Improved bordetella pertussis vaccines based on mutant glycosyltransferases lps

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is presented is a host cell of Bordetella pertussis, Bordetella bronchiseptica or Bordetella parapertussis, which is used as an adjuvant or for preventing or treating whooping cough, having the low activity of endogenous glycosyltransferase at least 98% identical to the amino acid sequence SEQ ID NO: 2 as compared to the activity of glycosyltransferase of a relative parent strain, wherein the low activity is ensured by using an inactivating vector, which causes the inactivation of expression of a sequence of endogenous nucleic acid coding glycosyltransferase, or reduces to a low level of expression of the sequence of endogenous nucleic acid coding glycosyltransferase by the fusion of nucleic acid coding glycosyltransferase with a low-level or inducible promotor. What is disclosed is a preparation consisting of LPS of the above host cell with an increased replacement of hexosamine 1' or 4' phosphate groups of LPS referred to a lipid A, as compared to a LPS preparation from the related parent strain; thereby LPS is characterised by producing at least 8 ions in the ESI-MS spectrum, wherein the preparation is used as an adjuvant or for preventing or treating whooping cough. What is presented is using the above host cells or the LPS preparation for producing the preparation for preventing and/or treating whooping cough, or producing the drug preparation for immunising a mammal, wherein the host cells or LPS is used as an adjuvant. What is described is a pharmaceutical composition used as the adjuvant or for preventing or treating Bordetella infection containing the above host cell or above LPS preparation in an effective amount and a pharmaceutically acceptable carrier.

EFFECT: invention enables producing the pharmaceutical preparation of Bordetella cells or LPS, possessing the high immunogenicity as compared to the preparation of the related parent strain Bordetella.

12 cl, 7 dwg, 3 tbl, 1 ex

 

The scope to which the invention relates

The invention relates to an improved vaccine against pertussis containing mutant strains ofBordetella pertussiswith the modified LPS molecule and/or LPS molecules derived from these mutant strains. These mutant strains and/or received LPS molecules can be further used as adjuvant.

Prerequisites to the creation of inventions

LPS is an amphiphilic molecule, located on the outer side of the outer membrane of gram-negative bacteria. LPS has as endotoxic activity, and adjuvant activity. Both properties are based on the recognition of its receptor complex TLR4/MD-2 master (overview presents the Pålsson-McDermott and O'neill, 2004; O'neill, 2006). LPS consists of three distinct structural domains: lipid A, core and O-antigen. Lipid A is functioning as a hydrophobic membrane anchor and forms a biologically active molecules (Takada and Kotani, 1989). The core area consists of a complex oligosaccharide that, compared with the O-antigen, demonstrates only limited structural variability. In some bacteria, such asEnterobacteriaceaethe oligosaccharide core (nuclear OS) can be divided into an inner core and outer core. The outer core is mainly composed of hexoses in pyranose form of D-glucose, D-Gal is ctazy and D-glucosamine, while the inner core mainly consists of octulosonic acids and getoperand. The vast majority of gram-negative bacteria nuclear domain connected with the domain lipid And special carbohydrate, 2-keto-3-desoxycholate acid (Kdo) (Raetz and Whitfield, 2002). O-antigen contains the most variable part of the LPS and gives the bacteria serotype specificity. O-antigen consists of repeating sugar subunits of one to eight sugars. Each Of the chain can contain up to 50 subunits. O-antigen is involved in the escape of the bacteria from immune surveillance, especially the avoidance of serum complement-mediated lysis (Raetz and Whitfield, 2002).

Unlike LPSBordetella bronchisepticaandBordetella parapertussis, LPSBordetella pertussisnever contains O-antigenic domain (Peppler, 1984; Di Fabioet al., 1992). Therefore, LPSB. pertussisoften referred to as lipooligosaccharide.B. pertussisproduces two dominant forms of LPS, LPS group a and group b (Peppler, 1984). LPS group consists of lipid a and oligosaccharide core consisting of 9 carbohydrates (Caroffet al., 2000). Adding limit trisaccharide consisting ofN-acetylglucosamine, 2,3-diacetamido-2,3-dideoxyinosine acid and 2-acetamido-4-Nmethyl-2,4-dideoxyhexose to the LPS group forms LPS, called group A.

TheEscherichia coliandSalmonella entericaserovar Typhimurium, g the config cluster biosynthesis nuclear OS consists of three operons, denoted bygmhD,waaQandWaaAoperons. OperongmhDconsists of four genes,gmhDandwaaFCLwho are involved in the synthesis of the inner core (Schnaitman and Klena, 1993). GenesgmhD,waaFandwaaCencode proteins involved in the biosynthesis and transfer Gatos I and II to the Kdo2-lipid A (Schnaitman and Klena, 1993), whereas the gene productwaaLis a ligase, which is involved in the accession of the O-antigen (MacLachlanet al., 1991). OperonwaaQis the largest of the three operons and encodes proteins that are involved in the biosynthesis of the outer core and in the modification/scenery nuclear OS. The number and types of genes in the operonwaaQdiffer in strains that explains the strain-specific differences in the structure of the nucleus (Heinrichset al., 1998). OperonwaaAoften encodes only one protein, KdtA. OnlyE. coliK-12 is an additional, unrelated to LPS open reading frame (ORF) (Raetz and Whitfield, 2002). GenekdtAEnterobacteriaceaeencodes a bifunctional the Kdo transferase, which adds two Kdo residue in the biosynthesis of Kdo2-lipid A (Clementz and Raetz, 1991).

Although nuclear OSBordetellaandE. colidemonstrates some similarities, the exact composition and configuration of the residues show significant differences. For example, nuclear OSBordetellacontains only the Kdo residue, instead of two or three residues that are found in most other gr is otricatelnyh bacteria, includingE. coli. Recently it was shown through the operation of theBordetellaKdtA as monofunctional and bifunctional not Kdo transferase (Isobeet al., 1999). The enzymes responsible for the synthesis of the remaining parts of the nuclear OSBordetella,currently unknown, and is expected to further identification.

Although lipid A largely regarded as the main determinants for the biological activity of LPS activation of a receptor complex TLR4/MD-2, the area of the oligosaccharide can also play an important role in the interaction with antigen-presenting cells (APC). The receptors involved in this type of recognition LPS include complement receptor CR3 and phagocytic receptor SR-A (van Amersfoortet al., 2003; Plüddemannet al., 2006).

Some vaccinesBordetella pertussishas already been used. The introduction of whole cell pertussis vaccine (wP) in the 1940s and 1950s, and later acellular pertussis vaccine (aP) in the 1980s and 1990s, led to a gradual reduction in the incidence of pertussis and reduce the spread of the disease and mortality from this disease to low levels. Despite extensive area of vaccination, the disease pertussis remains endemic and continues to demonstrate cyclical with peaks of incidence every 2-5 years. Over the last two decades, some countries, including Niderle the water, experienced an increase in the number of reported cases of pertussis. Interestingly, in some areas, we also observed a change in the age distribution. Whereas in the era of pre-vaccination and early vaccination on cases of pertussis were mainly reported in young children, in recent years an increasing proportion of cases accounted for adults and adolescents. It was suggested several reasons for the revival of the reported cases of pertussis, including: (1) genetic changes in circulating strains ofB. Pertussiswhich reduce the effectiveness of the vaccine, (2) reduced efficiency kalyshevych vaccines, (3) reduced immunity, (4) the increase in reported cases of pertussis (whooping cough), and (5) improving the diagnosis of whooping cough.

Thus, there is still a need for new vaccines againstBordetella pertussislacking the disadvantages of existing vaccines.

Description of the invention

The present invention is based on the hypothesis that mutant strains ofB. pertussiswith the modified oligosaccharide chain may be affected in their interaction with dendritic cells (DC). Specific targeting antigen-presenting cells (APC), such as DC, could conceivably affect the outcome of the immune response against whole cell pertussis vaccine. As a first step toward improving whole cell vaccines so is m by, the inventors have currently identified a gene cluster involved in the biosynthesis of the oligosaccharide of LPS inB. pertussis. In particular, two genes in this cluster when inactivation or overexpression of this gene give mutant strains with improved potential to interact with DC and activate them.

Polypeptides

In the first aspect of the invention relates to two polypeptides.

The first polypeptide represents the polysaccharide deacetylase and has an amino acid sequence at least 50% identical to the amino acid sequence of SEQ ID NO:1.

The second polypeptide is glycosyltransferase and has an amino acid sequence at least 50% identical to the amino acid sequence of SEQ ID NO:2.

The deacetylase activity of polysaccharides relative to the polypeptide glycosyltransferase gene preferably is determined by the overexpression relative to the inactivation of the corresponding encoded gene in strainBordetella pertussisdefined later in this application, and analysis derived LPS. In those cases, when LPS produced a transformed strain ofBordetella pertussiscontains at least the detected number of LPS according to the invention, as hereinafter defined in this application, it is said that deacetylase polysaccharide, is responsible polypeptides glycosyltransferases has been an active and functional. Detected number of LPS preferably determined as described in the examples: after separation by extraction with hot phenol/water (Westphal and Jann, 1965), O-desacetyldiltiazem mild hydrolysis (Holst 2000) and analysis using ESI-MS (mass spectrometry with ionization by elektrorazpredelenie) in the detection of negative ions.

In accordance with another preferred embodiment, the polypeptide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%, even more preferably at least 90%, 92%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO:1. In the most preferred embodiment, deacetylase polysaccharide has the sequence of SEQ ID NO:1. This deacetilaza polysaccharide is fromBordetella pertussis. The nucleotide sequence encoding the amino acid sequence of SEQ ID NO:1 set forth in SEQ ID NO:3.

In accordance with another even more preferred embodiment, the polypeptide is at least 50%, 55%, 60%, 65%, 70%, 75%, 80% or 85%, even more preferably at least 90%, 92%, 95%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO:2.

In a preferred embodiment, glycosyltransferase has SEQ ID NO:2. This glycosyltransferase comes fromBordetella pertussis. The sequence of the nucleic acid that encodes the amino is isatou sequence of SEQ ID NO:2, presented in SEQ ID NO:4.

The percentage of identity is calculated as the number of identical amino acid residues between the aligned sequences divided by the length of the aligned sequences minus the length of all gaps. Alignment of multiple sequences was conducted using optimal alignment DNAman 4.0, using the default settings. Alignment is usually performed between sequences defined by their SEQ ID NO or parts thereof. Preferably, the alignment is done using the sequence defined by their SEQ ID NO.

The person skilled in the art will understand that the polypeptides of the present invention could be obtained from other organisms, other thanBordetella pertussisprovided that they have the required activity and identity. In the preferred embodiment, each polypeptide, as defined above, obtained from a species ofBordetellasuch aspertussis, bronchiseptica, parapertussis. Most preferably, each polypeptide defined above, derived fromBordetella pertussis.One particular strain ofBordetella pertussisor more different strains ofBordetella pertussiscan have multiple homologous polypeptides in accordance with the present invention.

In accordance with another preferred embodiment, the polypeptide according to izopet the tion is a variant of any of the polypeptide sequences previously defined. The variant polypeptide may be a non-natural form of the polypeptide. Variant polypeptide may differ due to the used genetic engineering techniques from the polypeptide isolated from a natural source. A variant can be created using site-directed mutagenesis starting from the amino acid sequence of SEQ ID NO:1 or SEQ ID NO:2 or with a nucleic acid sequence that encodes amino acid sequence SEQ ID NO:1, which is SEQ ID NO:3, or of a nucleic acid sequence that encodes amino acid sequence SEQ ID NO:2, which is SEQ ID NO:4. Preferably, the variant polypeptide contains a mutation that does not alter the biological function of the encoded polypeptide. Biological function or activity or polysaccharide deacetylase or glycosyltransferases has already been defined in the present description.

In another aspect of the present invention presents deacetilaza polysaccharide, respectively glycosyltransferase, as defined previously, both for use for the manufacture of a medicinal product. Preferably, the specified drug is a vaccine or adjuvant as defined hereinafter in the present description.

Nucleic acid sequence

In the second aspect of the present invention presents two sequences of nucleic acids.

The first sequence encodes the polysaccharide deacetylase having the amino acid sequence at least 50% identical to the amino acid sequence of SEQ ID NO:1, preferably having the amino acid sequence of SEQ ID NO:1, and/or originating from the speciesBordetellapreferablyBordetella pertussis.

The first nucleic acid sequence is preferably a sequence of nucleic acids of at least 50% identical to the nucleic acid sequence SEQ ID NO:3. Preferably, the identity is at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, more preferably at least 95%, even more preferably at least 98% and even more preferably at least 99%. Most preferably, the sequence of the nucleic acid has the nucleic acid sequence SEQ ID NO:3. SEQ ID NO:3 corresponds to NP_8809668.

The second nucleic acid sequence encodes glycosyltransferase having the amino acid sequence, at which ore is 50% identical to the amino acid sequence of SEQ ID NO:2, preferably having the amino acid sequence of SEQ ID NO:2 and/or originating from the speciesBordetellapreferablyBordetella pertussis.

The second nucleic acid sequence is preferably a sequence of nucleic acids, at least 50% identical to the nucleic acid sequence SEQ ID NO:4. Preferably, the identity is at least 55%, more preferably at least 60%, more preferably at least 65%, more preferably at least 70%, more preferably at least 75%, more preferably at least 80%, more preferably at least 85%, more preferably at least 90%, even more preferably at least 95%, even more preferably at least 98% and even more preferably at least 99%. Most preferably, the sequence of the nucleic acid has the nucleic acid sequence SEQ ID NO:4. SEQ ID NO:4 corresponds NP_8809669.

Percent identity was determined by calculating the ratio of the number of identical nucleotides in the sequence divided by the length of all nucleotides minus the length of all gaps. The multiple alignment of DNA sequences was performed using DNAman version 4.0 using the Optimal Alignment (Full Alignment). The minimum is the length of the relevant sequence DNA, showing 50% or higher level of identity, must be 40 nucleotides or longer. Alignment is usually performed between sequences defined by their SEQ ID NO, or parts thereof. Preferably, the alignment is done using the sequence defined by their SEQ ID NO.

In accordance with another preferred embodiment, the nucleic acid sequence according to the invention is a variant of any of the nucleic acid sequences defined above. Variants of the nucleic acid sequence can be used to generate variants of the polypeptide defined previously. A variant nucleic acid may be a fragment of any of the nucleic acid sequences defined above. A variant nucleic acid may be a nucleic acid sequence that differs from SEQ ID NO:3 or SEQ ID NO:4 due to the degeneracy of the genetic code. A variant nucleic acid may also be an allelic variant of SEQ ID NO:3 or SEQ ID NO:4. Allelic variant means any of two or more alternative forms of a gene occupying the same chromosomal locus. Preferred nucleic acid is a nucleic acid sequence that soda is separated by silent mutation (mutation). Alternative or in combination, a variant nucleic acid may also be obtained by introduction of nucleotide substitutions which do not give rise to another amino acid sequence of the polypeptide encoded by the nucleic acid sequence, but which corresponds to the frequency of codon usage by the body-master, intended for the production of the polypeptide of the present invention. In accordance with the preferred embodiment, the variant nucleic acid encodes a polypeptide that is still showing its biological function defined previously in the present description. More preferably, the variant nucleic acid sequence encodes a polypeptide exhibiting the activity of the polysaccharide deacetylase or glycosyltransferases, respectively. Nucleic acid sequence encoding such a polypeptide may be isolated from any organism.

All these options can be obtained using methods known to the expert, such as the screening of the library by hybridization (methods southern blot) hybridization conditions from low to medium and to high in relation to the nucleic acid sequence SEQ ID NO:3 or SEQ ID NO:4 or its variants, which can be used to create a probe. Terms of severity from low to medium and it will vysokovskaja prehybridization and hybridization at 42°C in 5X SSPE, of 0.3% SDS, 200 PG/ml cleaved and denatured DNA, salmon sperm, and either 25%, 35% or 50% formamide for low-medium-high severity, respectively. Then, the hybridization reaction is washed three times for 30 minutes each using 2XSSC, 0.2% of SDS and either 55°C, 65°C or 75°C for low-medium-high severity.

Information on the sequences disclosed in the present description, should not be so narrowly interpreted as to require the inclusion mistakenly identified reason. The specialist can identify such erroneously identified base and knows how to correct these errors.

In another aspect of the present invention presents a nucleic acid encoding the polysaccharide deacetylase, respectively glycosyltransferase, as defined previously, both nucleic acid designed to be applied to obtain drugs. Preferably the specified drug is a vaccine or adjuvant as defined hereinafter in the present description.

The design of nucleic acid

In another aspect the present invention relates to the design of nucleic acid containing any of the nucleic acid sequences defined in the previous section, the sequence of the nucleic acid is derouet polypeptide, showing:

The activity against polysaccharide and having an amino acid sequence that is at least 50% identical to the amino acid sequence of SEQ ID NO:1, or

Activity in respect of glycosyltransferases and having an amino acid sequence that is at least 50% identical to the amino acid sequence of SEQ ID NO:2.

Optionally, the nucleic acid sequence is present in the design nucleic acid operatively linked to one or more control sequences that direct the production of the polypeptide in a suitable expression host.

In the present description "operatively linked" is defined as a configuration in which a control sequence is appropriately located in a position relative to the nucleic acid sequence that encodes a polypeptide according to the invention in such a way that the control sequence directs the production of a polypeptide according to the invention.

It will be clear that the expression includes any stage involved in the production of the polypeptide, including, but not limited to, transcription, post-transcriptional modification, translation, post-translational modification and secretion.

The design of the nucleic acid is defined as a molecule nuclei the OIC acid, which is isolated from a natural gene or which has been modified to contain segments of nucleic acid which are combined or connected in a manner that otherwise would not exist in nature.

Defined in the present description of the control sequence includes all components that are required or preferred for expression of the polypeptide. As a minimum, the control sequences include a promoter and stop signals trascription and broadcast.

The expression vector of

The present invention additionally relates to the expression vector containing the design nucleic acid containing a nucleic acid sequence encoding a polypeptide exhibiting deacetylase activity against polysaccharide and having an amino acid sequence that is at least 50% identical to the amino acid sequence of SEQ ID NO:1, defined in the previous section. Preferably, the expression vector contains a nucleic acid sequence that is operatively linked to one or more control sequences that direct the production of the encoded polypeptide in a suitable expression host. As a minimum, the control sequences include a promoter and stop signals is ranscription and broadcast. The expression vector can be considered as a recombinant expression vector. The expression vector may be any vector (e.g., a plasmid, a virus), which can be subjected to the techniques of recombinant DNA and which can realize the expression of a nucleic acid sequence that encodes the polypeptide. Depending on the form of the master, which will be introduced the expression vector and the origin of the nucleic acid sequence of the present invention, a specialist will know how to choose the most suitable expression vector and a control sequence. The most preferred cell owners are presented in the section titled cell hosts.

In the context of the present invention the expression vector when introduced into a cell of the host will lead to the fact that in the cell will increase the level of expression of a nucleic acid sequence, located in the expression vector, and/or increase the level of expression of the polypeptide encoded by the nucleic acid sequence, located in the expression vector, and/or increase the level of activity of polypeptide encoded by the nucleic acid sequence, located in the expression vector. In this context, the increase is estimated in comparison with the host-cell, which does not include the specified expression vector, and/or the cell-master, which does not contain an endogenous polypeptide that is at least 50% identical to SEQ ID NO:1.

In another aspect of the present invention represented by the expression vector, as described previously, to use, to get drugs. Preferably the specified drug is a vaccine or adjuvant, as hereinafter defined.

Inactivating vector

The present invention additionally relates to inactivating vector containing the design nucleic acid containing a nucleic acid sequence encoding a polypeptide exhibiting glycosyltransferase activity and having an amino acid sequence that is at least 50% identical to the amino acid sequence of SEQ ID NO:2 described in the previous section. Inactivating vector create to reduce or inactivate the expression of a nucleic acid sequence that is at least 50% identical to the amino acid sequence of SEQ ID NO:2 in a given host.

Vector inactivation can be regarded as a recombinant expression vector. Inactivating vector may be any vector (e.g., a plasmid, a virus), which can be subjected to the techniques of recombinant DNA and which can realize the inactivation of the expression of the sequence is lnasty nucleic acid, as defined above. Depending on the form of the master, which will be introduced inactivating vector and origin of the nucleic acid sequence according to the invention, the specialist will know how to choose the most suitable inactivating vector. The most preferred cell owners are presented in the section titled cell hosts.

In the context of the present invention, inactivating vector when introduced into a cell of the host will lead to the fact that in this cell will be reduced (decreased) level of expression of a nucleic acid sequence, located in the expression vector, and/or a reduced level of expression of the polypeptide encoded by the nucleic acid sequence, located in the expression vector and/or a reduced level of activity of polypeptide encoded by the nucleic acid sequence, located in the expression vector. In this context, the reduction preferably is evaluated by comparison with the host-cell, which does not contain the specified inactivating vector.

Decrease the level of expression of the polypeptide exhibiting glycosyltransferase activity and having an amino acid sequence that is at least 50% identical to the amino acid sequence of SEQ ID NO:2, and/or a decrease in its level of activity was achieved by the traditional is nymi ways, known from the prior art, for example, inactivation or negative expression regulation sequence of the endogenous nucleic acid that encodes a specified glycosyltransferase the owner. Such inactivation or negative regulation can be achieved by deletion of one or more nucleotides in the nucleic acid sequence that encodes the specified polypeptide. In another embodiment, the invention relates to a host, preferably Bordetella, which has a mutation in a nucleic acid sequence that encodes a specified glycosyltransferase. It is preferable to obtain a master having inactivate the nucleic acid sequence that encodes glycosyltransferase, get vector substitution or inactivating vector, and subsequently administered to the host by transformation. The specialist knows how to obtain such a vector.

Alternative or in combination with inactivation of the endogenous sequence of the nucleic acid that encodes glycosyltransferase, the expression of a nucleic acid sequence that encodes glycosyltransferase, can be reduced by merging it with a weak promoter suitable for expression of the protein at a low level in the selected organism.

Alternative or in combination with inactivation sequence well Lanovoy acid, coding endogenous glycosyltransferase, the expression of a nucleic acid sequence that encodes glycosyltransferase, can be made inducible by merging it with an inducible promoter that is suitable for inducible expression level of the protein in a selected organism.

Alternative or in combination with the previously described preferred embodiment, inactivation of the nucleic acid sequence that encodes the endogenous glycosyltransferase preferably achieved by using a suicide vector. More preferably, the suicide vector represents pSS1129 (Stibitz et al., 1994).

In another aspect of the present invention presents inactivating vector, as described previously, to apply to obtain drugs. Preferably the specified drug is a vaccine or adjuvant as defined hereinafter in the present description.

A host cell

In another aspect, the invention relates to the cell host containing an expression vector of the present invention and/or inactivating vector of the present invention, both the vector described in the previous sections. The choice of host cell will to a large extent depend on the source of the nucleic acid sequence on the right is bretania. Depending on the type of host cell, the expert knows how to transform this cell design or vector of the present invention.

The host-cell can be any microbial prokaryotic or eukaryotic cell suitable for the expression of LPS according to the invention. In a preferred embodiment, a host cell is a species ofBordetellaas mentioned earlier in this description. Most preferably,Bordetellarepresents aBordetella pertussis.

Methods suitable for transformationBordetellamay include a method comprising conjugation, to a certain extent familiar to the specialist. Methods suitable for transformationBordetella,described by Stibitz et al., 1994.

In accordance with the first preferred embodiment, thus obtained a host cell has an increased level of expression of a nucleic acid sequence, located in the expression vector, and/or has an increased level of expression of the polypeptide encoded by the nucleic acid sequence, located in the expression vector, and/or has an increased level of activity of polypeptide encoded by the nucleic acid sequence, located in the expression vector. In this embodiment, the sequence of nucleic KIS is the notes, in expressing the design, encodes a polypeptide at least 50% identical to SEQ ID NO:1. In this context, the increase is estimated by comparison with the host-cell, which does not include the specified expression vector and/or with the host-cell, which does not contain an endogenous polypeptide that is at least 50% identical to SEQ ID NO:1 under cultivation of both cells and/or analysis in the same conditions.

"Increased expression of the polypeptide in the present description is preferably defined as the production of a larger amount of the polypeptide, as defined earlier than the quantity that will produce the parent of a host cell, which is transformed cell under cultivation in both types of cells (parental and transformed cells) in the same conditions. Preferably, a host cell of the present invention produces at least 3%, 6%, 10% or 15% more of the polypeptide according to the invention, at least 50% identical to SEQ ID NO:1 than to produce the parent of a host cell, which is transformed by a host cell under cultivation in both types of cells (parental and transformed cells) in the same conditions. Also preferred are the owners that produce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% the sludge is 150% greater than a specified polypeptide, than the parent cell. In accordance with another preferred embodiment the level of production of the polypeptide by the cell host according to the present invention is compared with the level of production strain B213Bordetella pertussis(Kasuga et al., 1953, see also Table 1), which is taken as control. In accordance with another preferred embodiment, in cases where a host cell according to the invention is a strain ofBordetella pertussisthe production level of the polypeptide in the host cell according to the invention compared with the level of production strain B213, as defined above, which is taken as control.

Assessment of the level of production of the polypeptide can be performed at the mRNA level, by performing Northern blot or dot matrix analysis, and/or level of the polypeptide, carrying out Western blotting. All of these methods are well known to the specialist.

"The increase in the activity of the polypeptide in the present description is defined as the manifestation of a higher activity of the polysaccharide deacetylase than the activity of the parent host cell is from a transformed cell using an analysis specific to the specified activity. Preferably, the analysis is the analysis referred to in section polypeptides. Preferably, a host cell according to the invention shows at least n is 3%, 6%, 10% or 15% higher activity of the polysaccharide deacetylase than will show the parent of a host cell, which is transformed cell was investigated using specific for the specified activity analysis, which preferably represents the analysis referred to in section polypeptides. Also preferred is the owner, who demonstrates at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% greater than the specified activity than the parent cell. In accordance with another preferred embodiment, the level of activity of the polysaccharide deacetylase host cell of the present invention compared to the corresponding activity of the strain B213, as defined above, which is taken as control. In accordance with the preferred embodiment, in cases where a host cell according to the invention is a strain ofBordetella pertussisthe level of activity of the polysaccharide deacetylase host cell according to the invention compared to the corresponding activity of the strain B213, as defined previously, which is taken as control.

The increased expression of the polypeptide and/or activity can be achieved by conventional methods known from the prior art, for example by introducing into the host a larger number of copies posledovatelnostyakh acid, encoding the polysaccharide deacetylase, whether in the media or in the chromosome than there is in nature. Alternatively, the nucleic acid sequence encoding the polysaccharide deacetylase, can hyperexpression by merging it with highly expressed or strong promoter suitable for high level expression of the protein in a selected organism, or a combination of the two approaches. The specialist will know what a strong promoter is the most appropriate, depending on the type of host cell. Preferably, when a host cell is a strain ofBordetella pertussis, a strong promoter istac-promoter vector pMMB67EH (Methods for General and Molecular Bacteriology, Editors P. Gerhardt et al., American Society for Microbiology, Washington DC, 1994, p.409-410).

Alternative or in conjunction with the first preferred embodiment, the present invention relates to a second preferred variant implementation, in which a host cell has a reduced level of expression of a nucleic acid sequence that encodes a polypeptide at least 50% identical to the amino acid sequence of SEQ ID NO:2, and/or has a reduced level of expression of the specified polypeptide and/or an increased level of activity of the specified polypeptide, preferably through the use of nectivorous the th vector according to the invention, described previously in the present description. In this embodiment, the nucleic acid sequence, located in inactivating vector that encodes a polypeptide at least 50% identical to SEQ ID NO:2. In this context, the reduction is assessed by comparing with the host-cell, which does not contain such inactivating vector, when the cultivation of both cells and analyzing them in the same conditions.

"Reducing the level of expression of the polypeptide in the present description is preferably defined as the production of a smaller amount of the polypeptide described earlier, than will be produced by the parent cell, which is transformed by a host cell, when the cultivation of both cells (parental and transformed cells) in the same conditions. Preferably, a host cell of the present invention produces at least 3%, 6%, 10% or 15% less of the polypeptide according to the invention, at least 50% identical to SEQ ID NO:2, what will produce the parent of a host cell, which is transformed by a host cell under cultivation both types of cells (parental and transformed cells) in the same conditions. Also preferred are the owners that produce at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% less than the decree of the frame of the polypeptide, than the parent cell. In accordance with another preferred embodiment, the production level of the polypeptide in the host cell according to the invention compared with the level of production strain B213, described previously, which is taken as control. In accordance with another preferred embodiment, in cases where a host cell according to the invention is a strain ofBordetella pertussisthe production level of the polypeptide in the host cell according to the invention compared with the level of production strain B213, described above, which is taken as control.

Assessment of the level of production of the polypeptide can be performed at the mRNA level, by performing Northern blot or dot matrix analysis and/or level of the polypeptide, carrying out Western blotting. All of these methods are well known to the specialist.

"Reducing polypeptide activity" in the present description is defined as the manifestation of a lower activity of glycosyltransferases than the activity of the parent host cell is from a transformed cell using an analysis specific to the specified activity. Preferably, the analysis is the analysis already described in the present description in section polypeptides. Preferably, a host cell according to the invention shows at least 3%, 6%, 10% or 15 below the activity of glycosyltransferases, what will be the parent of a host cell, which is transformed by a host cell, which investigated using specific analysis for the specified activity, which preferably represents the analysis described in section polypeptides. Also preferred is a host that exhibits at least 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 100% or 150% greater than the specified activity than the parent cell. In accordance with another preferred embodiment the level of activity of glycosyltransferases host cell according to the invention compared to the corresponding activity of the strain B213, described previously, which is taken as control. In accordance with the preferred embodiment, in cases where a host cell according to the invention is a strain ofBordetella pertussisthe level of activity of the polysaccharide deacetylase host cell according to the invention compared to the corresponding activity of the strain B213, described above, which is taken as control.

Decrease in the expression of the polypeptide and/or activity can be achieved by conventional methods known from the prior art, for example by introducing into the cell host a larger number of copies of a nucleic acid sequence that encodes the deacetylase of Polish the IDA, whether in the media or in the chromosome than that found in nature. Alternatively, the nucleic acid sequence that encodes the polysaccharide deacetylase, can be hyperexpression by merging it with highly expressed or strong promoter suitable for high level expression of the protein in a selected organism, or a combination of these two approaches. The specialist will know what a strong promoter is the most appropriate, depending on the type of host cell. Preferably, when a host cell is a strain ofBordetella pertussis, a strong promoter istac-promoter vector pMMB67EH as described above.

In accordance with the preferred embodiment, a host cell does not produce any detectable amounts of the glycosyltransferases of the invention and/or exhibits no detectable glycosyltransferase activity. Preferably, a host cell does not produce or does not inherently produces glycosyltransferase.

Alternatively, in accordance with another preferred embodiment, a host cell produces inducible number of glycosyltransferases of the invention and/or exhibits inducible glycosyltransferase activity.

Decrease the level of expression of the glycosyltransferases what about the invention and/or a reduced level of activity can be achieved by conventional methods, known from the prior art, for example, inactivation or negative regulation of nucleic acid sequence that encodes the endogenous glycosyltransferase owner. Inactivation or negative regulation can be achieved by deletion of one or more nucleotides in a gene encoding a. In another embodiment, the present invention relates to a host, preferablyBordetella pertussis,having a mutation in a nucleic acid sequence that encodes glycosyltransferase. Preferably, to obtain a master having inactivate the nucleic acid sequence that encodes glycosyltransferase, get vector substitution or inactivating vector, and subsequently administered to the host by transformation. The specialist will be clear how to obtain such a vector.

Alternative or in combination with inactivation of the endogenous sequence of the nucleic acid, expression of the nucleic acid sequence that encodes glycosyltransferase, can be reduced by merging it with a weak promoter, suitable for low level of expression of the protein in a selected organism.

Alternative or in combination with inactivation of the endogenous sequence of the nucleic acid, expression of the nucleic acid sequence that encodes glycosyltransferase the ABC, may be inducible by merging it with an inducible promoter that is suitable for inducible expression level of the protein in a selected host. Preferably, when a host cell is a strain ofBordetella pertussis, the inducible promoter is atac-promoter vector pMMB67EH described previously.

Suddenly, a host cell of the present invention has the attractive properties that make it very attractive for use as the whole kolusheva vaccine or adjuvant: improved potential ability to interact with DC, and for the subsequent induction of maturation and to induce the production of proinflammatory cytokines. Alternative or in combination, LPS derived from these cells is also very suitable for use as a vaccine or adjuvant, as described below.

Accordingly, in another aspect of the present invention presents a host cell, as described previously, for use as a drug. Preferably, the specified drug is a vaccine or adjuvant defined hereinafter in the present description.

LPS derived using the host cell

In another aspect, the present invention relative to the Xia to LPS, derived from the host cell according to the invention, as defined previously in the present description. Preferably, the host-cell types areBordetellamore preferablyBordetella pertussiseven more preferablyBordetella pertussiswith overexpression of the polysaccharide deacetylase of the present invention and/or inactivation of the glycosyltransferases of the invention. More preferably, the LPS according to the invention is obtained from the mutant strain 2331, as obtained in the examples.

Even more preferably, in the analysis after separation by extraction with hot phenol/water (Westphal and Jann, 1965), O-desacetyldiltiazem mild hydrolysis (Holst 2000) and analysis using ESI-MS in the detection of negative ions, the spectrum of ESI-MS LPS of the present invention is characterized by the fact that gives more ions than the corresponding range of ESI-MS LPS derived from wild-typeBordetella pertussis,called LPS of wild-type.Preferably wild typeBordetella pertussisis the strain B213, described above. Not wishing to be bound to any theory, these additional ions may reflect at least a partial increase in the replacement of 1 or 4' phosphate groups part of LPS related to lipid And remnants of hexosamine.

Usually range of ESI-MS LPS of wild-type characterized by the fact that gives 7 ions (see table 3), whereas the range of ESI-MS LPS really the image the structure is characterized by that gives more than 7 ions, at least 8, at least 10, at least 12, and more preferably 14 ions.

Alternative or in combination with the previous embodiment, it is preferable range of ESI-MS LPS according to the present invention contains more ions containing hexosamine than ESI-MS spectrum of the wild-type LPS. Usually ESI-MS spectrum of the wild-type LPS gives two ion hexosamines (see table 3), whereas ESI-MS spectrum of the LPS of the present invention is characterized by the fact that gives more than two ions, at least 4, at least 6, and more preferably 8 ions.

Pharmaceutical compositions and use in the medical field

The invention additionally relates to pharmaceutical compositions containing the cell host according to the invention and/or LPS according to the invention, both described earlier in this description. The pharmaceutical composition can be used as a vaccine or adjuvant. The vaccine may be used for immunization (inducing an immune response) or vaccination of a mammal.

In the present description it is determined that adjuvants include any substance or compound that, when used in combination with the antigen for immunization of a mammal, preferably human, stimulates the immune system, thereby inducing, enhancing or facilitating the immune re the t antigen, preferably without inducing a specific immune response to itself adjuvant. Preferred adjuvants enhance the immune response to a given antigen, at least 1.5, 2, 2,5, 5, 10 or 20 times, compared to the immune response generated to the antigen in the same conditions but in the absence of adjuvant. Tests to determine the statistical mean of enhancing the immune response against a given antigen produced by adjuvant in the group of animals or people, compared with an appropriate control group, available from the prior art. The adjuvant is preferably able to enhance the immune response of at least two different antigen. Adjuvant according to the present invention will usually be a compound that is foreign to the mammal, thereby eliminating immunostimulatory compounds that are endogenous to mammals, such as interleukins, interferons and other hormones.

In a preferred embodiment, in cases where the pharmaceutical composition is used as the adjuvant, the composition further comprises an antigen.

In those cases, when the composition is used as a vaccine antigen presented on the surface of the host cell of the present invention and/or LPS is derived from such cells. In this case, the HAC is ina preferred is a vaccine against the owner of the present invention and/or against any owner, able to Express the corresponding LPS molecule.

In those cases, when the composition is used as an adjuvant, preferably present antigen. The antigen is preferably the antigen from bacteria, viruses, fungi, parasites, cancer cells or allergen, as determined below, or is produced by these organisms. Antigen and a host cell according to the invention and/or LPS produced by such cells are preferably used for the treatment and/or prevention of infectious diseases caused by bacteria, viruses, fungi or parasites or tumor caused by malignant cells, or an allergic reaction caused by an allergen.

In another preferred embodiment, the pharmaceutical composition comprising the cell host according to the present invention and/or LPS derived from it, and not necessarily the antigen, as defined above in the present description, further comprises a pharmaceutically acceptable carrier. The pharmaceutical compositions may additionally contain pharmaceutically acceptable stabilizing agents, osmotic agents, buffering agents, dispersing agents and the like. The preferred form of the pharmaceutical composition depends on the intended route of administration and therapeutic application. F. rmaceutical carrier can be any compatible, non-toxic substance, suitable for delivery to the patient of the active ingredients, i.e., the host cell according to the invention and/or LPS derived from a host cell, and optionally antigen. For pharmaceutically acceptable carriers for intranasal delivery examples include water, buffered salt solutions, glycerin, Polysorbate 20, cremophor EL, and an aqueous mixture of Caprylic/capricioso glycerides, and may be buffered to provide a neutral pH environment. Examples of pharmaceutically acceptable carriers for parenteral delivery are sterile buffered 0.9% NaCl or 5% glucose optionally supplemented with a 20% albumin. Preparations for parenteral administration must be sterile. Parenteral for injection active ingredient corresponds to known methods, e.g. injection or infusion, subcutaneous, intravenous, intraperitoneal, intramuscular, intraarterial or by the ingestion of affected tissues. The compositions of the present invention preferably injected bolus injection. Typical pharmaceutical composition for intramuscular injection would contain, for example, 1-10 ml of phosphate buffer saline and 1 to 100 μg, preferably 15-45 μg of antigen and 1 to 100 μg, preferably 15-45 µg host cell and/or LPS according to the invention. For oral introduction the Oia active ingredient can be introduced in liquid dosage forms, such as elixirs, syrups and suspensions. Liquid dosage forms for oral administration may contain coloring and flavoring agents to increase the acceptability for the patient. Methods of making compositions, administered parenterally, orally, or intranasally well known in the art and are described in more detail in various sources, including, for example, in Remington''s Pharmaceutical Science (15th ed., Mack Publishing, Easton, PA, 1980) (incorporated by reference in full for all purposes).

The antigen in the composition of the invention preferably is an antigen from bacteria, viruses, fungi, parasites, cancer cells or an allergen, or is produced by them. Viral antigens that can be combined with the host-cell and/or LPS of the present invention, can occur from all types of viruses, non-limiting examples of such viruses are retroviruses, such as human immunodeficiency virus (HIV); rubella virus; paramyxoviruses, such as parainfluenza viruses, measles, infectious mumps, respiratory syncytial virus, human metapneumovirus; flaviviruses, such as yellow fever virus, dengue virus, hepatitis C virus (HCV), Japanese encephalitis virus (JEV), tick-borne encephalitis, encephalitis, St. Louis, or West Nile virus; herpes viruses such as herpes simplex virus, cytomeg lovirus, the virus of Epstein-Barr; Bunyaviruses; Arenavirus; Hantavirus, such as Hantaan; coronaviruses; Papovaviruses such as human papilloma virus; rhabdoviruses, such as the rabies virus. Coronaviruses, such as human coronavirus; alpha viruses, Arterivirus, filovirus, such as Ebolavirus, Arenavirus, poxviruses, such as variola virus, and the virus of African swine fever. Similarly a host cell and/or LPS according to the invention can be combined with antigens derived from pathogenic bacteria, fungi (including yeast), or parasitic organisms. Such antigens include bacterial antigens, for example,Helicobactersuch asH. pylori,Neisseriasuch asN. mengitidis,Haemophilussuch asH. influenza,Bordetellasuch asB. pertussis,Chlamydia,Streptococcussuch asStreptococcussp. serotype A,Vibriosuch asV. cholerae, gram-negative enteric pathogens, such asSalmonella,Shigella,CampylobacterandEscherichiaand the antigen of the bacteria that cause anthrax, leprosy, tuberculosis, diphtheria, Lyme disease, syphilis, typhoid fever, and gonorrhea. Antigens of parasitic organisms, for example, include antigens from the simplest, such asBabeosisbovis,Plasmodium,Leishmaniaspp.ToxoplasmagondiiandTrypanosomasuch asT. cruzi. Antigens fungi may include antigens from so the x mushrooms, asAspergillussp.,Candidaalbicans,Cryptococcussuch as, for example,C.neoformansandHistoplasmacapsulatum.

Although vaccination is usually used for preventive protection against pathogens or for treatment of disease following infection by a pathogen, the person skilled in the art is aware of the use of vaccines for the treatment of tumors. Moreover, discovered an increasing number of tumor-specific proteins, which are suitable objects that can be targeted human antibodies or humanized antibodies. Such tumor-specific proteins are also included in the scope of the present invention. Many tumor-specific antigens are known from the prior art. Thus, in one preferred embodiment, the invention relates to compositions containing a tumor-specific antigen and the cell host and/or LPS, as defined above. Suitable tumor antigens include, for example, embryonic tumor antigen, prostate-specific membrane antigen, prostate-specific antigen, a protein MZ2-E, polymorphic epithelial mucin (PEM), voltsveateadete protein LK26, (truncated) the receptor for epidermal growth factor (EGRF), HER2, antigen, Thomson-Friedenreich (T), gangliosides GM-2 and GD-2, Ep-CAM, mucin-1, epithelial glycoprotein-2, and the specific antigen of the colon.

In addition, the antigens could the t to be aimed at DC for the induction of tolerance in the prevention of autoimmune disease. Such allergens are also included in the scope of the present invention.

Accordingly, in another aspect, a host cell according to the invention, preferably Bordetella pertussis and/or LPS derived from such cells, are used as medicines. Preferably, the drug is a vaccine against whooping cough.

In another preferred embodiment, a host cell according to the invention, preferably Bordetella pertussis and/or LPS derived from such cells, used as adjuvant. More preferably, a host cell according to the invention, preferably Bordetella pertussis and/or LPS derived from such cells, used in combination with the antigen.

In accordance with another aspect, the present invention relates to the use of host cell according to the invention, preferably Bordetella pertussis and/or LPS derived from such cells, to obtain drugs for prevention and/or treatment of whooping cough. In a preferred embodiment, the cell host according to the invention, preferably Bordetella pertussis and/or LPS derived from such cells, used as an adjuvant to obtain medicines for inducing an immune response to an antigen. More preferably, a host cell according to the invention and/or LPS derived from such cells, are used as adjuvant is combined with the specified antigen.

In accordance with another aspect, the present invention relates to the use of the polypeptide according to the invention, described previously in the present description, and/or nucleic acid sequence according to the invention described in the present description, for the prevention and/or treatment of whooping cough.

In accordance with another aspect, the invention relates to the use of the polypeptide according to the invention, described previously in the present description, and/or nucleic acid sequence according to the invention, described previously in the present description, for receiving adjuvant. Preferably, in this aspect, the polypeptide according to the invention, described previously in the present description and/or sequence of nucleic acid according to the invention, described previously in the present description, used in combination with an antigen to obtain medicines for inducing an immune response to this antigen.

In the methods and uses according to the invention mammal, preferably a human being is.

In this document and in the claims, the verb "to contain" and its conjugations is used in a non-limiting sense to denote that the concept of following the word are included, but concepts which are not specifically indicated, are not excluded. In addition, a link to an item in the have a unique number not exclude the possibility of that there is more than one such element, unless the context explicitly requires one and only one such element. Singular, therefore, usually means "at least one".

Description of figures

Fig. 1.(A)Schematic representation of the identified glycosyltransferases operon. Dark gray arrows indicate genes that encode putative glycosyltransferases, and light gray and white arrows indicate the gene encoding assumed the deacetylase of monosaccharide and flanking the ORF, respectively. (B)The profile analysisLPS from strainB. pertussiswild-type (WT), and BP2329-, BP2328-and BP2331-mutant strains using tricin-SDS-PAGE.

Fig. 2.ESI-MS in negative ion modeO-deacetylating LPSB. pertussiswild-type (A)and mutant strains BP2328 (B), BP2329 (C) and BP2331 (D)B. pertussis.

Fig. 3.Tandem mass spectrometry analysis of negative ionsO-deacetylating LPS from mutant strain BP2331. (A) the spectrum of the MS/MS ionm/z1108,3, (B) the spectrum of the MS/MS ionm/z1162,0, (C) the spectrum of the MS3ionm/z1112,6 from ionm/z1162,0.

Fig. 4. Activation of DC after stimulation with wild-type cells and mutantB. pertussis. (A) Analysis of expression of CD83, HLA-DR, CD86, and CD40 on the cell surface of DC after 24 h of stimulation PFA cells B. pertussiswild-type and mutant cells at MOI 10 (black line) or 100 (dotted line). Estimulando DC served as control (grey histogram). Shows FACS histograms for these strains ofB. pertussisof the estimated 5000 cases. The vertical axis represents the number of cells, and the horizontal axis represents the intensity of the staining. (B) Production of IL-10 and IL-12p70 cultured DC after stimulation PFA-fixed cellsB. pertussiswild-type and mutant cells at MOI of 10 or 100. The results are expressed as average concentrations of cytokines (± SD).

Fig. 5. Activation of DC after stimulation with purified LPSB. pertussiswild-type and mutant strain. (A) Analysis of expression of CD83, CD86, and CD40 on the cell surface DC after 24 h of stimulation with 1 mg/ml of purified LPS. Estimulando DC served as control (grey histogram). Shows FACS histograms for these LPS strains ofB. pertussisof the estimated 5000 cases. The vertical axis represents the number of cells, and the horizontal axis represents the intensity of the staining. (B) Production of IL-10 cultured DC after stimulation with 1 mg/ml of purified LPS. The results are expressed as average concentrations of the cytokine.

Fig. 6. Induction of IL-6 under the action of purified LPSB. pertussisand whole bacterial cells. The production of IL-6 cell lineam of human macrophages stimulated with serial dilutions mother solutions of purified LPS (A) or whole bacterial cells (B) from a strain of B. pertussiswild-type (WT), or BP2328-, BP2329-and BP2331-mutant strains. The concentration of IL-6 in the culture supernatant quantitatively analyzed in ELISA in comparison with IL-6 person. Data represent mean values of three separate experiments.

Fig. 7. The structure of LPSB. pertussis. Presents truncated structure of the OS kernel BP2328 and BP2329-mutant strains indicated by the red arrows. Borrowed from Caroffet al. (2000).

Examples

Materials and methods

Bacterial strains and growth conditions

All the used bacterial strains described in Table 1. Typically the strains ofE. coliwere grown at 37°C in broth, Luria-Bertani with shaking at 200 rpm, as appropriate bacteria were grown in the presence of 100 μg/ml ampicillin, 50 µg/ml kanamycin or 10 μg/ml gentamicin, to maintain plasmids or breeding strain.B. pertussiswere grown at 35°C on agar Board-Zhang (BG), supplemented with 15% defibrinating sheep blood (Tritium).

Methods of recombinant DNA

All plasmids used are described in Table 1. Plasmid DNA was isolated using the Promega Wizard®PlusSV Minipreps. The restriction enzyme used according to the manufacturer's instructions (Roche). DNA fragments were isolated from agarose gels using the Promega Wizard®SV Gel and PCR system Clean-Up. Ligation was performed using the abortion practices rapid DNA ligation kit (Roche).

All used primers described in Table 2. Chromosomal DNA templates for PCR reactions was obtained by resuspending ~109bacteria in 50 µl of distilled water, after which the suspension was heated for 15 min at 95°C. Then the suspension was centrifuged for 1 min at 16100 ×g, after which the supernatant was used as DNA templates. For constructing mutant strains ofB. pertussisB213ΔBP2328 and ΔBP2329, the inventors amplified DNA segments encompassing the 5' region and the overlying sequence corresponding to ORF using primers BP2328_FWup, BP2329_FWupand primers BP2328_REVupand BP2329_REVupboth contained a BamHI site. In addition, the DNA fragments containing the 3' region and the underlying sequence of the ORF was obtained by PCR with primers BP2328_FWdown, BP2329_FWdown, both containing a BamHI site, and primers BP2328_REVdownand BP2329_REVdown. To construct a mutant strain ofB. pertussisBP2331 corresponding ORF amplified using primers BP2331_FW and BP2331_REV. PCR was performed using pure beads for PCR Taq Ready-to-go (Amersham Biosciences) in a total reaction mixture of 25 µl with 5 pmol of each primer. The temperature regime was as follows: 95°C for 3 min, 30 cycles of 15 s at 95°C, 30 s at 55°C and 1 min at 72°C, then 7 min at 72°C and then cooled to 4°C. PCR Products cleaned is whether from an agarose gel and then cloned in pGEM-T Easy, receiving the resulting plasmid pGEM-BP2328up, pGEM-BP2328down, pGEM-BP2329up, pGEM-BP2329downand pGEM-BP2331, respectively.BamHI-SpeI fragments pGEM-BP2328downand pGEM-BP2329downligated in pGEM-BP2328upand pGEM-BP2329up, restrictionenzymeBamHI-SpeI, respectively. The resulting plasmids and plasmid pGEM-BP2331 cut using BamHI and EcoRV, respectively, to make it possible for a cartridge resistance to kanamycin of plasmids pBSL128 obtained by splitting under the action of BamHI and HindIII, respectively. Finally, the EcoRI fragments derived structures ligated in restrictivelyEcoRI suicide plasmid pSS1129. The final design, marked pSS1129-BP2328KO, pSS1129-BP2329KOand pSS1129-BP2331KOaccordingly, contained cartridge resistance to kanamycin in the same orientation as the direction of transcription of the operon. Plasmid-based pSS1129 used for transformationE. coliSM10(λpir), which further allowed for the transfer of plasmids inB. pertussisand to construct mutant strains ofB. pertussisBP2328, BP2329 and BP2331 by replacing the alleles. Transformants were screened by PCR, using different pairs of primers.

The allocation of LPS and getting de-O-acetylated LPS

LPS was isolated using the method of extraction with hot phenol/water Westphal and Jann, 1965) with slight modifications (Geurtsenet al., 2006). DeO-acetylation LPS was achieved by mild hydrolysis (Holst, 2000). Briefly, LPS was dissolved in anhydrous hydrazine (200 μl) and incubated at 37°C for 50 min with constant stirring to releaseO-linked fatty acyl chains. The mixture was cooled and was added 600 μl of cold acetone in small portions for the conversion of hydrazine in the hydrazone of acetone. The precipitate deO-acylated LPS were collected by centrifugation (4000 ×gat 7°C for 30 min). The precipitate was washed twice with 600 μl of cold acetone, centrifuged and dissolved in water before lyophilization.

Capillary electrophores-mass spectrometry with elektrorazpredelenie

System Prince CE (Prince Technologies) coupled with mass spectrometer (4000 QTRAP (Applied Biosystems/MDS Sciex). The anode solution (isopropanol-methanol, 2:1) was delivered with a flow rate of 1.0 µl/min Separation was obtained on a bare capillary quartz glass length ~90 cm, using 15 mm ammonium acetate in deionized water, pH of 9.0. 5 kV and -5 kV voltage ionization elektrorazpredelenie used for separation of positive and negative ions, respectively. For all mass spectrometry experiments nitrogen was used as the gas for reflection and collision. In MS2(enhanced product ion scanning the Oia or EPI) and MS 3experiments, the scanning speed was set to 4000 Da/s with carbon capture Q0differential time of capture was set as "dynamic" and the resolution of Q1 was established as a "unit". For MS3experiments, extinction coefficient was set at the value for the excitation of only the first isotope to a single predecessor to the time of excitation, set to 100 MS.

Analysis of LPS using trypsin-SDS-PAGE

Approximately 109bacteria suspended in 50 μl of buffer for sample (Laemmli, 1970), and was added to 0.5 mg/ml proteinase K (final concentration). Samples were incubated for 60 min at 55°C, then 10 min at 95°C to inactivate proteinase K. Then, the samples were diluted 10-fold by addition of buffer for sample, after which 2 μl of each sample were applied to the gel trypsin-SDS-PAGE (Lesseet al., 1990). Bromophenol blue were driven into the separating gel at 35, after which the voltage was raised to 105 C. After reaching the front lower part of the gel electrophoresis was continued for a further 45 minutes, the Gels were fixed overnight in water/ethanol/acetic acid 11:8:1 (V/V/V) and subsequently stained with silver as described (Tsai and Frasch, 1982).

The suspensions of bacterial cells

Bacteria iactiveaware in 0.5% paraformaldehyde (PFA) in phosphate-buffered saline (PBS) during the 30 min and thoroughly washed in RPMI medium 1640 without phenol red (Gibco). A bacterial suspension with an optical density at 600 nm (OD600), is equal to 1, corresponding to ~109bacteria/ml, was obtained in medium RPMI 1640 without phenol red.

Isolation and culturing of DC man

Immature DC men had received from mononuclear cells of peripheral blood (PBMC), as described previously with slight modifications (Sallusto and Lanzavecchia, 1994). Briefly, PBMC were isolated from heparinized blood from healthy volunteers using centrifugation in density gradient on the gradient Ficoll (Amersham Biosciences). The extracted fractions of PBMC were washed three times in RPMI medium 1640, supplemented with 10% V / V heat inactivated fetal calf serum (FCS) (Bodinco BV). Next monocytes from PBMC were obtained by centrifugation through a three-layer Percoll gradient (GE Healthcare Bio-Sciences AB) (60%, and 47.5%, and 34% Percoll in RPMI 1640, 10% FCS). Monocytes were collected from the upper surface of the partition and washed three times using RPMI 1640, 10% FCS Wednesday and incubated in a six-hole tablet (4 ml per well of 0.5×106cells/ml) in RPMI 1640, 10% FCS, supplemented with 2.4 mm L-glutamine (Sigma-Aldrich), 100 U/ml penicillin-streptomycin (Gibco), 100 ng/ml recombinant GM-CSF person (Peprotech), 50 ng/ml recombinant IL-4 (Strathmann-Biotec AG). After six days of cultivation were collected immature DC (imDC), which were negative for CD14 and CD83, expressed low levels of CD86 and HLA-DR, and who was expressively high levels of CD40 and CD11c, according to flow cytometry.

Stimulation of DC

ImDC washed and resuspendable at a concentration of 5×105cells/ml in RPMI 1640 10% FCS and incubated together with either PFA-fixed cellsB. pertussiswith a multiplicity of infection (MOI) of 10 or 100, or with LPS at a concentration of 10 or 1000 ng/ml Estimulando imDC served as a control in all experiments. DC were harvested after 24 hours and directly stained for the expression of cell surface markers, supernatant kept at -80°C until measurement of cytokines.

Running cytometrics analysis of cell surface markers

Surface expression of markers of DC maturation and molecules co-stimulation was evaluated using flow cytometry. Immature or stimulated DC were collected, washed in RPMI 1640, 10% FCS and resuspendable in sterile-filtered PBS containing 0.1% bovine serum albumin (FACS buffer). Next, cells were incubated for 30 min at 4°C with one of the following antibodies: FITC-conjugated against CD11c person (mIgG1) and CD83 (mIgG1), conjugated with phycoerythrin against human CD86 (mIgG1) and CD40 (mIgG1), conjugated with allophycocyanin against human CD14 (mIgG1) and HLA-DR (mIgG2b) and the appropriate isotype controls, labeled fluorochromes (CD11c, CD40 and CD14 from eBioscience; CD83, CD86 and HLA-DR from BD Pharmingen). Cells were washed twice with FACS buffer and analyzed, with p the power flow cytometry (FACScan, Becton Dickinson).

Measurement of cytokines

The concentration of IL-10 and IL-12p70 in supernatant stimulated DC were determined using enzyme-linked immunosorbent assay (ELISA) according to manufacturer's instructions (BD Biosciences Pharmingen).

Research endotoxic activity

Cell line macrophages man MM6 (Ziegler-Heitbrocket al., 1988) stimulated with serial dilutions of suspensions of whole bacterial cells or purified LPS as described (Geurtsenet al., 2006). Suspensions of bacterial cells were obtained by collecting cells from the cultures by centrifugation, after which they resuspendable in PBS with OD5901,0, iactiveaware by heating for 10 min in the presence of 8 mm of formaldehyde and stored at 4°C. After stimulation, the concentration of IL-6 in the culture supernatant quantitatively analyzed using ELISA against IL-6 in accordance with the manufacturer's instructions (PeliKine Compact™).

Results

Identification of a new operon of LPS biosynthesis inB. pertussis

The inventors have discovered a cluster of four genes (BP2328-BP2331, GenBank Accession Numbers NP_880966-NP_880969), three of which showed high sequence similarity with glycosyltransferase LPS from different bacteria, i.e. BP2328, BP2329 and BP2331. BP2330 shows the highest similarity with deacetylated polysaccharides fromXylella of. Che who ever got ORFS are located close to each other and in some cases even overlap, giving the opportunity to suggest that they constitute an operon (Fig. 1A). Genes above, and in the opposite orientation, below operon, presumably encode homologues of DNA polymerase III subunit alpha DnaE and assumed sulfatase YhbXE. coli, respectively. To study the role of the alleged glycosyltransferases LPS, the inventors have produced a design in suicide plasmid pSS1129 carrying single genes BP2328, BP2329 and BP2331 that break cassette kanamycin-resistant for insertion inactivation by allelic exchange. Using this approach, the knock-out mutants for all three genes can be easily obtained in the strain ofB. pertussisB213. Analysis of their LPS using trypsin-SDS-PAGE of lysates of whole cells showed clearly truncated LPS for mutant strains BP2328 and BP2329 (Fig. 1B). In contrast, LPS mutant strain BP2331 was more heterogeneous and consisted of many bands, including the length of the wild type.

Structural analysis of LPS

To determine their structure, LPS from strains of wild type and mutant strains BP2328-, BP2329-and BP2331 - allocated,Ohe dezazetilirovanie and analyzed using ESI-MS in the detection of negative ions (Fig. 2). The proposed composition of LPS are summarized in Table 3. The spectrum of the wild-type LPS (Fig. 2A) showed the main treasurary ion withm/z1108,5 corresponding full-sized LPSB. pertussisthe composition GlNAc·Man2NAc3NAcA·Fuc2NAc4NMe·GalNA·Glc·GlcN 2·GlcA·Hep3·Kdo· lipid A-OH. Additional ions were present atm/z770,1 ([M-3H]3-), 811,1 ([M-4H]4-), 831,4 ([M-4H]4-), 888,3 ([M-3H]3-), 951,8 ([M-H]-), 987,1 ([M-2H]2-), 1081,7 ([M-3H]3-), 1121,1 ([M-3H+K]3-), 1155,0 ([M-2H]2-), and 1162,1 ([M-3H]3-). Most of these ions corresponded dephosphorylating or truncated glycoforms; however, treasurary ion withm/z1162,1 corresponded to a full-sized LPSB. Pertussisreplaced by the additional hexosamines part (table 3). ESI-MS spectrum of the LPS mutant strain BP2328 (Fig. 2B) showed treharne ions withm/z743,6, 770,0, and 823,7, together with their respective double-ions withm/z1115,2, 1155,1, and 1235,7. Additional peaks were located atm/z777,3 ([M-3H+Na]3-), 952,1 ([M-H]-), 1034,6 ([M-2H]2-), 1074,6 ([M-2H]2-), and 1166,1 ([M-2H+Na]2-). The distribution of the peaks showed that the full structure of nuclear OS was presented bym/z823,7 and 1235,7 corresponding to the composition GalNA·Glc·GlcN2·GlcA·Hep2·P·Kdo·lipid A-OH. Mutant LPS BP2329 (Fig. 2C) showed treharne ions withm/z603,9 and 657,6, together with the corresponding double-ions withm/z906,0 and 986,6. In addition, sodium and potassium adducts of these ions were whenm/z917,4 and 997,6, andm/z925,0 and 1005,6, respectively. Additional peaks were onm/z866,0 ([M-2H]2-), 937,4 ([M-2H-H2O]2- ), and 1067,1 ([M-2H]2-). In this case, the most complete structure of the nucleus was presented double ion withm/z1067,1, the relevant part of GlcN2·GlcA·Hep2·P·Kdo·lipid A-OH. Mutant LPS BP2331 (Fig. 2D) showed a large number of peaks, including treharne ions withm/z1108,3 and 1162,0 corresponding full-sized LPSB. pertussisand a full-sized LPSB. Pertussisreplaced by hexosamine, respectively.

To determine the localization of additional hexosamines part, which was observed in LPS as wild-type and mutant LPS BP2331, conducted research ESI-MS2in the negative ion mode (Fig. 3). MS/MS spectra of ions withm/z1108,3 (Fig. 3A) and 1162,0 (Fig. 3B) both showed a singly charged fragment ion withm/z951,5, which showed that A-OH, the resulting splitting of the relationship between Kdo-lipid A in terms of dissociation, induced by the collision, consisted of β-(1→>6)-linked disaccharideN-acylated (3OH C14) glucosamine residues, each residue is replaced by a phosphate group. Range ionm/z1162,0 also showed additional ion withm/z1112,6, which indicates that additional hexosamines the residue was directly attached to the lipid A. MS3onm/z1112,6 additionally supported this conclusion (Fig. 3C).

Activation of dendritic cells under the action of a mutant who's LPS B. pertussis

To determine the effect of mutations LPS to activate DC, immature DC were co-cultured with PFA-fixedB. pertussiswild-type and mutant bacteria with MOI 10 and 100. Activation of DC controlled analysis of maturation markers (CD83 and HLA-DR), and the expression of molecules co-stimulation (CD86 and CD40) using flow cytometry (Fig. 4A) and the induction of IL-10 and IL12p70 using ELISA (Fig. 4B). Bacterial wild-type and all mutant bacteria induced the expression of CD83, HLA-DR, CD86, and CD40, demonstrating that all strains were able to activate DC. However BP2329 and BP2331-mutant bacteria were clearly less and more stimulating, respectively, than the wild-type bacteria, whereas the mutant strain BP2328 was as effective as the wild-type strain. Less DC maturation was observed in the case of the mutant strain BP2329 was accompanied by a lower induction of IL-10 and IL-12p70 (Fig. 4B). Similarly, the mutant strain BP2331, which demonstrated an increased ability of DC to maturation, induced higher amounts of IL-10 and IL-12p70. Strain wild type and mutant strain BP2328 induced comparable levels of IL-10, which is consistent with the equal expression of molecules co-stimulation and markers on DC maturation in response to these strains. However, whereas the wild-type strain clearly induced the production of IL-12p70, it was not very likely in the case of the mutant strain BP2328 (Fig. 4B), which gives an opportunity to assume the expression of IL-10 and IL-12p70 may be regulated differentially.

To assess whether the observed differences in the ability to activate DC between strains of wild-type and mutant strains directly from differences in the composition of LPS, research DC activation was performed with 10 and 1000 ng/ml of purified LPS. In contrast to the large increase in the expression of maturation markers and molecules co-stimulation by DC in response to wild-type bacteria, BP2328-and BP2331-mutant bacteria, only a slight increase in the expression of CD83, CD86, and CD40 (Fig. 5A) and no increase in the expression of HLA-DR (data not shown) were detected even with 1000 ng/ml LPS of these strains. Similarly, the induction of IL-10 was low (Fig. 5B) and IL-12p70 could not be detected in supernatant DC, LPS-stimulated (data not shown). However, mutual comparison (Fig. 5A and 5B) showed that, in accordance with the results obtained with intact bacteria, the greatest ability to activate DC was found for LPS isolated from a mutant strain BP2331, followed by LPS mutant strain BP2328 and strain wild type, whereas LPS mutant strain BP2329 was unable to induce the maturation of DC. Thus, changes in the structure of the LPS mutant strains differentielle affects the ability to activate DC.

Endotoxic activity of LPS and whole bacterial cells

the button to evaluate the effects of the mutations LPS for endotoxic activity of LPS, was tested the effectiveness of purified LPS in relation to stimulation of the cell line macrophages man MM6 to the production of IL-6. Compared to wild-type LPS, LPS, purified from the mutant strain BP2331 had significantly higher effectiveness in terms of stimulation of macrophages (Fig. 6A). In contrast, LPS from mutant strain BP2329 had a reduced efficacy in stimulating the production of IL-6, whereas the activity of LPS from mutant strain BP2328 was similar to the activity of wild-type LPS (Fig. 6A). Only at the two highest tested concentrations of LPS, the last LPS was more active than wild-type LPS. Consistent with data obtained with purified LPS, suspensions of whole cells of mutant strain BP2331 showed, compared with wild-type cells clearly increased efficiency in relation to stimulation of macrophages (Fig. 6B). However, mutant cells BP2328 showed the same effect (Fig. 6B), although the mutant cells BP2329 had a similar activity as the wild-type cells, despite their less active purified LPS (Fig. 6A).

Discussion

The purpose of this study was to identify novel glycosyltransferases LPS in the genome ofB. pertussis. Sequences of known glycosyltransferases LPS as leaders, the inventors were able to identify four gene operon. In radiusim study in which genomic sequence of avian pathogenBordetella aviumcompared with the genomic sequences of otherBordetellaeit has been described that the gene cluster homologous to one of the identified in the present study, involved in the biosynthesis of LPS (Sebaihiaet al., 2006). However, any functional studies that could confirm this distribution was not reported.

To study the role of this operon in the biosynthesis of LPSB. pertussisthe authors of the invention iactiveaware putative glycosyltransferases genes by allelic exchange, and compared the LPS profiles of strains of wild-type and mutant strains using tricin-SDS-PAGE and ESI-MS. Unexpectedly, the inventors have found that the wild-type strain not only contained a full-sizedLPSB. pertussisand also contained a full-sized kinds, substituted another hexosamines part, which, as was shown by the authors of the invention was directly attached to the lipid A. the lipid Substitution AndB. pertussishexosamine previously was not observed and, therefore, represents a new modification of lipid AndB. pertussis.

The proposed truncated oligosaccharide patterns for mutant strains BP2328 and BP2329 is summarized in Fig. 7. The most complete structure of nuclear OS in the mutant strain BP2328 consisted of GalNA·Glc·GlcN2·GlcA·Hep2·P·Kd·lipid A-OH·HexN, indicating that the mutant strain BP2328 deprived terminal trisaccharide, the rest of leprosy and one of the GlcN residues. This composition suggests that BP2328-encoded protein functions as a GlcN (1-4) in relation to the Glc transferase (Fig. 7). Analysis of the LPS mutant strain BP2329 showed that LPS was further truncated, and that his most complete structure consisted of GlcN·GlcA·Hep2·P·Kdo·lipid A-OH·HexN. Since this structure is devoid of Glc, to which must be attached to the second GlcN nuclear OS, remaining present GlcN residue must be attached to the second heptose. Thus, this composition suggests that BP2329-encoded protein functions as glycosyltransferases, which attaches the Glc to the first heptose the subunit (Fig. 7). This would be consistent with high homology of this gene product with glucose (β1-4) getstringparam, such asrfaKandlgtF/icsBthat were used to identify the gene in the first position. The most complex phenotype was observed in the case of the mutant strain BP2331. Although this protein shows high sequence similarity with various glycosyltransferase LPS, a full-sized LPSB. pertussisstill present in the mutant strain. This observation suggests that either this gene BP2331 does not encode an active glycosyltransferase the memory LPS, or that encoded the enzyme demonstrates duplication. According to this latter view, the inventors have identified a gene, i.e., BP3671 with registration number GenBank CAE43928 in the genome ofB. Pertussiswhich encodes a protein that is 69% identical to a protein encoded BP2331. Although the LPS profiles of the wild-type strain and mutant BP2331 were more or less comparable, one striking observation was that the mutant LPS was more heterogeneous. Although the exact cause of this phenomenon remains to explain one possible explanation could be that BP2331 mutant engages in some form of higher non-stoichiometric replacement of LPS, possibly hexosamines. Modification of lipid And amino sugars has been described in various bacteria, for example, substitution of 4-aminoarabinose inE. coliandSalmonella(Trentet al.2001b), and galactosamine inFrancisella tularensis(Phillipset al., 2004). Aminoarabinose path was studied in detail inE. coliand it has been shown that it is involved in the Assembly of the sugar part on a separate underepresentation media to transfer to lipid A (Trentet al.2001a). Because it is possible that the insert cartridge resistance to kanamycin in BP2331 increased expression of the underlying gene BP2330, you could make the assumption that increased expression BP2330 can lead to increased hexosamine modification of lipid a and, consequently, to improve the Noah heterogeneity of LPS in BP2331-mutant cells. The basis for this interpretation is elevated hexosamines modifications in mutant VR, see Table 3.

Turning to the structure of LPS, purified LPS and whole bacterial cells were tested for their ability to induce DC maturation and stimulate the production of proinflammatory cytokines by human macrophages. The results showed that, compared with the wild-type strain, VR-mutant strain showed an increased ability to induce DC maturation and the production of proinflammatory cytokines. Similar results were obtained with purified LPS. In contrast, whole bacterial cells and purified LPS from mutant strains WR and WR showed similar and reduced ability to induce DC maturation and stimulate macrophages, respectively. These results indicate that changes in LPS nuclear OS-composition differentially affect the biological properties of LPS Century pertussis. From a perspective of creating vaccines this is an interesting discovery, as this may make it possible to obtain strains that are more effectively primesouth immune responses. Furthermore, mutant strains that exhibit high heterogeneity of LPS, such as mutant strain WR, can cause the formation of a large diversity of antibodies against LPS, which in itself is mo is no positive impact on vaccine efficacy. Found a good correlation between the level of activation of DC and macrophages on the one hand and the degree hexosamines modification of lipid A with another (see Table 3), clearly indicates that the increased modification in the mutant strain VR is crucial in this respect.

Table 1
Bacterial strains and plasmids
Strain or plasmidGenotype or descriptionThe source of the link
Strains
B. pertussis
B213Resistant to streptomycin derived strain ofB. pertussisTohamaKasuga et al., 1953
B213 ΔBP2328BP2328 mutant strain B213, StrR, KmRThis study
B213 ΔBP2329BP2329 mutant strain B213, StrR, KmRThis study
B213 ΔBP2331BP2331 mutant strain B213, StrR, KmRThis study
the
E. coli
TOP10F'F{lacIqTn10 (TetR)} mcrA Δ(mrr-hsdRMS-mcrBC) Φ80lacZΔM15 ΔlacX74
deoR recA1 araD139 Δ (ara-leu)7697 galU galK rpsL endA1 nupG
Invitrogen
DH5αF-Δ(lacZYA-algF)U169 thi-1 hsdR17 gyrA96 recA1 endA1 supE44 relA1
phoA & Phi; 80 dlacZΔM15
Hanahan, 1983
SM10(λpir)thithrleufhyAlacYsupErecA::RP4-2-Tc::Mu λpirR6K KmRN. V. I.a

Plasmids
pGEM-T EasyE. colicloning vector AmpRPromega
pUC4KE. colia vector containing the cassette of resistance to kanamycin, AmpRKmRVieira and Messing, 1982
pSS1129Vector allelic replacement,bla gen rpsL oriVColE1 oriT λcosStibitz, 1994
pGEM-BP2328upderived pGEM-T Easy containing the sequence BP2328 button
before the site of transcription initiation
This study
pGEM-BP2328downderived pGEM-T Easy containing the sequence BP2328 button
during transcription
This study
pGEM-BP2329upderived pGEM-T Easy containing the sequence BP2329 button
before the site of transcription initiation
This study
pGEM-BP2329downderived pGEM-T Easy containing the sequence BP2329 button
during transcription
This study
pGEM-BP2331derived pGEM-T Easy containing the sequence BP2331This study
pSS1129-BP2328KOderived pSS1129 containing the knockout construct BP2328, Km RThis study
pSS1129-BP2329KOderived pSS1129 containing the knockout construct BP2329, KmRThis study
pSS1129-BP2331KO)derived pSS1129 containing the knockout construct BP2331, KmRThis study
aNetherlands Vaccine Institute, Bilthoven, the Netherlands

Table 2
Primers
NameSequence (5'-3')a
BP2328_FWupTTCCGCACTTACTGGCTGAG
BP2328_FWdownGGATCCTCGCGGTACGACAGCACAT
BP2328_REVupGGATCCTGTTGCGCGAGATGCTGGAG
BP2328_REVdownCCTCATCGCCAAGGTCAATC
BP2329_FWupTCACCTTCGACGACGGATAC
BP2329_FWdownGGATCCGTGCGCATCTACCTGATCC/b>
BP2329_REVupGGATCCGAATCGACCACGATGAAC
BP2329_REVdownGATCCAGCTTGGCCTGGTTG
BP2331_FWGTGACGTGGTGGTACATCAG
BP2331_REVTGGTCTACCGCAGGAACAAT
aBamHI restriction sites are underlined

Links

Alexeyev, M. F., Shokolenko, I. N., and Croughan, T. P. (1995) Improved antibiotic-resistance gene cassettes and omega elements forEscherichia colivector construction and in vitro deletion/insertion mutagenesis.Gene160: 63-67.

Allen, A. G., Isobe, T., and Maskell, D. J. (1998a) Identification and cloning ofwaaF(rfaF) fromBordetella pertussisand use to generate mutants ofBordetellaspp. with deep rough lipopolysaccharide.J. Bacteriol.180: 35-40.

Allen, A. G., Thomas, R. M., Cadisch, J. T., and Maskell, D. J. (1998b) Molecular and functional analysis of the lipopolysaccharide biosynthesis locus ofwlbfromBordetella pertussis,Bordetella parapertussisandBordetella bronchiseptica.Mol. Environ.29: 27-38.

Allen, A., and Maskell, D. (1996) The identification, cloning and mutagenesis of a genetic locus required for lipopolysaccharide biosynthesis inBordetella pertussis.Mol. Environ.19: 37-52.

Caroff, M., Brisson, J., Martin, A., and Karibian, D. (2000) Structure of theBordetella pertussis1414 endotoxin.FEBS Lett.477: 8-14.

Clementz, T., and Raetz, C. R. H. (1991) A gene coding for 3-deoxy-D-manno-octulosonic-acid transferase inEscherichia coli. Identification, mapping, coning, and sequencing.J. Biol. Chem.266: 9687-9696.

Di Fabio, J. L., Caroff, M., Karibian, D., Richards, J. C., and Perry, M. B. (1992) Characterization of the common antigenic lipopolysaccharide O-chains produced byBordetella bronchisepticaandBordetella parapertussis.FEMS Environ. Lett.76: 275-281.

Geurtsen, J., Steeghs, L., Hamstra, H-J., ten Hove, J., de Haan, A., Kuipers, B., Tommassen, J., and van der Ley, P. (2006) Expression of the lipopolysaccharide-modifying enzymes PagP and PagL modulates the endotoxic activity ofBordetella pertussis.Infect. Immun.74: 5574-5585.

Hanahan, D. (1983) Studies on transformation ofEscherichia coliwith plasmids.J. Mol. Biol.166: 557-580.

Holst, O. (2000) Deacylation of lipopolysaccharides and isolation of oligosaccharides phosphates. inMethods in Molecular Biology, Bacterial Toxins: Methods and Protocols(Holst, O., Ed.) pp 345-353, Humana Press, Totowa, NJ.

Heinrichs, D. E., Yethon, J. A., and Whitfield, C. (1998) Molecular basis for structural diversity in the core regions of the lipopolysaccharides ofEscherichia coliandSalmonella enterica.Mol. Environ.30: 221-232.

Isobe, T., White, K. A., Allen, A. G., Peacock, M., Raetz, C. R. H., and Maskell, D. J. (1999)Bordetella pertussiswaaAencodes a monofunctional 2-keto-3-deoxy-D-manno-octulosonic acid transferase that can complement anEscherichia coliwaaAmutation.J. Bacteriol.181: 2648-2651.

Kasuga, B., Nakase, Y., Ukishima, K., and Takatsu, K. (1953) Studies onHaemophilus pertussis.Kitasato Arch. Exp. Med.27: 21-28.

Kurzai, O., Schmitt, C., Claus, H., Vogel U, Frosch M, and Kolb-Maurer, A. (2005) Carbohydrate composition of meningococcal lipopolysaccharide modulates the interaction ofNeisseria meningitidiswith human dendritic cells.Cell. Environ.7: 1319-1334.

Laemmli, U. K. (1970) Cleavage of structural proteins during the assembly of the head of bacteriophage T4.Nature227: 680-685.

Lesse, A. J., Campagnari, A. A., Bittner, W. E., and Apicella, M. A. (1990) Increased resolution of lipopolysaccharides and lipooligosaccharides utilizing tricine-sodium dodecyl sulfate-polyacrylamid gel electrophoresis. J. Immunol. Methods126: 109-117.

MacLachlan, P. R., Kadam, S. K., and Sanderson, K. E. (1991) Cloning, characterization, and DNA sequence of therfaLKregion for lipopolysaccharide synthesis inSalmonella typhimuriumLT2.J. Bacteriol.173: 7151-7163.

O'neill, L. A. J. (2006) How Toll-like receptors signal: what we know and what we don't know.Curr. Opin. Immunol.18: 3-9.

Pålsson-McDermott, E. M., and O'neill, L. A. J. (2004) Signal transduction by the lipopolysaccharide receptor, Toll-like receptor-4.Immunology113: 153-162.

Peppler, M. S. (1984) Two physically and serologically distinct lipopolysaccharide profiles in strains ofBordetella pertussisand their phenotype variants.Infect. Immun.43: 224-232.

Phillips, N. J., Schilling, B., McLendon, M. K., Apicella, M. A., and Gibson, B. W. (2004) Novel modification of lipid A ofFrancisella tularensis.Infect. Immun.72: 5340-5348.

Plüddeman, A., Mukhopadhyay, S., and Gordon, S. (2006) The interaction of macrophage receptors with bacterial ligands.Exp. Rev. Mol. Med.8: 1-25.

Raetz, C. R. H., and Whitfield, C. (2002) Lipopolysaccharide endotoxins.Annu. Rev. Biochem.71: 635-700.

Sallusto, F. and Lanzavecchia, A. (1994) Efficient presentation of soluble antigen by cultured human dendritic cells is maintained by granulocyte/macrophage colony-stimulating factor plus interleukin 4 and downregulated by tumor necrosis factor α.J. Exp. Med. 179: 1109-1118.

Schnaitman, C. A., and Klena, J. D. (1993) Genetics of lipopolysaccharide biosynthesis in enteric bacteria.Environ. Rev.57: 655-682.

Sisti, F., Fernández, J., Rodríguez, M. E., Lagares, A., Guiso, N., and Hozbor, D. F. (2002) In vitro and in vivo characterization of aBordetella bronchisepticamutant strain with a deep rough lipopolysaccharide structure.Infect. Immun.70: 1791-1798.

Steeghs, L., van Vliet, S. J., Uronen-Hansson, H., van Mourik, A., Engering, A., Sanchez-Hernandez, M., Klein, N., Callard, R., van Putten, J. P. M., van der Ley, P., van Kooyk, Y., and van de Winkel, J. G. J. (2006)Neisseria meningitidisexpressinglgtBlipopolysaccharide targets DC-SIGN and modulates dendritic cell function.Cell. Microbol. 8: 316-325.

Stibitz, S. (1994) Use of conditionally counterselectable suicide vectors for allelic exchange.
Methods Enzymol.235: 458-465.

Takada H, and S. Kotani (1989) Structural requirements of lipid A for endotoxicity and other biological activities.Crit. Rev. Environ.16: 477-523.

Trent, M. S., Ribeiro, A. A., Doerrler, W. T., Lin, S., Cotter, R. J., and Raetz, C. R. H. (2001a) Accumulation of a polyisoprene-linked amino sugar in polymyxin-resistantSalmonella typhimuriumandEscherichia coli: structural characterization and transfer to lipid A in the periplasm.J. Biol. Chem.276: 43132-43144.

Trent, M. S., Ribeiro, A. A., Lin, S., Cotter, R. J., and Raetz, C. R. H. (2001b) An inner membrane enzyme inSalmonellaandEscherichia colithat transfers 4-amino-4-deoxy-L-arabinose to lipid A: induction on polymyxin-resistant mutants and role of a novel lipid-linked donor.J. Biol. Chem.276: 43122-43131.

Tsai, C. M., and Frasch, C. E. (1982) A sensitive silver stain for detecting lipopolysaccharides in polyacrylamide gels.Anal. Biochem.119: 115-119.

Uronen-Hansson, H., Steeghs, L., Allen, J., Dixon, G. L. J., Osman, M., van der Ley, P., Wong, S. Y. C., Callard, R., and Klein, N. (2004) Human dendritic cell activation byNeisseria meningitidis: phagocytosis depends on expression of lipooligosaccharide (LOS) by the bacteria and is required for optimal cytokine production.Cell. Environ.6: 625-637.

van Amersfoort, E. S., Van Berkel, T. J., and Kuiper, J. (2003) Receptors, mediators, and mechanisms involved in bacterial sepsis and septic shock.Clin. Environ. Rev.16: 379-414.

Westphal, O., and Jann, J. K. (1965) Bacterial lipopolysaccharides, extraction with phenol-water and further applications of the procedure.Methods Carbohydr. Chem.5: 83-91.

Ziegler-Heitbrock, H. W. L., Thiel, E., Futterer, A., Herzog, V., Wirtz, A., and Riethmüller, G. (1988) Establishment of a human cell line (Mono Mac 6) with characteristics of mature monocytes.Int. J. Cancer41: 456-461.

1. A host cellBordetella pertussis,Bordetella bronchisepticaorBordetella parapertussisfor use as an adjuvant with reduced activity of endogenous glycosyltransferases with at least 98% identity with the amino acid sequence SEQ ID NO: 2 compared with the activity of glycosyltransferases corresponding parent strain, where the reduced activity is achieved by using inactivating vector, which causes inactivation of the expression of a sequence of an endogenous nucleic acid that encodes glycosyltransferase, or leads to a reduced level of expression of the sequence of an endogenous nucleic acid that encodes glycosyltransferase, merge nucleic acid sequence that encodes glycosyltransferase, with weak or inducible promoter.

2. A host cellBordetella pertussis,Bordetella bronchisepticaorBordetella parapertussisfor use for the prevention or treatment of pertussis with reduced activity of endogenous glycosyltransferases with at least 98% identity with the amino acid sequence SEQ ID NO: 2 compared with the activity of glycosyltransferases corresponding parent strain, where the reduced activity is achieved by using inactivating vector, which causes inactivation of the expression of a sequence of an endogenous nucleic acid that encodes glycosyltransferase, or leads to a reduced level of expression of the sequence of an endogenous nucleic acid that encodes glycosyltransferase, merge nucleic acid sequence that encodes glycosyltransferase, with weak or inducible promoter.

3. A host cell p is p. 1 or p. 2, where inactivating vector, which causes inactivation of the expression of a sequence of an endogenous nucleic acid that encodes glycosyltransferase, is a suicide vector.

4. Preparation for use as an adjuvant consisting of LPS, derived from the host cell under item 1, where the drug consists of LPS with increased replacement hexosamine 1' or 4' phosphate groups part of LPS related to lipid And compared with drug LPS from the corresponding parent strain, and whereby LPS is characterized by obtaining at least 8 ions in ESI-MS spectrum.

5. Formulation for use as a drug for prevention or treatment of whooping cough, consisting of LPS, derived from the host cell under item 2, where the drug consists of LPS with increased replacement hexosamine 1' or 4' phosphate groups part of LPS related to lipid And compared with drug LPS from the corresponding parent strain, and whereby LPS is characterized by obtaining at least 8 ions in ESI-MS spectrum.

6. Pharmaceutical composition for use as an adjuvant containing a cell-master under item 1 or the drug under item 4 in an effective amount and a pharmaceutically acceptable carrier.

7. Pharmaceutical composition for use as a vaccine for the prevention and/or treatment of infectionsBordtella containing the cell-master under item 1 or the drug under item 4 in an effective amount and a pharmaceutically acceptable carrier and optionally containing an antigen in an effective amount.

8. Pharmaceutical composition for use as a vaccine for the prevention and/or treatment of infectionsBordetellacontaining the cell-host for p. 2 or the drug under item 5 in an effective amount and a pharmaceutically acceptable carrier.

9. The use of host cell under item 2 or preparation under item 5 for a medicinal product for the prevention and/or treatment of whooping cough.

10. The use of host cell under item 1 or drug under item 4 to obtain medicines for immunization of a mammal, where a host cell or LPS used as adjuvant.

11. Application under item 10, where the cell-master or the drug is used in combination with the antigen.

12. Application under item 11, where the adjuvant is additionally combined with the antigen to obtain medicines for inducing an immune response to an antigen.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology. Presented are versions of an antigen-binding polypeptide specific to LIGHT polypeptide characterised by a variable domain of heavy and light chains, as well as versions of based conjugates for treating a disease or a condition. What is described is a pharmaceutical composition for inhibiting apoptosis induced by human LIGHT based on a therapeutically effective amount of the polypeptide. There are disclosed: a method of treating or a diagnosing the disease or condition on the basis of the composition. There are described versions of the recovered polynucleotide or a cell transformed by the polynucleotide for preparing the antigen-binding polypeptide, as well as a method for producing the antigen-binding polypeptide on the basis of the cell.

EFFECT: using the invention provides the antibodies, which block the human or macaque LIGHT interaction to LIGHT receptors that can find application in treating various diseases related to high T-cell activity.

23 cl, 11 dwg, 8 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology.

EFFECT: bispecific anti-human vascular endothelial growth factor VEGF and human angiopoietin-2 ANG-2 antibodies, methods for producing them, pharmaceutical compositions containing the above antibodies, and using them are described.

13 cl, 26 dwg, 15 tbl, 19 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and a vector, a host cell containing a vector, a genetically modified microorganism Clostridium thermocellum, a method of producing said microorganism and a method of converting lignocellulose biomass to ethanol. The present vector is designed for acetate kinase gene knockout in Clostridium thermocellum and has nucleotide sequence SEQ ID NO:1 or SEQ ID NO:2. The present genetically modified microorganism is transformed by the nucleotide sequence SEQ ID NO:1 or SEQ ID NO:2, and can also further contain a non-native gene which provides the capacity to metabolise pentose sugar, hydrolyse xylan or is involved in metabolic production of ethanol. The present method of converting lignocellulose biomass to ethanol includes bringing the biomass into contact with said genetically modified microorganism.

EFFECT: invention enables to obtain a larger amount of ethanol.

17 cl, 53 dwg, 6 tbl, 10 ex

FIELD: chemistry.

SUBSTANCE: claimed inventions deal with an isolated polynucleotide, coding a polypeptide, involved in biosynthesis of pyripyropene A, a vector and a host cell, including such a polypeptide, and methods of obtaining pyripyropene A precursors, including the host cell cultivation. The claimed polynucleotide codes the polypeptide, possessing any one or more of the activities - polyketide synthase, prenyltransferase, hydroxylase, acetyltransferase or adenylate synthase.

EFFECT: claimed inventions make it possible to synthesise pyripyropene A, which is an insecticidal agent, and can be used in the formation of plant resistance to pest insects.

16 cl, 11 dwg, 1 tbl, 11 ex

Siglec-15 antibody // 2539790

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is described is a pharmaceutical composition used for treating and/or preventing pathological bone metabolism and containing this antibody. The invention can be used in medicine.

EFFECT: antibody and its functional fragment specifically recognising human Siglec-15 and possessing the osteoclast inhibitory activity are described.

73 cl, 57 dwg, 4 tbl, 33 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is described is a recovered human antibody or its antigen-binding fragment. The antibody binds to human interleukin-4 alpha-receptor (hlL-4R). There are also described a nucleic acid molecule coding this antibody, an expression vector, a host cell, a method for producing such antibody and a therapeutic composition containing this antibody.

EFFECT: presented group of inventions can be used in medicine for treating asthma and atopic dermatitis.

15 cl, 3 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology, in particular to integrative genetic construction pWpr-le. Claimed invention can be used for introduction of gene of human/swine growth hormone releasing factor into chromosome of cell of Bacillus subtilis and related species of genus Bacillus and its further expression in said cells. Integrative genetic construction pWpr-le is characterised by nucleotide sequence, given in Fig. 2.

EFFECT: claimed invention makes it possible to obtain vector system for expression of gene of GHRH_le peptide in bacteria, possessing high stability in obtaining bacterial preparation of probiotic purpose in industrial conditions.

4 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of immunology and biotechnology. Described are: humanised antibody and its antigen-binding fragment (Fab), which selectively bind human IFN-γ and contain variable site of heavy chain (VH) and variable site of light chain (VL), where VH and VL have sequences of amino acids respectively SEQ ID NO:1 and 2, presented in description. Also disclosed are fragments of DNA, which code said antibody and its Fab-fragment; plasmid DNA for expression of said specific proteins; and modified cells of bacteria and eukaryotes, which contain said plasmid DAN and intended for expression of said antibody and its Fab-fragment. Claimed are methods of obtaining said antibody and its Fab-fragment, which include cultivation of said modified cells in nutritional medium and isolation of antibody and its Fab-fragment by claimed invention from cultural liquid.

EFFECT: invention makes it possible to obtain humanised antibody or its Fab-fragment, binding with IFN-γ with kD 4,6 and IC50 not less than 1,5 nM in test on cells U937, with preservation of affinity of initial mouse monoclonal antibody.

13 cl, 3 dwg, 1 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology or gene engineering. System of modulating recombinant gene expression, expression gene and host cell are described.

EFFECT: invention extends arsenal of methods for gene expression modulation.

12 cl, 14 tbl, 10 ex

Polypeptide // 2539776

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry, in particular to polypeptide, possessing amylase activity, derived from parent polypeptide, which represents non-maltogenic exoamylase of wild type, which has at least 90% identity SEQ ID NO: 13. Said polypeptide contains amino acid substitution in position 307 for lysine (K) or arginine (R), in accordance with numeration of positions of Pseudomonas saccharophilia exoamylase sequence, represented in SEQ ID NO: 1. Polypeptide is applied as food or forage additive, in method of starch processing to obtain starch-containing food or forage product, in particular bakery product.

EFFECT: invention makes it possible to increase thermal stability and exospecificity of non-maltogenic exoamylase in comparison with wild type polypeptide.

62 cl, 14 dwg, 25 tbl, 37 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and provides a pharmaceutical composition for treating Gaucher's disease, which contains as an active ingredient lyophilised plant cells which express recombinant human glucocerebrosidase, a pharmaceutically acceptable carrier, where said pharmaceutical composition is intended for oral administration and where said human glucocerebrosidase has high-mannose glycosylation.

EFFECT: invention enables to obtain an effective pharmaceutical composition for treating Gaucher's disease with high enzyme biological activity owing to high-mannose glycosylation thereof.

16 cl, 21 dwg, 3 tbl, 6 ex

FIELD: biotechnologies.

SUBSTANCE: described is alpha-D-galactosidase having changed regiospecificity in relation to α1.4-bond and containing Pro402Asp or Phe328Ala mutation in corresponding position of amino acid sequence of initial wild-type enzyme, extracted from Thermoioga maritima MSB8 strain. Production method of the specified alpha-D-galactosidase consists in selection of positions for site-directed mutagenesis of amino acid sequence of wild-type enzyme as follows: a) zymophores having high homology of their amino acid sequence and space structure similarity, which crystal structure contains residue of D-galactose, are overlapped in space; based on performed overlapping of structures potential arrangement of B-galactose in active centre of α-galactosidase from Thermotoga maritima MSB8 is determined; b) potential arrangement of D-galactose in active centre of α-galactosidase is determinec by molecular dynamics methods, general amino acid residues of fermentative centre forming hydrogen bonds with D-galactose are determined, and potential arrangement of D-galactose relative to a pair of catalytic amino acid residues of ferment is found out; c) in silieo mutations of wild type α-galactosidase are performed, positions of amino acid residues for site-directed mutagenesis are selected, after positions selection one of amino acid residues selected at stage c) is replaced by another amino acid residue, namely Pro402Asp or Phe328Ala. Invention allows obtaining regiospecific alpha-D-galactosidases in relation to α1.4-bond.

EFFECT: improving compound properties.

2 cl, 3 dwg, 2 tbl, 1 ex

FIELD: biotechnologies.

SUBSTANCE: compositions containing active versions of alpha-amylase are proposed. Besides a new version of alpha-amylase, compositions as per the invention usually contain at least one additional ferment, a detergent, one surface-active substance, one complexing agent, an oxidiser, an acidifying agent, an alkaliser, a peroxide source, a harness source, salt, a detergent complexing agent, a polymer, a stabilising agent or a conditioner. Besides, application methods of those compositions for scouring of woven fabric, for washing or cleaning of products, such as dishware or linen, which are contaminated with starch-containing substances, are described.

EFFECT: improved thermal stability relative to parental; form of AmyS-like alpha-amylase, from which they have been obtained.

10 cl, 12 tbl, 24 dwg, 14 ex

FIELD: biotechnologies.

SUBSTANCE: host cell Trichoderma reesei contains polynucleotides that code a heterologous polypeptide GH61, fusion protein of beta-glucosidase, cellulolytic ferments. The method to produce the composition includes cultivation of the host cell Trichoderma reesei and extraction of the composition. The composition conatins the polypeptide GH61, fusion protein of beta-glucosidase and one or more cellulolytic ferments. The method to decompose a material that contains cellulose is characterised by treatment of the material with a cellulolytic protein composition. The method to produce a fermentation product includes saccharification of the material, fermentation of the saccharified material with fermenting microorganisms and extraction of fermentation products.

EFFECT: presented inventions may be used for decomposition or transformation of a cellulose-containing material.

12 cl, 14 dwg, 23 ex

FIELD: chemistry.

SUBSTANCE: described is a version of Bacillus licheniformis alpha-amylase having an amino acid sequence which is at least 90% identical the SEQ ID NO: 4 sequence and contains a substitution of S239Q, corresponding to SEQ ID NO:4 given in the description. Provided are a nucleic acid which codes said version; an expression vector containing said nucleic acid; and a host cell containing said vector or nucleic acid. Described are compositions containing the disclosed alpha-amylase and used for starch liquefaction, starch saccharification, starch processing, textile desizing, baking, as well as detergent compositions and an additive. Disclosed is a method of producing ethanol comprising the following steps: a) using the starch liquefaction composition on ground maize or starch suspension; b) starch saccharification; c) fermentation of the saccharified starch; d) obtaining ethanol.

EFFECT: invention enables to obtain compositions containing alpha-amylase, having high thermostability and melting point.

43 cl, 3 tbl, 9 dwg, 6 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of biotechnology. Claimed is protein, including catalytic fragment of sialidase and possessing sialidase activity, which is selected from protein, whose sequence includes amino acids 274-666, or 274-681, or 290-666, or 290-681 SEQ ID NO:12, or includes amino acid sequence SEQ ID NO:14, described herein. Described is fused protein, which includes described above protein and anchor domain. Also given is information about molecules of nucleic acids, which code said proteins, expression vectors, containing said nucleic acids, and pharmaceutical compositions, containing said protein or fusion protein. Claimed is method of treatment or prevention of viral infection, caused by virus of influenza or parainfluenza, including application of therapeutically efficient amount of said composition to epithelial cells of subject.

EFFECT: invention makes it possible to extend arsenal of means against infection, caused by influenza or parainfluenza vitus.

25 cl, 2 tbl, 13 dwg, 17 ex

Modified xylanase // 2464313

FIELD: medicine.

SUBSTANCE: one of the versions provides modified xylanase of Family 11 containing cysteine residues in positions 99 and 118 to form an intramolecular disulphide bond with said intramolecular disulphide bond formed by amino acid replacement in positions 99 and 118 by cysteine with said positions detected by sequence alignment of said modified xylanase of Family 11 with the amino acid sequence of xylanase II from Trichoderma reesei SEQ ID NO: 16, presented in the description. The other versions involves the amino acid replacements in positions 99 and 118 by Cys to form a disulphide bond and 40 by Arg, Cys, Phe, Tyr, His or a basic amino acid in positions 10, 58, 105, 144 and 161 by the basic amino acid in any of the positions, 27 and 29 by the hydrophobic amino acid in any of the positions, 75 and 125 by the non-polar amino acid from the positions, 11 and 129 by the acidic amino acid in any of the positions, 131 by Asn, 52 by Cys. One more version of the present invention is modified xylanase of Family 11 containing replacement by histidine in position 40 with said position detected by amino acid sequence alignment of said modified xylanase and xylanase II Trichoderma reesei with sequence SEQ ID NO: 16.

EFFECT: invention enables producing xylanase of high thermophilicity, alkalophilicity, thermal stability.

17 cl, 22 tbl, 17 dwg, 16 ex

FIELD: chemistry.

SUBSTANCE: fused proteins contain an endoglucanase nucleus amino acid sequence having at least 95% identity to SEQ ID NO:2, fused with an amino acid sequence containing a linker and a cellulose-binding domain (CBD), having at least 95% identity to SEQ ID NO:15. Such fused proteins can be obtained via a recombinant technique using suitable polynucleotides, expression vectors and host cells.

EFFECT: invention provides cellulase, having low activity with respect to restaining, and can be used to treat cellulose material; disclosed fused proteins and enzyme preparations based thereon can be used to prepare detergent compositions or for improving quality of animal feed.

26 cl, 8 dwg, 10 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: strain is prepared of a commercial producer, a mutant strain, Aspergillus awamori M-2002 (Russian National Collection of Microorganisms F-3771D) with using methods of induced mutagenesis and plasmid transformation. The strain A.awamori amyR - T-19 is deposited in Russian National Collection of Microorganisms of Scryabin Institute of Biochemistry and Physiology of Microorgnisms of the Russian Academy of Sciences No. 4277D, stored in a lyophilised condition on a mowed wort agar in the Department of Enzymatic Preparation in Food Industry of State Scientific Institution All-Russian Research Institution of Food Biotechnology of Moscow Russian Agricultural Academy.

EFFECT: invention provides considerably higher glucoamylase yield from a substratum unit.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, in particular to tumour-specific promoters, and can be used in the anti-cancer therapy. There are constructed the broad-spectrum tumour-specific promoters providing the therapeutic gene expression inside a cancer cell. The invention also involves expression cassettes, expression vectors, pharmaceutical compositions, methods of treating cancer and using the expression cassettes and vectors.

EFFECT: promoters of the present invention provide a high expression level of the operatively linked therapeutic gene in the cancer cells of different origin, wherein the normal cell expression is absent or low.

29 cl, 19 dwg, 4 tbl, 20 ex

Up!