al. (2004). Opukholespetsificheskaya de2-7 receptor epidermal growth factor (EGFR) promotes the survival of cells and heterodimerizes with EGFR wild-type, Oncogene 23: 6095-6104). Cells �localitatea human cancer A431 were obtained from ATCC (Rockville, MD). Cell line A431 epidermoid cancer has been described previously (Sato et al. (1987) Derivation and assay of biological effects of monoclonal antibodies to epidermal growth factor receptors. Methods Enzymol. 146, 63-81).

All cell lines were cultured in DMEM/F-12 with GlutaMAXTM(Life Technologies, Inc., Melbourne, Australia and Grand Island, NY) supplemented with 10% FCS (fetal calf serum) (CSL, Melbourne, Australia); 2 mm glutamine (Sigma Chemical Co., St. Louis, MO) and penicillin/streptomycin (Life Technologies, Inc., Grand Island, NY). Besides cell line U87MG.Δ2-7 and U87MG.EGFR wild type maintained in the presence of 400 mg/ml geneticin (Life Technologies, Inc., Melbourne, Victoria, Australia). Cell lines were grown at 37°C in an unchanging atmosphere of 5% CO2.

Reagents

Unique connective peptide de2-7 EGFR has the amino acid sequence: LEEKKGNYVVTDH (SEQ ID NO: 13). Biotinylated unique connective peptide (Biotin-LEEKKGNYVVTDH (SEQ ID NO: 5) and LEEKKGNYVVTDH-Biotin (SEQ ID NO: 6)) based on the de2-7 EGFR were synthesized using standard chemical techniques using Fmoc, and purity (>96%) were determined using HPLC with reversed phase and mass spectral analysis (Auspep, Melbourne, Australia).

Antibodies used in research

To compare the findings with the authors of the present invention with other reagents in the study included additional Mat. These reagents were met against EGFR wild-type (Sato et al. (1983) Mol. Biol. Med. 1(5), 511-529) and DH8.3, Kotor�e was generated against a synthetic peptide, covering the connecting sequence of deletion mutations Δ2-7 EGFR. Antibody DH8.3 (IgG1), which is specific against de2-7 EGFR, has been described previously (Hills et al. (1995) Specific targeting of a mutant, activated EGF receptor found in glioblastoma using a monoclonal antibody. Int. J. Cancer. 63, 537-543, 1995) and was obtained after immunization of mice unique connecting peptide, discovered in de2-7 EGFR (Hills et al., 1995).

Antibody 528, which recognizes and de2-7 EGFR wild type, was described previously (Masui et al. (1984) Growth inhibition of human tumor cells in athymic mice by antiepidermal growth factor receptor monoclonal antibodies. Cancer Res. 44, 1002-1007) was obtained in the Biological Production Facility, Ludwig Institute for Cancer Research (Melbourne, Australia) with the use of hybridomas (ATCC HB-8509), obtained from the American type culture collection (Rockville, MD). Polyclonal antibody SC-03 is subjected to affinity purification of rabbit polyclonal antibody induced against the C-terminal peptide of EGFR (Santa Cruz Biotechnology Inc.).

The formation of antibodies

As an immunogen used was a line NR6 mouse fibroblastsΔEGFR. Mouse hybridomas were generated by fivefold, subcutaneous immunization of mice BALB/c components with 2-3 weeks intervals using a 5×l05- 2×106cells in adjuvant. For the first injection was used complete adjuvant freind. Later it was used incomplete adjuvant freind (DifcoTM, Voigt Global istribution, Lawrence, KS). Cells spleens of immunized mice were fused with cells of the mouse myeloma SP2/0 (Shulman et al. (1978) Nature 276: 269-270). The supernatants of the newly created clones were subjected to screening in the analysis of hemadsorption on reactivity with cell lines NR6, NR6wtEGFRand NR6ΔEGFRand then analyzed using analyses of hemadsorption using cell lines human glioblastoma U87MG, U87MGwtEGFRand U87ΔEGFR. Selected hybridomas supernatants subsequently examined using Western blotting and, in addition, were subjected to immunohistochemical analysis. The newly created Mat, showing the expected pattern of reactivity was cleansed.

Five hybridomas, and for further characteristics were initially selected three clones: 124 (IgG2a), 806 (IgG2b) and 1133 (IgG2a) - based high titer of antibodies (1:2500) when using NR6ΔEGFRand low background in the reaction of hemagglutination for counting rosette NR6 cells and NR6wtEGFR. The fourth clone, 175 (IgG2a), was subsequently further characterized and discussed separately in example 23, below. Subsequent reactions of these antibodies hemagglutination (non-diluted supernatant ≤10%) showed no reactivity with the line of natural cells human glioblastoma U87MG and U87MGwtEGFRbut gave a strong reaction with U87MGΔEGFR; less reactivity was observed�ü with A431. In contrast, analysis using FACS (cell sorting device with excitation fluorescence), 806 did not give a reaction with a line of natural U87MG cells, intensely stained U87MGΔEGFRand to a lesser extent U87MGwtEGFRthat indicates the binding 806 and ΔEGFR, and with EGFR wild type (see below).

Then l24, Mat and Mat were analyzed in assays using Western blotting for reactivity with EGFR wild-type and ΔEGFR. Lysates were extracted obtained by detergent treatment of NR6 cellsΔEGFR, U87MGΔEGFRand A431. All three Mat showed a similar pattern of reactivity with the cell lysates, painting as EGFR wild type (170 kDa) and protein ΔEGFR (140 kDa). As a control reagent was used R.I., which, as you know, gives the reaction with EGFR wild type (Waterfield et al. (1982) J. Cell Biochem. 20(2), 149-161), instead Mat, which, as you know, gives no reaction in the analyses using Western blotting. R.I. demonstrated reactivity with EGFR wild-type and ΔEGFR. All three newly created clone showed reactivity with ΔEGFR and less strong reactivity with EGFR wild-type. DH8.3 gave a positive reaction only in the case of lysates of U87MGΔEGFRand NR6ΔEGFR.

Table 1 presents the results of immunochemical studies of clone 124, 806, and 1133, and Mat and DH8.3 xenotransplant�Ah U87MG tumor cells, U87MGΔEGFRand A431. All Mat showed strong staining of xenotransplanted U87MG cellsΔEGFR. Only Ab528 showed weak reactivity compared to xenograft natural U87MG cells. In the A431 xenograft Mat showed strong homogeneous reactivity. Mat, Mat and Mat showed reactivity, mainly with basal located cells A431 squamous cancer and did not react with the upper cell layers or squamous cell component. DH8.3 gave a negative reaction in the case of A431 xenografts.

Table 1
Immunohistochemical studies of antibodies 528, DH8.3, and 124, 806, and 1133
AntibodyXenograft ΔU87MGΔEGFRXenograft A431Xenograft U87MG (native)
MatPositive reactionPositive reactionPositive reaction (focal staining)
MatPositive reactionPosition�tive reaction (mainly basal cell) -
MatPositive reactionPositive reaction (mainly basal cell)-
MatPositive reactionPositive reaction (mainly basal cell)-
DH8.3Positive reaction--

Slight staining of the stroma due to the discovery of endogenous mouse antibodies.

Sequencing

Were sequenced variable regions of heavy (VH) and light (VL) chains Mat, Mat and Mat, and identified the complementarity determining areas (CDR), as described next.

Mat

VH Mat: a nucleic acid sequence (SEQ ID NO: 1) and amino acid sequence with signal peptide (SEQ ID NO: 2) shown in Fig. 14A and 14B, respectively (signal peptide underlined in Fig. 14B). Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 15, 16 and 17, respectively) are shown underlined in Fig. 16. Amino acid sequence of VH Mat without its signal peptide (SEQ ID NO: 11) is represented by n� Fig. 16.

VL Mat: a nucleic acid sequence (SEQ ID NO: 3) and amino acid sequence with signal peptide (SEQ ID NO: 4) shown in Fig. 15A and 15B, respectively (signal peptide underlined in Fig. 15B). Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 18, 19, and 20, respectively) are shown underlined in Fig. 17. Amino acid sequence of VL Mat without its signal peptide (SEQ ID NO: 12) shown in Fig. 17.

Mat

VH Mat: nucleotide (SEQ ID NO: 21) and amino acid (SEQ ID NO: 22) sequence shown in Fig. 51A and 51B, respectively. Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 23, 24 and 25, respectively) are shown in underline.

VL Mat: nucleotide (SEQ ID NO: 26) and amino acid (SEQ ID NO: 27) sequences shown in Fig. 51C and 51, respectively. Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 28, 29 and 30, respectively) are shown in underline.

Mat

VH Mat: nucleotide (SEQ ID NO: 31) and amino acid (SEQ ID NO: 32) sequences shown in Fig. 52A and 52B, respectively. Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 33, 34 and 35, respectively) are shown in underline.

VL Mat: nucleotide (SEQ ID NO: 36) and amino acid (SEQ ID NO: 37) sequence shown in Fig. 52C and 52D, respectively. Defining complex in�interest plots CDR1, CDR2 and CDR3 (SEQ ID NO: 38, 39 and 40, respectively) are shown in underline.

Example 2

Analysis of antibody binding to the cell lines by FACS

For further characteristics set forth here and in subsequent examples, was initially selected Mat. Mat and Mat were also selected for further characteristics discussed in example 26 below, and found to have properties corresponding to the unique properties Mat discussed here.

To determine the specificity Mat its binding to cells U87MG, U87MG.Δ2-7 and U87MG.wtEGFR was analyzed using cell sorting device with excitation fluorescence (FACS). Briefly, cells were labeled with the relevant antibody (10 μg/ml), and then conjugated with fluorescein goat antibody against mouse IgG (diluted 1:100; Calbiochem, San Diego, CA, USA; Becton-Dickinson PharMingen, San Diego, CA, USA) as described previously (Nishikawa et al., 1994). FACS data were obtained on a Coulter Epics Elite ESP by fixing a minimum of 5000 events and analyzed using EXPO (version 2) for Windows. Irrelevant IgG2b was included as a matching isotype control for Mac, and was included antibody 528, as it recognizes and de2-7 EGFR wild-type.

Only antibody 528 was able to paint the parental cell line U87MG (Fig. 1), which is consistent with previous reports that these to�EDI Express EGFR wild-type (Nishikawa et al., 1994). Mat and DH8.3 showed levels of binding are similar to those of the control antibody, which clearly demonstrates that they are unable to bind the wild-type receptor (Fig. 1). Linking matching isotype control antibodies with U87MG cells.Δ2-7 and U87MG.wtEGFR was the same as the binding observed in the case of U87MG cells.

Mat stained U87MG cells.Δ2-7 and U87MG.wtEGFR, which indicates that Mat specifically recognizes the de2-7 EGFR and amplificatory EGFR (Fig. 1). Antibody DH8.3 stained U87MG cells.Δ2-7, confirming that the antibody DH8.3 specifically recognizes the de2-7 EGFR (Fig. 1). As expected, the antibody 528 stained lines such as U87MG cells.Δ2-7 and U87MG cells.wtEGFR (Fig. 1). As expected, the antibody 528 stained U87MG cells.Δ2-7 more intensively than the parent cell line, because it binds with the receptor de2-7 and wild-type receptors, which coexpressed in these cells (Fig. 1). Similar results were obtained using a mixed haemadsorption using protein A, which is associated with surface IgG detected by the appearance of protein And covered with human erythrocytes (group O), on target cells. Monoclonal antibody 806 gave the reaction with U87MG cells.Δ2-7, but have not demonstrated significant reactivity (non-diluted supernatant less than 10%) with U87MG cells, expressyou�their EGFR wild type. It is important that Mat had also contacted cell line BaF/3.Δ2-7, which suggests that the reactivity Mat coexpression of EGFR wild-type is not required (Fig. 1).

Example 3

Binding of antibodies in a blood test

To further determine the specificity Mat and antibodies DH8.3 binding was investigated using ELISA. To determine the specificity of antibodies used two types of ELISA. In the first analysis the tablets were coated with sEGFR (10 μg/ml in 0.1 M carbonate buffer pH of 9.2) for 2 h, and then blocked with 2% human serum albumin (HSA) in PBS. sEGFR is a recombinant ekstraklasy domain (amino acids 1 to 621) EGFR wild-type and was produced as previously described (Domagala et al. (2000) Stoichiometry, kinetic and binding analysis of the interaction between Epidermal Growth Factor (EGF) and the increasing interest among Domain of the EGF receptor. Growth Factors. 18, 11-29). In the hole in three replicates antibody was added in increasing concentrations in 2% HSA in phosphate buffered saline (PBS). Bound antibody was detected using conjugated with horseradish peroxidase sheep antibodies against mouse IgG (Silenus, Melbourne, Australia), using ABTS (Sigma, Sydney, Australia) as the substrate, and the optical density was measured at 405 nm.

As Mat and antibody 528 curves demonstrated dose-dependent binding with saturation of the immobilized wild-type sEGFR (Fig. 2A). Since uni�a bottom of the connecting peptide, discovered in de2-7 EGFR, is not contained in sEGFR, Mat must contact an epitope located within the sequence of EGFR wild-type. The binding of an antibody 528 itself was less observed in the case Mat, probably because it recognizes a conformational epitope. As expected, the antibody DH8.3 is not contacted with the wild-type sEGFR even at concentrations up to 10 μg/ml (Fig. 2A). Although sEGFR in solution inhibited the binding of an antibody 528 with immobilized sEGFR dose-dependent manner, he was unable to inhibit the binding of met (Fig. 2B). This suggests that Mat can communicate only with EGFR wild-type after immobilization on plates for ELISA, a process that may cause a conformational change. Similar results were observed using BIAcore, thereby Mat contacted with immobilized sEGFR, but immobilized Mat was incapable of binding of sEGFR in solution (Fig. 2C).

After denaturation by heating for 10 min at 95°C sEGFR in solution was able to inhibit binding Mat with immobilized sEGFR (Fig. 2C), confirming that Mat can communicate with EGFR wild-type under certain conditions. Interestingly, denatured sEGFR was unable to inhibition of binding of the antibody 528 (Fig. 2C), indicating that this antibody recognizes a conformational epitope. Antibody D8.3 showed dose-dependent binding to saturation with a unique peptide de2-7 EFR (Fig. 2D). Neither Mat or antibody 528 not been contacted with the peptide, even in concentrations exceeding those that have been used to achieve saturation binding DH8.3, which provides further evidence that Mat does not recognize antigenic determinants in this peptide.

In the second analysis biotinylating specific for the de2-7 peptide (Biotin-LEEKKGNYVVTDH (SEQ ID NO: 5)) was associated with tablets for ELISA, pre-coated with streptavidin (Pierce, Rockford, Illinois). Antibodies are bound and found, as in the first analysis. Neither Mat or antibody 528 not been contacted with the peptide, even in concentrations exceeding those that have been used to achieve saturation binding DH8.3, which provides further evidence that Mat does not recognize antigenic determinants in this peptide.

To demonstrate further that Mac recognizes an epitope different from that of the connecting peptide, were conducted additional experiments. C-terminal biotinylating peptide de2-7 (LEEKKGNYVVTDH-Biotin (SEQ ID NO: 6)) was used in studies using Mat and L8A4 created against the peptide de2-7 (Reist et al. (1995) Cancer Res. 55(19), 4375-4382; Foulon et al. (2000) Cancer Res. 60(16), 4453-4460).

The reagents used in the studies using peptides

The connecting peptide: LEEKKGNYVVTDH-OH (Biosource, Camarillo, CA);

C peptide: LEEKKGNYVVTDH(K-Biotin)-OH (Biosource, Camarillo, CA);

sEGFR: derived from CHO cells recombinant soluble ekstraklasy domain (amino acids 1 to 621) EGFR wild-type (LICR Melbourne);

Mat: mouse monoclonal antibody IgG2b(LICR NYB);

L8A4: mouse monoclonal antibody IgG1(Duke University);

IgG1matching isotype control Mat;

IgG2bmatching isotype control pad.

C peptide was immobilized on the microsensor chip with streptavidin on its surface with a density of 350 RE (±30 D). Serial dilutions of the Mat was tested for reactivity with the peptide. To assess the specificity of conducted experiments using blocking using nebutiniausias peptide.

L8A4 showed strong reactivity with peptide C even at low antibody concentrations (6,25 nm) (Fig. 2E). Mat showed no detectable specific reactivity with peptide C until concentrations of antibodies comprising 100 nm (highest tested concentration) (Fig. 2E and 2F). It was expected that L8A4 will react with peptide C, since this peptide was used as immunogen for education L8A4. The addition of the connecting peptide (nebutiniausias, 50 µg/ml) completely blocked the reactivity L8A4 with C peptide, confirming the specificity of this antibody against the epitope will connect�form of further peptide.

In the second set of experiments using BIAcore sEGFR was immobilized on the microsensor chip with CM on its surface with a density component of ~4000 RYO. Serial dilutions of the Mat was tested for reactivity with sEGFR.

Mat gave a strong reaction with the denatured sEGFR, while L8A4 did not react with denatured sEGFR. Reactivity Mat with denatured sEGFR decreases with decreasing concentrations of antibody. It was expected that L8A4 will not react with sEGFR because L8A4 was formed using the connecting peptide as an immunogen, and sEGFR does not contain the connecting peptide.

There were also experiments with the use of immunoablative dot-blot. Serial dilutions of the peptide in a volume of 0.5 µl was applied as spots on PVDF or nitrocellulose membrane. Membranes were blocked using 2% BSA in PBS, and then probed using antibodies 806, L8A4, DH8.3 and the control antibodies. Antibody L8A4 and DH8.3 contacted with the peptide on the membrane (data not presented). Mat not bind the peptide in the concentrations in which L8A4 clearly demonstrated binding (data not presented). Control antibodies were also negative in binding of the peptide.

Mat was associated with EGFR wild-type cell lysates after immunoblotting (results not presented�ATA). This result differs from the results obtained with the antibody DH8.3, which is reacted with de2-7 EGFR, but not with EGFR wild-type. Thus, Mat can recognize EGFR wild type after denaturation, but not when the receptor is in its natural state on the cell surface.

Example 4

Analysis of Scatchard

Analysis of Scatchard using U87MG cells.Δ2-7, was made after the amendment of immunoreactivity to determine the relative affinity of each antibody. Antibody was labeled with125I (Amrad, Melbourne, Australia) using the method using chloramine T, and the immunoreactivity was determined using analysis of Lindmo (Lindmo et al. (1984) Determination of the immunoreactive fraction of radiolabeled monoclonal antibodies by linear extrapolation to binding at infinite antigen excess. J. Immunol. Methods. 72, 77-89).

All binding assays were performed in 1% HSA/PBS at 1-2×106live U87MG cells.Δ2-7 or A431 for 90 min at 4°C with mild rotation. A constant concentration of 10 ng/ml125I-labeled antibody used in the presence of increasing concentrations of the corresponding unlabeled antibody. Nonspecific binding was determined in the presence of 10,000-fold excess of unlabeled antibody. No125I-labeled Mat or antibody DH8.3 were not associated with parental U87MG cells. After incubation cells were washed and counted in respect of the associated 125I-labeled antibody using a gamma counter COBRA II, Packard Instrument Company, Meriden, CT, USA).

As Mat and antibody DH8.3 retained high immunoreactivity after iodization, which was typically more than 90% in the case met and 45-50% in the case of antibodies DH8.3. Mat possessed affinity to the receptor de2-7 EGFR, amounting to 1.1×109M-1whereas the affinity DH8.3 was approximately 10 times lower, ranging from 1.0×108M-1. As iodated antibody were not associated with parental U87MG cells. Mat recognized average 2.4×105binding sites in each cell, wherein the antibody DH8.3 was associated with an average of 5.2×105sites. Thus, good agreement existed not only in the number of receptors between the antibodies, but also with the previous message about the establishment of 2.5×105receptor de2-7 in each cell, defined with excellent specific against de2-7 EGFR antibody in the same cell line (Reist et al. (1997) Improved targeting of an anti-epidermal growth factor receptor variant III monoclonal antibody in tumor xenografts after labeling using N-succinimidyl 5- - iodo-3-pyridinecarboxylate. Cancer Res. 57, 1510-1515).

Example 5

Internalization of antibodies by U87MG cells.Δ2-7

The rate of internalization of the antibody after binding to the cell-target impacts on the characteristics of its effects on the tumor and its therapeutic �osmocote. Therefore, the authors present invention investigated the internalization math and antibodies DH8.3 after binding to U87MG cells.Δ2-7 by FACS. The U87MG cells.Δ2-7 cells were then incubated with either Mat or antibody DH8.3 (10 μg/ml) for 1 h in DMEM at 4°C. After washing, cells were transferred to DMEM pre-warmed to 37°C, and aliquots were taken at various time points after incubation at 37°C. Internalization was stopped by immediate washing aliquots are cold as ice with buffer for washing (1% HSA/PBS). Upon completion of the incubation period the cells were stained and examined by FACS as described above. Internalization in percent was calculated by comparing the staining antibodies to the surface at different times from those at time = 0, using the formula: percentage of internalized antibody = (mean fluorescence at time x - background fluorescence)/(mean fluorescence at time 0 - background fluorescence) × 100. This method was alidibirov in one analysis with the use of iodinated antibody (Mat) to determine the internalization, as described previously (Huang et al. (1997) The enhanced tumorigenic activity of a mutant epidermal growth factor receptor common in human cancers is also been other ideas where by threshold levels of constitutive tyrosine phosphorylation and unattenuated signaling. J. Biol. Chem. 272, 2927-2935). Differences in the degree of internalization at various time points were compared, used�lsua student test. Throughout this study the significance of the data was analyzed using student's criterion, except for analyses ofin vivosurvival data were analyzed using the Wilcoxon test.

Both antibodies demonstrated a relatively rapid internalization, reaching the same levels after 10 min in the case met and after 30 minutes in the case of DH8.3 (Fig. 3). Internalization of DH8.3 was significantly higher both in terms of speed (80,5% DH8.3, internalized after 10 min, compared with 36.8% in the case of mit, p<0.01) and the ratio to the total quantity, internalized after 60 min (93.5 per cent compared to a 30.4%, p<0,001). Mat demonstrated slightly lower levels of internalization after 30 and 60 min compared to 20 min in all 4 analyses conducted (Fig. 3). This result was also confirmed using the analysis of internalization on the basis of iodized Mat (data not presented).

Example 6

Electron microscopic analysis of internalization of antibodies

Taking into account the above mentioned differences in speeds between internalization by antibodies, a detailed analysis of the directional movement of antibodies into cells was performed using electron microscopy.

The U87MG cells.Δ2-7 were grown in tablets, divided into the wells coated with gelatin, (Nunc, Naperville, IL) to 80% by�influencesthe, and then washed with cold as ice DMEM. Then cells were incubated with met or antibody DH8.3 in DMEM for 45 min at 4°C. After washing, cells were incubated for another 30 min with conjugated with gold (20 nm particles) antibody against mouse IgG (BBlnternational, Cardiff, United Kingdom) at 4°C. After additional washing of pre-warmed DMEM/10% PCS was added to the cells, which were incubated at 37°C for various time periods from 1 to 60 min. the antibody Internalization was stopped with cold as ice environments, and the cells were fixed with 2.5% glutaraldehyde in PBS/0,1% HSA, and then were subjected to additional fixation in 2.5% osmium tetroxide. After dehydration using a stepped series of acetone, the samples were poured resin EPON/Araldite, made ultrathin sections using microtome Reichert Ultracut S (Leica) and placed on Nickel grids. Sections were stained with uranyl acetate and analyzed by lead citrate before observation under a transmission electron microscope Philips CM 12 at 80 kV. Statistical analysis of gold grains contained in bordered pits, were performed using the Chi-square test.

While antibody DH8.3 was subjected to the internalization predominantly through bordered pits, Mat seems to have been internalized through macropinocytosis (Fig. 19). Dei�Hey, we really, a detailed analysis of 32 bordered pits formed in cells subjected to incubation with met showed that none of them contained the antibody. In contrast, approximately 20% of bordered pits in cells subjected to incubation with DH8.3 were positive for the antibodies, however, a number of them contained a number of gold grains. With the help of statistical analysis of total number of gold grains contained in bordered pits, it was found that the difference was highly significant (p<0.01). After 20-30 minutes, both antibodies could be seen in the structures that morphologically resemble liposomes (Fig. 19C). The presence of cellular debris within these structures is also consistent with their lysosomal nature.

Example 7

Bioespeleo antibodies have tumor Nude thymus of mice

Bioespeleo Mat and antibodies DH8.3 was compared in Nude thymus of mice with U87MG xenograft in one side and U87MG xenograft.Δ2-7 in the other side. For this study was chosen relatively short period of time, as in the previous message indicated that the antibody DH8.3 shows the maximum exposure levels for tumors between 4-24 h (Hills et al. (1995) Specific targeting of a mutant, activated EGF receptor found in glioblastoma using a monoclonal antibody. Int. J. Cancer. 63, 537-543).

Tumor xenograft was established in Nude thymus of mice BAB/c by subcutaneous injection of 3×10 6cells U87MG, U87MG.Δ2-7 or A431. The expression of de2-7 EGFR in U87MG xenograft.Δ2-7 remained stable throughout the study period of bearsdley that determined using immunohistochemical analysis at various time points (data not presented). The A431 cells retained their reactivity with met after development in tumor xenograft that determined using immunohistochemical analysis. The U87MG cells or A431 were injected in one side for 7-10 days prior to injection of U87MG cells.Δ2-7 to the other side because of the higher growth rate observed in the case of expressing de2-7 EGFR xenografts. Antibody was labeled with a radioactive isotope and were evaluated for immunoreactivity, as described above and were injected to the mice by retro-orbital, when the weight of tumors were 100-200 mg. Each mouse received two different antibodies (2 μg of each antibody): 2 μci125I-labeled Mat and 2 μci131I-labeled DH8.3 or 528. If not specified, groups of 5 mice were sacrificed at various time points after injection, and blood was obtained by puncture of the heart. By opening received tumor, liver, spleen, kidneys and lungs. All tissues were weighed and analyzed for activity125I and131I using the window for counting using two channels. For each antibody data were submitted to�to % ID/g tumor, determined by comparison with the standards of the injected dose (ID) and in turn the relationship of the localization of the tumor: blood/liver (i.e., the % ID/g of tumor divided by the % ID/g blood or liver). Differences between groups were analyzed using student's criterion. After injection, labeled with a radioactive isotope met some tumors were fixed in formalin, embedded in paraffin, done medium with a thickness of 5 μm, and then was carried out by exposing x-ray film (AGFA, Mortsel, Belgium) radiation from them to determine the localization of antibodies using radio-autography.

Regarding the % ID/g tumor, Mat reached in the U87MG xenograft.Δ2-7 its highest level, amounting to 18.6% ID/g tumor, after 8 h (Fig. 4A), which is significantly higher than in any other tissue except blood. Although DH8.3 also showed the highest levels in the tumor after 8 h, the level was statistically (p<0,001) lower, at 8.8% ID/g tumor than in the case of Mat (Fig. 4B). The levels of both antibodies was slowly decreased after 24 and 48 h. Radioautography of tissue sections of U87MG xenograft.Δ2-7 obtained 8 hours after injection only125I-labeled Mat, clearly shows the localization of the antibody in viable tumor (Fig. 20). The antibody showed no specific focus on xenograft bear�raising U87MG cells (Fig. 4A and 4B). With regard to the relationship of the tumor:blood/liver, Mat showed the greatest respect after 24 h as in the case of blood (ratio of 1.3), and in the case of the liver (ratio, amounting to 6,1) (Fig. 5A and 5B). Antibody DH8.3 had the greatest attitude in the case of blood after 8 h (the ratio of the gap of 0.38) and after 24 h in the case of the liver (the ratio of the gap of 1,5) (Fig. 5A and 5B), both of which are significantly below the values obtained for Mat.

As described above, the levels met in the tumor reached a maximum after 8 hours. Although this maximum is relatively early compared to many potential for anti-tumor antibodies, it is completely consistent with other studies using specific against de2-7 EGFR antibodies, all of which demonstrate the highs through 4-24 hours after injection using a similar dose of antibody (Hills et al., 1995; Reist et al., 1997; Reist et al. (1996) Radioiodination of internalizing monoclonal antibodies using N-succinimidyl 5- - iodo-3-pyridinecarboxylate. Cancer Res. 56, 4970-4977). Indeed, unlike in previous messages constituting the 8 h time point was included, assuming that the maximum targeted delivery of antibodies will be achieved quickly. % ID/g of tumor observed in the case Mat, was similar to that reported for other specific against de2-7 EGFR antibodies using standard methods jodirovanic� (Hills et al., 1995; Huang et al., 1997; Reist et al. (1995) Tumor-specific anti-epidermal growth factor receptor variant III monoclonal antibodies: use of the tyramine-cellobiose radioiodination method enhances cellular retention and uptake in tumor xenografts. Cancer Res. 55, 4375-4382).

The reason for the early maximum is probably twofold. First, tumors, expressservice de2-7 EGFR, including transfetsirovannyh U87MG cells, grow very quickly in the form of tumor xenografts. Therefore, even during a relatively short period of time, which was used in these studies, bearsdley, the size of the tumor increases to such an extent (5-10-fold increase in mass within 4 days), % ID/g tumor reduced compared with slow-growing tumors. Secondly, although internalization Mat was relatively slow compared with DH8.3, it nevertheless is fast relative to many other systems antibody/tumor antigen. Subjected to the internalization of the antibodies are subjected to rapid proteolysis, the degradation products are excreted from the cells (Press et al. (1990) Inhibition of catabolism of radiolabeled antibodies by tumor cells using lysosomotropic amines and carboxylic acid ionophores. Cancer Res. 50, 1243-1250). This process of internalization, degradation and excretion reduces the amount of iodinated antibody remaining inside the cells. Therefore, subject to the internalization of the antibodies exhibit lower levels of exposure than they are not subjected to the internalization equiv�tape. Reported here is the data of electron microscopy show that subjected to the internalization of met quickly moves to lysosomes, where it is presumably rapid degradation. These data are consistent with the rapid removal of iodine from the cell.

The previously described monoclonal antibody L8A4 against unique connective peptide found in de2-7 EGFR, behaves similar to Mat (Reist et al. (1997)In vitroandin vivobehavior of radiolabeled chimeric anti-EGFRvIII monoclonal antibody: comparison with its murine parent. Nucl. Med. Biol. 24, 639-647). When using U87MG cells transfected de2-7 EGFR, the antibody demonstrated a similar rate of internalization (35% after 1 hour compared to 30% in 1 hour in case Mat) and showed comparable in vivo orientation when using 3T3 fibroblasts transfected de2-7 EGFR (max of 24% ID/g tumor after 24 hours, compared with 18% ID/g tumor in 8 hours in case Mat) (Reist et al. (1997) Improved targeting of an anti-epidermal growth factor receptor variant III monoclonal antibody in tumor xenografts after labeling using N-succinimidyl 5- - iodo-3-pyridinecarboxylate. Cancer Res. 57, 1510-1515).

Interestingly,in vivothe retention of the antibody in the tumor xenograft was improved in the case of tagging the N-Succinimidyl-5-iodo-3-pyridinecarboxylic (Reist et al., 1997). This labeled prosthetic group is positively charged at lysosomal pH �, thus, improves retention in the cell (Reist et al. (1996) Radioiodination of internalizing monoclonal antibodies using N-succinimidyl 5- - iodo-3-pyridinecarboxylate. Cancer Res. 56, 4970-4977). Improved retention is potentially useful for the application of antibodies for radioimmunotherapy, and this method could be used to improve retention of iodized Mat or its fragments.

Example 8

Binding Mat with cells having amplificatory EGFR gene

To check whether Mac to recognize EGFR expressed in cells that have amplificatory receptor gene, analyzed its binding to A431 cells. As described earlier, the cells are cells of A431 human squamous cancer and Express high levels of EGFR wild-type. Were low, but highly reproducible, bondage Mat with A431 cells in the analysis using FACS (Fig. 6). Antibody DH8.3 were not associated with A431 cells, which indicates that the binding Mat was not the result of the expression of de2-7 EGFR at low levels (Fig. 6). As expected, directed against EGFR antibody 528 demonstrated strong staining of A431 cells (Fig. 6). Taking into account this result, the binding Mat with A431 cells was assessed using analysis of Scatchard. Despite the fact that the binding of iodinated Mat was relatively low, it was possible to obtain naproti�orucevic data for analysis of Scatchard. On average, in three such experiments determined a value for affinity, amounting to 9.5×107M-1when determining to 2.4×105receptors in every cell. Thus, the affinity for this receptor was approximately 10 times lower than the affinity for the de2-7 EGFR. In addition, Mat seems to recognize only a small portion of EGFR is found on the surface of A431 cells. Antibody 528 determined approximately 2×106receptors in every cell, which is consistent with numerous other studies (Santon et al. (1986) Effects of epidermal growth factor receptor concentration on tumorigenicity of A431 cells in nude mice. Cancer Res. 46, 4701-4705).

To make sure that these results are not confined only to the cell line A431, the reactivity Mat was investigated in 2 other cell lines, showing EGFR gene amplification. As reported, as cell line tumors of the head and neck HN5 (Kwok T. T. and Sutherland, R. M. (1991) Differences in EGF related radiosensitisation of human squamous carcinoma cells with high and low numbers of EGF receptors. Br. J. Cancer. 64, 251-254) and line of breast cancer cells MDA-468 (Filmus et al. (1985) MDA-468, a human breast cancer cell line with a high number of epidermal growth factor (EGF) receptors, has an amplified EGF receptor gene and is growth inhibited by EGF. Biochem. Biophys. Res. Commun. 128, 898-905) contain multiple copies of the EGFR gene. In accordance with these reports, the antibody 528 demonstrated intense staining of both cell lines (Fig. 21). As in the case of cell line A431, Mat, carried�definitely a stained both cell lines, but at a lower level than the level observed in the case of the antibody 528 (Fig. 21). Thus, the binding Mat not limited to A431 cells, but appears to be a General result for cells having a gene amplification of EGFR.

Recognition of wild-type sEGFR monoclonal antibody 806, clearly requires some denaturation of the receptor to expose the epitope. Degree required denaturation is only small, because even the absorption of wild-type sEGFR to plastic surfaces was induced strong binding Mat in ELISA tests. Because Mat was associated with only approximately 10% of EGFR on the surface of A431 cells, it is tempting to assume that this subset of receptors may have an altered conformation, similar to that induced by truncation in de2-7 EGFR. Indeed, the very high expression of EGFR is mediated by gene amplification in A431 cells may be the cause of the incorrect processing of some receptors, leading to an altered conformation. Interestingly, semiquantitative immunoblotting of lysates of A431 cells using math showed that it can recognize most of the EGF receptor in A431 after electrophoresis in SDS-page and Western transfer. This result additionally supports thesis that met the hol�ivalsa with a subset of receptors on the cell surface of A431, which has an altered conformation. These observations in A431 cells are consistent with the data immunohistochemical analysis showing that Mat binds to gliomas with EGFR gene amplification. Since the binding Mat was completely negative in the case of parental U87MG cells, it seems that this phenomenon may be limited to cells that have amplificatory EGFR, although the level of "denatured" receptor on the surface of U87MG cells may be below the level of detection. However, the latter seems unlikely, since iodized Mat not been associated with precipitation of U87MG cells, containing up to 1×107cells.

Example 9

In vivoorientation Mat against A431 cells

Was performed a second study of bearsdley using math to determine whether it targets xenograft A431 tumor cells. The study was conducted over a longer period of time for more information on orientation Mat against U87MG xenografts.Δ2-7, which were included in the case of all the mice as a positive control. In addition, directed against EGFR antibody 528 was included as a positive control in the case of A431 xenografts as pre cursors�following the study showed low, but a significant focus of this antibody against A431 cells, develop Nude thymus in mice (Masui et al. (1984) Growth inhibition of human tumor cells in athymic mice by anti-epidermal growth factor receptor monoclonal antibodies. Cancer Res. 44, 1002-1007).

During the first 48 h Mat showed the direction properties almost identical to those observed in the initial experiments (Fig. 7A is compared with Fig. 4A). The value of % ID/g tumor levels met in the U87MG xenograft.Δ2-7 slowly decreased after 24 h, but always remained above the levels determined in normal tissue. Absorption in the A431 xenograft was relatively low, however there was a slight increase in % ID/g tumor during the first 24 hours, not observed in normal tissues such as liver, spleen, kidney and lung (Fig. 7A). Absorption of the antibody 528 was very small in both xenografts when represented as % ID/g of tumor (Fig. 7B) in part due to faster removal of the antibody from the blood. Radioautography of tissue sections A431 xenografts obtained 24 h after injection only125I-labeled Mat, clearly shows the localization of the antibody in viable tumor at the periphery and not in the Central areas of necrosis (Fig. 23). As to the relationship of the tumor:blood, Mat reached a maximum after 72 h in the case of U87MG xenograft.Δ2-7 and after 100 h in the case of xootr�of spuntata A431 (Fig. 8A, B). With regard to the A431 tumor, although the ratio of tumor:blood for Mat never exceed 1.0, it's really increased throughout the observation period (Fig. 8B) and was higher than in other tested tissues (data not presented), indicating low levels of orientation.

The ratio of tumor:blood for antibodies 528 demonstrated a profile similar to that for math, although higher levels were observed in the A431 xenograft (Fig. 8A, B). In the case of U87MG xenografts.Δ2-7 Mat showed maximum ratio tumor:liver, amounting to 7.6 after 72 h, clearly showing the preferred absorption in these tumors compared with normal tissue (Fig. 8C). Other relationships the tumor:organ for math were similar to those registered in the liver (data not presented). Maximum ratio tumor:liver for Mat in the A431 xenograft was 2.0 after 100 h, again indicating a slight preferred absorption in the tumor compared with normal tissue (Fig. 8D).

Example 10

Therapeutic research

Effects Mat was determined in two models using xenografts: a preventive to the disease model and model-seated tumors.

The model using xenografts

In accordance with �regsetvalue messages (Nishikawa et al., Proc. Natl. Acad. Sci. U. S. A., 91(16), 7727-7731) U87MG cells, transfetsirovannyh de2-7 EGFR, grew faster than the parental cells and U87MG cells transfected EGFR wild type. Therefore, it was impossible for the development of both types of cells in the same mice.

Tumor cells (3×106) in 100 ml of PBS was inoculable subcutaneously in both flanks of female Nude thymus of mice aged 4-6 weeks (Animal Research Centre, Western Australia, Australia). Therapeutic efficacy Mat was studied both in a preventive model and in the model-seated tumors. In the case of preventive models 5 mice with two each xenograft was treated by intraperitoneal administration of either 1 or 0.1 mg Mat, or vehicle (PBS) since prior to inoculation of tumor cells. Treatment was continued for the introduction of a total of 6 doses, 3 times a week for 2 weeks. In the model-seated tumor treatment was started when the average volume of tumors reached 65±is 6.42 mm3(U87MG.Δ2-7), 84±9,07 mm3(U87MG), 73±7.5 mm3(U87MG.EGFR wild-type) or 201±19,09 mm3(A431 tumors). Tumor volume in mm3was determined, using the formula (length × width2)/2, where length was a longest axis and width the measurement at right angles relative to the length (Clark et al. (2000) Therapeutic efficacy of anti-Lewis (y) humanized 3S 193 radioimmunotherapy in a breast cancer model: enhanced activity when combined with Taxol chemotherapy. Clin. Cancer Res. 6, 361-3628). Data were presented as the average volume of tumors ± standard error for each subject in the treatment group. Statistical analysis was performed at the specified time points using student's criterion. The animal was euthanized when the approximate volume of the xenograft reached 1.5 cm3and the tumor was resected for histological analysis. This research project was authorized by the Commission on the issue of the ethical treatment of animals Austin and Repatriation Medical Centre.

Histological analysis of tumor xenografts

Xenograft dissected and divided in half. One half was fixed in 10% formalin/PBS prior to pouring the wax. Then make slices with a thickness of four microns, and stained with hematoxylin and eosin (H&E) for conventional histological analysis. The other half was filled compound Tissue Tek® OCT (Sakura Finetek, Torrance, CA), frozen in liquid nitrogen and stored at -80°C. was Doing fine (5 micron) frozen sections and fixed in cold as ice acetone for 10 min followed by air drying for an additional 10 min, the Slices were blocked in blocking reagent proteins (Lipshaw Immunon, Pittsburgh, USA) for 10 min, and then incubated with biotinylated the first antibody (1 mg/ml) for 30 min at room temperature. Everything is biotinylated antibodies have been using to�component to biotinylate proteins ECL (Amersham, Baulkham Hills, Australia), according to manufacturer's instructions. After washing with PBS, the slices were incubated with a complex of streptavidin-horseradish peroxidase for 30 min (Silenus, Melbourne, Australia). After final washing with PBS the sections were exposed substrate 3-amino-9-ethylcarbazole (AEC) (0.1 M acetic acid, 0.1 M sodium acetate, 0,02 M AEC (Sigma Chemical Co., St Louis, MO)) in the presence of hydrogen peroxide for 30 min. the Sections were washed with water and subjected to contrast staining with hematoxylin for 5 min and mounted on slides.

Efficiency met in preventive models

Mat were tested for efficacy against tumors of U87MG and U87MG.Δ2-7 in the preventive model using xenografts. Antibody or vehicle was administered intraperitoneally one day before the inoculation of tumor cells, and the introduction was carried out 3 times a week for 2 weeks. Mat had no effect on the growth of xenografts of parental U87MG cells, which Express EGFR wild-type, at a dose of 1 mg at each injection (Fig. 9A). On the contrary, Mat significantly inhibited the growth of U87MG xenografts.Δ2-7 dose-dependent manner (Fig. 9B). On day 20, when control animals were killed, the average volume of tumors was 1637±178,98 mm3in the case of the control group, statistically less 526±94,74 mm3in the case of groups, to�ora were administered 0.1 mg at each injection (p< 0,0001), and 197±42,06 mm3in the case group, which was administered 1 mg at each injection (p<0,0001). The treated groups were sacrificed on day 24, when the average volume of tumors was 1287±243,03 mm3in the case of the group treated with 0.1 mg and 492±100,8 mm3in the case of the group treated with 1 mg.

Efficiency Mat rooted in the model of xenotransplanted

Taking into account the efficiency met in preventive model using xenografts, was then tested its ability to suppress the growth-seated tumor xenografts. The antibody treatment was as described for the preventative model, except that it started when the average volume of tumors reached 65±is 6.42 mm3in the case of U87MG xenografts.Δ2-7 and 84±9,07 mm3in the case of xenografts of parental U87MG cells. And again Mat had no effect on the growth of xenografts of parental U87MG cells in a dose of 1 mg at each injection (Fig. 10A). On the contrary, Mat significantly inhibited the growth of U87MG xenografts.Δ2-7 dose-dependent manner (Fig. 10B). On day 17, the day before the killing control animals, the average volume of tumors was 935±215,04 mm3in the case of the control group, 386±57,51 mm3in the case of the group, which were administered 0.1 mg at each injection (p<0,0), and 217±58,17 mm3in the case group, which was administered 1 mg at each injection (p<0.002 inch).

For the study, are limited the growth suppression observed at Mat, cells expressing de2-7 EGFR, its efficacy against xenografts U87MG tumor cells.wtEGFR was tested in the model-seated tumors. These cells serve as a model for tumors with EGFR gene amplification without the expression of de2-7 EGFR. Treatment Mat started when the average volume of tumors reached 73±7.5 mm3. Mat significantly inhibited the growth of rooted U87MG xenografts.wtEGFR compared to control tumors treated with vehicle (Fig. 10C). On the day of the killing control animals, the average volume of tumors was 960±268,9 mm3in the case of the control group and 468±78,38 mm3in the case of a group, subjected to treatment by injection, 1 mg (p<0,04).

Histological and immunohistochemical analysis-seated tumors

To determine the possible histological differences between the treated Mat and control U87MG xenograft.Δ2-7 and U87MG.wtEGFR (collected on days 24 and 42, respectively), fixed with formalin, filled with paraffin sections were stained with H&E. the Area of necrosis was observed in slices as U87MG xenografts.Δ2-7 (received 3 days after about�of onania treatment), and U87MG xenografts.wtEGFR (received after 9 days after treatment), the treated Mat. This result was observed repeatedly in several tumor xenografts (n=4). However, in the analysis of sections of xenografts subjected to treatment with control, not found the same areas of necrosis were observed in the treatment Mat. Sections of U87MG xenografts, treated Mat or control, also stained with H&E, and no difference was found in cell viability between the two groups, which serves as an additional confirmation of the hypothesis that the binding Mat induces decreased cell viability/necrosis in the tumor xenograft.

Immunohistochemical analysis sections of the xenograft U87MG, U87MG.Δ2-7 and U87MG.wtEGFR was conducted to determine the expression levels of de2-7 EGFR wild type after treatment Mat. The sections were obtained on days 24 and 42, as described above, and subjected to immunoablative antibody 528 and 806. As expected, the antibody 528 were all stained sections of xenografts without apparent reduction in the intensity between the treated and control tumors. When using Mat staining of sections of U87MG was undetectable, however, registered a positive staining of sections of U87MG xenograft.Δ2-7 and U87MG.wtEGFR. There was no difference in intensity�STI staining Mat between control and subjected to treatment of the U87MG xenograft.Δ2-7 and U87MG.wtEGFR, which suggests that treatment with antibody did not inhibit the expression of de2-7 or EGFR wild-type.

Treatment of A431 xenografts with Mat

To demonstrate that the antitumor effects Mat not limited to U87MG cells, the antibody injected mice with A431 xenograft. These cells have amplificatory EGFR gene and Express approximately 2×106receptors on the cell. As discussed above, met is associated with approximately 10% of these EGFR and acts on the A431 xenograft. Mat significantly inhibited the growth of A431 xenografts when checking in the previously described preventive model using xenotransplanted (Fig. 11A). On day 13, when control animals were killed, the average volume of tumors was 1385±147,54 mm3in the case of the control group and 260±60,33 mm3case of a group, subjected to treatment by injection, 1 mg (p<0,0001).

In a separate experiment component of the 0.1 mg dose Mat also significantly inhibited the growth of A431 xenografts in a preventive model.

Taking into account the efficiency met in preventive model using A431 xenografts, was then tested its ability to suppress the growth-seated tumor xenografts. The antibody treatment was as described for the preventive model, for the claim�ucheniem, what it didn't start until, while the average volume of tumors reached 201±19,09 mm3. Mat significantly inhibited the growth of rooted tumor xenografts (Fig. 11B). On day 13, when control animals were killed, the average volume of tumors was 1142±120,06 mm3in the case of the control group and 451±65,58 mm3in the case group, which was administered 1 mg at each injection (p<0,0001).

Thus, the research described here therapy using Mat was evident in a dose-dependent inhibition of the growth of U87MG xenografts.Δ2-7. On the contrary, suppress growth of xenografts of parental U87MG cells was not observed, despite the fact that they continue to Express the EGFR wild-typein vivo. Mat not only significantly reduced the volume of the xenograft, it also induced significant necrosis inside of the tumor. This is the first report of successful therapeutic usein vivosuch antibodies against glioma xenografts of human cells expressing de2-7 EGFR.

Reported gene amplification of EGFR in a number of different tumors, and it was observed in approximately 50% of gliomas (Voldberg et al., 1997). It has been suggested that subsequent overexpression of EGFR is mediated by gene amplification of the receptor, may provide a growth advantage by increasing HV�triketones signaling and cell growth (Filmus et al., 1987). Line U87MG cells were transfected by EGFR wild-type to create gliomas cell that mimics the process of amplification of the EGFR gene. Treatment rooted U87MG xenografts.wtEGFR monoclonal antibody 806 has led to a significant suppression of growth. Thus, Mat also mediatesin vivoantitumor activity against cancer cells with EGFR gene amplification. Interestingly, the suppression by using Mat U87MG xenografts.wtEGFR seems to be less effective than any observed in the case of U87MG tumors.Δ2-7. This probably reflects the fact that Mat has a low affinity to increased in number as a result of EGFR gene amplification and is associated only with a small portion of receptors presented on the cell surface. However, it should be noted that despite the small effect on the volume of the xenograft U87MG.wtEGFR treatment Mat gave rise to large areas of necrosis within these xenografts.

To exclude the possibility that Mat mediates suppression only derived from U87MG cell lines, we tested its effectiveness against A431 xenografts. This originating from a squamous cancer cell line has a significant amplification of the EGFR gene, which is saved asinvitroandin vivo. Treatment of xenograft A41 monoclonal antibody 806 caused significant suppression of growth and in the preventive model, in the model-seated tumors, which means that the antitumor effects Mat are not limited to lines transfected U87MG cells.

Example 11

The combined therapeutic treatment of A431 xenografts with Mat and AG1478 effect

Antitumor effects Mat in combination with AG1478 effect was tested on mice with A431 xenograft. AG1478 effect (4-(3-chloroanilino)-6,7-dimethoxyquinazoline) is a potent and selective inhibitor of EGFR kinase in comparison with HER2-neu and receptor platelet-derived growth factor (Calbiochem cat. No. 658552). Included three controls: treatment of only the carrier, only the carrier + Mat and only the carrier + AG1478 effect. The results are illustrated in Fig. 12. 0.1 mg Mat was injected 1 day before the creation of xenotransplantation and after 1, 3, 6, 8 and 10 days after the creation of xenotransplantation. 400 mcg AG1478 effect were injected on days 0, 2, 4, 7, 9 and 11 after the creation of xenotransplantation.

As AG1478 effect, and Mat, after the introduction separately, caused a significant reduction of tumor volume. However, in combination the decrease was much greater.

In addition, evaluated the binding Mat with EGFR of A431 cells in the absence and in the presence of AG1478 effect. Cells were placed in serum-free medium overnight and then treated with AG1478 effect for 10 min at 37°C, washed twice with PBS, then literally in 1% Triton, and lysates were prepared by centrif�of grovania for 10 min at 12000×g. Then the lysates were evaluated for reactivity with 806 using ELISA in a modified version of the analysis described Schooler and Wiley in Analytical Biochemistry 277, 135-142 (2000). The tablets were coated with 10 μg/ml met in PBS/EDTA overnight at room temperature, and then washed twice. Then the plates were blocked using 10% serum albumin/PBS for 2 hours at 37°C and washed twice. Added cell lysate at a dilution of 1:20 in 10% serum albumin/PBS for 1 hour at 37°C, then the plate was washed four times. Caused the reaction with the antibody against EGFR (SC-03; Santa Cruz Biotechnology Inc.) in 10% serum albumin/PBS for 90 min at room temperature, the plate was washed four times, and added anywhereman with HRP entirelife antibody (1:2000, if it's from Silenus) in 10% serum albumin/PBS for 90 min at room temperature, the plate was washed four times, and the color expression was carried out using ABTS as substrate. It was found that the binding Mat increases significantly in the presence of increasing amounts of AG1478 effect (Fig. 13).

Example 12

Immunoreactivity in human glioblastomas, EGFR status in which a pre-typed

Taking into account the high frequency of expression, amplification and mutation of EGFR in glioblastomas, was performed a detailed immunohistochemical study to determine� " s specificity 806 in tumors, than xenografts. Using immunohistochemical studies was reviewed by a panel of 16 of glioblastoma. In this panel from 16 glioblastomas was determined using RT-PCR the presence increased in number as a result of gene amplification of EGFR wild-type and expression of de2-7 EGFR. Six of these tumors expressively only a transcript for EGFR wild-type, 10 had amplification of EGFR wild-type, with 5 of them showed only transcripts for EGFR wild-type, the other 5 as a transcript for EGFR wild-type and gene transcript de2-7.

Immunohistochemical analysis was performed using a slice thickness of 5 mm fresh frozen tissue, placed on glass slides for histological examination and fixed for 10 minutes in cold acetone. Bound first antibody was detected using biotinylated anti-mouse antibody, followed by reaction with the formation of a complex of avidin-Biotin. Diaminobenzidine (DAB) was used as Chromogen. The degree of immunohistochemical reactivity in tissues was determined using light microscopy, and the location in degrees was carried out in accordance with the number of immunoreactive cells, it consistently increasing by 25%, as indicated below:

Focal = less than 5%

+ = 5-25%

+ = 25-50%

+++ = 50-75%

++++ = >75%

Antibody 528 demonstrated strong reactivity in all tumors, while immunoablative antibody DH8.3 limited to those tumors that Express de2-7 EGFR (table 2). In accordance with the preceding data analyses using FACS and analyses of rosette cells Mat did not react with glioblastomas expressing a transcript for EGFR wild-type not amplified EGFR genes (table 2). This pattern of reactivity in the case Mat similar to that observed in studies using xenografts, and again suggests that this antibody recognizes the de2-7 and amplificatory EGFR, but not EGFR wild-type, after the presentation on the cell surface.

++++
Table 2
Immunoreactivity of monoclonal antibodies 528, DH8.3 and 806 in glioblastomas, in which pre-determined the presence of EGFR wild-type and mutated de2-7 EGFR and their state amplification
AmplificationThe expression of de2-7 EGFR528DH8.3806
No--
No++++--*
No++++--
No++--
No+++--
No++++--
YesNo++++-++++

YesNo++++-+
YesNo++++- +++
YesNo++++-++++
YesNo++++-+- ++++
YesYes++++++++++++
YesYes++++++++++++
YesYes++++++++++++
YesYes++++++++++++
YesYes++++++++
*Focal staining.

Example 13

Immunoreactivity with EGFR in normal tissues

To determine whether expressed de2-7 EGFR in normal� tissue, was conducted immunohistochemical analysis using mA and DH8.3 using a panel of 25 tissues. In none of the tissues examined was not observed strong reactivity with either Mac nor with DH8.3, which suggests that the de2-7 EGFR is absent in normal tissues (table 3). When using Mat there was some non-permanent staining that is found in the tonsils, which was restricted to the basal cell layer of the epidermis and secreting mucus squamous cells of the epithelium. In the placenta were observed irregular immunoablative trophectoderm. Interestingly, two tissues that Express high endogenous levels of EGFR wild-type, liver and skin, did not demonstrate any significant reactivity with Mat. Reactivity was not observed with samples of the liver, and only a weak and unstable focal reactivity was observed from time to time (not more than 10% of all analyzed samples) in the basal keratinocytes in the skin samples and in squamous epithelium of the mucous membrane of the tonsils, which provides further evidence that this antibody is not associated with EGFR wild-type provided on the surface of cells to any significant extent (table 3). All tissues were positive for the EGFR wild type, as evidenced by the universal staining observed in �ispolzovanie antibody 528 (table 3).

Table 3
Reactivity 528, DH8.3 and 806 in normal tissues
Cloth528DH8.3806
The esophagusPositive--
StomachPositive--
DuodenumPositive--
The small intestine/duodenumPositive--
ColonPositive--
LiverPositive--
Salivary glands (parotid)P�positive --
KidneyPositive--
BladderPositive--
ProstatePositive--
EggPositive--
The uterus (cervix/endometrium)Positive-*-
End pipePositive--
OvaryPositive--
Mammary glandPositive-*-
PlacentaPositive�th --

Peripheral nervePositive--
Skeletal musclePositive--
ThyroidPositive--
Lymph nodePositive--
SpleenPositive--
The amygdalaPositive--Irregular weak reactivity with the basal layer of squamous epithelium
HeartPositive--
EasyPositive --
LeatherPositive--Irregular weak reactivity with the basal layer of squamous epithelium
*Some stromal staining in different tissues.

Example 14

Immunoreactivity with EGFR in a variety of tumors

The prevalence of de2-7 EGFR in other types of tumors were investigated using a panel of 12 different cancers. Antibody 528 often showed homogeneous staining in many of the analyzed tumors other than melanoma and seminoma. In the presence of immunoreactivity with DH8.3 it was limited to rare focal tumor cell, indicating that there is little, if any, expression of de2-7 EGFR in tumors outside of the brain when using this system of detection (table 4). When using antibodies DH8.3 was also observed focal staining of blood vessels and changing the diffuse staining of the connective tissue in certain tumors (table 4). This staining was strongly dependent on the used concentration of the antibody and was considered non-specific background reactivity. Mat demonstrated positive staining 64% �of puhala head and neck and 50% of lung carcinomas (table 4). There was little reactivity Mat in other tumors in addition to bladder tumors, which were positive in 30% of cases.

Because cancers of the head and neck and lung were negative in relation to antibody staining DH8.3, the reactivity observed with this Mat in these tumors may be related to EGFR gene amplification.

Example 15

Immunoreactivity in human glioblastomas with netheravon EGFR status

To confirm the unique specificity and determination of reactivity Mat it was compared with antibody 528 and DH8.3 using a panel of 46 glioblastoma netheravon advance the state of the EGFR. Antibody 528) showed a strong and homogeneous staining of all samples except two (27 and 29) (44/46, 95.7 per cent). These two cases were also negative for reactivity with Mat and DH8.3. Mat was positive in 27/46 (58.7 per cent) cases, 22 of which demonstrated a homogeneous immunoreactivity in more than 50% of tumors. Antibody DH8.3 was positive in 15/46 (32.6 per cent) of glioblastomas, 9 of which demonstrated a homogeneous immunoreactivity. The results of immunochemical staining of these tumors with netheravon EGFR status are summarized in table 5.

Between Mat and DH8.3 was with�the compliance in each case, except one (No. 35). Molecular analysis of EGFR gene amplification was performed in 44 cases (table 5). Of them typing 30 cases coincide with the previously established pattern of immunoreactivity with Mat: for example, 16 Mat-negative cases revealed no EGFR amplification, and 14 cases with EGFR amplification were also Mat-immunologically. However, 13 cases showed immunoreactivity with 806, were negative for EGFR gene amplification, while one case with EGFR gene amplification was Mat-negative. Additional analysis of the mutational status of these cases, negative for amplification and positive for reactivity with 806 described below and explains most of the 13 cases that were negative for EGFR gene amplification and is recognized by the antibody 806.

Was subsequently performed molecular analysis of deletion mutations using RT-PCR using 41/46 cases (table 5). Of them typing 34 cases coincide with the pattern of immunoreactivity with the antibody DH8.3, is specific in respect of deletion mutations: 12 cases were positive in RT-PCR and immunohistochemical analysis, and 22 cases were negative/negative. Three cases (#2, #34 and #40) were DH8.3-positive/negative for deletion mutations in RT-PCR, and three cases (#12, #18 and #39) �yli DH8.3-negative/positive in RT-PCR. As expected based on previous analyses of the specificity of the authors of the present invention, immunoreactivity with Mat was observed in all DH8.3-positive tissues, except for one case (#35).

In the case of #3 also identified a mutation (indicated by A2 in table 5), which included sequence mutations de2-7, but it seems that was not the classical deletion of de2-7 with loss of 801 bases (data not presented). This case was negative for reactivity with DH8.3, but showed reactivity with 806, which means 806 may recognize additional and possibly unique mutation of EGFR.

Positive type of reactivity of the antibody 806 correspond amplificadores or de2-7 mutant EGFR in 19/27 or more than 70% of cases. It is noteworthy that 2 of these 8 cases, also reacted with DH8.3.

Example 16

Systemic therapy and analysis of intracranial tumors - gliomas

To test the effectiveness of monoclonal antibodies against ΔEGFR, Mat, Nude thymus of mice with intracranial xenograft expressing ΔEGFR gliomas were treated with intraperitoneal injections Mat matching isotype IgG as a control or PBS.

Because the primary glioblastoma explants chelovechestva lost expression of receptors, resulting from amplification, rearrangement of their gene in culture, the existing lines of glioblastoma cells do not show such an expression. For enforcement to maintain levels of expression similar to those observed in human tumors, the cells U87MG, LN-Z308 and A1207 (a gift from Dr. S. Aaronson, Mount Sinai Medical Center, New York, NY) were infected with viruses encoding ΔEGFR, ΔEGFR with a lack of kinase activity (DK) or EGFR wild-type (wtEGFR), which also impart resistance to G418 as described previously (Nishikawa et al. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc. Natl. Acad. Sci. U. S. A., 91, 7727-7731).

Populations expressing similar levels of the various alleles of EGFR (these expression levels approximately correspond to the level of amplification of 25 copies of a gene; human glioblastoma typically have levels of amplification comprising from 10 to 50 copies of a gene truncated receptor) were selected by FACS as described previously (Nishikawa et al., 1994), and named U87MG.ΔEGFR, U87MG.DK, U87MG.wtEGFR, LN-Z308.ΔEGFR, LN-Z308.DK, LN-Z308.wtEGFR, A1207.ΔEGFR, A1207.DK and A1207.wtEGFR, respectively. Each of them maintained in medium containing G418 (in the case of cell lines U87MG - 400 µg/ml; in the case of cell lines LN-Z308 and A1207 - 800 µg/ml).

The U87MG cells.ΔEGFR (1×105) or 5×105cells LN-Z308.ΔEGFR, A1207.ΔEGFR, U87MG, U87MG.DK and U87MG.wtEGFR in 5 µl PBS were implanted into the right striatum of the brain Nude thymus of mice, campisano previously (Mishima et al. (2000) A peptide derived from the non-receptor binding region of urokinase plasminogen activator inhibits glioblastoma growth and angiogenesisin vivoin combination with cisplatin. Proc. Natl. Acad. Sci. U. S. A. 97, 8484-8489). Systemic therapy with Mat, or IgG2b as matching the isotype control was performed by intraperitoneal injection of 1 μg Mat in a volume of 100 μl every other day from days 0 to 14 after transplantation. For direct treatment of intracranial U87MG tumors.ΔEGFR 10 μg Mat, or IgG2b as matching the isotype control, in a volume of 5 µl were injected in the injection of tumor cells through the day, starting with day 1 for 5 days.

Animals subjected to treatment with PBS or matching isotype IgG as a control, had a median survival, which is 13 days, while the treated Mat mouse had a gap of 61.5 per cent increase in the median survival up to 21 days (P<0,001; Fig. 24A).

Treatment of mice 3 days after implantation, after establishment of the tumor, also increased the median survival of the treated Mat animals 46.1% (from 13 days to 19 days; P<0.01) in comparison with that of control group (data not presented).

To determine whether these antitumor effects Mat beyond U87MG xenografts.ΔEGFR, similar treatment was administered to animals with other xenograft glioma cells: LN-Z308.ΔEGFR and A1207.ΔGFR. The median survi�emoti treated Mat mice with xenograft LN-Z308.ΔEGFR was increased from 19 days in the case of controls to 58 days (P< 0,001; Fig. 24B). Strikingly, four of the eight treated Mat animals remained alive for more than 60 days (Fig. 24B). Median survival of animals with xenograft A1207.ΔEGFR was also increased from 24 days in the case of controls to 29 days (P<0.01; data not presented).

Treatment Mat inhibits the growth sverkhekspressiya ΔEGFR tumors of the brain

Mice with U87MG xenograft.ΔEGFR and LN-Z308.ΔEGFR was euthanized on day 9 and day 15, respectively. Sections of tumors were subjected to histopathological analysis and determined the volumes of the tumors. In accordance with the results obtained in relation to the survival of animals, treatment Mat significantly reduced the volume to approximately 90% in the case of U87MG xenografts.ΔEGFR. (P<0,001; Fig. 24C) and more than 95% in the case of xenografts LN-Z308.ΔEGFR (P<0,001; Fig. 24D) in comparison with those of control groups. Similar results were obtained in the case of animals with tumors A1207.ΔEGFR (a decrease of 65%, P<0.01; data not presented).

Treatment by injection Mat inside tumors increases survival of mice with brain tumors U87MG.ΔEGFR

Also was determined the efficiency of direct injection Mat inside tumors for the treatment of U87MG xenografts.ΔEGFR. Animals were injected tumors inside Mat or matching and�otipo IgG as a control, a day after implantation. Control animals remained alive for 15 days, while the treated Mat mice remained alive for 18 days (P<0.01; Fig. 24E). Although the treatment by injection Mat inside tumors was somewhat effective, it included the difficulties of multiple intracranial injection and increased risk of infection. Therefore, the authors of the present invention have focused on systemic therapies for further research.

Treatment Mat slightly increases the survival of mice with intracranial U87MG xenograft.wtEGFR, but not U87MG or U87MG.DK

To determine whether suppression of growth with math selective for tumors expressing ΔEGFR, treatment of exposed animals with the xenograft brain tumors: U87MG, U87MG.DK (ΔEGFR with a lack of kinase activity) and U87MG.wtEGFR. Treatment Mat did not increase the survival of mice that were implanted with U87MG tumors (Fig. 25A), which expressively at a low level of endogenous EGFR wild-type (wtEGFR) (Huang et al. (1997) The enhanced tumorigenic activity of a mutant epidermal growth factor receptor common in human cancers is also been other ideas where by threshold levels of constitutive tyrosine phosphorylation and unattenuated signaling. J. Biol. Chem., 272, 2927-2935) or animals with U87MG xenograft.DK which were sverkhekspressiya ΔEGFR with a lack of kinase activity in addition to low levels of endogenous EGFR wild type(Fig. 25B). Treatment Mat slightly increased the survival of mice with U87MG tumors.wtEGFR (P<0, 05, median survival of 23 days compared to 26 days for the control groups), which were sverkhekspressiya EGFR wild type (Fig. 25C).

Reactivity Mat correlated within vivoantitumor efficacy

To understand the differential effect Mat on tumors expressing different levels or different types of EGFR, the authors present invention has determined the reactivity Mat with various tumor cells through analysis using FACS. Stained cells were analyzed using FACS Calibur, using the software Cell Quest (Becton-Dickinson PharMingen). As the first antibodies used were the following Mat: Mat, clone 528 MAB against EGFR and clone EGFR.1. As a matching isotype controls were used mouse IgG2a or IgG2b.

In accordance with the preceding message (Nishikawa et al. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc. Natl. Acad. Sci. U. S. A., 91, 7727-7731), Mat against EGFR recognized as ΔEGFR and EGFR wild-type and showed more intense staining of U87MG cells.ΔEGFR than U87MG cells (Fig.26A, 528).

In contrast, the antibody clone EGFR.1 reacted with EGFR wild-type, but not with ΔEGFR (Nishikawara et al., 1994), because U87MG cells.ΔEGFR reaction was as weak as with U87MG cells (Fig.2A, panel EGFR.1).

This antibody clone EGFR.1 reacted with U87MG.wtEGFR more strongly than with U87MG cells, as U87MG cells.wtEGFR was sverkhekspressiya EGFR wild type (Fig. 26A, panel EGFR.1). Although Mat reacted strongly with U87MG cells.ΔEGFR and U87MG.DK, but not with U87MG cells, it reacted weakly with U87MG.wtEGFR, which means Mat is selective for ΔEGFR, there is a weak cross-reaction with sverkhekspressiya EGFR wild type (Fig. 26A, panel Mat).

This level of reactivity with U87MG.wtEGFR correspond in quantity and quality to increase survival, mediated by antibody treatment (Fig. 25C).

In the future, the authors of the present invention determined the specificity Mat using the immunoprecipitation. EGFR in different cell lines were subjected to immunoprecipitation using antibodies Mat, clone 528 MAB against EGFR (Oncogene Research Products, Boston, MA) or clone EGFR.1 (Oncogene Research Products).

Briefly, cells were literally using lysis buffer containing 50 mm HEPES (pH 7,5), 150 mm NaCl, 10% glycerol, 1% Triton X-100, 2 mm EDTA, 0,1% SDS, 0,5% sodium deoxycholate, 10 mm sodium PPi, 1 mm phenylmethylsulfonyl, 2 mm Na3VO4, 5 µg/ml leupeptin and 5 µg/ml of Aprotinin. Antibodies were incubated with cell lysates at 4°C for 1 h before adding sepharose with protein A and G. Immunoprecipitates were washed twice with lysis buffer for � once HNTG buffer [50 mm HEPES (pH 7,5), 150 mm NaCl, 0,1% Triton X-100 and 10% glycerol], was subjected to electrophoresis and transferred onto nitrocellulose membranes.

The blots with electrophoretic separated proteins were probed using antibodies against EGFR, C13 (courtesy of Dr. G. N. Gill, University of California, San Diego, CA) was used to detect EGFR wild-type and ΔEGFR on immunoblots (Huang et al., 1997), and proteins were visualized using a chemiluminescent detection system ECL (Amersham Pharmacia Biotech.). Antibodies against Bcl-X (rabbit polyclonal antibody; Transduction Laboratories, Lexington, KY) and phosphotyrosine (4G10, Upstate Biotechnology, Lake Placid, NY) was used for analysis using Western blotting, as described previously (Nagane et al. (1998) Drug resistance of human glioblastoma cells conferred by a tumor-specific mutant epidermal growth factor receptor through modulation of Bcl-XL and caspase-3-like proteases. Proc. Natl. Acad. Sci. U. S. A. 95, 5724-5729).

In accordance with the analysis using FACS antibody 528 recognize EGFR wild-type and mutant receptors (Fig. 26B, panel IP: 528), whereas EGFR antibody.1 reacted with EGFR wild-type but not mutant varieties (Fig. 26B, panel IP:EGFR.1). In addition, the levels of mutant receptors in U87MG cells.ΔEGFR and U87MG.DK is comparable to the levels of EGFR in wild-type U87MG cells.wtEGFR (Fig. 26B, panel IP: 528).

However, the antibody Mat was capable of precipitating only a small number of EGFR wild-type lysates from U87MG cells.EGFR wild-type compared with large�m number exposing the precipitation of the mutant receptor from U87MG cells.ΔEGFR and U87MG.DK and no detectable amount of U87MG cells (Fig. 26B, panel IP: Mat). Collectively, these data suggest that Mat recognizes an epitope in ΔEGFR, which also exists in a small portion of the EGFR wild-type only in the case of sorprendentemente on the cell surface (see below for further discussion and references epitope for Mac).

Treatment Mat reduces autophosphorylation ΔEGFR and inhibits expression of the Bcl-XLin brain tumors U87MG.ΔEGFR

Then, we investigated the mechanisms underlying the suppression of growth by antibody Mat. Since the activity of constitutive active kinase and autophosphorylation carboxyl end of ΔEGFR important for its biological functions (Nishikawa et al. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc. Natl. Acad. Sci. U. S. A. 91, 7727-7731; Huang et al., 1997; Nagane et al. (1996) A common mutant epidermal growth factor receptor confers enhanced tumorigenicity on human glioblastoma cells by increasing proliferation and reducing apoptosis. Cancer Res., 56, 5079-5086; Nagane et al. (2001) by aberrant receptor signaling in human malignant gliomas: mechanisms and therapeutic implications. Cancer Lett. 162 (Suppl.l), S17-S21), it was determined the phosphorylation state of ΔEGFR in the tumors of the treated and control animals. As shown in Fig. 27A, treatment Mat significantly reduces autophosphorylation ΔEGFR, although the receptor levels were only slightly reduced in the treated Mat the xenograft. The authors of the present invention previously found that autophosphorylation increase the expression antiapoptosis gene Bcl-XLthat plays a key role in reducing apoptosis sverkhekspressiya ΔEGFR tumor cells (Nagane et al., 1996; Nagane et al., 2001). So then it was determined the effect of treatment Mat on the expression of Bcl-XL. In ΔEGFR tumors from the treated Mat animals, in fact, is not revealed decreased levels of Bcl-XL(Fig. 27A).

Treatment Mat decreases growth and angiogenesis and increases apoptosis in U87MG tumors.ΔEGFR

Due toin vivothe inhibition caused by treatment Mat, and its biochemical effects on signal transmission receptor, the authors present invention has determined the proliferation rate of tumor cells in control and treated mice. The proliferation index, determined by staining for Ki-67 antigen treated Mat tumors was significantly lower than the index for the control tumors (P<0,001; Fig. 28).

Briefly, for the assessment of angiogenesis in tumors were fixed in a solution containing zinc chloride, poured paraffin, made the cut and was subjected to immunoablative, using a monoclonal rat antibody against mouse CD31 (Becton-Dickinson PharMingen; 1:200). Assessment of proliferation of tumor cells was performed using immunohistochemical analysis of Ki-67 on the formalin-fixed filled with paraffin tumor tissues. After dewaxing and rehydration, the sections t�Anya were incubated with 3% hydrogen peroxide in methanol to suppress endogenous peroxidase. Sections were blocked for 30 min with goat serum and incubated overnight with the first antibody at 4°C. Then the sections were washed with PBS and incubated with biotinylated second antibody for 30 min. After several washes with PBS products were visualized using conjugated with a streptavidin horseradish peroxidase, using diaminobenzidine as Chromogen and hematoxylin as the substance for contrast staining. As an indicator of cell proliferation was determined a labeling index for Ki-67 as the ratio of labeled nuclei to all nuclei in visual fields under high magnification (3400).

Counted about 2000 cores in each case when systematic random sampling. In the case of staining of macrophages and NK cells frozen sections, fixed with buffered 4% paraformaldehyde solution, was subjected to immunoablative using biotinylated F4/80 (Serotec, Raleigh, NC) and rabbit polyclonal antibody against asialo-GM1 (Dako Chemicals, Richmond, VA), respectively. Using performed using the calculated machine analysis, carried out quantitative analysis of angiogenesis in the area of vascularization. To this end, the sections were subjected to immunoablative using an antibody against CD31, and analyzed using the system to performed by using the calculated mA�ins image analysis, without contrast staining. MVA (area of microvascularization) was determined by fixing the converted into digital form of slice images at magnification 3200, using the device for color imaging CCD as described previously (Mishima et al., 2000). Then the images were analyzed using the software Image Pro Plus version 4.0 (Media Cybernetics, Silver Spring, MD), and MVA was determined by identification of common staining in each slice. In the case of each drug was evaluated by four fields. This value is then represented as a percentage of the total area in each field. In each experiment the results were confirmed by at least two observers (K. M., H-J. S. H.).

In addition, tumor tissue revealed apoptotic cells through the use of a method using TUNEL (terminal deoxyuridine tagging ends) as described previously (Mishima et al., 2000). TUNEL-positive cells were positively at magnification of 400. The apoptosis index was calculated as the ratio of apoptotic cells to the total number of cells in each field. Analysis of the index of apoptosis through TUNEL-labeling showed a significant increase in the number of apoptotic cells in the treated Mat tumors compared to control tumors (P<0,001; Fig. 28).

The degree of vascularization of the tumors were also analyzed using immunoablative tumors subjected from Le�structure and control subjects on CD31. For the quantitative analysis of vascularization of the tumors was determined by the square of microvascularization (MVA) using performed using the calculated machine image analysis. The treated Mat tumors showed a lower 30% MVA than the control tumors (P<0,001; Fig. 28).

To understand whether the interaction between the receptor and the antibody to induce an inflammatory response, sections of tumors were stained for a marker of macrophages, F4/80, a marker of NK-cells, asialo-GM1. Macrophages were identified around the tumor matrix and were particularly accumulated at the periphery of the treated Mat U87MG tumors.ΔEGFR (Fig. 28). The authors of the present invention was observed by a small number of NK cells infiltrated in the tumor, and around them and did not observe significant differences between the treated Mat and matching isotype control tumors (data not presented).

Example 17

Combined immunotherapy using Mat and Mat

The experiments outlined here are of the formin vivostudies designed to determine the effectiveness of the antibodies in accordance with this invention.

Females Nude thymus of mice aged 4-6 weeks were used as experimental animals. Mice were subcutaneously inoculable 3×106tumor cells in each and� sides.

Animals were inoculable cells or U87MG.D2-7, U87MG.DK or A431, all of which are described above. Treatment was started when tumors had grown to a sufficient size.

Then, the mice injected with one of the following: (i) phosphate-buffered saline, (ii) Mat (0.5 mg/injection), (iii) Mat (0.5 mg/injection) or (iv) a combination of both mate. As for the "(iv)", different groups of mice received either 0.5 mg/injection of each Mat, or 0.25 mg/injection of each Mat.

The first study group mice were mice, which were injected U87MG cells.D2-7. The treatment Protocol was started after 9 days after inoculation and lasted 3 times a week for 2 weeks (i.e. injection animals was performed on days 9, 11, 13, 16, 18 and 20 after inoculable cells). At the beginning of the treatment Protocol, the average diameter of tumors was 115 mm3. Each group contained 50 mice, each with two tumors.

In the group of mice treated with a combination of antibodies (0.5 mg/injection), there were three full regression. The regression was not in any of the other groups. Fig. 18A graphically presents the results.

In the case of the second group of mice injected materials were the same, except that combination therapy contained 0.25 mg of each antibody per injection. Injections were performed on days 10, 12, 14, 17, 19 and 21 after inoculation of cells. At the beginning of therapy crenidium tumors was 114 mm 3. The results are presented in Fig. 18B.

The third group of mice was inoculable U87MG cells.DK. Injection of therapeutic agents began 18 days after inoculation of the cells and continued on days 20, 22, 25, 27 and 29. The average size of tumors at the beginning of treatment was 107 mm3. The results are summarized in Fig. 18C. Injection of therapeutic agents were the same as in the case of the first group.

Finally, the injection of the fourth group of mice, which were inoculable A431 cells, was performed as in the case of groups I and III, on days 8, 10, 12 and 14 after inoculation. First, the average size of tumors was 71 mm3. The results are presented in Fig. 18D.

The results indicate that combination therapy using antibodies demonstrated a synergistic effect in reducing tumors. Cm. Fig. 18A. A similar effect was observed at a lower dose, according to Fig. 18B, which means that the effect is not only due to the levels of doses.

Combination therapy inhibited the growth of U87MG.DK (Fig. 18C), which means that the immune function of the antibodies was not the reason for the decrease observed in Fig. 18A and 18B.

It is noted that, as shown in Fig. 18D, combination therapy also showed a synergistic effect on A431 tumor, with 4 doses led to a degree of 60% from the full answer. These data suggest that mo�Akula EGFR, recognized Mat, is functionally different from molecules, incubated 528.

Example 18

Suppression using Mat growth of tumor xenografts

As discussed herein and further demonstrated and discussed in this example, it was unexpectedly discovered that Mat inhibits the growth of xenograft tumors expressing either the de2-7 or amplificatory EGFR, but not EGFR wild-type.

Cell lines and antibodies were prepared as described in example 1. To determine the specificity Mat analyzed its binding to cells U87MG, U87MG.Δ2-7 and U87MG.wtEGFR by FACS. In short, subjected to the cultivation of the parental lines and transfected U87MG cells were analyzed for expression of EGFR wild-type and de2-7EGFR using antibodies 528, 806 and the DH8.3. Cells (1×106) were incubated with 5 μg/ml of the respective antibody or matching isotype antibody as a negative control in PBS containing 1% HSA for 30 min at 4°C. After three washes with PBS/1% HSA, cells were incubated for another 30 min at 4°C with an associated with FTTC goat artemisinin antibody (at a dilution of 1:100; Calbiochem, San Diego, CA). After three subsequent washes, cells were analyzed in an Epics Elite ESP (Beckman Coulter, Hialeah, FL) by fixing at least 20,000 events and analyzed using EXPO (version 2) for Windows. Irrelevant IgG2b (MAB 100-310, napravlennosti antigen A33 person) was included as a matching isotype control for Mac, and was included antibody 528, as it recognizes and de2-7 EGFR wild-type.

Only antibody 528 was able to paint the parental cell line U87MG (Fig. 29), which is consistent with previous reports indicating that these cells Express EGFR wild-type (Nishikawa et al. (1994) A mutant epidermal growth factor receptor common in human glioma confers enhanced tumorigenicity. Proc. Natl. Acad. Sci. U. S. A. 91, 7727-7731). Mat showed levels of binding are similar to those of the control antibody, which clearly demonstrates that it is unable to bind the receptor EGFR wild type (Fig. 29). Linking matching isotype control antibodies with U87MG cells.Δ2-7 and U87MG.wtEGFR was the same as the binding observed in the case of U87MG cells. Mat stained U87MG cells.Δ2-7 and U87MG.wtEGFR, which indicates that Mat specifically recognizes the de2-7 EGFR and a subset expressed EGFR (Fig. 29). As expected, the antibody 528 stained lines such as U87MG cells.Δ2-7 and U87MG cells.wtEGFR (Fig. 29). The intensity of staining of the antibody 528 U87MG cells.wtEGFR was a lot more intensity staining Mat, which suggests that Mac recognizes only a portion of the expressed EGFR. Reactivity Mat observed with U87MG cells.wtEGFR, is similar to that obtained with A431 cells, another cell line, which sverkhekspressiya EGFR.3 wild-type.

Analysis of Scatchard was made�Yong, using U87MG cells.Δ2-7 and A431, to determine the relative affinity and binding sites met in each cell line. Mat possessed affinity to the receptor de2-7 EGFR, amounting to 1.1×109M-1and was recognized on average (three separate experiments) of 2.4×105binding sites in each cell, as noted in example 4. In contrast, the affinity Mat to EGFR wild type A431 cells was only 9.5×107M-1as noted in example 8. Interestingly, Mat recognize of 2.3×105binding sites on the surface of A431, which is approximately 10 times less represented in the message the number of EGFR that is installed in these cells. To confirm the number of EGFR on the cell surface of A431 used by the authors of the present invention, they performed an analysis of Scatchard using125I-labeled antibody 528. As expected, this antibody was associated with approximately 2×106sites on the surface of A431 cells. Thus, Mat seems to be associated only with a part of EGFR receptors on the surface of A431 cells. It is important that125I-labeled Mat was not associated with parental U87MG cells, even when the number of cells was increased to 1×107.

In further reactivity Mat in various cell lines was determined using the immunoprecipitation after35S-tagging, using math, sc-03 (�meyxana on sale polyclonal antibody specific in relation to the COOH-terminal domain of EGFR) and IgG2b as a matching isotype control. Briefly, the cells were subjected to labeling for 16 h with 100 MCI/ml TRANS35S-label (ICN Biomedicals, Irvine, CA) in DMEM without methionine/cysteine, supplemented with 5% subjected to dialysis FCS. After washing with PBS, the cells were placed in lysing buffer (1% Triton X-100, 30 mm HEPES, 150 mm NaCl, 500 μm 4-(2-aminoethyl)benzolsulfonat (AEBSF), 150 nm Aprotinin, 1 µm protease inhibitor E-64, 0.5 mm EDTA and 1 µm leupeptin, pH 7.4) for 1 h at 4°C. Lysates were clarified by centrifugation for 10 min at 12000×g, and then incubated with 5 μg of the respective antibody for 30 min at 4°C before adding sepharose with protein A. Immunoprecipitates were washed three times with lysing buffer, was mixed with sample buffer with SDS, separated by gel electrophoresis using 4-20% page in Tris/glycine, which is then subjected to drying, and was carried out by exposing x-ray film radiation from it.

Antibody sc-03 was immunoprecipitated giving three bands of molecules from U87MG cells.Δ2-7: doublet, corresponding to 2 lanes de2-7 EGFR is observed in these cells, and a strip of molecules of higher molecular weight, corresponding to EGFR wild type (Fig. 22 and 30). In contrast, although Mat was immunoprecipitated giving two bands of molecules de2-7 EGFR, EGFR wild type was completely absent. Paintings, �abrudaime in U87MG cells.wtEGFR and A431, were essentially identical. Antibody sc-03 was immunoprecipitated giving one lane of the molecule corresponding to the EGFR wild-type A431 cells (Fig. 22 and 30). Mat also immunoprecipitated giving one lane of the molecule corresponding to the EGFR wild-type and U87MG cells.wtEGFR and A431 cells (Fig. 22 and 30). According to data analysis using FACS and analysis of Scatchard the number of EGFR immunoprecipitation Mat, was significantly less than the total amount of EGFR present on the cell surface. Taking into account that Mat and sc-03 was immunoprecipitated similar number of de2-7 EGFR, this result supports the idea that the antibody Mat recognizes only a portion of the EGFR in cells, sverkhekspressiya receptor. Comparison between Mat and antibody 528 found an identical pattern of reactivity (data not presented). Irrelevant IgG2b (matching the isotype control for Mac) did not immunoprecipitate EGFR from any cell line (Fig. 22 and 30). When using identical conditions met not immunoprecipitated EGFR from the parental U87MG cells (data not presented).

Mat was also tested for efficacy against tumors of U87MG and U87MG.Δ2-7 in the preventive model using xenografts. Antibody or vehicle was administered intraperitoneally one day before the inoculation of tumor cells, and resulted in the introduction of�and 3 times a week for 2 weeks. At a dose of 1 mg/injection, Mat had no effect on the growth of xenografts of parental U87MG cells, which Express EGFR wild type (Fig. 9A). On the contrary, Mat significantly inhibited the growth of U87MG xenografts.Δ2-7 dose-dependent manner (Fig. 9B). Twenty days after inoculation of tumor cells, when control animals were killed, the average volume of tumors was 1600±180 mm3in the case of the control group, significantly less 500±95 mm3in the case of the group, which were administered 0.1 mg at each injection (p<0,0001), and 200±42 mm3in the case group, which was administered 1 mg at each injection, (p<0,0001). The treated groups were sacrificed on day 24, when the average volume of tumors was 1300±240 mm3in the case of the group treated with 0.1 mg and 500±100 mm3in the case of the group treated with 1 mg (p < 0,0005).

Taking into account the efficiency met in preventive model using xenografts, we tested its ability to suppress the growth-seated tumor xenografts. The antibody treatment was as described for the preventative model, except that it started when the average volume of tumors reached 65 mm3(10 days after implantation) in the case of U87MG xenografts.Δ2-7 and 84 mm3(after 19 days after implant�tion) in the case of xenografts of parental U87MG cells (see example 10). And again Mat had no effect on the growth of xenografts of parental U87MG cells even at a dose of 1 mg/injection (Fig. 10A). On the contrary, Mat significantly inhibited the growth of U87MG xenografts.Δ2-7 dose-dependent manner (Fig. 10B). On day 17, the day before the killing control animals, the average volume of tumors was 900±200 mm3in the case of the control group, 400±60 mm3in the case of the group, which were administered 0.1 mg at each injection (p<0.01), and 220±60 mm3in the case group, which was administered 1 mg at each injection (p<0.002 inch). Treatment of U87MG xenografts.Δ2-7 match the isotype control IgG2b antibody had no effect on tumor growth (data not presented).

For the study, are limited the growth suppression observed at Mat, cells expressing de2-7 EGFR, its efficacy against xenografts of U87MG cells.wtEGFR was tested in the model-seated tumors. These cells serve as a model for tumors with EGFR gene amplification without the expression of de2-7 EGFR. Treatment Mat started when the average volume of tumors reached 73 mm3(22 days after implantation). Mat significantly inhibited the growth of rooted U87MG xenografts.wtEGFR compared to control tumors treated with vehicle (Fig. 10C). On the day of the killing Kont�measuring animals the average volume of tumors was 1000±300 mm 3in the case of the control group and 500±80 mm3in the case of a group, subjected to treatment by injection, 1 mg (p<0,04).

To determine the possible histological differences between the treated Mat and control U87MG xenograft.Δ2-7 and U87MG.wtEGFR fixed with formalin filled with paraffin sections were stained with H&E (Fig. 31). The area of necrosis was observed in slices treated Mat U87MG xenografts.Δ2-7 (treated Mat xenograft was extracted after 24 days after inoculation of tumor cells, and the treated carrier xenograft - 18 days later) and U87MG xenografts.wtEGFR (treated Mat xenograft removed after 42 days after inoculation of tumor cells, and the treated carrier xenograft - after 37 days, Fig. 31). This result was observed repeatedly in several tumor xenografts (n=4 for each cell line). However, in the analysis sections of U87MG xenograft.Δ2-7 and U87MG.wtEGFR subjected to treatment with control (n=5), not found the same areas of necrosis were observed in the treatment Mat (Fig. 31). The treated carrier and Mat xenograft derived in the same time, also showed these differences in necrosis within the tumors (data not presented). So�m, the observed increase of necrosis was not caused by the longer periods of growth, used to exposed to treatment Mat xenografts. In addition, sections of U87MG xenografts, treated Mat, also stained with H&E, and have not identified any areas of necrosis (data not presented), which serves as an additional confirmation of the hypothesis that the binding Mat induces decreased cell viability, leading to increased necrosis in the tumor xenograft.

Immunohistochemical analysis sections of the xenograft U87MG, U87MG.Δ2-7 and U87MG.wtEGFR was conducted to determine the expression levels of de2-7 EGFR wild type after treatment Mat (Fig. 32). As expected, the antibody 528 were all stained sections of xenografts without apparent reduction in the intensity between the treated and control tumors (Fig. 32). When using Mat staining of sections of U87MG was not detectable, however, registered a positive staining of sections of U87MG xenograft.Δ2-7 and U87MG.wtEGFR (Fig. 32). There was no difference in the intensity of staining Mat between control and subjected to treatment of the U87MG xenograft.Δ2-7 and U87MG.wtEGFR, which suggests that the antibody treatment does not lead to clonal selection of variants with the lack of reactivity with Mat.

To demonstrate that PR�teleophobia effects Mat not limited to U87MG cells, antibody injected mice with A431 xenograft. These cells have amplificatory EGFR gene and Express approximately 2×106receptors on the cell. As shown above, met is associated with ~10% of these EGFR and acts on the A431 xenograft (Garcia et al. (1993) Expression of mutated epidermal growth factor receptor by non-small cell along carcinomas. Cancer Res. 53, 3217-3220). Mat significantly inhibited the growth of A431 xenografts when checking in the previously described preventive model using xenotransplanted (Fig. 11A). On day 13, when control animals were killed, the average volume of tumors was 1400±150 mm3in the case of the treated carrier group and 260±60 mm3the case of the group treated by injection of 1 mg at each injection (p<0,0001). In a separate experiment component of the 0.1 mg dose Mat also significantly (p<0.05) and inhibited the growth of A431 xenografts in a preventive model (data not presented) (see example 10).

Taking into account the efficiency met in preventive model using A431 xenografts was tested its ability to suppress the growth-seated tumor xenografts. The antibody treatment was as described for the preventative model, except that it didn't start until, while the average volume of tumors reached 200±20 mm3. Mat EIT�rapidly inhibited the growth of rooted tumor xenografts (Fig. 11B). On day 13, when control animals were killed, the average volume of tumors was 1100±100 mm3in the case of the control group and 450±70 mm3in the case group, which was administered 1 mg at each injection (p<0,0001).

Example 19

Construction, expression and analysis of chimeric antibody 806

Chimeric antibodies are a class of molecules in which the variable regions of the heavy and light chains, such as mice, rats or other kind attached to the regions of heavy and light chains of a human. The chimeric antibody produced by recombinant means. One advantage of chimeric antibodies is that they can reduce the effects against xenoantigens inherent immunogenicity of non-human antibodies (e.g., mouse, rat or other species). In addition, recombinante obtained chimeric antibody is often possible to produce in large quantities, particularly if you use vectors for expression at a high level.

For production at a high level the most widely used system for expression in mammalian cells is the system that uses the process of gene amplification provided by the cells of the Chinese hamster ovary with lack dehydropeptidase ("dhfr-"). This system is well known to a qualified specialist. The system is based on the gene deg�totalattempts "dhfr", which encodes the DHFR enzyme, catalytic conversion dihydrofolate to tetrahydrofolate. To achieve high production cells dhfr-CHO transferout expression vector containing a functional DHFR gene together with the gene that encodes the desired protein. In this case, the desired protein is a heavy chain and/or light chain recombinant antibodies.

By increasing the amount of competitive inhibitor of DHFR - methotrexate (MTX) in recombinant cells develop resistance as a result of gene amplification of dhfr. In the standard cases used amplification unit is much larger than the dhfr gene, and as a result coamplified heavy chain of the antibody.

When the desired vysokomytska protein products, such as chain antibodies, are decisive as to the level of expression and stability of the used cells. When cultured for a long term populations of recombinant CHO cells lose homogeneity against its industry-specific antibodies during amplification, even if they come from a single parent clone.

Bicistronic gene-expression vectors were prepared for use in recombinant expression of chimeric antibodies. In these bicistronic expression vectors used "section of the internal landing ribosomes" Il� "IRES". In the case of these structures for the production of chimeric antibody against EGFR cDNA for the immunoglobulin chains and selectable markers connect via IRES. IRES are active in CIS-position elements that attract small ribosomal subunit to internal initiator codon in the mRNA with the help of cell operating in the TRANS-position factors. IRES contribute to the expression of two or more proteins with polycistronic transcription units in eukaryotic cells. Bicistronic gene expression vectors in which the selectable marker is linked to a cap-dependent manner, and the gene of interest - IRES-dependent manner, was used in a number of experimental methods. IRES elements have been successfully incorporated into vectors for transformation of cells, creating transgenic animals, production of recombinant proteins, gene therapy, genes and stop effects on genes.

Summary construction of the chimeric antibody 806

Chimeric antibody 806 was created by cloning the VH - and VL-regions of the antibody 806 source of murine hybridomas using standard techniques of molecular biology. VH - and VL-regions are then cloned into vectors for expression in mammalian cells pREN, the design of which is presented in SEQ ID NO: 7 and SEQ ID NO: 8, and transfusional in CHO cells (DHFR-/-ve) for the amplification and Express�I. Briefly, after trypsinization 4×106the CHO cells were cotranslationally 10 μg of each of the vectors for expression of LC and HC, using electroporation under standard conditions. After a 10-minute rest period at room temperature, the cells were added to 15 ml of medium (10% fetal calf serum, hypoxanthine/thymidine Supplement additional components) and transferred to a 15×10 cm culture dishes Petri. Then the cups were placed in a thermostat under normal conditions for 2 days.

At this point, the addition of gentamicin, 5 nm methotrexate, the replacement of fetal calf serum subjected to dialysis fetal calf serum and removal of hypoxanthine/thymidine initiated the selection of clones that were transfected by both LC and HC, from the environment. 17 days after transfection, individual clones growing under selective conditions, were selected and skanirovali on the expression of the chimeric antibody 806. For screening used ELISA, and it consisted of coating the tablet for ELISA denatured soluble EGF receptor (denatured EGFR, as you know, makes possible the linking 806). This analysis allows skanirovat production levels of individual clones, as well as on the functionality skrinichenko antibodies. It was found that all the clones produce functional ch806, and the best producer was selected and subjected ek�panchi as a result of amplification. To increase levels produced ch806 clone with the best products were subjected to repeated breeding at higher concentrations of methotrexate (100 nm compared to 5 nm). This is performed using the above mentioned procedure.

Clones growing at 100 nm, passed in the Biological Production Facility, Ludwig Institute, Melbourne, Australia to determine levels of production, getting rid of the whey, bankera cells. It is established that the cell line is stably produces ~10 mg/liter in rotating vials.

The nucleic acid sequence of the vector pREN ch806 LC neo provided in SEQ ID NO: 7. The nucleic acid sequence of the vector pREN ch806 HC DHFR provided in SEQ ID NO: 8.

Fig. 33 depicts vectors pREN-HC and pREN-LC, using IRES. System with bicistronic vectors pREN described and disclosed in located on the simultaneous consideration of the patent office the patent application U.S. No. 60/355838, filed February 13, 2002, which is incorporated here by reference in full.

Assessment of ch806 was performed using analysis using FACS to demonstrate that chimeric 806 shows the binding specificity identical to that of the original murine antibody. The analysis was performed using the wild-type cells (parental U87MG cells), cells sverkhekspressiya receptor EGFR (A431 cells and U87MG cells.wtEGFR) and cells UA87.Δ2 - cells (data not presented). Similar binding specificity Mat and ch806 was set using cells, sverkhekspressiya EGFR, and cells expressing de2-7 EGFR. In the case of wild-type cells the binding was not observed. Through the analysis of Scatchard set the affinity of binding of the labeled with a radioactive isotope ch806, amounting to 6.4×109M-1using cells U87MG-de2-7 (data not presented).

Analysis of bearsdley antibody ch806 was held at the Nude thymus mice BALB/c with the xenograft tumor cells U87MG-de2-7, and the results are presented in Fig. 34. Mice injected with 5 µg labeled with radiolabeled antibodies, and they were killed in groups of four mice at each time point is after 8, 24, 48 and 74 hours. The organs removed, weighed and radioactivity measured in a gamma counter.125I-labelled ch806 demonstrates a reduced focus on the tumor compared with111In-labelled ch806, which is characterized by high adsorption and cumulative tumor retention in the tumor during the 74-hour period of time. At time 74 hours in the case of111In-labeled antibody is detected in approximately 30% ID/gram tissue and a gap of 4.0 against a tumor:blood (Fig. 35).111In-labeled antibody ch806 shows some nonspecific retention in the liver, spleen and kidneys. I�is usual in the case of the use of this isotope and decreases with time, affirming that this binding is nonspecific for ch806 and due to binding111In.

Chimeric antibody ch806 was evaluated for therapeutic efficacy in a model-seated tumors. 3×106of U87MG cells.Δ2-7 in 100 µl PBS were inoculable subcutaneously in both flanks of female Nude thymus of mice aged 4-6 weeks (Animal Research Center, Western Australia, Australia). As a positive control included Mat. The results are presented in Fig. 36. Treatment was started when the average volume of tumors reached 50 mm3and consisted of only 5 intraperitoneal injections of 1 mg ch806 or Mat every injection performed on the specified days. Tumor volume in mm3was determined, using the formula (length × width2)/2, where length was a longest axis and width the measurement at right angles relative to the length. Data were presented as the average volume of tumors ± standard error for each subject in the treatment group. ch806 mAb806 and demonstrated almost identical antitumor activity against U87MG xenografts.Δ2-7.

Analysis immunoelectron functions Ch806

Materials and methods:

Antibody and cell line

Mouse monoclonal antibody against de2-7 EGFR-Mut, chimeric antibody ch806 (IgG1) and control matching isotype chimeric monoclonal antialopecia G250-cG250 were prepared for the Biological Production Facility, Ludwig Institute for Cancer Research, Melbourne, Australia. As in the analysis of complement-dependent cytotoxicity (CDC) and antibody-dependent analysis cretaceouspaleogene cytotoxicity (ADCC) used U87MG cells.de2-7 and A431 as target cells. The previously described cell line U87MG.de2-7 is a cell line of human astrocytomas, infected with retrovirus containing the de2-7EGFR (Nishikawa et al. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 7727-7731). Cells epidermoid A431 human cancer were purchased from the American type culture collection (Manassas, VA). All cell lines were cultured in DMEM/F-12 with GlutaMAX (Life Technologies, Inc., Melbourne, Australia), supplemented with 10% inactivated by heating FCS (CSL, Melbourne, Australia); 100 units/ml penicillin and 100 µg/ml streptomycin. To maintain the selection in transfected retrovirus U87MG cells.de2-7 in environment consisted of 400 μg/ml G418.

Preparation of mononuclear cells from peripheral blood (PBMC) human - cells-effectors

PBMC were isolated from blood of healthy volunteer donors. Heparinized whole blood was subjected to fractionation by centrifugation in a density gradient ficoll-vipaka (ICN Biomedical Inc., Ohio, USA). The PBMC fraction was collected and washed three times RPMI+1640, supplemented with 100 u/ml penicillin and 100 µg/ml streptomycin, 2 mm L-glutamine containing 5% inactivated by heating FCS

Preparation of target cells

Analyses of CDC and ADCC was performed by modifying a previously published method (Nelson, D. L. et al. (1991) In: J. E. Colignan, A. M. Kruisbeek, D. D. Margulies, E. M. Shevach, and W. Strober (eds.), Current Protocols in Immunology, pp. 7.27.1 New York: Greene Publishing Wiley Interscience). Briefly, 5×106target cells U87MG.de2-7 and A431 were labeled with 50 μci51Cr (Geneworks, Adelaide, Australia) at 1×106cells and incubated for 2 h at 37°C. Then cells were washed three times with PBS (0.05 M, pH 7,4), and the fourth time the medium for cultivation. Aliquots (1×104cells/50 μl) of labeled cells were added to each well of 96-well titration microplates (NUNC, Roskilde, Denmark).

The CDC analysis

To 50 μl of labeled target cells were added to three replicates of 50 µl ch806 or matching isotype control antibody cG250 in all range of concentrations - 0,00315-10 μg/ml and incubated on ice for 5 min. was Then added 50 μl of freshly prepared complement a healthy donor (serum) to obtain a final serum dilution of 1:3. Titration microplates were incubated for 4 h at 37°C. After centrifugation carried out the calculations freed51Cr in the supernatant (in an automated gamma counter Cobra II, Canberra Packard, Melbourne, Australia). The percentage of specific lysis was calculated on the basis of experimental release51C, total (50 μl of target cells + 100 ál 10% Tween 20) and spontaneous (50 μl of target cells + 100 ál of medium) release.

Analysis of ADCC

ch806-dependent ADCC, mediated PBMC of a healthy donor, were determined using the 4-hour tests release51Cr. In the first analysis of labeled target cells were placed together with cells effectors in 96-well plates with U-shaped bottom (NUNC, Roskilde, Denmark) in an amount of 50:1 ratio of cells-effectors/target cells (E:T). To determine the activity is ADCC in each well three times added 0,00315-10 μg/ml (final concentration) of the test and control antibodies. In the second analysis of ADCC activity ADCC ch806 was compared to that of the original murine Mat in range of cells-effectors/target cells when using a constant of 1 μg/ml concentrations of the studied antibodies. In both analyses titration microplates were incubated at 37°C for 4 hours, then from each well was collected in 50 μl of the supernatant and released51Cr was determined by counting gamma radiation (in an automated gamma counter Cobra II, Canberra Packard, Melbourne, Australia). Included in the analyses controls were amended on spontaneous release (only Wednesday) and on General release (10% Tween20/PBS). In parallel was performed with appropriate controls used�lo g antibodies of the same subclass.

The percentage of cell lysis (cytotoxicity) was calculated in accordance with the formula:

Build a graph of the cytotoxicity percentage (%) of the antibody concentration (µg/ml).

Results

The results of the CDC is shown in Fig. 37. Minimum activity - CDC was observed in the presence of up to 10 μg/ml ch806, while CDC was comparable with that observed in the case of matching the isotype control cG250.

ch806-dependent ADCC against target cells U87MG.de2-7 and A431 when the ratio E:T of 50:1, shown in Fig. 38. Effectively, ch806-specific cytotoxicity was demonstrated in respect of target cells U87MG.de2-7, but the minimum was observed in ADCC against A431 cells using ch806. Achieved levels of cytotoxicity reflect the number of binding sites ch806 in two populations of cells. Target cells U87MG.de2-7 Express ~1×106de2-7EGFR that is specifically recognized by ch806, while only a subset of 1×106molecules EGFR wild-type, presented in A431 cells, is recognized by ch806 (see examples above).

In addition, analyses were performed to compare ADCC ADCC against target cells U87MG.de2-7 using 1 μg/ml with ch806 such, carried out using 1 μg/ml of the original murine Mat. The results are presented in Fig. 39. After�the effect of chimerization Mat was an obvious increase in ADCC, achieved using the original mouse Mat, with greater than 30% cytotoxicity was achieved at ratios (E:T, equivalent to 25:1 and 50:1.

Missing immunoelectron function of the original murine Mat was significantly increased after chimerization. With the help of ch806 achieved significant ADCC, but minimal activity in the CDC.

Example 20

The creation of antiidiotypic antibodies against the chimeric antibody ch806

To facilitate clinical assessment met ch806 or require laboratory tests to monitor the pharmacokinetics of antibodies in serum and for any quantitative analysis of immune responses against chimeric murine-human antibodies. Were established murine monoclonal antiidiotypic antibodies, and determined their suitability as reagents for ELISA to measure ch806 in serum samples of patients and the possibility of use as positive controls in assays of immune responses against the chimeric antibody in humans. These antiidiotypic antibodies are also useful as therapeutic or prophylactic vaccines, which creates a natural response in the form of production of antibodies against EGFR in patients.

Methods of production of antiidiotypic antibodies are well known in the art (Chatterjee et al., 2001; Uemura et al., 1994; Steffens et al., 1997; Safa and Foon, 2001; Brownand Ling, 1988).

Briefly, mouse monoclonal antiidiotypic antibodies created as follows. Splenocytes of mice subjected to immunization ch806, were fused with cells plasmacytoma SP2/0-AG14, and producing antibodies, the hybridomas were selected through ELISA for specific binding to ch806 and competitive binding in the case of antigen (Fig. 40). Initially, we selected twenty-five hybridomas, and four named LMH-11, -12, -13 and -14, secretively antibodies, which showed specific binding with ch806, Mat and were able to neutralize the binding activity ch806 or Mat with the antigen (Fig. 41). Proof of recognition idiotope or CDR-phase ch806/Mat was the lack of cross-reactivity with purified polyclonal human IgG.

In the absence of readily available recombinant antigen de2-7 EGFR for assistance in determining ch806 in serum samples was used the ability of new idiotypic antibodies against ch806 parallel to the binding variable regions 806 in the development of sensitive, specific ELISA for the determination of ch806 in clinical samples (Fig. 42). When using LMH-12 for capture and biotinylated LMH-12 for detecting subjected to validation by ELISA demonstrated highly reproducible binding curves for the determination of ch806 (2 μg/ml of -1.6 ng/ml) in serum components with 3 ng/ml limit of detection (n=12; 1-100 ng/ml, coefficient of variation <25%; 100 ng/ml - 5 μg/ml, coefficient of variation <15%). There was no appreciable background linking the three tested sera from healthy donors, and there was a slight binding with matching isotype control hu3S193. The hybridoma produces the antibody LMH-12 at high levels, and is scheduled for more vysokomytska products in order to make possible the definition of ch806 and quantification of any immune responses in clinical samples (Brown and Ling, 1988).

Results

Immunization of mice and selection of hybrid clones

The immunoreactivity of serum samples before and after immunization indicated the establishment of a murine MAB against ch806 and against huIgG with high titers. Initially, we selected twenty-five hybridomas producing antibodies, which were associated with ch806, but not with huIgG. Characteristics of binding of some of these hybrid shown in Fig. 42A and 42B. In four of these hybridomas producing antibodies against ch806 with high binding affinity (clone 3E3, SB8, 9D6 and 4D8), subsequently performed a clonal expansion from single cells by limiting dilution, and they were called the Ludwig Institute for Cancer Research Melbourne Hybridoma (LMH)-11, -12, -13, and - 14, respectively (Fig. 42).

The activity of binding and blocking selected the antiidiotypic antibodies�

The ability of antibodies against ch806 in parallel contact with two antibody ch806 is a desirable feature in the case of their use as reagents in ELISA to determine levels of ch806 in serum. Clonal hybridomas LMH-11, -12, -13 and -14 showed parallel binding (data not presented).

After clonal expansion, the supernatants of cultures of hybrid cells was checked by ELISA for the ability to neutralize the activity of binding ch806 or mAb806 with antigen - sEGFR621. The results indicated antagonistic activity of anti-Mat LMH-11, -12, -13 and -14 with blocking solution binding as ch806 and mouse Mat with tablets, coated with sEGFR (Fig. 41 in the case of LMH-11, -12, -13).

After more vysokomarochnogo cultivation in rotating vials tested the binding specificity of a stable clonal hybrid LMH-11, -12, -13 and -14 using ELISA. Antibodies with LMH-11 to -14 were identified as the IgG1κ isotype by using the set to determine the isotypes of mouse monoclonal antibodies.

ch806 to develop pharmacokinetic analysis using ELISA clinical serum samples

For assistance in determining ch806 in serum samples was used the ability of antiidiotypic antibodies against ch806 parallel to the binding variable regions 806 when I�TKE sensitive and specific ELISA for the determination of ch806 in clinical samples. Three purified clone LMH-11, -12 and -13 (Fig. 49B and 49C, respectively) were compared for their ability to sequester, and then the detection of the associated ch806 in serum. The results showed that the use of LMH-12 (10 μg/ml) for trapping and biotinylated LMH-12 for the detection provides the greatest sensitivity to ch806 in serum (3 ng/ml) with negligible background binding.

After establishing optimal conditions for pharmacokinetic analysis using ELISA using 1 µg/ml of anti-LMH-12 and 1 µg/ml biotinylated LMH-12 for capture and detection, respectively, was carried out validation method. Three separate ELISA were performed in four repetitions to measure ch806 in serum of three healthy donors or 1% BSA/media with matching isotype control hu3S193. The results of the validation are presented in Fig. 43 and demonstrate reproducible binding curves for the determination of ch806 (2 µg/ml - 1.6 ng/ml) in sera with constituents 3 ng/ml limit of detection (n=12; 1-100 ng/ml, coefficient of variation <25%; 100 ng/ml - 5 μg/ml, coefficient of variation <15%). There was no appreciable background binding to any of the three tested sera, and there was a slight binding with matching isotype control hu3S193.

Example 21

Evaluation of carbohydrate structures and the detection antibody

Was� performed experiments to further define the role of carbohydrate structures in the binding and recognition of EGFR, as increased in number as a result of gene amplification of EGFR and de2-7 EGFR, the antibody Mat.

To determine whether directly carbohydrate structures in the epitope for Mac, recombinant sEGFR, expressed in CHO cells, treated PNGase F (peptide-N-glycanase F) to eliminate N-linked glycosylation. After treatment, the protein was subjected to electrophoresis in SDS-page, transferred onto membrane and subjected to hybridization with Mat (Fig. 44). As expected, deglycosylated sEGFR moved faster during electrophoresis in SDS-page, which meant that the carbs were successfully removed. Antibody Mat obviously contacted deglycosylated material, which suggests that the epitope for the antibody is peptide in nature, and not only the glycosylated form of the epitope.

Lysates prepared on the basis of lines of cells, metabolically labeled with35S, were subjected to immunoprecipitation with various antibodies directed against the EGFR (Fig. 45). As expected, the antibody 528 was immunoprecipitated corresponding to the three bands of molecules from U87MG cells.Δ2-7, with the upper band corresponded to EGFR wild type, and two lower bands corresponded to the de2-7 EGFR. These two de2-7 EGFR bands, as previously reported and assumed to reflect differential glycosylation (Chu et al. (1997) Biochem. J. un 15; 324 (Pt 3): 885-861). In contrast, Mat was immunoprecipitated only relevant two lanes de2-7 EGFR, wherein the wild-type receptor was completely absent even after overexposure (data not presented). Interestingly, Mat demonstrated increased relative reactivity with the respective lower band de2-7 EGFR, but reduced reactivity with the upper band compared to the antibody 528. Antibody SC-03, a commercial rabbit polyclonal antibody directed against the C-terminal domain of EGFR, was immunoprecipitates corresponding to the three bands of EGFR observed when using antibodies 528, although the total number of receptor immunoprecipitation this antibody was significantly less. No bands were observed when using an irrelevant IgG2b antibody as a control for Mat (see example 18).

Antibody 528 gave a single band corresponding to the wild-type receptor, as a result of the immunoprecipitation of U87MG cells.wtEGFR (Fig. 45). Mat also gave one lane as a result of the immunoprecipitation of these cells, however, this strip EGFR obviously moved faster stripes corresponding reactive 528 receptor. Antibody SC-03 was immunoprecipitated reacting both EGFR strips of U87MG cells.wtEGFR, which provides further confirmation that Mat and 528 recognize different forms of EGFR in Zelin�cell lysates of these cells.

As was observed with U87MG cells.wtEGFR, antibody 528 gave one lane EGFR as a result of immunoprecipitation from A431 cells (Fig. 45). Band reactive with EGFR 528 is very wide in these low-gels (6%) and probably reflects the diversity of glycosylation of the receptor. One lane of EGFR was also observed after immunoprecipitation with Mat. Despite the fact that this band EGFR't moved much faster broad band in General react with EGFR 528, it was located in front of the broad bands obtained from 528, over and over again. Unlike lysates of U87MG cells.Δ2-7, total number of EGFR immunoprecipitating using Mat lysates from A431, was significantly smaller than that in the case of using the antibody 528, the result being in accordance with those obtained by the authors of the present invention data analysis Scatchard showing that Mac recognizes only a portion of the EGFR on the surface of these cells (see example 4). The result of immunoprecipitation with SC-03 was one wide strip of EGFR, as in the case of the antibody 528. Similar results were obtained with HN5 cells (data not presented). Taken together, these data indicate that Mat preferably reacts with more fast moving varieties of EGFR, which may represent differentially glycosylated forms of the receptor.

<> To determine at what stage the processing of the receptor appears reactivity with Mat, experiment was carried out on pulsed tagging/tracking. Cells A431 and U87MG.Δ2-7 were subjected to pulse labeling for 5 min using35S methionine/cysteine and then incubated at 37°C for various periods of time prior to the immunoprecipitation using Mat or 528 (Fig. 46). Picture of immunoprecipitation with antibody 528 in A431 cells was typical for antibodies specific against a conformational epitope of EGFR. A small amount of receptor was immunoprecipitates at t=0 min (i.e. after pulse labeling for 5 min), while the number of labeled EGFR increased at each time point. As time went on, also parallel to the increased molecular mass of the receptor. In contrast, reactive Mat material EGFR was present at high levels in t=0 min, reached a maximum after 20 min, and then decreased in each future point in time. Thus, Mat seems preferable to recognize the shape of EGFR is detected at an early stage of processing.

Reactivity with the antibody is observed in subjected to pulsed tagging of U87MG cells.Δ2-7, was more complex. As a result of immunoprecipitation with antibody 528 at t=0 min discovered that it was marked small to�icesto de2-7 EGFR, the respective lower band (Fig. 46). As time went on, the number of reactive 528 de2-7 EGFR corresponding to the lower band increased, reaching a maximum after 60 min and slowly decreasing by 2 and 4 h. a Significant amount of labeled de2-7 EGFR corresponding to the upper band was detected up to 60 min, after which it continued to increase until the end of the tracking period. This clearly indicates that the de2-7 EGFR upper band is a more Mature form of the receptor. Reactivity Mat also changed during the tracking period, but Mat preferably precipitable de2-7 EGFR lower band. Indeed, high levels of reactive Mat receptor upper band was not observed until 4 h after tagging.

The above experiments indicate that Mat preferably reacts with the shape of the de2-7 EGFR wild type earlier glycosylation. This possibility was tested using immunoprecipitation of EGFR from different cell lines that are marked during the night35S methionine/cysteine and then exposure resulting from the precipitation products to cleavage by endoglycosidase H (Endo H). This enzyme preferentially removes the type of carbohydrates with a high content of mannose (i.e., early glycosylation) of proteins, leaving intact complex carbohydrates (i.e. late I�e glycosylation). Immunoprecipitate through 528, math and SC-03 and cleavage of Endo H labeled lysates of U87MG cells.Δ2-7 showed similar results (Fig. 47).

As expected, de2-7 EGFR lower band was completely susceptible to cleavage Endo H, moving faster during electrophoresis in SDS-page after cleavage of the Endo H, indicating that this band represents the shape of the de2-7 EGFR with high mannose content. de2-7 EGFR upper band was essentially resistant to splitting Endo H, showing only a very slight difference in displacement after cleavage of the Endo H, indicating that a large portion of carbohydrate structures is a complex type structures. A small but reproducible decrease in molecular weight of the receptor of the upper band after cleavage of the enzyme suggests that although the carbohydrates de2-7 EGFR upper band are mainly structures of complex type, it has a certain number of structures with a high content of mannose. Interestingly, these cells also Express low amounts of endogenous EGFR wild-type, which is clearly seen after immunoprecipitation 528. There was also a small but noticeable decrease in the molecular weight of the wild-type receptor after cleavage of the Endo H, indicating that it also contains a structure with a high content of mannose.

The sensitivity of the subject and�nanoprecipitation EGFR wild type to splitting Endo H was similar in both cell lines U87MG.wtEGFR and A431 (Fig. 47). A large amount of material, precipitating antibody 528, was resistant to the enzyme Endo H, although a small amount of material was a material form with a high content of mannose. And this time there was a slight decrease in molecular weight EGFR wild type after cleavage of the Endo H, indicating that he indeed has a number of structures with a high content of mannose. Results using antibody SC-03 were similar to the results when using the antibody 528. Instead, most EGFR, precipitating Mat, was sensitive to Endo H in both cell lines U87MG.wtEGFR and A431, confirming that Mat preferably recognizes the form of the EGFR with high mannose content. When using cells HN-5 were obtained similar results, in which the bulk of the material, precipitating Mat, was susceptible to cleavage Endo H, whereas most of the material, precipitating math and SC-03, was resistant to cleavage of Endo H (data not presented).

Iodization of surface structures cell line A431 were performed using125I followed immunoprecipitate using antibody 806. The Protocol for the iodination of surface structures was as follows. The lysis of the cells, immunoprecipitate, splitting Endo H, electrophoresis in SDS-page and radioautography procedures are�mi, described here above. For labeling cells were grown in media with 10% FCS, detached with EDTA, washed with PBS twice, then resuspendable in 400 μl PBS (approximately 2-3×106cells). Thereto was added 15 μl125I (100 MCI/ml stock solution), 100 ál of stock solution of bullish laktoperoksidazy (1 mg/ml), 10 µl H2O2(0.1% of the mother liquor), and the mixture incubated for 5 min Then was added 10 µl H2O2and incubation was continued for another 3 min. Then the cells were again washed 3 times with PBS and literally in 1% Triton. Iodization of surface structures cell line A431 using laktoperoksidazy followed by immunoprecipitation using antibody 806 showed that, as in the case of whole cell lysates, as described above, the predominant form of EGFR recognized by antibody 806, located on the surface of A431 cells, is sensitive to EndoH cleavage (Fig. 48). This confirms the fact that the form of the EGFR associated 806, on the surface of A431 cells is sensitive to EndoH form, and therefore, is the type with a high content of mannose.

Example 22

A humanized (generowanie) antibody 806

A. Designing hu806

Was constructed vector for expression of humanized antibody 806 (hu806). Vector, named 8C65AAG (11891 p. O.; SEQ ID NO: 41), was designed t�to, it contains both the gene for the full-size hu806 in a managed one promoter GS gene expression cassette (Fig. 53 and 54).

Variable region heavy chain (VH) and a constant region (CH) (SEQ ID NO: 42 and 43, respectively) shown in Fig. 55A, wherein CDR1, CDR2 and CDR3 (SEQ ID NO: 44, 45 and 46, respectively) VH-region is shown underlined.

Variable region light chain (VH) and a constant region (CH) (SEQ ID NO: 47 and 48, respectively) shown in Fig. 55V, wherein CDR1, CDR2 and CDR3 (SEQ ID NO: 49, 50 and 51, respectively) VL-region is shown underlined.

To obtain designs for a humanized antibody 806 used technology generowania (Daugherty et al. (1991) Polymerase chain reaction facilitates the cloning, CDR-grafting, and rapid expression of a murine monoclonal antibody directed against the CD18 component of leukocyte integrins. Nucl Acids Res. 19(9), 2471-2476; U.S. patent No. 6797492 issued Daugherty; Padlan, E. A. (1991) A possible procedure for reducing the immunogenicity of antibody variable domains while preserving their ligand-binding properties. Mol. Immunol. 28(4-5), 489-498; European patent No. 519596 issued by Padlan, etc.). To minimize the immunogenicity of the variable domains of the antibody 806, while maintaining the ligand binding properties, there was replacement of exposed residues on the surface of the frame areas that differ from the residues commonly found in human antibodies. To accomplish this, VL - and VH-region of murine monoclonal antibody (MAB) 806 were rebuilt�titles using the technology of gene synthesis using overlapping primers for PCR. CL (Kappa)-the area was the same way. For the proof of preservation of intact binding sites vVL and vVH also expressible in the form of scFv, which demonstrated sufficient binding to a synthetic peptide that includes an antigenic determinant for 806, using ELISA with recombinant extraclean domain (ECD) of the EGF receptor (EGFR), which is determined through analysis using surface plasmon resonance (SPR).

v806VL and v806VH set in the backdrop of a full-sized human IgG1 using an optimized in relation to the frequency of use of codons Kappa-LC and newly created, optimized in relation to the frequency of use of codons and splicing sites of the constant region of the heavy chain of human IgG1, for achieving stable gene expression systems using NSO cells and CHO. Gene-expression system based on gene expression system LONZA GS, which uses vectors for expression of the heavy and light chains pEE12.4 and pEE6.4 provided by LONZA Biologies.

The product in the form of hu806 antibody (Fig. 55), obtained using a transient expression vector 8C65AAG, reacted with recombinant EGFR-ECD, which is determined using SPR, and with synthetic epitope peptide for EGFR 806 that determined using ELISA. Vector 8C65AAG gave LICR Affiliate Christoph Renner (University of Zurich), to create stable cell lines�to the GS-NSO hu806, and LICR, Melbourne Centre, to create cell lines GS-CHO hu806.

Strategy design, amplification and cloning of antibody genes hu806

Generowanie and optimization regarding the frequency of use of codons

Generowanie antibodies is a humanization strategy aimed at countering responses in the form of products HAMA (human antibodies against mouse antibodies). The patient's immune system sees a mouse Mat as a "foreign" antigens, and immune response is induced, even after a single injection that prevents further use of the reagent for these patients. At the first stage of the process of generowania Mat analyzed the amino acid sequence of VL - and VH-regions in Mat, and each amino acid residue in the protein sequence Mat was evaluated in relation to exposure on the surface (Fig. 56 and Fig. 57). For possible modification was considered only those amino acids, which were located on the outer surface of the molecule antibodies, as these amino acids are the only amino acids that could be recognized by the antibody. Using BLAST, sequence protein Mat compared with sequences of the three human antibodies (VH36germ, CAD26810 and AAA37941). Everywhere, where surface residue Mat did not match the consensus sequence, lyveden�th of the sequences of human antibodies, this residue was identified as a residue that must be replaced by the residue of the consensus sequence. First 12 amino acids in VL were subjected to generowania, and 14 in VH ch806 (Fig. 56 and Fig. 57).

Optimization concerning the frequency of use of codons is a way of improving heterologous expression of antibodies or other proteins on the basis of giving preference to the codons of the system used for expression of these antibodies. One of the goals when creating hu806 was the use of optimization in relation to the frequency of use of codons to increase the expression levels of this antibody. Gene-expression system based on gene expression system LONZA GS, which uses vectors for expression of HC and LC pEE12.4 and pEE6.4 provided by LONZA Biologies, and NSO cells and/or CHO as cells-producers. Therefore, decisions regarding whether the codon to be used for specific amino acids, to take into account whether the preferred codon in the gene expression system using the NS0/CHO.

Construction and amplification of DNA sequences 806 PCR

Sequence for generowanych optimized in relation to the frequency of use of codons variants of variable regions of heavy (VH) and light (VL) chains of hu806 antibody synthesized as follows. For each region (VH �whether VL) was constructed 8-10 oligonucleotides in the form of overlapping sense and antisense primers. These oligonucleotides will certainly overlap with each other so that covered the entire sequence of VH or hu806 VL, including the signal sequence, coding sequences, introns, and included a site for HindIII at the 5'-end and the site for BamHI at the 3'-end. Mapping of oligonucleotides shown in Fig. 56B and 57B, and the details of the primers are presented below.

Briefly, the VH or hu806 VL was PCR as follows. First, in three separate reactions were pooled v806hc - or v8061c-oligonucleotides 1, 2, 3 and 4, the oligonucleotides 5 and 6 and oligonucleotides 7, 8, 9 and 10. Aliquots (50 pmol) of each of the flanking oligonucleotide and 5 pmol of each oligonucleotide was added to 50 µl reaction mixture for PCR containing 25 μl of 2× mixture of HotStar Taq Master Mix (Qiagen) and 48 μl containing a nuclease water. Programmed with the following cycles: 95°C; 15", [94°C; 30", 58°C 30", 72°C; 30"]× 20 cycles, 72°C; 10", 4°C. the Products of these three reactions is excised after separation by gel electrophoresis. They were then purified using a column for desalting (Qiagen-Qiaspin Minipreps), and United. These products are further subjected to amplification by PCR using primers 1 and 10. The product of this second reaction included sites for restriction enzymes HindIII and BamHI, which ensured the possibility of integration into gene-expression plasmids.

The oligonucleotides used to synthesize by PCR the V-regions hu806:

CL hu806:

Optimized in respect to the frequency of use of codons variant constant region light chain Kappa (CL) was prepared in a manner similar to the method used for variable regions. However, the initial round of PCR included the establishment of only two advanced products, using the oligonucleotides VK1cons-1, 2, 3, 4, 5, 6, 7 and 8. In addition, in the case of this product flanking restriction sites were BamHI and Notl prior to incorporation into the plasmid.

The oligonucleotides used to synthesize by PCR CL-areas hu806:

CH hu806:

Synthetic, humanized variant of the gene constant region of the heavy chain (CH) IgG1 (SEQ ID NO: 80) was purchased from GeneArt, Regensburg, Germany. Gene optimized in relation to the frequency of use of codons for expression in CHO cells/NS0. Details regarding the sequence of the gene, restriction sites, etc. shown in Fig. 58.

Construction of expression plasmids

For transient transfection and preliminary testing sequence VH and VL hu806, prepared as described above, was ligated into expression vectors containing generic constant region. These vectors provide�by LICR Affiliate Christoph Renner (University of Zurich, Switzerland) was known as pEAK8 HC (which contained generic CH) and a33-xm-lc (which contained generic CL). The vectors were digested using BamHI and HindIII in the presence of CIP, then VH and VL hu806 was ligated into the corresponding vectors. The resulting plasmids were used to transform chemically competentE. coliTop10 (Invitrogen) in accordance with instructions from the manufacturer. TransformedE. coliplaced on the Cup with LB + ampicillin, and stable clones were selected using cleavage by restriction enzymes and PCR. In total, eight positive clones thus identified, singled out and then were amplified. Purified from these colonies DNA was analyzed by automated DNA sequencing.

Optimized in respect to the frequency of use of codons options constant regions were added to these constructs by digestion with restriction enzymes, using BamHI and NotI and ligation. These transformants was subjected to selection, sequencing, and analysis as described above. Prior to ligation of the full-sized chains of the antibody in the system Lonza GS eliminated the site for BamHI between the sequences of variable and constant regions, in one case, by splitting BamHI, filling in with DNA polymerase and by ligating the blunt ends.

Restriction fragments containing hu806 (VH+CH) �whether hu806 (VL+CL), then were digested NotI, HindIII and then. These splitting are designed to create a blunt end at the site for NotI and therefore were carried out sequentially as follows. First, the plasmids were digested NotI. Fully cleaved (in one site) the plasmid was separated by electrophoresis using 1% agarose gel. This product is then cut out and purified on a column for desalting, and the ends were filled in using DNA polymerase. The product of this reaction was purified on a column for desalting, and then were digested HindIII. This product (~1,3 T. p. O. in the case of hu806 (VH+CH) and ~0,8 T. p. O. in the case of hu806 (VL+CL)) then separated by electrophoresis, excised and purified.

Each of the vectors pEE12.4 and pEE6.4 (Lonza Biologies plc, Slough, United Kingdom) were digested HindIII and PmlII. hu806 (VH+CH) was ligated with pEE12.4 with the creation of pEE12.4-hu806H, and hu806 (VL+CL) was ligated with pEE6.4 with the creation of pEE6.4-hu806L.

After the selection was created by the United Lonza plasmid with two genes containing both sequences of the heavy and light chains hu806. Briefly, vectors pEE12.4-hu806H and pEE6.4-hu806L were digested with restriction enzymes NotI and SalI. The resulting fragments containing the transcription unit GS and promoter hCMV-MIE, followed by cassettes for expression of the heavy or light chains hu806, was isolated and was ligated together. The resulting "combined" Lonza plasmid (named 8C65AAG) was used for transient �of respecti one plasmid system HEK 293 and stable transpency systems NS0 and CHO. Map of the plasmid is shown in Fig. 53.

Modification of structures

Full verified amino acid sequence generowanych hu806Hc and hu806Lc presented in comparison with HC and LC Mat in Fig. 59 and Fig. 60, respectively. Adjacent to the sequence hu806 in the notes are asterisks ( * ) denoting the initial changes in generowanie, and the numbers (1-8) are numbered modifications # 1 to # 8, described here.

With regard to Fig. 60, the reference file (LC Mat) incorrectly indicates that the histidine (H), and not at tyrosine (Y) at position 91; the reason modification #1. The original uncorrected sequence file is included in Fig. 60 to illustrate the necessary modifications to hu806 in position 91.

A number of modifications were made in the sequence of cDNA hu806 after the initial phase of designing and sequencing. The reasons for making these modifications included the introduction of the 4 sites for restriction enzymes in order to modify sequences, correcting 2 errors in amino acid sequence, is introduced during the PCR, the correction of a single amino acid error resulting from the original documentation relating to math, and the introduction of 4 additional amino acid substitutions to provide additional options of generowania. Performed the following 8 �of TDI modifications:

1. Hu806 VL: CDR3 H91Y

The document, on the basis of which was created the original oligonucleotides, incorrectly indicated that CAC (histidine, H) is in position 91 in the sequence of VL CDR3 Mat. To create the correct sequence of the TAC (tyrosine, Y; patent application WO02/092771) used site-directed mutagenesis. Resulting change in amino acid sequence at this position was change to CVQHAQF (SEQ ID NO: 84) at CVQYAQF (SEQ ID NO: 85). Final DNA sequence and translated protein in comparison with ch806 shown in Fig. 61.

Semantic primer for modification with the replacement of histidine for tyrosine VL-region hu806 (PDV1; 40-Mer):

5'-CCACATACTACTGCGTCCAGTACGCTCAGTTCCCCTGGAC-3' (SEQ ID NO: 86)

Antisense primer for modification with the replacement of histidine for tyrosine VL-region hu806 (PDV2; 20-Mer):

5'-CTGGACGCAGTAGTATGTGG-3' (SEQ ID NO: 87)

2. Heavy chain hu806: adding sites for the restriction enzymes DraIII and Fsel

In the introns surrounding the VH - and VL-region hu806, were added sites for restriction enzymes. These restriction sites unique in the system of vectors pREN, LICR) were designed to facilitate the process of making modifications to gene expression cassette. The sequence of the VH-region hu806, without the initial portion of the signal sequence can be removed or embed using the splitting only DraIII. In addition, m�are encouraged to use FseI with NotI (pREN) or EcoRI (Lonza) for cutting out the constant region, realizing the function of the BamHI site on the basis of the original sequence.

These modifications were performed using a two-step PCR process. The products then were digested HindIII and BglII. Then their was ligated in the vectors pREN containing optimized in relation to the frequency of use of codons of the constant region, which were digested HindIII and BamHI. This process of re-ligation eliminated the site for BamHI.

Semantic primer for variable region 5' from the first site for DraIII (5' DraIII site in the sequence of the heavy chain 806; 26-Mer):

5'-GAGAAGCTTGCCGCCACCATGGATTG-3' (SEQ ID NO: 88)

Antisense primer comprising the site I for the DraIII (3' from the DraIII site in the sequence of the heavy chain 806; 28-Mer): 5'-CACTGGGTGACTGGCTTCGATGGTGACC-3' (SEQ ID NO: 89)

Semantic primer for variable region of HC between the two sites DraIII (5' DraIII sites for-FseI in the sequence of the heavy chain 806; 49-Mer):

5'-GGTCACCATCGAAGCCAGTCACCCAGTGAAGGGGGCTTCCATCCACTCC-3' (SEQ ID NO: 90)

Antisense primer comprising the site II for DraIII and FseI site (3' from the sites DraIII-FseI in the sequence of the heavy chain 806; 44-Mer):

5'-CCAAGATCTGGCCGGCCACGGTGTGCCATCTTACCGCTGCTCAC-3' (SEQ ID NO: 91)

3. Light chain hu806: adding sites for restriction enzymes RsrII and PacI

In the case of light chain hu806 added restriction sites were the RsrII site for having the same function as the DraIII site in the heavy chain, and sa�t for PacI, function of which coincided with that of the FseI site.

Semantic primer for variable region 5' from the first RsrII site (5' from the RsrII site in the sequence light chain 806; 22-Mer):

5'-GAGAAGCTTGCCGCCACCATGG-3' (SEQ ID NO: 92)

Antisense primer comprising the site I for the RsrII (3' from the RsrII site in the sequence light chain 806; 25-Mer): 5'-CGGTCCGCCCCCTTGACTGGCTTCG-3' (SEQ ID NO: 93)

Semantic primer for LC variable regions between the two sites RsrII (5' from sites RsrII-PacI in the sequence light chain 806; 45-Mer):

5'-CGAAGCCAGTCAAGGGGGCGGACCGCTTCCATCCACTCCTGTGTC-3' (SEQ ID NO: 94)

Antisense primer comprising the site II for RsrII and the site for PacI (3' from the sites RsrII-PacI in the sequence 806 light chain; 50-Mer):

5'-CCAAGATCTTTAATTAACGGACCGCTACTCACGTTTGATTTCCAGTTTTG-3' (SEQ ID NO:95)

4. Hu806 VH: re-generowanie P85A

In the case of the original Mat protein sequences in the range of positions of the amino acids 81-87 VH is SVTIEDT (SEQ ID NO: 96). As part of the process of generowania isoleucine and glutamic acid at positions 84 and 85 were replaced with Allen-Proline to read SVTAPDT (SEQ ID NO: 97; Fig. 56). After further analysis it was decided that the best choice could be alanine instead of Proline in this case. To implement this secondary changes (SVTAADT, SEQ ID NO: 98) was used for site-napravlenii mutagenesis using the primers listed below. End� DNA sequences and translated protein is shown in Fig. 62.

Semantic primer (Fx3; 49-Mer):

5'-CTGCAGCTGAACTCCGTTACAGCCGCAGACACAGCAACATATTACTGCG-3' (SEQ ID NO: 99)

Antisense primer (Fx4; 49-Mer):

5'-CGCAGTAATATGTTGCTGTGTCTGCGGCTGTAACGGAGTTCAGCTGCAG-3' (SEQ ID NO: 100)

5. Hu806 VH: additional generowanie

The sequence of the variable regions of the heavy chain hu806 was subjected to three additional mutations after the initial generowania: T70S, S76N and Q81K. Substitution at position 76 of serine for asparagine represented the change back to the original sequence of the molecule Mat. Additional substitutions in the framework region were included because they represent residues that are not found in antibodies of the mouse, but found in human antibodies. Accordingly, there have been generowanie protein sequence TRDTSKSQFFLQ (SEQ ID NO: 101) in SRDTSKNQFFLK (SEQ ID NO: 102). End of the DNA sequence and translated protein in comparison with Mat shown in Fig. 62.

Semantic primer for the 5' PCR fragment of the variable region of HC (hu806HCfx2-5p-U; 49-Mer):

5'-GGTCACCATCGAAGCCAGTCACCCAGTGAAGGGGGCTTCCATCCACTCC-3' (SEQ ID NO: 103)

Antisense primer for the 5' PCR fragment includes the first two substitutions (hu806HCfx2-5p-D; 45-Mer):

5'-GATTCTTCGACGTGTCCCTTGAGATTGTGATCCGGCTTTTCAGAG-3' (SEQ ID NO: 104)

Semantic primer for 3' PCR fragment includes all replacements (hu806HCfx2-3p-U; 55-Mer):

5'-CAAGGGACACGTCGAAGAATCAGTTCTTCCTGAAACTGAACTCCGTTACAGCCGC-3' (SEQ ID NO: 105)

Antisense primer for 3' PCR fragment of the variable region of HC hu806HCfx2-3p-D; 44-Mer):

5'-CCAAGATCTGGCCGGCCACGGTGTGCCATCTTACCGCTGCTCAC-3' (SEQ ID NO: 106)

6. Hu806 VL: generowanie E79Q

That was the only modification in the process of generowania VL performed after construction. In the modification at position 79 was used site-directed mutagenesis to change the sequence SSLEPE (SEQ ID NO: 107) at SSLQPE (SEQ ID NO: 108). End of the DNA sequence and translated protein in comparison with ch806 shown in Fig. 61.

Semantic primer for the 5' PCR fragment of LC variable regions (hu806LC-5p-U; 45-Mer):

5'-CGAAGCCAGTCAAGGGGGCGGACCGCTTCCATCCACTCCTGTGTC-3' (SEQ ID NO: 109)

Antisense primer for the 5' PCR fragment includes the intended mutation (hu806LC-5p-D; 34-Mer):

5'-CTCTGGTTGTAAGCTAGAGATGGTCAGTGTATAG -3' (SEQ ID NO: 110)

Semantic primer for 3' PCR fragment of LC variable regions includes the intended mutation (hu806LC-3p-U; 45-Mer):

5'-CCATCTCTAGCTTACAACCAGAGGACTTTGCCACATACTACTGCG-3' (SEQ ID NO: 111)

Antisense primer for 3' PCR fragment of LC variable regions (hu806LC-3p-D; 50-Mer):

5'-CCAAGATCTTTAATTAACGGACCGCTACTCACGTTTGATTTCCAGTTTTG-3' (SEQ ID NO: 112)

7. Light chain hu806: modification at the connection in the process of splicing the constant region Kappa

This point mutation was necessary to correct an error in the splicing optimized in relation to the frequency of use of codons of the variant constant region of the Kappa. Prior to this change a part of the amino acid chain that starts with VYACEVTH (SEQ ID NO: 113) iprodoljayutza until the end of the molecule, not included in the final antibody (Fig. 60).

Semantic primer for the 5' PCR fragment of the constant region of the Kappa LC (F1; 21-Mer):

5'-GGCGGCACAAAACTGGAAATC-3' (SEQ ID NO: 114)

Antisense primer for the 5' PCR fragment of the constant region of the Kappa LC includes edit (F2; 59-Mer):

5'-GATGAGTTACTTCACAGGCATATACTTTGTGCTTTTCATAATCAGCTTTTGACAGTGTC-3' (SEQ ID NO: 115)

Semantic primer for 3' PCR fragment of the constant region of the Kappa LC includes edit (F3; 26-Mer):

5'-AGTATATGCCTGTGAAGTAACTCATC-3' (SEQ ID NO: 116)

Antisense primer for 3' PCR fragment of the constant region of the Kappa LC (F4; 17-Mer):

5'-GCCACGATGCGTCCGGC-3' (SEQ ID NO: 117)

8. Hu806 VH: N600

In addition to changes in the process of generowania made to the antibody 806 in the initial stages of design, at this time, the asparagine at position 60 in CDR2 VH was replaced by glutamine. N-glycosylation is focused on structure: NXS/T, where X is any amino acid. Amino acid sequence from position 60 was NPS, which is derived from this structure. However, a case where the position X in the site of N-glycosylation of Proline is found (as in this example) or cysteine, is infrequent. Worried that unstable glycosylation could lead to changes in reactivity of the antibody. Therefore, asparagine was removed and replaced with the most closely related amino acid glutamine, which led to the exclusion of any possibility glycosyl�hardware in this site (Fig. 59 and Fig. 62).

Binding generowania hu806 antibody constructs 8C65AAG

Was performed transient transfection of 293FT cells final plasmid 8C65AAG to allow the preparation of small quantities of hu806 for initial verification of binding to the antigen. The supernatants of cultures, the result of multiple small-scale parallel transitory transpency, were pooled, concentrated, and antibody 806 obtained using chromatographic stage using protein A. received approximately 1-2 μg hu806 antibody that is defined by using quantitative ELISA for huIgG1, and the antibody was analyzed by Biacore for binding to recombinant EGFR-ECD (Fig. 63). Bovine immunoglobulin from the medium for cell culture was purified with hu806 and represented the main fraction of total IgG, limiting quantitative determination of binding hu806.

Used for sequencing primers

RenVecUPSTREAM: semantic primer, enable start sequence 5' from the variable regions in the peak8 vector and a33xm.

5'-GCACTTGATGTAATTCTCCTTGG-3' (SEQ ID NO: 118)

RenVecDwnstrmHC: antisense primer, enable start sequence 3' from the variable regions in the plasmid for the heavy chain peak8. The annealing takes place with the area inside is not optimized in relation to the frequency of use� codons constant region HC.

5'-GAAGTAGTCCTTGACCAGG-3' (SEQ ID NO: 119)

RenVecDwnstrmLC: antisense primer, enable start sequence 3' from the variable regions in the plasmid for a33 light chain-xm-lc. The annealing takes place with the area inside is not optimized in relation to the frequency of use of codons constant region LC.

5'-GAAGATGAAGACAGATGGTGCAG-3' (SEQ ID NO: 120)

Upstrm Lonza: a conceptual primer, enable start sequence 5' from the variable regions in the vectors Lonza pEE and 12.4 6.4 pEE. It cannot be used with the combined plasmid Lonza, because in it there is a district-duplicate.

5'-CGGTGGAGGGCAGTGTAGTC-3' (SEQ ID NO: 121)

Dnstrm 6-4: antisense primer, enable start sequence 3' of the constant region in the vector Lonza 6.4 pEE

5'-GTGATGCTATTGCTTTATTTG-3' (SEQ ID NO: 122)

Dnstrm 12-4: antisense primer, enable start sequence 3' of the constant region in the vector Lonza pEE 12.4

5'-CATACCTACCAGTTCTGCGCC-3' (SEQ ID NO: 123)

Cod-Opt LC const E: semantic primer and the inner is rather optimized in relation to the frequency of use of codons of the constant region of the v-Kappa light chain

5'-CCATCCTGTTTGCTTCTTTCC-3' (SEQ ID NO: 124)

Cod-Opt LC const F: antisense primer and the inner is rather optimized in relation to the frequency of use of codons of the constant region of the v-Kappa light chain (vκ).

5'-GACAGGGCTGCTGAGTC-3' (SEQ ID NO: 125)

806HCspec: semantic primer, internal and unique d�I generowania variant HC variable regions 806.

5'-GTGCAGCTCCAAGAGAGTGGAC-3' (SEQ ID NO: 126)

806LCspec: semantic primer, internal and unique to generowania option LC variable regions 806.

5'-CAGAGTCCATCCAGCATGTC-3' (SEQ ID NO: 127)

Formatted GenBank text document related to the sequence of the plasmid 8C65AAG encoding hu806 in the form of IgG1, and annotations thereto, is shown in Fig. 64.

Fig. 53 was created using vector NTI (Invitrogen).

Fig. 59-62 were created using vector NTI AlignX.

Discussion

Generowanie antibody 806 against the EGF receptor included mutating 14 amino acids in the VH (Fig. 59 and Fig. 62) and 12 changes in VL-region (Fig. 60 and Fig. 61) with optimization regarding the frequency of use of codons, as indicated, for expression in mammalian cells CHO or NS0. The final sequence of the vector with two genes, named 8C65AAG, was verified, and checked coding sequence and resulting from its broadcast sequence. Binding to recombinant extraclean domain of EGFR was confirmed by Biacore analysis using transiently expressed product hu806.

Stable single clones producing high levels of intact hu806 antibody, were selected in medium without glutamine, as recommended by LONZA. Stable clones gradually wean from the serum to obtain passionato�'s cultures.

B.In vitro andin vivofeature hu806

In the future, were created more high producing, stable GS-CHO hu806-transfectant 14D8, 15B2 and 40A10 and GS-NSO hu806-transfectant 36, and initiated small-scale culture to allow pre-treatment and product features in the form of hu806. The results indicated a similar physico-chemical properties. Therefore, it was made vysokololtnoe cultivation in a mixing tank (15 l) of transfectant with the highest products (GS-CHO hu806 40A10), and subjected to purification the product was subjected to an additionalin vitrocharacterization andin vivotherapeutic research models using U87MG xenografts.de2-7 and A431.

The methodology and results

Production and further processing

Small-scale products

Experiments have been performed using the shake flasks E500 components with 100 ml volume of cell culture. Fig. 76 presents the cell viability and graphics production of antibodies to four transfectants during cultivation. The product concentration was determined using ELISA, using idiotypic (anti-806) antibody LMH-12 (Liu et al. (2003) Generation of anti-idiotype antibodies for application in clinical immunotherapy laboratory analyses. Hybrid Hybridomics. 22(4), 219-228) as the antibody for coating and ch806 (clinical series: J06024 as standard. The material at the time of collection was subjected to centrifugation, and the supernatant was subjected to filtration through a filter with a pore size of 0.2 μm, and then the antibodies were subjected to affinity purification using chromatography using protein A.

Vysokomytska products

Cell line-transfectant CHO-K1SV expressing hu806, - clone-candidate 40A10 were cultured in a bioreactor and mixing VAT with 15 l with dose supply of glucose for 16 days using CD-CHO (Invitrogen)/25 µm L-methionine, sulfoximine (MSX; Sigma)/GS-Supplement (Sigma) as the main media. Fig. 76C shows growth of cells and volume production in a bioreactor-a mixing VAT to 15 L. the Final yield was 14.7 per liter at a concentration of 58 mg/l, determined using ELISA.

The material at the time of collection was subjected to centrifugation, and the supernatant was subjected to filtration through a filter with a pore size of 0.2 μm, and then was concentrated to 2 l using 2 membranes with a nominal cut off molecular weight of 30 kDa in the hub Pall Centrimate. Subsequently, aliquots (4×500 ml) was added with 250 ml column of protein a, and elution was performed using 50 mm citrate buffer, pH 4.5, containing 200 mm NaCl. Subjected to elution based on the 4 chromatography antibody were then pooled, concentrated and dialyzed against PBS, pH 7,4.

The number of products in the form of hu806, Paul�derived from small - and vysokomarzhinalnyh of kultivirovanii, was determined by OP nm. Samples of antibody-eluted with recombinant protein A, was evaluated using gel filtration (SEC) (small-scale, Fig. 77; large-scale, Fig. 78), electrophoresis in 4-20% page in Tris-glycine buffer with SDS in regenerating and Sevostyanova conditions (Fig. 79-81), and was performed isoelectrofocusing system Amersham Multiphor II Electrophoresis in the plate Ampholine PAG (pH 3.5 to 9.5) according to the manufacturer's instructions (Fig. 82).

Subjected to affinity purification using protein And hu806 antibody showed a symmetrical protein peak and the elution profiles with the SEC, identical to those in the clinical control of substances ch806. Pictures of the gels after electrophoresis in SDS-page were in accordance with those of immunoglobulin. Picture after IEF indicated three isoforms with pI ranging from 8.66 roubles to of 8.82, which corresponded to calculated for protein sequences pI, amounting to 8.4.

Analyses of the binding

Analysis by FACS

Measuring the concentration of antibodies, specific for each sample by OP nm, was used for analyses by FACS using cell line A431 adenocarcinoma (with EGFR gene amplification). The authors of the present invention previously found that math is associated with approximately 10% of ~2×106EGFR wild type, represented by n� the surface of tumor cells A431, compared to specific for EGFR wild-type Mat (Johns et al. (2002) Novel monoclonal antibody specific for the de2-7 epidermal growth factor receptor (EGFR) that also recognizes the EGFR expressed in cells containing amplification of the EGFR gene. Int. J. Cancer. 98(3), 398-408). The cells were subjected to staining with either one of the four samples hu806, irrelevant IgG2b antibody, ch806 or as a positive control, each in accordance with the assessment at a concentration of 20 μg/ml was Also included controls for only the second antibody [anywhereman with FITC goat antibody against human IgG (Fc-specific)]. Total binding curves in the analysis by FACS is shown in Fig. 83 and demonstrate equivalent staining in the case of all components.

Using FACS were also identified characteristics of binding of the cells of the sample hu806 40A10 obtained by visakapattanam culturing, the cells A431 and U87MG glioma cells.de2-7 expressing receptor variant EGFRvIII (Johns et al., 2002). Representative results of analyses in the two repeats is shown in Fig. 84 and Fig. 85, respectively. Controls included an irrelevant IgG2b antibody (shaded histogram), ch806 or 528 (associated with EGFR wild-type and de2-7 EGFR), as indicated.

ch806, and hu806 antibody showed a similar staining of cell lines A431 and U87MG.de2-7, confirming previous observations of the authors of the present Fig�t, that b806 specifically recognizes the de2-7 EGFR and a subset expressed EGFR (Luwor et al. (2001) Monoclonal antibody 806 inhibits the growth of tumor xenografts expressing either the de2-7 or amplified epidermal growth factor receptor (EGFR) but not wild-type EGFR. Cancer Res. 61(14), 5355-5361). As expected, the antibody 528 stained both cell lines U87MG.de2-7 and A431 (Fig. 84 and 85).

The binding assays with cells

Ability radioimmunoconjugates to the binding to the antigen was assessed using analysis of cellular absorption (Lindmo et al. (1984) Determination of the immunoreactive fraction of radiolabeled monoclonal antibodies by linear extrapolation to binding at infinite antigen excess. J. Immunol. Methods. 72(1), 77-89) using lines of glioma U87MG cells.de2-7 cells and A431 epidermoid cancer expressing amplificatory geneEGFR.

Immunoreactive fractions radioimmunoconjugates based hu806 and ch806 was determined by binding with expressing the antigen by the cells in the presence of excess antigen. Fig. 86A presents the results of a binding125I-hu806 and125I-ch806 with U87MG cells.de2-7 at concentrations of cells of 20×106to 0.03×106cells/sample. Fig. 86B presents the results of a binding125I-hu806 and125I-ch806 with A431 cells at concentrations of cells from 200×1060.39×106cells/sample.

Analyses of Scatchard was used to calculate Association constants (K(a) (Lindmo et al., 1984). Linking low levels(20 ng) of labeled antibody itself was compared to its binding in the presence of excess unlabeled antibody. The immunoreactive fraction was taken into account when calculating the number of free, reactive antibodies, as described previously (Clarke et al. (2000)In vivobiodistribution of a humanized anti-Lewis Y monoclonal antibody (hu3S193) in MCF-7 xenografted BALB/c nude mice. Cancer Res. 60(17), 4804-4811), and built a graph of the concentration of specifically bound Mat (nm; total antibody concentration × % bound fraction) the relationship specifically associated Mat/reactive free Mat (Fig. 87 and 88). The Association constant was determined on the basis of the negative slope of a line.

The binding affinity in the case of binding125I-hu806 with EGFRvIII in U87MG cells.de2-7, as defined, is 1.18×109M-1. Ka125I-ch806 was 1.06×109M-1. These data are consistent with published results concerning the values ofKa for111In - and125I-ch806, components of 1.36×109M-1and of 1.90×109M-1accordingly, in a high degree commensurate with the value of Ka for source mouse Mat, amounting to 1.1×109M-1(Panousis et al. (2005) Engineering and characterization of chimeric monoclonal antibody 806 (ch806) for targeted immunotherapy of tumours expressing de2-7 EGFR or amplified EGFR. Br. J. Cancer. 92(6), 1069-77).

Analysis of Scatchard on A431 cells showed binding with high affinity both designs 806 with a small amount of EGFR in these cells. Ka125I-ch806 was 0.61×109M-1and for125I-hu806Ka=0,28×10 9M-1.

Analysis using biosensor

The analyses using the biosensor were performed in a BIAcore biosensor 2000 using covered carboxymethylcysteine sensor chip (CM5). Channel 3 chip was subjected to derivatization with the containing the epitope peptide 806 (amino acids 287-302 EGFR; SEQ ID NO: 14; see application for U.S. patent No. 11/060646, filed February 17, 2005; provisional application for U.S. patent No. 60/546602, filed February 20, 2004; and provisional application for U.S. patent No. 60/584623, filed July 1, 2004, all of which are included, thus, in their entirety), using a standard chemotherapy combination with amines. Channel 2 was subjected to derivatization with control antigen used to determine system suitability. Channel 1 was subjected to derivatization with ethanolamine and used as a blank control channel for the amendment of the effects on the index of refraction. Samples hu806 was diluted in HBS buffer (10 mm HEPES, pH of 7.4; 150 mm NaCl; 3.4 mm di-Na-EDTA; 0.005% of Tween-20), and aliquots (120 μl) containing 50 nm, 100 nm, 150 nm, 200 nm, 250 nm and 300 nm, were injected with a deletion on the surface of the sensor chip at a flow rate amounting to 30 μl/min After the injection phase followed by dissociation under the action of the current on the chip surface of the buffer HBS within 600 sec. �knitted antibody was subjected to elution, and chip surface was regenerated between injections of the samples by injection of 20 µl of 10 mm solution of sodium hydroxide. Was included as positive control, ch806. Binding parameters were determined using the model of equilibrium binding BIAevaluation software. Fig. 89 presents received sensogram.

Dose-dependent binding was observed using as hu806 and positive control, ch806, in the channel 3. System suitability was confirmed by the dose-dependent binding of the appropriate monoclonal antibody with the control channel 2. Cross-reactivity was observed between hu806 (or ch806) and control antibody. In these tests it was found that the apparent KD(1/Ka) is 37 nm for hu806 and 94 nm in the case of ch806.

Analyses of antibody-dependent cretaceouspaleogene cytotoxicity

The ADCC assays were performed using purified preparation hu806 antibody 40A10 together with the target cells A431 adenocarcinoma and effector cells in freshly isolated mononuclear cells from peripheral blood of healthy donors. In short, all the tests were repeated three times 1) using 1 µg/ml of each antibody in a range of cells-effectors/target cells (E:T=0,78:1 - 100:1), and 2) at E:T=50:1 in the range of concentrations of each antibody (3,15 ng/ml - 10 �kg/ml). Three repetitions were included controls on the isotype of the antibody, spontaneous and General cytotoxicity, and calculations of specific cytotoxicity was performed as described previously (Panousis et al., 2005). The results are presented in Fig. 90.

hu806 repeatedly demonstrated activity in ADCC, which was better than the one in the case of chimeric ch806 IgG1. In a representative experiment showed that using hu806 at a concentration of 1 µg/silt ADCC was achieved, amounting to 30% of cytotoxicity, unlike achieved by ch806 5% cytotoxicity.

In vivotherapeutic research 806

Therapeutic efficacy hu806 investigated, rooted using xenograft cells A431 adenocarcinoma or glioma cells U87MG-de2-7 in Nude thymus of mice BALB/c. To generate xenografts, the mice were injected subcutaneously in the right and left mamillary line of the inguinal region is 1×106cells A431 adenocarcinoma or 1×106glioma U87MG cells.de2-7 in 100 µl PBS. Tumor volume (TV) was calculated by the formula [(length×width2)/2], where the length represented the longest axis and width the measurement at right angles relative to the length. In the initial experiment, groups of five Nude thymus of mice BALB/c (n=10 tumors/group) with established A431 xenograft or U87MG.de2-7 were treated with 1 mg hu806, or 1 mg of anti�La ch806, or carrier PBS as a control by intraperitoneal injection. Treatment was administered on days 6, 8, 11, 13, 15 and 18 in the case of cell line A431 and days 4, 6, 8, 11, 13 and 15 in the case of cell line U87MG.de2-7, respectively. The volumes of tumors in the form of mean values ± standard deviation prior to the completion of the experiments for ethical reasons against tumor mass is shown in Fig. 91 for xenotransplantation A431 until day 25 and Fig. 92 for xenotransplantation U87MG.de2-7 to 31 days.

Evaluation ofin vivotherapy using hu806 showed an obvious reduction in growth xenotransplanted A431 compared with treatment with medium PBS as a control. Growth curve xenotransplanted A431, installed in the case hu806, was comparable to a high degree with that of the treatment groups ch806. Subjected to treatment with control (PBS group mice with established U87MG xenograft.de2-7 was subjected to euthanasia on day 20. Treatment hu806 demonstrated a significant decrease in tumor growth by day 20 compared with the control PBS treatments (P<0.001) and continued slowing of tumor growth after 20 days, and in the group subjected to treatment ch806.

Discussion

Subjected to affinity purification using protein And hu806 antibody showed elution profiles with the SEC, identical to those in the clinical control of substances�and ch806, and pictures of the gels after electrophoresis in SDS-page in accordance with those of immunoglobulin. Picture after IEF is in accordance with the expected pI, amounting to 8.4.

In continuation of the analysis of Scatchard cellular binding and epitope analysis of binding using biosensor hu806 antibody demonstrated binding curves and parameters of affinity, highly comparable to those of antibody ch806. Affinity binding hu806 and ch806 with EGFRvIII and expressed EGFR wild type were similar and were in the low mu range. Binding to cells, as determined by analysis by FACS confirmed these observations.

In addition, hu806 demonstrated significantly increased ADCC compared with the design of ch806 in relation to antigen-positive cells A431 - targets.

Evaluation ofin vivotherapy using hu806 showed an obvious reduction in growth xenotransplanted A431, which was comparable to a high degree with those in the group subjected to treatment ch806. In models with the usages rooted U87MG xenografts.de2-7 treatment hu806 demonstrated a significant decrease in tumor growth by day 20 compared with the control treatment of PBS and continued slowing of tumor growth after 20 days, and in the group subjected to treatment ch806.

Example 23

Mon�clonal antibody 175

As discussed in example 1, clone 175 (IgG2a) was selected to define additional characteristics.

Materials and methods:

Cell line

Transfetsirovannyh Δ2-7EGFR cell line U87MG.Δ2-7 (Huang et al. (1997) J. Biol. Chem. 272, 2927-2935) and A431 (Ullrich et al. (1984) Nature. 309, 418-425) have been described previously. Cell line hormone carcinoma of the prostate DU145 (Mickey et al. (1977) Cancer Res. 37, 4049-4058) was obtained from ATCC (atcc.org).

All cell lines were maintained in DMEM (Life Technologies, Grand Island, NY) supplemented with 10% FCS (CSL, Melbourne); 2 mm glutamine (Sigma Chemical Co., St. Louis) and penicillin/streptomycin (Life Technologies, Grand Island). Besides cell line U87MG.Δ2-7 was maintained in the presence of 400 mg/ml geneticin (Life Technologies, Inc., Grand Island). Cell line BaF/3 (Palacios et al. (1984) Nature. 309, 126-131) and BaF/3 expressing great EGF receptors (Walker et al. (2004) J. Biol. Chem. 2(79), 22387-22398), usually supported in the medium RPMI 1640 (GIBCO BRL), supplemented with 10% fetal calf serum (GIBCO BRL) and 10% conditioned medium WEHI-3B (Ymer et al. (1985) Nature. 19-25; 317, 255-258) as a source of IL-3. All cell lines were grown at 37°C in an atmosphere of air/CO2(95%-5%).

Antibodies and peptides

Mat and mAb175 were created at the Ludwig Institute for Cancer Research (LICR) New York Branch and were produced and purified in a Biological Production Facility (Ludwig Institute for Cancer Research, Melbourne). As an immunogen used was a line NR6 mouse fibroblastsΔEGFR. Murine hybridomas was� created by five-time subcutaneous immunization of mice BALB/c components with 2-3 weeks intervals using a 5×10 5- 2×106cells in adjuvant. For the first injection was used complete adjuvant freind. Later it was used incomplete adjuvant freind (Difco). Cells spleens of immunized mice were fused with cells of the mouse myeloma SP2/0. The supernatants of the newly created clones were subjected to screening in the analysis of hemadsorption on reactivity with the cell line NR6, NR6wtEGFRand NR6ΔEGFRand then analyzed using analyses of hemadsorption using cell lines human glioblastoma U87MG, U87MGwtEGFRand U87ΔEGFR.

Intact Mat (50 mg) was subjected to cleavage in PBS with activated papain for 2-3 hours at 37°C in a ratio of 1:20, and papain inactivated by iodization. The cleavage product is then passed through a column of separate protein a (Amersham) in 20 mm nutrifaster buffer pH of 8.0, with no further bound material was subjected to purification using cation exchange chromatography column (Mono S (Amersham). Then the protein was concentrated using a centrifugal concentrator with a nominal cut off molecular weight of 10,000 Da (Millipore). For the formation of complexes of Fab-peptide directly to Fab was added in a molar excess of lyophilized peptide and incubated for 2 hours at 4°C before crystallization studies.

Mapping of epitopes for mats fragments of EGFR, expressed in mammalian cells

The day before transfection, these fragments of the fibroblasts of the human newborn kidney 293T were seeded with a density of 8×105per well in 6-well plates for the cultivation of tissues containing 2 ml of medium. Cells were transfusional 3-4 μg of plasmid DNA formed a complex with lipofectamine 2000 (Invitrogen) according to manufacturer's instructions. 24-48 h after transfection of culture cells aspirated and cell monolayers were literally in 250 ál of buffer for lysis (1% Triton X-100, 10% glycerol, 150 mm NaCl, 50 mm HEPES pH 7,4, 1 mm EGTA, and a mixture of all inhibitors of protease (Roche)). Aliquots of cell lysate (10-15 ml) was mixed with the SDS sample buffer containing 1.5% β-mercaptoethanol, subjected to denaturation by heating for 5 min at 100°C and subjected to electrophoresis in 10% polyacrylamide gels in bis-Tris buffer NuPAGE (Invitrogen). Then the samples were subjected to electromigration onto nitrocellulose membranes, which were washed in the buffer CORRESPONDENT (10 mm Tris-HCl, pH 8,0, 100 mm NaCl and 0.1% Tween-20) and blocked in CORRESPONDENT containing 2.5% skim milk for 30 min at room temperature. Membranes were incubated overnight at 4°C with 0.5 μg/ml met in the buffer to block. Parallel membranes were probed overnight using Mat 9B11 (1:5000, Cell Signaling Technology, Danvers, Massachusetts) for the detection of epic�PA c-myc. Membranes were washed in CORRESPONDENT and incubated in the buffer for the block containing anywhereman with horseradish peroxidase rabbit antibody against mouse IgG (Biorad) diluted 1:5000 for 2 h at room temperature. Then the blots were washed in CORRESPONDENT and showed, using film for inspection, after incubation with the chemiluminescent substrate for Western Pico (Pierce, Rockford, Illinois).

Mapping of epitopes for Mac using fragments of EGFR, expressed in mammalian cells and yeast

A number of overlapping labeled c-myc fragments of ectodomain EGFR, beginning with residue 274, 282, 290 and 298 and ending in all cases, the amino acid 501 and merged with the growth hormone, has been described previously (Johns et al. (2004) J. Biol. Chem. 279, 30375-30384). Protein expression of EGFR on the surface of yeast cells was performed as previously described (Johns et al., 2004).

Briefly, transformed colonies were grown at 30°C in minimal media containing the basis of nitrogen agar for yeast, casein hydrolysate, dextrose, and phosphate buffer pH 7,4, on a rocking platform for about one day to achieve OP600=5-6. Then carried out the induction of representations of proteins yeast cells by transfer to minimal medium containing galactose and incubated with shaking at 30°C for 24 h. Then the culture was stored at 4°C to EN�Lisa. Unpurified ascites fluid containing monoclonal antibody against c-myc 9E10 was obtained from Covance (Richmond, CA). 1×106yeast cells were washed with cold as ice in FACS buffer (PBS containing 1 mg/ml BSA) and incubated with either ascites containing the antibody against c-myc (diluted 1:50) or with a monoclonal antibody against human EGFR (10 μg/ml) in a final volume of 50 μl for 1 h at 4°C. Then cells were washed with cold as ice in FACS buffer and incubated with labeled phycoerythrin antibody against mouse IgG (diluted 1:25) in the final volume of 50 μl for 1 h at 4°C, protected from light. After washing the yeast cells with cold as ice in FACS buffer on the fluorescence data were obtained using a flow cytometer Coulter Epics XL (Beckman-Coulter) and analyzed using software for cytometric data, (J. Trotter, Scripps University). To identify linear epitopes in comparison with the conformational epitopes of the yeast cells were heated at 80°C for 30 min, then cooled on ice for 20 min prior to labeling with antibodies. A number of EGFR mutants listed in table 7, have been described previously (Johns et al., 2004).

Surface plasmon resonance (BIAcore)

In all experiments we used BIAcore 3000. Peptides containing the presumed epitope for Mac, immobilizovana on sensor chip CM5 using �a combination with amines, thiols or Pms, at a flow rate of 5 ál/min (Wade et al. (2006) Anal. Biochem. 348, 315-317). Mat and Mat passed across the sensor surface at a flow rate of 5 μl/min at 25°C. the Surface was regenerated between injections of antibodies by injection of 10 mm HCl at a flow rate of 10 μl/min.

Immunoprecipitation and Western blotting

Cells were literally using lysis buffer (1% Triton X-100, 30 mm HEPES, 150 mm NaCl, 500 mm 4-(2-aminoethyl)benzolsulfonat, 150 nm Aprotinin, 1 mm protease inhibitor E-64, 0.5 mm EDTA and 1 mm leupeptin) for 20 minutes, clarified by centrifugation at 14000×g for 30 minutes, subjected to immunoprecipitation relevant antibodies at a final concentration of 5 μg/ml, for 60 minutes and capture the granules separate-And during the night. Then the samples were suirable 2X sample buffer with SDS NuPAGE (Invitrogen), were separated in NuPAGE gels (or 3-8% or 4-12%), was subjected to electromigration on the membrane to transfer Immobilon-P (Millipore), and then probed using relevant antibodies prior to detection using the chemiluminescent testing.

Immunohistochemical analysis

Frozen sections were subjected to staining with 5 μg/ml Mat or irrelevant matching isotype control antibodies for 60 min at room temperature. Bound antibody was detected with IP�altanium system to identify Dako Envision+ HRP according to the manufacturer's instructions. Finally, the sections were washed with water, and subjected to contrast staining with hematoxylin and mounted.

The model using xenografts

The U87MG cells.Δ2-7 (3×106) in 100 ml of PBS was inoculable subcutaneously in both flanks of female Nude thymus of mice aged 4-6 weeks (Animal Research Centre, Perth, Australia). All studies were conducted using models-seated tumors, as previously reported (Perera et al. (2005) Clin. Cancer Res. 11, 6390-6399). Treatment was started when the average volume of tumors reached the value specified in the caption to the corresponding figure. Tumor volume in mm3was determined, using the formula (length × width2)/2, where length was a longest axis and width the measurement at right angles relative to the length. Data were presented as the average volume of tumors ± standard error for each subject in the treatment group. All data were analyzed for significance using one-sided student test, where p<0.05 was considered statistically significant. This research project was authorized by the Commission on the issue of the ethical treatment of animals Austin Hospital.

Establishment and characterization of stable cell lines expressing constructs of mutant EGFR

Mutations in EGFR wild-type were created using a kit for site-directed mutagenesis (Stratagene, La Jolla, CA). In case� each mutation matrix served cDNA for human EGFR (incoming number x00588) (Ullrich et al. (1984) Nature. 309, 418-425). Performed automated nucleotide sequencing of each construct to confirm the safety of EGFR mutations. EGFR wild-type and mutant (C173A/C281A) EGFR was transfusional in cells BaF/3 by electroporation.

Stable cell lines expressing mutant EGFR, obtained through selection in containing neomycin environment. After the final selection mRNA was isolated from each cell line was subjected to reverse transcription, and sequencing for EGFR were amplified by PCR. All mutations in a murine EGFR was confirmed by sequencing of PCR products. The expression level of EGFR was determined using analysis using FACS in FACStar (Becton and Dickinson, Franklin Lakes, NJ) using an antibody against the EGFR - Mut (Masui et al. (1984) Cancer Res. 44, 1002-1007; Gill et al. (1984) J. Biol. Chem. 259, 7755-7760) at a concentration of 10 μg/ml in PBS, 5% FCS, 5 mm EDTA, and then labeled with Alexa 488 antibody against mouse Ig (final dilution 1:400). Background fluorescence was determined by incubation of cells with irrelevant, matching the class of the first antibody. All cells were usually passively in RPMI, 10% FCS, 10% conditioned medium WEHI3B and 1.5 mg/ml G418.

EGF-dependent activation of mutant EGFR

Cells expressing EGFR wild-type or C271A/C283A-EGFR, washed and incubated for 3 h in medium without serum or IL-3. The cells were collected by�m centrifugation and were resuspended in the medium, containing EGF (100 ng/ml) or equal volume of PBS. Cells were collected after 15 min, precipitated and subjected to lysis directly in sample buffer, subjected to electrophoresis in SDS-page containing β-mercaptoethanol. Samples were separated in 4-12% gradient NuPAGE gels, transferred to PVDF membrane Immobilon and probed using antibodies against phosphotyrosine (4G10, Upstate Biotechnologies) or antibodies against EGFR (Mat provided in LICR). Reactive bands were detected using chemiluminescence.

The effect of EGF and antibodies on cell proliferation

Cells in logarithmic growth phase were collected and washed twice with PBS to remove residual IL-3. The cells were resuspended in RPMI 1640 plus 10% FCS and seeded in 96-well plates with a density of 105cells/well only with the carrier or with increasing concentrations of EGF. According to circumstances, cultures have also added a constant concentration Mat or Mat (2 μg/well). Proliferation was determined using an analysis based on the MTT (van de Loosdrecht et al. (1994) J. Immunol Methods. 174, 311-320).

Reactivity with antibodies specific against conformational epitopes

The cells were collected by centrifugation and subjected to staining of the control and test antibodies (in all cases at a concentration of 10 μg/ml in FACS buffer for over 40 minutes on ice, washed with buffer d�I FACS), and then labeled with Alexa 488 antibody against mouse Ig (in a final dilution of 1:400 for 20 min on ice). Cells were washed with cold as ice buffer for FACS, collected by centrifugation and analyzed in a FACScan; for each sample was determined by the maximum channel fluorescence and the median fluorescence using statistical method of the program Cell Quest (Becton and Dickinson). Of all the definitions subtracted the background fluorescence (negative control). The median values of fluorescence were selected as creating a better sense of the shape of the peak and the fluorescence intensity was used to obtain a relationship linking Mat:linking Mat.

Determining crystal structures Fab175 and Fab806, complexes of Fab-peptide and determined in solution using NMR structure of the epitope-based peptide for 806

The structure was determined by molecular replacement and refinement to an R-factor=0,225/Rfree=0,289 for Fab806 and R-factor=0,226/Rfree=0,279 for Fab806:peptide; R factor=0,210/Rfree=0,305 for Fab806 and R-factor=0,203/Rfree=0,257 for Fab806:peptide.

Crystals of the Fab 806 natural grown by pinching the diffusion of steam into the drop, using 10 mg/ml Fab and a reservoir containing 0.1 M nitroacetate buffer pH 4,6, 6-8% PEG 6000 and 15-20% isopropanol. For data collection crystals were transferred to cryoprotectant solution containing 0.1 M nitroacetate Boothe�R pH 4,6, 10% PEG 6000, 15-20% isopropanol and 10% glycerol. The crystals are inserted in a frame of nylon and quickly frozen directly in liquid nitrogen.

Crystals of the complex 806 Fab-peptide were grown by pinching the diffusion of steam into the drop, using 10 mg/ml of the complex of Fab-peptide and a reservoir containing 0.2 M ammonium acetate, 16-18% PEG 5000 monomethylether, the crystal quality was then improved through the means of depositing the seed. For data collection crystals were transferred to cryoprotectant solution composed of solution tank, supplemented with 25% glycerol. The crystals are inserted in a frame of nylon and quickly frozen directly in liquid nitrogen.

Crystals of the complex of 175 Fab-peptide were first grown using the free diffusion between phases, using the system for crystallization of Topaz (Fluidigm, San Francisco). The microcrystals were grown by pinching the diffusion of steam into the drop, using 7 mg/ml Fab, using similar conditions: 0.1 M Bis-Tris propane buffer, 0.2 M ammonium acetate and 18% PEG 10000. Then carried out the improvement of the microcrystals by making priming in the form of a strip in 0.15 M format of sodium and 15% PEG 1500 to get a small plate-like crystals. For data collection crystals were transferred to cryoprotectant solution composed of solution tank, supplemented with 25% glycerol. Crystals �amounting in the frame of nylon and quickly frozen directly in liquid nitrogen.

Data on diffraction in crystals 806 Fab and complex 175 Fab-peptide were collected on their own, using the detector R-AXIS IV in the generator Rigaku Micromax-007, are equipped with optical systems AXCO, this data is then processed using CrystalClear. Data on diffraction in crystals of the complex 806 Fab-peptide were collected in the detector ADSC quantum315 through the CCD channel synchronous radiation X29, Brookhaven National Laboratory, these data were then processed using HKL2000 (Otwinowski, Z. and Minor, W. (1997) Processing of X-ray diffraction data collected in oscillation mode. Academic Press (New York)) (statistics of data collection are presented in table 9). Resolution Fab patterns 806 natural carried out by molecular replacement using the program MOLREP (Vagin, A. and Teplyakov, A. (1997) J. Appl. Cryst. 30, 1022-1025), using the coordinates of the structure of the Fab 2E8, the structure refinement was performed in REFMAC5 (Murshudov et al. (1997) Acta crystallographica 53, 240-255) and model building in COOT (Emsley, P. and Cowtan, K. (2004) Acta crystallographica 60, 2126-2132).

The resolution of structures as complex 806 Fab-peptide and the complex of 175 Fab-peptide was performed by molecular replacement using the program MOLREP using the coordinates of the structure 806 Fab, refinement and reconstruction again performed in REFMAC5 and COOT and validation of the final structures was performed using PROCHECK (Laskowski et al. (1993) J. Appl. Cryst. 26, 283-291) and WHATCHECK (Hooft et al. (1996) Nature 381, 272).

Studies using NMR

For issledovaniy using NMR labeled with 15N peptide was obtained recombinate in the form of a merger with SH2-domain of SHP2 using the method previously described by Fairlie et (Fairlie et al. (2002) Protein expression and purification 26, 171-178), except thatE. coligrew up a minimal environment Neidhardt supplemented15NH4Cl (Neidhardt et al. (1974) Journal of bacteriology 119, 736-747). The peptide was tsalala from the ground floor whilst using CNBr, was purified by using HPLC with reversed phase, and its identity was confirmed using MALDI-TOF mass spectrometry and N-terminal sequencing. The methionine residue in binding to the antibody 806 sequences were subjected to mutation with a substitution of a leucine to create the possibility of detachment from the binding partner, but not within the peptide.

Used for research using NMR samples were prepared in an aqueous solution containing 5%2H2O, 70 mm NaCl and 50 mm NaPO4at a pH of 6.8. All spectra were obtained at 298K in a Bruker Avance500 using the cryoprobe. Subsequent assignment to the peptide in the absence of Fab Mat carried out using standard 2D TOCSY and NOES spectra, as well as adjusted15N TOCSY and NOESY spectra. The interaction between the peptide and Fab806 explored through tracking15N HSQC spectra of the peptide in the absence and in the presence of Fab806. Deviation15N HSQC spectra of the peptide in the presence Fab806 is a clear sign that �eptid was able to bind with Fab806 in terms of a solution. The detailed structure of the peptide in the form of the complex is not defined. Deviations from the values of chemical shift in a random spiral for Mat-peptide is shown in Fig. 93.

Bioespeleo chAb806 patients

To demonstrate specificity for tumors Matin vivochimeric variant (ch806) was designed and produced in the terms of use cGMP (Panousis et al. (2005) Br. J. Cancer. 92, 1069-1077). Held for the first time in humans the test phase I was undertaken to determine the safety, bearsdley and immune response to ch806 in patients with positive for reactivity with 806 tumors, and the results of determination of safety, bearsdley and pharmacokinetics reported previously (Scott et al. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 4071-4076). To determine the specificity of ch806 to the tumor compared with normal tissue (e.g., liver) in patients was performed a quantitative analysis of absorption ch806 tumor and liver by calculating the % of injected dose (ID)111In-ch806 on the basis of images of the whole body obtained in gamma camera for one week after the injection of 5-7 MCI (200-280 MBq)111In-ch806. Dosimetric calculations in the liver and tumors performed on the basis of interest areas of each individual patient. The data set in the form of images after infusion111In-ch806, corrected for background and attenuation, allowing�Il calculate the cumulative activity. Dosimetry calculation was performed to derive the concentration of111In-ch806 in tumor and liver during a one-week period after the injection.

b. Sequencing

That sequenced the variable region of the heavy chain (VH) and variable region light chain (VL) Mat, and they identified the complementarity determining areas (CDR) as shown below:

VH-region met: a nucleic acid sequence (SEQ ID NO: 128) and amino acid sequence (SEQ ID NO: 129) is shown in Fig. 74A and 74B, respectively. Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 130, 131 and 132, respectively) are shown underlined in Fig. 74B.

VL-region met: a nucleic acid sequence (SEQ ID NO: 133) and amino acid sequence (SEQ ID NO: 134) shown in Fig. 75A and 75B, respectively. Defining complementarity sites CDR1, CDR2 and CDR3 (SEQ ID NO: 135, 136 and 137, respectively) are shown underlined in Fig. 75V.

Data relating to the sequence Mat, based on data sequencing and data determination of the crystal structure, since the cell line is clonal, and therefore the set of sequences was obtained from this cell line. Sequence Mat, presented above, were confirmed by crystal structure and�sight are also noted for one amino acid in each of CDR1 and CDR2 VL-region from the previous sequences, based only on data relating to standard sequences. Was also received excellent isotype Mat (unusual isotype IgG2a), based on the final data concerning sequences and crystal structures.

Specificity Mat

Preliminary studies of binding given the opportunity to assume that Mat manifests specificity against EGFR, similar to that Mat. The amino acid sequence of CDR-plots Mat (IgG2b) and Mat (IgG2a) are nearly identical, with a difference only in one amino acid in each of the three CDR (Fig. 65; see example 26 below). If all three differences between the stored charge and the size of the side chains. Obviously, these antibodies have arisen independently.

c. Experiments

A number of experiments using immunohistochemical analysis was performed to analyze the specificity of binding Mat. Mat colors the slices A431 xenografts, which sverkhekspressiya EGFR (Fig. 66A) and sections of the xenograft glioma U87MG cells.Δ2-7, which Express Δ2-7EGFR (Fig. 66A). In contrast Mat not stain sections of U87MG xenografts. Cell line U87MG expresses only at medium levels of EGFR wild type (Fig. 66A), with no detectable autocrine loop involving EGFR. The most important thing Mat not associated with sections of normal PEC�and humans (Fig. 66B). Thus, Mat seems demonstrated the same specificity as Mat, i.e. it detects and expressed truncated human EGFR, but not EGFR wild type, expressed at medium levels.

Identification of the epitope for Mac

Because Mat also associated with Δ2-7EGFR from where deleterows amino acids 6-273, and EGFR1-501the epitope for Mat must be contained within residues 274-501. When determining the epitope for Mat the authors of the present invention expressively the number of labeled c-myc fragments of the EGFR fused to the carboxyl end of GH (growth hormone), ending in all cases, the amino acid 501 (Chao et al. (2004) J. Mol. Biol. 342, 539-550; Johns et al. (2004) J. Biol. Chem. 279, 30375-30384).

Mat also reacted with both fragments 274-501 and 282-501 EGFR in a Western blot, but not identified fragments that begin with amino acid 290 or 298 (Fig. 73). The presence of all fusion proteins GH-EGFR was confirmed using an antibody against c-myc, 9EI0 (Fig. 73). Therefore, an important determinant of the epitope for Mac is located at about amino acids 290. Finally, the piece 274-501 with the deletion of the EGF epitope for Mac (Δ287-302) was also negative in binding with Mat (Fig. 73), allowing to assume that this area is also exactly determined, mainly, by linking Mat.

To further characterize the epitope DL� Mat was used the second approach. Fragments covering extraclean domains of EGFR were expressed on the surface of yeast and tested for binding to met using direct immunofluorescence using flow cytometry. Mat recognize the yeast fragment 273-621 that corresponds extracticona domain Δ2-7 EGFR, but not the fragments 1-176, 1-294, 294-543 or 475-621 (Fig. 67A and Fig. 67B). Thus, at least part of the epitope for Mat must be contained within the region between amino acids 274-294 that is in accordance with the data of immunoblotting using EGFR fragments. Because Mat binds to denatured fragment 273-621 (Fig. 67C), the epitope must be linear in nature (Fig. 73). Obviously, math and math recognize the similar region and the conformation of EGFR.

Using surface plasmon resonance (BIAcore) investigated the binding Mat with EGFR peptide (287CGADSYEMEEDGVRKC302; SEQ ID NO: 138)). EGFR287-302was immobilized on the surface of the biosensor, using chemistry combination with amines, thiol-disulfide exchange or a combination of Pms-Ser. In the latter method, the immobilization of the peptide takes place exclusively via N-terminal cysteine (Wade et al. (2006) Anal. Biochem. 348, 315-317).

Mat was associated with EGFR287-302in all orientations (table 6). Affinely Mat to EGFR287-302ranged from 35 nm in the case of a combination of Pms-serine to 154 NIV the case of a combination with amines. In all cases, the binding affinity Mat with EGFR287-302was lower than the one established for Mat (table 6). The authors of the present invention have also determined the affinity Mat to two great extraclean EGFR fragments. Mat contacted the fragment 1-501 with affinity similar to that established when using the peptide (16 nm versus 35 nm) (table 6). As expected, the affinity Mat to 1 to 621 full extracticona domain, which can form autoinhibitory conformation, was much lower (188 nm). Although Mat and Mat have similar affinity to EGFR287-302, Mat appears, shows great affinity to extracticona domain of EGFR (table 6). It is obvious that the epitope for Mac contained in EGFR287-302and , like math, affinity of binding to extraclean domain of the EGFR is dependent on conformation.

Table 6
Definition by means of BIAcore affinely binding Mat and Mat with EGFR epitopes
The EGFR fragmentKDfor Mat (nm)KDfor Mat (nm)
287-302 (a combination of Pms-Ser)35 16
287-302 (combination with thiols)14384
287-302 (combination with amines)15485
1-501 (not able to create autoinhibitory)1634
1 to 621 (can create autoinhibitory)188389

To determine the ultrastructure of the epitope for Mac was used a set of mutants of the fragment 273-621 of EGFR expressed on the surface of yeast (Chao et al. (2004) J. Mol. Biol. 342, 539-550; Johns et al. (2004) J. Biol. Chem. 279, 30375-30384). Mat and Mat demonstrated an almost identical pattern of reactivity with the mutants (table 7). The destruction of disulfide bonds 287-302 had only a moderate effect on reactivity epitope as the antibody was associated with all the mutants in C287 and with some, but not all, mutants in C302 (table 7). Important for binding to met amino acids include E293, G298, V299, R300 and C302 (table 7). met seemed relatively more sensitive to mutations and V299 D297, but Mat also showed reduced binding with certain mutations in these sites (table 7). And again, the epitope for Mac seems JW�makes essentially the same epitope, the epitope recognized by Mat.

Efficiency Mat against tumor xenografts, induced Δ2-7EGFR or an autocrine loop that involves EGFR

Was investigatedin vivoantitumor activity Mat and Mat against glioma xenografts of U87MG cells.Δ2-7. The xenograft was allowed to take root within 6 days prior to treatment with antibodies (3 times a week for 2 weeks these days). At this time, the average volume of tumors was 100 mm3(Fig. 68A). Treatment Mat led to a decrease in the rate of overall growth of tumors compared with treatment with medium or Mat and was highly significant at day 19 after inoculation (P<0.0001 in comparison with control and P<0.002 in comparison with Mat) when the control group was sacrificed for ethical reasons. The average volume of tumors in this moment of time was 1530, 300 and 100 mm3for groups, the treated carrier, Mat and Mat, respectively (Fig. 68A), confirming the antitumor activity Mat against xenografts expressing Δ2-7EGFR.

But although U87MG cells Express approximately 1×105EGFR on the cell, Mat not able to recognize any surface EGFR and, not surprisingly, did not inhibitin vivothe growth of U87MG. In addition, these cells are not coexpress�irout any of the EGFR ligand. A study was conducted, is exhibited whether transiently EGFR epitope, and, therefore, can it be recognized Mat and Mat in cells with an autocrine loop involving EGFR. The cells of the prostate DU145 Express EGFR wild-type levels, similar to those set forth in U87MG cells, but unlike U87MG cells DU145 cells have amplification of the gene TGF-α and therefore demonstrate an autocrine loop involving the EGFR/TGF-α. As Mat and 806 are associated with DU145 cells, as determined by analysis using FACS (Fig. 68B), and both antibodies are capable of immunoprecipitating a small portion of the EGFR extracted from these cells (Fig. Below 68c). Both methods showed greater binding Mat, however, compared with Mat that binds to the L2 domain, Mat and Mat bind only a subset of the EGFR on the surface of these cells (Fig. 68B and Fig. Below 68c). Similar observations were obtained with the second line of prostate cancer cells (LnCap); (data not presented) or cell lines of the colon (LIM1215), both of which also have an autocrine loop involving EGFR (Sizeland, A. M. and Burgess, A. W. (1992) Mol. Cell Biol. 3, 1235-1243; Sizeland, A. M. and Burgess, A. W. (1991) Mol. Cell Biol. 11, 4005-4014). Obviously, math and math can recognize only a small proportion of the EGFR on the cells in the presence of an autocrine loop of stimulation.

P�since Mat and Mat communicate more effectively with EGFR, expressed in DU145 cells than in U87MG cells, a study was conducted to analyze the anti-tumor activity of these antibodies in the DU145 xenograft, the development of which takes place in the Nude thymus mice. The xenograft was allowed to take root within 18 days before the start of treatment (3 times a week for 3 weeks on the specified days). At this time, the average volume of tumors was 90 mm3(Fig. 68D). As Mat and Mat inhibited growth of DU145 xenografts. The control group was sacrificed on day 67, and it had an average volume of tumors constituting 1145 mm3compared to the 605 and 815 mm3for groups the treated Mat and Mat, respectively (p<0.007 to 0.02, respectively) (Fig. 68D).

Spatial structure of EGFR287-302in contact with Fab-fragments Mat and Mat

For understanding the molecular intricacies of how math and math can recognize EGFR in some, but not all conformations, were determined the crystal structure of the Fab-fragments of both antibodies in combination with oxidised epitope of EGFR287-302(at the resolution of 2.0 and 1.59 Å, respectively, Fig. 69A and 69B) and themselves (at resolution of 2.3 Å and 2.8 Å, respectively). In both cases, the structure of the Fab in the free form and in the complex were essentially the same, and a well-defined conformation of the peptide and the loop�'s plots CDR antibodies (Fig. 69). The epitope adopts a β-folded structure, wherein one face of the folded sheet is aimed at Fab, and V299 lies in the center of the antigen-binding site (Fig. 69C-E). Both ends of the epitope are exposed to solvent, which is consistent with the fact that these antibodies bind longer polypeptides.

Of the 20 residues of the antibody in contact with the epitope, between Mat and Mat there are only two substitutions (Fig. 65). In contact with the epitope residues Mat are S30, S31, N32, Y49, H50, Y91, F94, W96 light chain and D32 Y33, A34, Y51, S53, Y54, S55, N57, R59, A99, G100, R101 heavy chain; in contact with the epitope residues met residues are the same except for one difference in the sequence light chain, N30, and one difference in the sequence of the heavy chain, F33. EGFR287-302binds to Fab thanks to the close contacts between peptide residues 293-302, most of the contacts between residues 297 and 302. Only hydrogen bonds between main chain atoms of EGFR287-302and Fab are provided by residues 300 and 302 (Fig. 69F). The recognition sequence of the epitope occurs through the formation of hydrogen bonds between the residue E293 and side chains (H50 and R101 Fab), between D297 and side chains (Y51 and N57), R300 and side chains (D32) and K301 and side chains (Y51 and W96 through of water molecules). Hydrophobic contacts carried�Tsuda in G298, V299 and C302.

In crystals Fab806 and Fab175 backbone conformation epitope between 293 and 302 was essentially identical (standard deviation of 0.4 Å for the Cα atoms in these residues). Although bound by disulfide bond, N-end peptide (287-292) is not in contact substantially with any one nor with the other antibody structure, and conformation in this region differ. However, this segment in complex with Fab806 appears to be rather disordered. More interestingly, the conformation of the peptide EGFR287-302in contact with the antibodies is very closely related conformation of EGFR287-302observed in the skeleton autoinhibitory or neautoriziranom structures of EGFR (Li et al., 2005; Garrett et al., 2002). In the case of EGFR287-302from complex Fab175 standard deviation in Cα positions are equal to 0.66 and 0.75 Å, respectively (Fig. 69).

For further information about recognition of EGFR by antibodies Mat and Mat conformation15N-labeled, oxidized peptide EGFR287-302free and in the presence of 806 Fab, studied by NMR spectroscopy in solution (see "Materials and methods"). In the case of the free peptide resonances were determined and compared with those for random spirals. Essentially free peptide was taking random structure of the spiral, and not a beta pleated sheet observed in natural EGFR (Garrett et al. (2002) Cell 20; 110, 763-773).

After d�the Addendum Fab was observed by the shift of resonant frequencies. However, due to the weak signal resulting from a significant linear expansion after adding a Fab and successful crystallization of the complexes, the study of the structure of the complex Fab806-epitope in solution was not pursued further in the future. Despite this, it is clear that in the case of binding of the peptide with Fab-fragment Mat (or Mat) Fab, it appears that selects or induces a conformation of the peptide that corresponds to the conformation of the peptide in the natural receptor.

For the study, why math and math recognize only some conformations of EGFR, Fab-fragment Mat was docked with extraclean domain of EGFR (autoinhibitory and neautoriziranom monomers) by affixing a EGFR287-302. In the case of Δ2-7-like fragment was not significant steric conflicts with the receptor. In case neautoriziranom form a significantly large area of the exposed surface were subjected to Fab closure (920 Å2compared to 550 Å2in autoinhibitory form). Therefore, this antigen may further be contacted with a non-CDR portions of antibody, as indicated expressively in yeast mutants (Chao et al. (2004) J. Mol. Biol. 342, 539-550). On the contrary, the joins are ectodomain with EGFR Fab there is significant spatial overlap with part of the CR1 domain in front of the epitope (residues 187-28) and with a passage through the center of the Fab (Fig. 69D and 69E). Therefore, since CR1 domain has essentially the same structure as autoinhibitory or neautoriziranom conformations, Mat or Mat will not be able to bind with any form of EGFR. Obviously, there must be a difference between the orientation of the epitope relative to the CR1 domain in any known conformation of EGFR wild type and orientation, allowing the binding epitope. Examination of the CR1 domain showed that the disulfide bond (271-283) before EGFR287-302binds a polypeptide that blocks access to the epitope; one would expect that the destruction of this disulfo connection, although it is not involved in direct binding to the antibodies, will allow partial deployment of the CR1 domain, resulting Mat or Mat could get access to the epitope.

The destruction of disulfide bonds 271-283 EGFR increases the binding Mat

Disulfide bonds in proteins provide enhanced structural rigidity, but in the case of some receptors on the cell surface, in particular, receptors for cytokines and growth factors, short-term destruction of disulfide bonds and disulfide exchange can control receptor function (Hogg, P. J. (2003) Trends in biochemical sciences 28, 210-214). Since this is one of the mechanisms by which Mat and Mat could gain access to their binding site, would�and an attempt was made to increase the accessibility of the epitope by mutation of one of the two or both cysteine residues at positions 271 and 283 to alanine residues (C271A/C283A). Vectors capable of expression of a full-sized mutant C271A-, C283A - or C271A/C283A-EGFR, transtitional in IL-3-dependent cell line Ba/F3. Were selected stable clones of Ba/F3, which expressively mutant C271A - and C271A/C283A-EGFR at levels equal to that of EGFR wild-type (Fig. 70A). Cells Ba/F3 expressing high levels of mutant C283A-EGFR were detected. As previously described, EGFR wild-type weakly reacts with Mat; however, the mutant receptors reacted equally strongly with Mat, Mat and an antibody against FLAG, which suggests that the receptor presented at the cell surface, correctly folded, and that the epitope for Mac is fully available in such cases. To confirm that Mat effectively recognizes mutant C271A/C283A than EGFR wild-type, we determined the binding Mat binding Mat. Since EGFR wild-type, and C271A/C283A EGFR were tagged on the N-ends of the FLAG, you can easily determine the ratio of bindings Mat/Mat using the M2 antibody. As previously reported, Mat recognize only a small fraction of all EGFR wild-type provided on the surface of cells Ba/F3 (the ratio of bindings Mat/528 is 0.08) (table 8). In contrast, Mat recognize virtually all mutant C271A/C283A EGFR presented on the cell surface (the ratio of bindings Mat/528-1,01) (Fig. 70A and tables� 8).

Table 8
Reactivity Mat with cells expressing EGFR wild-type or C271A/C283A EGFR
The relationship of antibody binding
Cell lineMat/M2Mat/M2Mat/Mat
wtEGFR-FLAG1,370,110,08
wt-EGFR--0,07
C271/283*1,08±0,101,09±0,381,01±0,13
*The average value for four independent clones.

Mutation of two cysteines not made interference in the binding of EGF or function of the receptor. The BaF3 cells expressing the mutant C271A/C283A EGFR, proliferate in the presence of EGF (Fig. 70B). Watched the left shift of the curve of dependence of the response on the dose of EGF in cells expressing mutations C271A/C283A, with repeatable result that says anything about a higher affin�spine to the ligand, or increased ability of the mutant receptor to signaling. The analysis by Western blotting confirmed that the mutant C271A/C283A is expressed at levels similar to those for EGFR wild-type, and undergoes phosphorylation on tyrosine in response to EGF stimulation (Fig. 70C). In accordance with previous studies on other cell lines Mat has no effect onin vitroEGF-induced cell proliferation of Ba/F3 expressing EGFR wild type, whereas the blocking of the ligand with Mat completely inhibited EGF-induced proliferation of these cells (FIG.70D, left panel). On the contrary, Mat completely inhibited EGF-induced proliferation of BaF3 cells expressing the mutant C271A/C283A (Fig. 70D, right panel). In the case of the destruction of the cysteine loop 271-283 Mat not only communicates more effectively, but, LiveChat, it prevents induced by ligand proliferation.

Discussion

Structural studies of the epitope of EGFR287-302show that as Mat and Mat recognize the same spatial motif in the structures of the EGFR wild-type, indicating that this basic conformation is also found in Δ2-7EGFR and exponirovanya in it. It is important, however, that the orientation of the epitope in these structures will prevent access of antibodies to relay�Antrim amino acids. This is consistent with experimental observations that Mat not associated with EGFR wild-type presented on the cell surface at physiological levels.

The results with mutant EGFRC271A/C283Aindicate that the CR1 domain can open the link Mat and Mat stoichiometric with this mutant receptor. This mutant receptor could still take natural conformation, since they are quite sensitive to EGF stimulation, but, unlike EGFR wild-type, completely inhibited Mat. The data clearly show that if incorrectly folded form of EGFR with this destroyed a disulfide bond was introduced on the surface of cancer cells, she would be able to initiate signal transmission in the cell and would also be inhibited or Mat or Mat.

Another explanation of these data is that during the activation of ligand structural reorganization of the receptor could induce local deployment about epitope, which would have created the opportunity for making a receptor conformation that allow linking. In the crystal structures of the epitope is located near the physical center of ectodomain EGFR, and access to the epitope blocked by a collapsed CR1 domain and the Quaternary structure of ectodomain EGFR. In autoinhibitory and aautoinsurancecompany.com the immutability of the CR1 domain is supported by additional interactions with either L1:ligand:L2 domains (in the case neautoriziranom conformation), either L2:CR2 domains (in the case autoinhibitory conformation). However, the epitope region has some of the highest thermal performance indicators established in ectodomain: the epitope for Mac/175 is structurally labile. During the activation of the receptor when the receptor undergoes a transition from autoinhibitory to neautoriziranom conformation, Mat and Mat can have access to the epitope. Thus, at the molecular level, these mechanisms could contribute to negligible binding Mat and Mat with normal cells and significantly higher levels of binding to tumor cells that have expressed and/or activated EGFR.

Example 24

Monoclonal antibodies 124 and 1133

As discussed in example 1 above, Mat and Mat were created at the same time as Mat, and, as installed, show similar properties, in particular, from the specificity regarding sverkhekspressiya EGFR wild type to unique properties Mat discussed here.

Initial screenings were conducted in new York (Jungbluth et al. (2003) A Monoclonal Antibody Recognizing Human Cancers with Amplification/Over-Expression of the Human Epidermal Growth Factor Receptor PNAS. 100, 639-644). Evaluations were performed using a competitive ELISA and Biacore assays to determine, recognize whether Mat and/or Mat epitope that is identical to the epitope for Mac, and�alternativnuy determinant of EGFR.

Analysis by FACS

Antibody binding to U87MG cells.Δ2-7, A431 and HN5 was determined using FACS. All antibodies showed specificity, similar to that Mat, with strong binding to de2-7 EGFR and a weak binding expressed with EGFR wild-type.

Competitive ELISA

Have been a number of competitive ELISA to determine, compete whether antibodies 1133 124 and with Mat for the epitope. Briefly, denatured soluble domain of EGFR (sEGFR) was covered tablets for ELISA. Then in the transverse direction of the tablet in increasing concentrations was added unlabeled antibodies 124 or 1133. After washing, to each well was added biotinylated math to determine whether it is still contact sEGFR. Detection associated met successfully performed using conjugated with streptavidin HRP. If the antibody binds to the same (or overlapping) epitope, and math, linking Mat not expected.

The results are summarized in table 10. Observed dependent on the concentration of the inhibitory effect of binding Mat and Mat: linking math increased as decreased concentration of unlabeled antibody, which suggests that antibodies 1133 124 and recognize the epitope is identical to Mat, or an epitope very close to him.

Table 10
Consolidated, determined by competitive ELISA binding Mat and Mat with sEGFR
Unlabeled blocking antibodyThe binding of Biotin-labeled 806
124No
1133No
806 (control for inhibition)No
Irrelevant IgG2b++++

Analysis by FACS: competition for binding to cells

The U87MG cells.Δ2-7 pre-incubated with unlabeled antibody 124, 1133. In the analysis were also included as positive control 806 and a matching isotype control antibody. Cells were washed and then stained with conjugated with Alexa488 Mat, and the level of 806 binding was determined by FACS.

The results are summarized in table 11. Antibodies 1133 124 and blocked the binding of Mat with the cell surface, indicating that the epitope recognition, is identical to Mat, or epitope very close to him.

td align="center" namest="c0" nameend="c1"> Analysis by FACS: competition for binding to U87MG cells.Δ2-7
Table 11
Unlabeled blocking antibodyInhibition of Alexa488-labeled Mat
124+++
1133+++
806++++
Control (IgG2bNo

The BIAcore analysis: linking with peptide epitope for Mac

Amino acid sequence of EGFR287CGADSYEMEEDGVRKC302(SEQ ID NO: 14) containing the epitope for Mac, synthesized in the form of peptide and immobilizovana on the touch chip. Determined the binding of antibodies 124, 1133 and 806 (200 nm) with this peptide. Obtained at the maximum binding of resonance units (D) are summarized in table 12. Antibodies 1133 124 and showed a clear binding to the peptide, confirming the recognition of the peptide epitope to 806.

806
Table 12
The BIAcore analysis: maximum binding peptide epitope for Mac
AntibodyThe binding of peptide to Mat (D)
1100
1241000
1133800

Discussion

As shown in this example, Mat and Mat contact the EGFR peptide recognized Mat, and block the binding of met with extraclean domain of EGFR and cells expressing de2-7 EGFR. Thus, these three antibodies recognize the same determinant in EGFR.

Example 25

Clinical trial ch806

A clinical trial was designed to studyin vivothe specificity of ch806 in the analysis focus on the tumor/analysis of bearsdley/pharmacokinetic analysis in patients with various tumor types.

1. Materials and methods:

The testing plan

This is the first time conducted on humans test was an open phase I study using increasing doses. The main objective was to assess the safety of single-ch806 infusion to patients with advanced tumours expressing the 806 antigen for. Secondary objectives of the study were the definition of bearsdley, pharmacokinetics and absorption of the tumor111In-ch806; determining the patient's immune response against ch806 and preliminary evaluation of data relating to clinical activity ch806. For this study was SEL�Ana single dose for optimal evaluation of in vivothe specificity of ch806 in relation to EGFR presented on tumor cells. The Protocol was approved by the Committee on human studies and ethics at the Austin Hospital before the study began. The test was carried out according to the scheme exclusions from clinical trials (CTX) developed by the Australian Ministry for therapeutic goods. All patients gave written informed consent.

Selection criteria for entering the study included running or metastatic tumors that are positive for antigen expression for 806-based chromogenicin situhybridization or immunohistochemical analysis of archived samples of tumors (tumors received a determination 806-positive if the result of immunohistochemical evaluation of archived samples of tumors was determined any cells positive for antigen expression for 806, see below); histologically or cytologically proven cancer; the disease is detected in the image obtained by CT (computed tomography), with at least one lesion ≥2 cm; the estimated lifetime for a period of at least 3 months; rating on a scale of functioning of the Karnofsky scale (KPS) ≥70; meeting the requirements of hematological characteristic, function of liver and kidneys; age >18 years and ability to give informed consent. To�iteria exceptions included extensive metastasis to the Central nervous system (in addition to subjected to appropriate treatment, and stable); chemotherapy, immunotherapy, biological therapy, or radiotherapy within four weeks prior to entry into the study; prior exposure to antibodies [except in cases where there is no evidence of human antibodies against chimeric antibodies (HACA)]; failure to complete recovery from effects of prior anticancer therapy; concomitant use of systemic corticosteroids or immunosuppressants; uncontrolled infection or other serious illness; pregnancy or breast feeding; women of reproductive potential not using an acceptable in medicine contraception.

Patients received a single infusion of ch806 labeled paltry amount of indium-111 (111In, 200-280 MBq; 5-7 MCI) by intravenous infusion in saline/5% human serum albumin for 60 minutes. The planned increase of the dose means that patients were enrolled into one of four groups dose level: 5, 10, 20 and 40 mg/m2. These doses were chosen to make possible the evaluation of the specificity of ch806 in respect of EGFR expressed in tumors, and definition, binds any normal tissue compartment with ch806 (and does impact on the pharmacokinetics or bioespeleo)in vivo. Bioespeleo, pharmacoki�the etic and the immune response was determined in all patients.

Obtained in gamma camera images of the whole body to assess bearsdley and absorption of the tumor was done on day 0, day 1, day 2 or 3, day 4 or 5 and day 6 or 7 after infusion111In-ch806. Blood samples for pharmacokinetic analyses were obtained at these time points, and additionally on day 14 (± 2 days) and day 21 (± 2 days). Blood samples to assess levels of HACA received at the stage of inclusion and weekly until day 30. Assessment of toxicity was performed at each visit for the study. Physical examination and conventional determination of hematological and biochemical parameters were performed weekly until the end of the study (day 30). Transfer to a new stage was performed at day 30.

Criteria for increasing doses

The first patient at each dose level were observed during the four weeks prior to enrolling any additional patients. If dose limiting toxicity (DLT) was not observed in any of the first 2 patients within 4 weeks from infusion ch8063, 4 patients were transferred to the group at the next higher dose level. If one patient in any group of 2 patients DLT was observed within 4 weeks from the first dose, an additional 4 patients (maximum of 6) has been included into the group this dose level. If no more than one patient out of 6 at any dose level were observed toxicity ≥ �Tapani 3, subsequent patients were enlisted in the group of the next dose level.

DLT was defined as non-hematological toxicity grade 3 or hematologic toxicity of grade 4, as defined by NCI common terminology criteria for adverse effects (CTCAE v3.0). Maximum tolerated dose (MTD) was defined as the dose of ch806, below which 2 or more patients from 6 DLT was observed.

Tagging ch806 radioactive isotope

ch806 quality that meets the requirements for clinical use, was produced in Biological Production Facility of the Ludwig Institute for Cancer Research, Melbourne, Australia. Antibody ch806 was labeled with111In (MDS Nordion, Kanata, Canada) through a bifunctional chelate metal ions CHX-A"-DTPA in accordance with the methods described previously (Scott et al. (2000) Cancer Res 60, 3254-3261; Scott et al. (2001) J. Clin. Oncol. 19(19), 3976-3987).

Obtained in gamma camera images

Pictures of the whole body to assess bearsdley111In-ch806 was obtained for all patients at day 0 after infusion111In-ch806 and at least 3 additional times up to 7 days after infusion. Obtained by single photon emission computed tomography (SPECT) images of the area of the body with known tumor also received at least once during this period. All obtained in the gamma camera images were obtained in the range camera with dual head (Picker Internaional, Cleveland, OH).

Pharmacokinetics

Blood for pharmacokinetic analysis were obtained on day 0 before infusion111In-ch806; then after 5 minutes, 60 minutes, 2 h and 4 h after infusion111In-ch806, day 1, day 2 or 3, day 4 or day 5 and 6 and 7. In addition, blood for pharmacokinetic analyses of ch806 protein was also obtained on day 14 (±2 days), day 21 (±2 days) and day 30 (±2 days).

Serum samples were divided into two aliquots and positively in scintillation gamma counter (Packard Instruments, Melbourne, Australia), together with the relevant standards111In. Results related to the serum is presented as % of injected dose per litre (% ID/l). The definition of ch806 protein levels in the serum of the patient after each infusion was performed using a recognized valid Protocol for immunological measuring ch806 protein in human serum40. The lower limit of quantification of ch806 in serum samples was 70 ng/ml. All the samples investigated in three replicates and were diluted in the ratio of at least 1:2. Certain levels ch806 in serum represented as μg/ml.

The pharmacokinetic calculations were carried out on the basis of measurements of the111In-ch806 in serum after infusion and identified by ELISA of ch806 protein levels in the sera of patients using the approximation of a curve by points (WinNonlin Pro Node 5.0.1, Pharsight C., Mountain View, CA). Evaluations were performed for the following parameters: T1/2α and T1/2β (half-periods of the existence of initial and final phases of elimination); V1, volume of Central compartment; Cmax(maximum concentration in serum); AUC (area under the curve concentration in serum from time with extrapolation to infinity); CL (total serum clearance).

Excretion from the body and dosimetry calculation in the tumor and organs111In-ch806

Dosimetric calculations throughout the body and normal organs (liver, lung, kidney and spleen) was performed on the basis of interest areas in the dataset in the form of images after infusion111In-ch806 each individual patient, which allowed for the calculation of cumulative activity and analysis using OLINDA, final dosimetry results (Stabin et al. (2005) J. Nucl. Med. 46(6), 1023-1027). Areas of interest were also determined for the respective tumors at each time point in the data sets in the form of images after infusion111In-ch806, with correction for background and attenuation, and dosimetry calculation was performed to derive the concentration of111In-ch806 in tumor/g (Scott et al. (2005) Clin. Cancer Res. 11(13), 4810-4817). It turned ch806 in µg/g of tumor tissue on the basis of the injected dose in mg ch806 protein.

Analysesfor the presence of HACA

Blood samples for assessment of HACA was selected to ch806 infusion and then weekly for up to 30 days after ch806 infusion. The samples were analyzed by ELISA and by using the technology of surface plasmon resonance using the device BIAcore2000 as described previously (Scott et al., 2005; Liu et al. (2003) Hybrid Hybridomics 22(4), 219-228; Ritter et al. (2001) Cancer Res. 61(18), 685-6859).

Immunohistochemical method

Fixed formalin filled with paraffin tumor tissue from each Respondent patient was subjected to immunoablative as follows. Briefly, sections with a thickness of 4 μm filled with paraffin tissues were mounted on glass slides SuperFrost® Plus (Menzel-Glaser, Germany), were subjected to dewaxing and rehydration prior to antigen retrieval in a microwave oven in a solution for extraction of the target, pH 6.0 (10 min; Dako, Glostrup, Denmark). Then the sections were treated with 3% hydrogen peroxide for 10 min to eliminate endogenous peroxidase and incubated at room temperature for 60 min with Mat (4 μg/ml) or matching isotype control antibody (IgG2b; Chemicon, Temecula, CA) in an appropriate concentration. Antibody binding was detected using a set of PowerVision Kit (Immuno Vision Technologies, Brisbane, CA). To make possible the visualization of immunoablative, sections were incubated with the Chromogen 3-amino-9-ethylcarbazole, or 0.4%, Sigma Chemical Co. MO, USA) for 10 min and subjected contrasting� staining with hematoxylin Mayer. Negative controls for procedures immunoablative were prepared by crossing a first antibody. The results were reported as percentage of positive staining tumor cells.

The chromogenic methodin situhybridization

Did sections were fixed with formalin filled with paraffin tumor tissue from each subject of the patient and mounted on glass slides SuperFrost® Plus, subjected to dewaxing and rehydration prior to processing the set of Spotlight® Tissue Pre-treatment Kit (Zymed Laboratories Inc. South San Francisco, CA). Sections were then covered with a probe for DNA EGFR Spotlight®, was subjected to denaturation at 95°C for 10 min and incubated overnight at 37°C. After hybridization, the slides were washed in 0.5×SSC. Detection of the probe was performed using the kit for detection of polymers Spotlight® CISHTM. Believed that the cuts that have demonstrated clusters of signals or ≥5 separate alarms in >25% of cancer cells have amplification of the EGFR gene, which correlated with the reactivity with Mat.

2. Results

Patients

Eight patients [1 woman and 7 men; mean age 61 years (range 44-75)] completed the full test (table 16). Table 13 also presents the original location of tumors before treatment in the past, and places affected by the disease at the time of entering the study�R. All 8 patients had positivity for the antigen to 806 in archived tumors (table 13).

All patients met the selection criteria, except for patient 8 (which had a primary brain tumor), all suffered from metastatic disease at the time of entering the study. The disease affected the sites identified as being targets of the lesions included lung (5 patients), brain (1 patient), lymph nodes (1 patient), nadesico region (1 patient). Other sites of metastatic disease (non-target lesions) included a mass on the kidney, bone, and lymph nodes (table 13). The median state functioning according to the Karnofsky scale was 90 (range 80-100).

Side effects and HACA

Side effects associated with ch806 are listed in tables 14 and 18. Associated with infusion side effects were observed. DLT was not, and, therefore, the MTD was not achieved. The main toxicities, which, according to the researchers, were possibly associated with ch806, were transient itching, some nausea, tiredness/lethargy and possible effects on the levels of ALP (alkaline phosphatase) and GGT (gamma glutamyl transferase) in serum. There was an increase in grade 2 the its (evaluation scale common toxicity criteria) level of GGT oupatient 5, however, he was on the background of the rise of 1 degree base line and was transient in nature. There were three serious adverse effect (SAE), but none of them was associated with ch806. In General, ch806 was safe and well tolerated at all dose levels, but there was usually predictable and verifiable negligible toxicity. Further increase in dose was not carried out due to the limited amount of cGMP ch806 available for this test.

A positive immune response against ch806 (in accordance with the methods as ELISA and BIAcore) were observed only in one out of eight patients (patient 1).

Table 14
Manifestation of adverse effects associated with ch806
The dose level (mg/m2)*The total number of episodes of the existence of each effect
Side effect5102040
Dizziness000/td> 11
Fatigue00101
Lethargy00011
Suppressed appetite00011
Nausea01012
Itching10001
Elevated levels of ALP00101
Elevated levels of GGT001 01

Total11349
* The numbers represent the number of episodes of the existence of any effect at each dose level.

Table 15
The distribution associated with the investigational agent side effects
The dose level (mg/m2)Toxicity maximum extent on its*
1 = easy2 = average3 = severe4 = life-threatening
51000
101000
202 100
404000
In General8100
* The number of patients.

Tagging ch806 radioactive isotope

During the test, there were just 8 infusions111In-ch806. Average (± standard deviation) radiochemical purity and immunoreactivity111In-ch806, as defined, were 99.3±0.1% to 77.4±7.0 percent, respectively.

Bioespeleo ch806

Original painting bearsdley111In-ch806 in patients at all dose levels was in accordance with the activity in the pool of blood that was slowly extinguished as time went on. Within one week after the injection absorption111In-ch806 liver and spleen were in accordance with the normal excretion of metabolites111In-chelate via the reticuloendothelial system. Specific localization111In-ch806 was observed in non-target lesions (≥2 cm) of all patients at all dose levels (Fig. 94), including targeted ócsa�Ah lesions, located in the lungs (patients 1, 3, 4, 5 and 7), the abdomen (patients 1 and 2) and in adhesional area on the right side of the neck (patient 6). Identified as a high degree of absorption111In-ch806 a brain tumor (patient 8) (Fig. 95). It is important that the absorption111In-ch806 tumor did not depend on the level of antigen expression for 806. For example, patient 4 revealed a high degree of absorption which targets the lesions found in both lungs, despite the component of <10% positivity in accordance with IHC in respect of reactivity with 806 in archived tumor (Fig. 96). This degree of absorption111In-ch806 which targets the lesions in patient 4 was comparable with that observed in patient 3, who 50-75% of tumor cells were positive for staining of the antigen 806 for immunohistochemical analysis of archived samples (Fig. 96).

Pharmacokinetics

Pharmacokinetic parameters in individual patients T1/2α and T1/2β, V1, Cmax, AUC and CL in case of a single infusion111In-ch806 are presented in table 16. The criterion of sum of ranks Kruskal-Wallis test was applied to the half-periods of the existence of alpha and beta phases, V1 and ground clearance. Significant differences between the dose levels were not observed (P>0,05).

Pharmacokinetic curve corresponding to rece�m using ELISA data for the combined population, shown in Fig. 97. Pharmacokinetic parameters are presented as mean values ± standard deviation, were T1/2α 29,16±21,12 h, T1/2β 172,40±90,85 h, V1 2984,59±91,91 ml and CL 19,44±4,05 ml/h. the Data relating to certain maximum and minimum concentrations of ch806 in serum (Cmaxand Cmin), are presented in table 17 for each patient. As expected, the observed linear dependence of Cmaxand Cminat each dose level. Values as mean values ± standard deviation, defined for pharmacokinetic parameters using the ELISA ch806, well consistent with the values obtained for the pharmacokinetic parameters using the111In-ch806 (table 16).

Dosimetric calculation111In-ch806

Excretion from the body was similar in all patients at all dose levels, with biological T1/2(mean value ± standard deviation) was 948,6±378,6 h. Due to the relatively short half-life of physical existence, the calculation of the biological halftime of existence is very dependent on small changes of the effective halftime of existence. There were no statistically significant differences in the excretion of between levels to� [the criterion of sum of ranks Kruskal-Wallis test: P-value = 0,54] (Fig. 98).

Revealed no difference in clearance111In-ch806 from normal organs (liver, lungs, kidneys and spleen) between dose levels, and the average effective value for T1/2as calculated, amounted to 78.3, 48,6, and 66.2 69,7 h, respectively. There was not a statistically significant difference in clearance between these normal organs. In particular, revealed no difference in the liver's detoxification between the dose levels (Fig. 98), which indicates the absence of saturable ch806 compartment of antigen in the liver.

Dosimetric analysis of tumors has been completed in the case of 6 patients. Patients 1 and 2 had targeted lesions close to the heart of the pool of blood and made the move while receiving some images that prevented accurate analysis. A certain maximum absorbance111In-ch806 occurred after 5-7 days after infusion and ranged from 5.2 to 13.7×10-3% of injected dose/g of tumor tissue.

Evaluation of clinical activity

At the end of the time period of this study, which will last a month, it was found that 5 patients had stable disease, and 3 patients - progressive disease (table 13). Interestingly, in the case of one patient (patient 7, level dose = 40 mg/m2clinical data talked about a temporary reduction in palpable under the auricle limpet�ical site (which, as was proven when exploratory puncture aspiration is metastatic SCC) during the study period, which suggests a possible biological activity ch806. However, this patient was confirmed using RECIST (criterion assessment of response in solid tumors) at the end of the study progressive disease.

Supplementary data

Eight patients [1 woman and 7 men; mean age 61 years (range 44-75)] completed a full test of phase I, as reported (Scott et al. (2007) Proc. Natl. Acad. Sci. U. S. A. 104, 4071-4076). All patients met the selection criteria, except for patient 8 (which had a primary brain tumor), all suffered from metastatic disease at entry into the study. Absorption At the tumor was observed in all patients, and111In-ch806 subjected chimerization option Mat, demonstrated a rapid and high level of absorption by the tumor (Fig. 71). Revealed no difference in clearance111In-ch806 from normal organs (liver, lungs, kidneys and spleen) between the dose levels (Scott et al., 2007). In particular, revealed no difference in the liver's detoxification between dose levels, indicating no saturable ch806 compartment of antigen in the liver. The total absorption of the liver had a maximum value 14,45±2,43% ID immediately after infusion and decreased to to 8.45±1,63% ID to 72 hours� and to 3.18±0,87% ID not later than one week after the infusion. This is clearly the opposite of absorption of antibodies against EGFR wild-type (e.g., antibody 225), which were found to reach more than 30% ID in liver (in the case of component 40 mg dose) in 3 days after infusion (Divgi et al. (1991) J. Natl. Cancer Inst. 83, 97-104). A certain maximum absorption by the liver111In-ch806 occurred after 5-7 days after infusion. Quantitative calculation of the absorption by the liver in patients 1 and 3 it was impossible to perform accurately due to the proximity which the target of the lesion to heart a pool of blood and body movements of the patient. Maximum absorbance ch806 tumor ranged from 5,21 to 13,73×10-3% ID/g tumor tissue. The calculation of the actual concentration of ch806 in tumor showed maximum values (mean ± standard deviation) of components of 0.85±0 mg/g (5 mg/m2), 0,92±0 µg/g (10 mg/m2), 3,80±1,10 µg/ml (20 mg/m2and 7,05±1,40 mg/g (40 mg/m2).

Discussion

As outlined in the example, this study represents the first reported demonstration of bearsdley and focus on the tumor chimeric antibody against epitope presented only expressed, mutant or ligand-activated forms of EGFR. Ch806 demonstrated excellent targeted delivery to tumors in all patients, was detected, data on removals normally�mi fabrics and significant toxicity. These in vitro and in vivo characteristics of ch806 set it apart from all other antibodies directed against the EGFR.

At doses up to 40 mg/m2ch806 was well tolerated, was not revealed DLT, and MTD was not achieved. The main toxicities that were possibly associated with ch806, were transient itching, some nausea, tiredness/lethargy and possible effects on the levels of ALP and GGT in serum. A running character of cancer patients meant that their disease could also be factors contributing to these side effects. All side effects that may have been associated with the study drug were mild, many of them self-limiting, and none of them required active treatment. It is important that none of the patients was not observed skin rash or disorder of the gastrointestinal tract, even at the highest dose level. The excellent tolerability of ch806 in this study using a single dose justifies the next stage of validation in trials using multiple doses.

Analysis of bearsdley ch806 in all patients showed gradual quenching activity in a pool of blood and the lack of a definite absorption111In-ch806 normal tissues. In all patients there was also excellent absorption ch806 tumors, including metastases to the lungs, lymph nodes and Natochin�to, and mesothelioma and glioma. It was observed at all dose levels, including 5 mg/m2(the lowest of the tested doses), which is one tenth to one twentieth of the dose required for imaging tumor removals by other antibodies against EGFR wild-type33. This difference in absorption ch806 in comparison with antibodies against EGFR wild type may be due to significant absorption of their normal tissues (liver and skin) due to the action of EGFR wild-type as absorption material - antigen33. In addition, localization111In-ch806 was even higher in patients with low expression of the antigen for 806 determined using immunohistochemical analysis of archived samples of tumors (Fig. 96). Absorption111In-ch806 glioma was particularly impressive (Fig. 97) and is comparable to any published data on the targeted delivery of antibodies to brain tumors after systemic or even local-regional infusion. These data confirm the unique selectivity of ch806 in respect of EGFR expressed on a broad range of tumors, and confirm the lack of absorption of the antibody with normal human tissues.

Pharmacokinetic analyses showed that ch806 is characterized by a finite half-life, constituting more than a week, and no depen�spine on the dose excretion 111In-ch806 from serum. Also found a linear relationship for AUC, Cmaxand Cminwhile at dose levels exceeding 10 mg/m2achieved the minimum concentration in serum above 1 µg/ml. the values of V1, C1, T1/2α and T1/2β were consistent between dose levels and was in line with typical human antibodies of IgG1 isotype (Scott et al., 2005; Steffens et al. (1997) J. Clin. Oncol 15, 1529-1537; Scott et al. (2001) J. Clin. Oncol. 19(19), 3976-3987). Also found that the clearance of ch806 was lower when calculations ch806 as determined by ELISA, were compared with measurements of111In-ch806. Although this difference can be explained by the small number of investigated patients, over numerous time points of sampling for ELISA ch806 could support this value as providing the best representation of the true ground clearance ch806. Pharmacokinetic values for ch806 comparable with those for other chimeric antibodies, published in this number (Steffens et al., 1997; Scott et al., 2001), and support the scheme of doses ch806 on a weekly basis.

The results of quantitative dosimetric and pharmacokinetic analyses indicate the absence of saturable ch806 compartment antigen in normal tissues at dose levels evaluated in this test. It is important that the data on the absence of dose-dependent pharmacokinetics � elimination from the body and the liver is clearly the opposite data of all published studies of antibodies against EGFR wild type (in Baselga J. and Artega, C. L. (2005) J. Clin. Oncol. 23, 2445-2449; Divgi et al. J. Natl. Cancer Inst. 83(2), 97-104; In Baselga J (2001) Eur. J. Cancer 37 Suppl. 4, S16-22; Gibson et al. (2006) Clin. Colorectal Cancer 6(1), 29-31; Rowinsky et al. (2004) J. Clin. Oncol. 22, 3003-3015; Tan et al. (2006) Clin. Cancer Res. 12(21), 6517-6522), confirming the specificity against tumors and the absence of binding of ch806 from normal human tissues. These observations provide conclusive proof of ability ch806 (or humanized forms) to selective binding to target EGFR in the tumor, avoiding the usual toxicity of other antibodies against EGFR and inhibitors of kinases (particularly in relation to skin) (Lacouture AE (2006) Nature Rev. Cancer 6, 803-812; Adams, G. P. and Weiner L. M. (2005) Nat. Biotechnol. 23(9), 1147-1157) and possibly achieve a greater therapeutic effect. Moreover, results of this test are a strong support for the feasibility of delivering the payload (due to rapid internalization met in tumor cells), and combined treatment with other biological agents such as antibodies against EGFR and tyrosine kinase inhibitors, in which case the toxicity by co-administration, apparently, is minimized. This study provides clear evidence of the ability to bind to a target epitope in the EGFR, which is tumor-specific, and are currently undergoing further clinical development of this unique approach to cancer�howl therapy.

Example 26

Comparison of sequences

Here are presented, and compares the CDR of the VH - and VL-regions of each of Mat, Mat, Mat, Mat and hu806.

CDR given above for the corresponding isotypes of antibodies, based on the analysis according to Kabat. As will be obvious skilled in the art specialists, CDR can also be defined on the basis of other tests, for example, on the basis of the Association definition by Kabat and Chothia. For example, when the application of the combined analysis by Kabat and Chothia these isotypes sequence VL CDR region and CDR of VH-region for the corresponding isotypes are presented in table 14.

As shown above, CDR sequences isotypes Mat, Mat, Mat and Mat are identical except for high-conservative amino acid substitutions that are likely to generate homologous coagulation proteins for epitope recognition. These data, together with data binding and other data provided in the examples above, show that these isotypes and hu806 are variants of closely related members of the family exhibiting the same unique properties discussed above in relation�attachment Mat (for example, binding to the epitope in the EGFR, which is available for binding only expressed, mutated or activated by ligand forms of EGFR, which leads to a unique specificity against the expressed EGFR tumors, but not in relation to EGFR wild type in normal tissue), and show that antibodies with excellent sequences of variable regions, in particular, with variable CDR sequences that have the same properties and abilities of the binding.

A list of references

This invention may be embodied in other forms or you�olnine other ways without departing from its essence or essential characteristics. Therefore, the description of the present invention should be considered in all aspects illustrative and not restrictive, the volume of the present invention is defined by the appended claims of the invention and includes, as expected, all changes that fall within the meaning and scope of equivalence.

Various references are cited throughout the description of the present invention and represented in the above list of references, each of which is included here by reference in its entirety.

1. The selected antibody to the receptor of epidermal growth factor (EGFR), containing the variable region of the heavy chain, which contains the amino acid sequence represented in SEQ ID NO:164, and variable area light chain contains the amino acid sequence represented in SEQ ID NO:166.

2. The selected antibody according to claim 1, where the antibody contains a constant region of the heavy chain, which contains the amino acid sequence represented in SEQ ID NO:43.

3. The selected antibody according to claim 1, where the antibody contains a constant region of light chain, which contains the amino acid sequence represented in SEQ ID NO:48.

4. The selected antibody according to claim 3, further comprising a constant region of the heavy chain of IgG1.

5. The selected antibody �of claim 1, containing the constant region of IgG1 heavy chain and the constant region light chain Kappa.

6. The selected antibody according to any one of claims.1-5, where the specified selected antibody are presented in the form of an antibody F(ab')2, scFv fragment, diately, Triatel or tetrathele.

7. The selected antibody according to any one of claims.1-5, further comprising a detectable or functional label.

8. The selected antibody according to claim 7, where the specified detectable or functional label is covalently attached.

9. The selected antibody according to claim 7 or 8, where the specified detectable label is a radioactive label.

10. The selected antibody according to claim 9, where the specified radioactive label selected from the group consisting of3N,14C,32P,35S,36Cl51Cr57Co,58Co,59Fe90Υ,121Ι,124Ι,125Ι,131Ι,111In211At,198Au,67Cu,225Ac,213Bi99Cu and186Re.

11. The selected antibody according to claim 7 or 8, where the specified detectable label is an imaging agent.

12. The selected antibody according to claim 11, where the imaging means is a means for enhancing magnetic resonance imaging.

13. The selected antibody according to any one of claims.1-12, where the specified selected antibody is pegylated.

14. A kit for diagnosing tumor in Kotor�th EGFR aberrant expressed or EGFR is expressed in the shape of a truncated protein, where the kit contains the selected antibody according to any one of claims.1-13, where the set contains optional reagents and/or instructions for use.

15. Pharmaceutical composition for tumor treatment containing a therapeutically effective amount of the antibody according to any one of claims.1-13.

16. Pharmaceutical composition according to claim 15, further comprising an anti-cancer agent selected from the group consisting of chemotherapeutic agents, antibodies against EGFR, radioimmunotherapeutic means and combinations of the above.

17. Pharmaceutical composition according to claim 16, in which the specified chemotherapeutic agent selected from the group consisting of a tyrosine kinase inhibitor, an inhibitor of the cascade of phosphorylation reactions, modulator posttranslational modification, inhibitor of growth or division of cells, the antimitotic funds inhibitor of signal transmission and combinations of the above.

18. A method of treating cancer in humans, comprising administering to the human antibody according to any one of claims.1-13.

19. A method according to claim 18, wherein said cancer is a cancer that strikes the brain.

20. A method according to claim 19, wherein said a cancer affecting the brain is selected from the group consisting of glioblastomas, medulloblastomas, meningiomas, neoplastic and neoplastic astrocytes arteriovenous malformations.

2. A method according to claim 18, in which the cancer is a solid tumour.

22. A method according to claim 21, in which the solid tumor is a glioma.

23. A method according to claim 21, in which the solid tumor is selected from the group consisting of breast tumor, lung tumor, prostate tumor, bladder tumor, tumor of head and neck tumors.

24. The method of treatment according to any one of claims.18-23, in which the antibody is administered in combination with a second agent.

25. A method according to claim 24, in which the second tool selected from the group consisting of a tyrosine kinase inhibitor, doxorubicin, cisplatin, carboplatin, nitrosamine, procarbazine, vincristine, the HIV, 5-fluorouracil, citizenerased, cyclophosphamide, epipodophyllotoxin, carmustine and lomustine.

26. A method according to any one of claims.18-23, in which the antibody is administered in combination with temozolomide.

27. Unicellular host for antibody formation, where the host transformed with a recombinant DNA molecule which encodes a selected antibody according to any one of claims.1-5, where, optionally, the unicellular host is selected from the group consisting ofE. coli,Pseudomonas,Bacillus,Streptomyces, yeast cells, Cho, YB/20, NSO, SP2/0, Rl.1, B-W, L-M, COS1, COS7, BSC1, BSC 40 and BMT 10, plant cells, insect cells and human cells in tissue culture.

28. Immunoconjugate containing cytotoxic with�adsto and the selected antibody to the receptor of epidermal growth factor (EGFR), where the antibody contains a variable region heavy chain, which contains the amino acid sequence of SEQ ID NO:164, and variable area light chain contains the amino acid sequence of SEQ ID NO:166, where immunoconjugate capable of binding EGFR.

29. Immunoconjugate according to claim 28, where the antibody contains a constant region of light chain, which contains the amino acid sequence represented in SEQ ID NO:48.

30. Immunoconjugate according to claim 29, where the antibody further comprises a constant region of the heavy chain of IgG1.

31. Immunoconjugate according to claim 28, where the antibody further comprises a constant region of IgG1 heavy chain and the constant region light chain Kappa.

32. Pharmaceutical composition for tumor treatment containing a therapeutically effective amount immunoconjugate according to any one of claims.28-31.

33. A method of treating cancer in humans, comprising administering immunoconjugate according to any one of claims.28-31.

34. A method according to claim 33, wherein said cancer is a cancer that strikes the brain.

35. A method according to claim 34, wherein said a cancer affecting the brain is selected from the group consisting of glioblastomas, medulloblastomas, meningiomas, neoplastic and neoplastic astrocytes arteriovenous malformations.

36. A method according to claim 33, in which the cancer is a solid tumour.

37. Method p� p. 36, in which a solid tumor is a glioma.

38. A method according to claim 36, in which the solid tumor is selected from the group consisting of breast tumor, lung tumor, prostate tumor, bladder tumor, tumor of head and neck tumors.

39. A method according to any one of claims.33-38, in which immunoconjugate administered in combination with a second agent.

40. A method according to claim 39 in which the second tool selected from the group consisting of a tyrosine kinase inhibitor, doxorubicin, cisplatin, carboplatin, nitrosamine, procarbazine, vincristine, the HIV, 5-fluorouracil, citizenerased, cyclophosphamide, epipodophyllotoxin, carmustine and lomustine.

41. A method according to claim 39 in which the second means is a temozolomide.

42. A method according to claim 18, where the cancer is characterized as a tumor that contains EGFR amplification.

43. A method according to claim 33, where the cancer is characterized as a tumor that contains EGFR amplification.



 

Same patents:

FIELD: medicine.

SUBSTANCE: group of inventions refers to medicine. Presented are diagnostic technique for chronic obstructive pulmonary disease (COPD) and differentiating stages I/II and III/IV COPD in a human involving measuring heat-shock protein 27 (HSP27), 70 (HSP70) and 90 alpha (HSP90 alpha) and measuring interleukin-1 (ST2) receptor 4 or histon-related DNA fragments in a sample. The COBD is diagnosed, when the measured amount of HSP27, HSP70, HSP90 alpha, ST2 and histon-related DNA fragments appears to increase as compared to that in the healthy people. The stage I/II COBD is diagnosed, when the measured amount of HSP27 in the sample of the above individual falls within 2,600 and 3,300 pg/ml, the amount of ST2 is more than 160 pg/ml, while the amount of HSP70 and HSP90 alpha is at least 40% increased as compared to that in the healthy people. The stage III/IV COBD is diagnosed, when the amount of HSP27 in the sample falls within 3,400 and 5,500 pg/ml, while the amount of HSP70, HSP90 alpha and histon-related DNA fragments is at least 40% increased as compared to that in the healthy people.

EFFECT: group of inventions provides the effective diagnostic techniques for the COPD and differentiating between the stages I/II and III/IV COPD in the individual.

11 cl, 20 dwg, 2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to laboratory diagnostics, namely to clinical immunology. Method of determining C3-convertase stabilisation of classical way of human complement activation is realised by carrying out reaction of lysis of ram erythrocytes with 0.8% of human blood serum for 10 min. Reaction is stopped by addition of buffer, which contains 10 mM ethylendiamintetraacetic acid, degree of lysis of erythrocytes in control sample is determined. Experimental sample is additionally incubated for 30 min at 37°C, degree of lysis is determined, activity of C3-convertase is calculated as difference between experimental and control samples, with difference higher than 10% it is evaluated as autoimmune pathological condition.

EFFECT: application of simple and fast in realisation method makes it possible to detect preclinical condition of immunodeficiency, can serve as specific marker for immunomodulating therapy, carry out profound research of pathogenesis of autoimmune diseases.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for determination of atherogenicity of immune complexes containing multiply modified low density lipoproteins (IC-MMLDLP). For this purpose basic calcium superphosphate of IC-MMLDLP is prepared from human blood serum by treatment with the buffer containing 10% solution of polyethyleneglycol with a molecular weight 3350 (PEG-3350), in the ratio 1:2.5, then it is incubate within 10 minutes at a room temperature. IC-MMLDLP aggregates are pelleted, dissolved in the buffer without PEG-3350, analysed for the content of cholesterol in immune complexes (ChIK) and the level of guinea pig complement binding (EBC) by precipitated immune complexes. IC-MMLDLP atherogenicity is calculated as SSK to HIK ratio. If the value is below 24 units a high blood atherogenicity because of the reduced complement activating IgG function in IC-MMLDLP is stated.

EFFECT: method allows to assess IC-MMLDLP atherogenicity, diagnose atherosclerosis at a preclinical stage, and also to predict both the course of atherosclerotic process at individuals, and efficiency of the conducted therapy.

1 tbl

FIELD: medicine.

SUBSTANCE: invention can be used for the instant assessment of atherogenicity of the immune complexes (IC) of human blood serum. Precipitated ICs from human blood serum are prepared by treating with a buffer containing 10% polyethylene glycol of molecular weight 3,350 (PEG-3350) in ratio 1:3.5, incubating for 10 min at room temperature. Aggregated ICs are deposited by centrifuging and dissolved in PEG-3350 free buffer; the immune complex cholesterol (ICC) is measured, and a guinea pig's complement fixation (CF) by the precipitated immune complexes is determined. The IC atherogenicity is calculated as CF/ICC relation, and if the derived value is less than 4 units, the high blood atherogenicity is stated.

EFFECT: higher assessment accuracy.

1 tbl

FIELD: biotechnology.

SUBSTANCE: on paramagnetic particles bearing the immobilised bacterial protein G of the family Streptococcus, with the blocked solution Denhardt-DNA the protein BoNT/A is adsorbed using specific highly affinity polyclonal antibodies. The formation of the protein complex BoNT/A is detected with a biotin-conjugated antibody by a noncovalent conjugate of DNA fragments with neutravidin. PCR amplification of the DNA matrix is carried out with the fluorescence detection of the signal in real time. Registration of the presence of BoNT/A in the samples under study is carried out by the change in the level of fluorescence compared to the control ones.

EFFECT: effective method of determining the presence of the compound.

5 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: high-molecular adiponectin is measured, and the measured level of high-molecular adiponectin of less than 4.6 mcg/ml is considered to be a risk factor of arterial hypertension. The sensitivity of the method makes 89.3%, while its specificity is 88.1%.

EFFECT: method enables determining the risk factor of arterial hypertension reliably in the females suffering from abdominal obesity.

2 ex, 1 tbl

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to oncohaematology, and can be used to monitor the effectiveness of the anti-tumour treatment of patients with multiple myeloma. For this purpose the concentration of free light chains of immunoglobulins is determined before and 24 hours after finishing the treatment course. In case of a 60% reduction of the concentration, the performed treatment is considered to be effective, in case the reduction of the concentration is 60% and lower - ineffective.

EFFECT: application of the claimed method makes it possible to obtain data about the treatment effectiveness in short terms, which increases the probability of remission achievement due to individual adequate selection of a scheme for anti-tumour treatment.

5 ex

FIELD: medicine.

SUBSTANCE: invention represents a prenosological diagnostic technique for the health problems caused by exposure to vibrations involving the laboratory examination of blood, mathematical processing of the derived values, differing by the fact that patient's blood serum is examined for tumour necrosis factor-α and protein S-100β; that is followed by calculating diagnostic coefficients F1 and F2, and if F1 is less than F2, the early manifestations of the health problems caused by local vibrations are diagnosed; if F1 is equal to F2 or more, the absence of early manifestations of the health problems caused by local vibrations is stated.

EFFECT: detecting the prenosological signs of the health problems caused by local vibrations.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and can be used to determine a human genotype by polymorphism in matrix metalloproteinase MMP9-1562 C>T (rs3918242) gene. The method is based on the establishment of a melting profile with fluorescence-labelled specific oligonucleotide samples. The method uses an allele-shared pair of primers, fluorescence-labelled allele-specific oligonucleotide samples different for each allele and a general oligonucleotide labelled with a fluorescence extinguisher of the following nucleotide composition: MMP9-1562s CGAAACCAGCCTGGTCAACG; MMP9-1562a TCTGCCTCCCGGGTTCAAGC; MMP9-1562p1 GGCGCACGCCTATAA-FAM; MMP9-1562p2 GGCGCATGCCTATAA-HEX; MMP9-1562pq BHQ1-ACCAGCTACTCGGGAGGC-3'-(P), wherein FAM means the fluorescence extinguisher FAM, HEX means the fluorescence extinguisher HEX, BHQ1 means the dark fluorescence extinguisher attached to 5'-terminal nucleotide. Referring the sample to a homozygote or a heterozygote by the allele is determined by a DNA melting profile shape that is a maximum of the first fluorescence curve derivative.

EFFECT: invention enables providing more reliable and accessible genotyping.

1 dwg

FIELD: medicine.

SUBSTANCE: invention can be used for monitoring the clinical antitumour effectiveness in patients suffering B-cell chronic lymphocytic leukaemia. For this purpose, CD20-positive B-cells are measured in the peripheral blood after a therapeutic course. That is combined with determining a mean activity of CB20 antigen fluorescence on B-lymphocytes, as well as the CD25-positive B-cell count. If the measured CD20-positive B-cell count falls within the range of 0 to 20%, while the CD25-positive B-cell count is from 0 to 20% with the mean CB20 antigen fluorescence intensity of 150 standard units or more, the treatment appears to be effective. The CD20-positive B-cell and CD25-positive B-cell counts exceeding 20% with the mean CB20 antigen fluorescence intensity of less than 150 standard unit show the non-effective treatment.

EFFECT: using the given method enables stating the efficacy of the conduced therapeutic regimens at the earlier stages of the disease, before any clinical manifestations that offers a clinician the possibility to correct the therapeutic approach in good time, and reduces the rate of potential complications of using the new preparations.

3 ex, 6 dwg

FIELD: biotechnology.

SUBSTANCE: synthetic DNA is proposed, encoding human erythropoietin, having the sequence Seq ID No. 1, comprising its expression vector, the method of production of erythropoietin producer strain, and a strain of a Chinese hamster ovary cells - producer of recombinant human erythropoietin, deposited under the number RKKK(P) 761 D.

EFFECT: invention enables to increase the expression level of recombinant human erythropoietin.

5 cl, 1 tbl, 8 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology. Presented is a molecule of bispecific single-chain antibody containing a first binding domain able to bind to epitope of CD3-epsilon-chain of human and Callithrix jacchus (tamarin), Saguinus oedipus (cotton-top tamarin) and Saimiri sciureus (squirrel monkey), and a second binding domain able to bind to an antigen specified in a group consisting of: PSCA, CD19, C-MET, endosialin, EGF-like domain 1 EpCAM coded by exon 2, FAP-alpha or IGF-IR (or IGF-1R) or a human and/or a primate. The epitope CD3e contains an amino acid sequence disclosed in the description. Disclosed are a nucleic acid coding the above molecule of the bispecific single-chain antibody, an expression vector, a host cell and a method for producing the antibody, as well as the antibody produced by the method. Described is a based pharmaceutical composition containing the molecule of the bispecific single-chain antibody and a method for preventing, treating or relieving cancer or an autoimmune antibody. Presented is using the above molecule of the bispecific single-chain antibody for making the pharmaceutical composition for preventing, treating or relieving cancer or the autoimmune disease.

EFFECT: using the invention provides the clinical improvement in relation to T-cell redistribution, reducing it, and the improved safety profile.

23 cl, 74 dwg, 17 tbl, 33 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to antibodies including human antibodies and their antigen-binding portions, which specifically bind to CCR2, in particular to human CCR2, and can act as CCR2 inhibitors. Anti-CCR2 antibodies are those binding to first and/or second extra-cellular CCR2 loops. The present invention also refers to human anti-CCR2 antibodies and to their antigen-binding portions. The present invention refers to the recovered heavy and light chains of immunoglobulin initiated from human anti-CCR2 antibodies, and to nucleic acid molecules coding such immunoglobulins. The present invention also refers to methods for preparing human anti-CCR2 antibodies and their antigen-binding portions, to compositions containing such antibodies or their antigen-binding portions, and to methods for using antibodies and their antigen-binding portions, and compositions for diagnosing and treating.

EFFECT: invention refers to methods for gene therapy with the use of nucleic acid molecules coding molecules of heavy and light chains of immunoglobulin, wherein the above molecules contain anti-CCR2 antibodies and their antigen-binding portions.

25 cl, 24 dwg, 8 tbl, 17 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. Presented are antibodies targeting integrin α2β1 containing humanised anti-integrin alpha-2 (α2) antibodies, as well as a method of treating by the integrin α2 antibodies. The humanised integrin α2 antibodies comprise a variable region of a light chain domain, a constant human light chain domain and a variable constant heavy chain domain of human IgG1, which exhibit the altered effector function. The variable constant heavy chain domain of human IgG1 comprises an S324N substitution. The invention can be used in medicine.

EFFECT: antibodies exhibit complement-dependent cytotoxicity, improved antibody-dependent cell-mediated cytotoxicity and improved CDC and ADCC.

33 cl, 3 dwg, 1 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology.

EFFECT: bispecific anti-human vascular endothelial growth factor VEGF and human angiopoietin-2 ANG-2 antibodies, methods for producing them, pharmaceutical compositions containing the above antibodies, and using them are described.

13 cl, 26 dwg, 15 tbl, 19 ex

Siglec-15 antibody // 2539790

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is described is a pharmaceutical composition used for treating and/or preventing pathological bone metabolism and containing this antibody. The invention can be used in medicine.

EFFECT: antibody and its functional fragment specifically recognising human Siglec-15 and possessing the osteoclast inhibitory activity are described.

73 cl, 57 dwg, 4 tbl, 33 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is described is a recovered human antibody or its antigen-binding fragment. The antibody binds to human interleukin-4 alpha-receptor (hlL-4R). There are also described a nucleic acid molecule coding this antibody, an expression vector, a host cell, a method for producing such antibody and a therapeutic composition containing this antibody.

EFFECT: presented group of inventions can be used in medicine for treating asthma and atopic dermatitis.

15 cl, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of biotechnology. Disclosed are methods and technologies of hepatitis C virus neutralisation, as well as antibodies against hepatitis C virus. It is suggested to apply completely human homogeneous antibodies RYB1, RYB2 and RYB3, as well as compositions on their base for prevention and treatment of hepatitis C. Said antibodies are obtained by cultivation by hybrid BIONA-RYB1, BIONA-RYB2 and BIONA-RYB3. Efficiency of antibodies is conditioned by the fact that they bind epitopes, respectively, E1, E2, E3 of protein E2 of hepatitis C virus envelope. Neutralising activity of antibodies on modal system of human cells infection in culture is demonstrated. It is shown that application of claimed group of inventions makes it possible to increase reliability of binding hepatitis C virus by antibodies.

EFFECT: claimed group of inventions can be applied in medicine, pharmaceutical industry and close fields of science and technique.

9 cl, 9 dwg, 8 tbl, 13 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to molecular biology and genetic engineering. What is declared is a genetically modified mesenchymal stem cell for the selective expression of cytotoxic protein containing exogenous nucleic acid comprising a region coding cytotoxic protein and functionally bound to a promoter or a combination of promoter/enhancer, wherein the promoter or the combination of promoter/enhancer cause the selective expression of cytotoxic protein, when the genetically modified mesenchymal stem cell closes the stromal tumour tissue.

EFFECT: what is declared is the genetically modified mesenchymal stem cell for the selective expression of cytotoxic protein.

30 cl, 10 dwg, 2 tbl

FIELD: chemistry.

SUBSTANCE: claimed invention relates to nucleic acids, coding functional AID mutants, to vectors and cells, including said nucleic acids. Claimed invention also relates to methods of applying mutants of AID protein.

EFFECT: obtaining functional mutants of protein of activation induced cytidine deaminase (AID), which possess higher activity in comparison with wild type AID protein.

39 cl, 11 dwg, 14 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to biotechnology and represents an expression plasmid without resistance to an antibiotic, containing a polynucleotide, coding a repressor protein cI. The expression of the said repressor protein regulates the expression of a toxic gene product, embedded into a non-essential section of a host genome. The claimed invention also discloses a constructed host cell, belonging to Gram-negative bacteria, which contains the said plasmid. The host cell is used to obtain the plasmid or to obtain a protein or an immunogen, if the expression plasmid additionally contains genes, coding the said protein or immunogen. The method of obtaining the expression plasmid and the method of obtaining the protein or immunogen are carried out in several stages. First, a strain of host cells, belonging to the Gram-negative bacteria, is created by embedding by the allele substitution of the gene, coding the toxic product, into the non-essential section of a host chromosome. After that, construction of the DNA-plasmid, which contains the gene, coding the repressor protein cI, and in case of necessity the gene, coding the protein or immunogen, is performed. Then, the obtained host cells are transformed by the said plasmid and grown in the presence of sucrose at a temperature of 30-42°C.

EFFECT: invention makes it possible to realise control of the toxic gene, localised on a chromosome, by means of the repressor, localised on the plasmid in the absence of selective pressure by an antibiotic.

33 cl, 31 dwg, 8 tbl, 10 ex

Up!