Method of studying fluorescent properties and spectral characteristics of nucleotide successions of dna by quantum-bound spectrum of irradiation of dyes with free fluorophoric groups

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and represents method of spectral analysis of fluorescent properties of DNA nucleotide successions. Claimed invention can be applied for genetic diagnostics, research of mitogenetic irradiation of cells, study of coding hereditary and proliferative information. Method includes preparation of water solutions of dyes of basic fluorescence colours. Background fluorescence of dye is measured in respective detection channels by means of fluorescent detector FDG-001. DNA sample is added to dye solution in quantity 150-200 ng. Fluorescence of dye solutions is measured. Results of analysis are registered in form of presentation of values in conventional units of positive or negative increase of fluorescence of dyes relative to their initial background before addition of DNA sample in form of building columnar diagrams or curves of signal growth dynamics in time. Results of dye fluorescence growth are interpreted.

EFFECT: claimed invention makes it possible to determine nucleotide rebuildings of telomeric DNA ends, point mutations, polymorphisms of gens, chromosome rebuildings, and change of karyotype or cell genome.

15 cl, 16 dwg, 1 tbl, 6 ex

 

The technical field

The invention relates to the field of molecular genetics and quantum Biophysics of cells and is essential for the detection of fluorescent properties of DNA sequences in a wide range of light spectrum, including ultraviolet, visible and infrared region. The invention can find application in fundamental studies of the spectral nature mutageneticheskogo radiation and the role of nucleotide changes rearrangements end regions of telomeric DNA in the activation process of cell division. In this regard, the claimed method allows to study the mechanisms of spectral encoding proliferative information in the cell. Its application for the study of gene sequences allows us to understand the mechanisms of quantum saturation of genestructure a method of laser-optical write and spectral encoding genetic information.

The claimed method is the basis of DNA-spectral fluorescence analysis - a new direction of research in biology and medicine. It can be used in the diagnosis and therapeutic purposes for information about the effect of changes in length and nucleotide endings of telomeric overhangs on the intensity and spectral characteristics of light energy, regulating cell division. The method can be used for making spectral maps and color is preset markers resulting fluorescence plots of genes their regulatory elements and entire gene sequence (gene mapping), parts of chromosomes, entire chromosomes and whole genomes (chromosome and genome mapping). In this sense, the invention allows for the spectral diagnosis of point mutations of genes, chromosomal rearrangements and any changes in karyotype and genome of the cell. This penetration into the mechanisms of spectral encoding of genetic information provides a unique opportunity for exposure to physical light sources or fluorescent molecules.

The level of technology

Common information about the fluorescence of DNA based on the idea that it is low intensity and is located in the ultraviolet region of the spectrum. Absorbing properties of DNA are basically determined by the maximum absorption of nitrogenous bases in the middle UV (260 nm). Radiative properties of DNA are also determined by the properties on their member bases. The main contribution in the fluorescence of DNA purines contribute. In aqueous solution the maximum fluorescence DNA falls on the peak emission of guanine (358 nm). Fluorescence of adenine and thymine in aqueous solution is much weaker and corresponds to 380 nm. Thus, according to the basic ideas in science, the fluorescence of the DNA is in the ultraviolet region spec is RA. This so-called conventional fluorescence DNA, easily available for registration direct spectrophotometric methods.

Controversial to this day is the existence of fluorescence DNA in the visible range of the spectrum, the study of which the classical spectrophotometric methods is difficult. However, in the work of the study group F. A. Popp (Germany) provides information about registering using a photomultiplier technology radiation DNA and chromosomes in a wide wavelength range of light from 300 to 800 nm in the form of very weak fields (Popp F. A. Electromagnetic Bioinformation. Munchen-Baltimore. Urban und Schwarzenberg, 1979; Popp F. A., Nagl, W., Li K. H., W. Scholz, O. Weingartner, R. Wolf Biophoton emission. New evidence for coherence and DNA as source. Cell Biophys. 1984; 6(1): 33-52).

Check this superweak radiation DNA in the range of visible wavelengths is very difficult for direct analysis and is based on the use of highly sensitive detectors of photomultipliers, amplifying the signal (Wijk E. R., Wijk R. V. Multi-site recording and spectral analysis of spontaneous photon emission from human body. Forsch Komplementarmed Klass Naturheilkd. 2005; 12(2): 96-106) or high-speed counters photons (Inaba N. Super-high sensitivity systems for detection and spectral analysis of ultraweak photon emission from biological cells and tissues. Experientia. 1988; 44(7): 550-559).

At present, there is widespread methods which allow to record the fluorescence of the DNA in the visible spectrum direct spectrophotometric methods is necessary sensitivity with the aim indisputable recognition of its existence. The defects of the sensitivity of direct methods, even using a photomultiplier technology, not allowed to date to establish a link between specific nucleotide sequence and radiation in various regions of the visible spectrum. There is also methods to link the major types of nitrogen bases with radiation in a particular region of the visible spectrum.

The difficulty of studying the fluorescence properties of DNA has led to the creation of indirect methods of analysis through the study associated with the molecules of the dye fluorescence. However, it should be noted that all known indirect methods related to the study of fluorescence DNA only in the ultraviolet region without consideration of the waves of the visible spectrum. They are based on the fact that some molecules of a fluorescent dye spontaneously bind to DNA, showing in a bound state even more intense fluorescence. This is due to the fact that the excitation spectrum of these dyes corresponds to the range of fluorescence DNA in the UV range. Thus, the dyes perform the role of a molecules witnesses that by increasing the intrinsic fluorescence of visible range in structurally related DNA status indicate a change in its fluorescence properties in the UV range. At the same time until the current mo is enta not disclosed the possible contribution of DNA sequences in increased fluorescence of the dyes in the visible range due to the intrinsic fluorescence of the DNA in the visible spectrum of the same wavelength.

The most widely used for the display UV fluorescent properties of DNA the following substances: ethidium bromide (EtBr), acridine orange and DAPI. Many dyes, including widely used ethidium bromide and acridine orange, bind to DNA through intercalation. When this occurs, the scheduling of the aromatic rings of the molecules of the fluorophore between the bases of the two spirals, i.e. there is a structural interaction. A significant drawback of the use of these dyes is a violation of the integrity of DNA. While local unbraiding and elongation of the double helix change its structure and properties, including fluorescent characteristics (Neville D. M. and Davies D. R. The interaction of acridine dyes with DNA: AnX-ray diffraction and optical investigation. J. Mol. Biol. 1966; 17: 57-74).

The fluorophores of another type, for example 4,6-diamidino-2-phenylindol (DAPI), are associated with minor groove of DNA and are called outwardly to bind ligands. They have advantages over the intercalating compounds, since the interaction does not violate the visible integrity of the biopolymer. However, the connection of such dyes with DNA without changing the visible structure of the double helix, leading to changes in the weight and moments of inertia for reasons that may contribute to the spread of conformational excitations of the non-linear nature of the type of solitons. This opened the program can affect the dynamics of the scattering of radiation by DNA bases and thus to change its native fluorescence (V. Fedyanin K. and Yakushevich L. V. Scattering of neutrons and light by DNA solitons. Stud. Biophys. 1984; 103: 171-178). In addition, the fluorophores type DAPI have a clear selective binding in relation to the nucleotide composition of DNA and suitable for study only at-rich segments. This fact severely limits the versatility of the use of such dyes for analysis of fluorescence properties heteronuclear sequences.

Thus, the main drawback of existing indirect ways to study the fluorescence properties of DNA with fluorescent dyes is changing the structure and physical parameters of DNA. The last remark can not affect its fluorescence characteristics. In this regard, all existing methods using bind ligand, and especially intercalating dyes have the error margin associated with the change of the native fluorescence of the DNA. So undoubtedly relevant is the development of a research method, fluorescence DNA using fluorescent molecules with free fluorophore groups that are not in direct physical contact with the DNA and do not change its structure and parameters.

The main methodological error of researchers to develop the claimed process was the consideration of fluorescent properties of DNA ViDi in the ohms range light separately without their interaction with molecules, fluorescent in the same spectrum of visible light. The result of such studies has been controversial registration using photomultiplier technology superweak fields in the form of single photons (the work of the study group F. A. Popp, Germany). Thus, in the literature there is no similar indirect way of studying the fluorescence of the DNA in the visible range of light using fluorescent dyes. To provide such a method based on the use of fluorescent dyes with free fluorophore groups, non-contact with the inner structure of DNA, has been the aim of the present invention. It should be noted that the inventive method for the first time allowed to establish the formation of quantum-associated spectrum of DNA and similar fluorescent molecules in the visible range of light. This quantum yield spectrum of the fluorophore-linked fluorescence DNA is much superior to that for a single fluorophore, and even more so for a single DNA. If this check results do not require the use of photomultiplier technology and its difficult to argue, as in the case of registration of single photons. In these properties for the proposed method does not currently exist the nearest analogues and prototypes.

Important research issue is the dependence of the fluorescence properties of DNA from the E. nucleotide sequence. In the literature there is evidence that the intensity of the luminescence DAPI increases to the greatest extent when the molecule of the dye binds to double-stranded pieces of DNA that have a lot of a-T nucleotides (Tanious F. A., J. M. Veal, Buczak N., Ratmeyer L. S., Wilson, W. D. DAPI (4',6-diamidino-2-phenylindole) binds differently to DNA and RNA: minor-groove binding at at sites and intercalation at AU sites. Biochemistry. 1992; 31(12): 3103-12). In this regard, the use of DAPI allows you to communicate its fluorescence only at the structure of DNA, but not with a specific nucleotide sequence. It is about the relationship of fluorescence dye and DNA in UV light and not to visible light range.

Thus, at the moment there are no known ways to trace the relationship between a specific nucleotide sequence, and the fluorescence of DNA in different areas of the spectrum, including UV, visible and IR ranges. Up to this time, prior to the claimed invention, not found references on the relationship of the main types of nitrogenous bases and the absorption or radiation, in particular visible light spectrum.

Disclosure of inventions

The main technical objective of the claimed invention is the development of a new indirect way to study the fluorescence properties of DNA in a wide range of wavelengths of light, allowing you to explore the multi-the positive characteristics of its spectrum. The problem is solved by using a new approach to the study of fluorescence properties of DNA without the use of fluorescent molecules that are in direct contact with DNA and alter its structure and physical parameters.

In the first variant of the method of the fluorescent dyes are free molecules together in the same solution with the test DNA (the option of using the free dye). In the second embodiment, the molecule of the dye is located at one end of the DNA sequence of the probe (option using labeled on the end of the probe) or in the form of modified nucleosides within the sequence (probes with internal label). When this plane fluorophoric groups of the dye are freely with respect to the DNA molecule without intercalation.

In remote non-contact embodiment of the method, the dye in the form of free molecules or DNA probes is in a separate test tube with respect to the target DNA sequence. The use of fluorescent dyes specific radiation spectra, allows you to set the ratio of the primary color channels of fluorescence of the studied DNA sequences.

The main technical result of the invention is to increase the special is licnosti and sensitivity of spectral analysis of the fluorescence properties of DNA sequences compared with existing methods. Increasing the specificity of the analysis is the opportunity to simultaneously study the various wavelengths of light corresponding to the spectral characteristics of fluorescent dyes used for analysis. Pre-existing methods using intercalating fluorescent dyes allowed to explore only the ultraviolet spectrum of the fluorescence of DNA.

Of particular importance to assess the specificity of the claimed method of analysis of the spectral properties of DNA has the ability to relate the intensity of the primary colors of fluorescence DNA in the visible spectrum of light with respect to the specificity of its nucleotide sequence. Pre-existing techniques using intercalating dyes of the type DAPI was allowed to see the connection of the fluorescence of the DNA in the UV spectrum with its nucleotide composition, namely the location of the at-par. When this sequence with the same nucleotide composition but differing in nucleotide sequence did not reveal any differences in fluorescence. In this regard, the main distinguishing feature of the claimed invention is the ability to study the spectral-specific properties heteronuclear DNA sequences is not due to the presence of at-rich sites. Raising sensitive the security of the proposed method is expressed in the possibility of registration of its results without the use of photomultiplier techniques using standard fluorometric equipment. This technique greatly simplifies the analysis and reduces its cost.

Improving the specificity and sensitivity of spectral analysis using the inventive method has allowed to establish interconnected fluorescence of the nucleotide sequences of DNA and fluorescent molecules in certain regions of the visible spectrum, identifying areas of radiation and absorption. This type of fluorescence associated with the establishment of a General quantum-associated fluorescence spectrum of DNA and fluorescent molecules. In this regard, it was called a fluorophore-coupled fluorescence DNA. According to the obtained representations of the spectrum of the fluorophore-linked fluorescence DNA functions as a conventional RGB system for encoding color information and presents primary colours (red, green, and blue) and intermediate colors (yellow, orange, blue, purple, violet), resulting from their application. With all the colors of the spectrum are interrelated (integrated) and can act as channels of radiation or absorption depending on the configuration of the spectral code DNA. Spectral code fluorophore-linked fluorescence DNA as managing the functioning of cells, the mechanism is subject to natural minor fluctuations (fluctuations). Significant restructuring of the code was theregister is by the second half of 2012. In this regard, the study of the examples of the invention, the spectral properties of DNA in this spectral unstable period is important for understanding mechanisms of quantum-optical regulation of vital processes of the cell. The special role of these studies acquire in connection with research telomeric DNA, namely its end regions, referred to as G-Ovorhangay. They laid the mechanisms of existence in the cell DNA sequences, which differ in nucleotide composition and spectral properties by changing the position of the nucleotides in the terminal telomeric repeat. The latter fact is of great significance in the light of the opening of the process of change of the terminal nucleotides of the DNA during activation of cell division. The claimed method for the first time allows you to set the ratio of the main channels of fluorescence of telomeric overhangs at any stage of the cell cycle.

However, a significant qualitative difference of the proposed method is that it gives an idea about the correlation of the processes of absorption and emission of light energy for each color channel within the formation of the resulting flow fluorescence of the studied sequences. Based on this, the first time it becomes possible to study quantum resonance relations between the individual what posledovatelnostei DNA in the studied color channels. Special value it finds in the light of studying the interactions of telomeric overhangs that the cell can be represented by different choices of main telomeric repeat and end on different terminal nucleotides. Thus, using the inventive method opens up new possibilities for exploring previously unknown fluorescent properties and spectral characteristics of the DNA inaccessible to previous methods of research.

The invention consists in a new approach to the study of fluorescence of DNA sequences using a set of fluorescent dyes corresponding to the primary colors of the emission spectrum of DNA. When the dyes are not relative to the DNA to bind to the grooves ligands or intercalation between the planes of the bases. The method is based on the unique properties of DNA sequences in different ways to affect the fluorescence of dyes based on their radiative and absorptive properties in the corresponding spectrum of light. The establishment of quantum-related relationship between the nucleotide sequence of the DNA and used dyes allows us to characterize the fluorescent properties of the test sample in a wide wavelength range of visible light from violet to red, including UV the IR region. Selecting dyes with specific spectral characteristics, the researcher gets the opportunity to selectively explore his interest region of the spectrum.

The main significant difference between the proposed method from the previously known is the possibility of detecting fluorescence properties of DNA in the visible range, while conventional spectrophotometric methods detect the fluorescence only in the UV range. Thus the distinguishing property of this method is the use of free fluorescent dyes, which do not come into direct contact with the DNA sequence and do not affect its properties. The application of the method enables to study the mechanism previously unknown method of resonant migration energy at distances greater than the radius of the electron clouds of the interacting substances. The remote nature of such processes can be investigated using contactless variant implementation of the method in which a solution of a fluorescent dye is in a separate test tube with respect to the analyzed DNA sequence. An important advantage of the inventive method is the ability to study the relation of the processes of absorption and emission of light energy in a certain range.

Detection described fluorescent properties the DNA sequences in the visible spectrum was preceded by the observation of an unusual distribution of the background fluorescence of the DNA-probes, which included variations of the telomeric repeat (example 1). These fluorescently-labeled probes contain a combination of dye (FAM) and quencher (RTQ1) on opposite ends. It was observed that regardless of the position of the dye at the 5'-end or 3'end of the probe containing the variant telomeric repeat, ending with the maximum number of guanine (TTAGGG) had maximum background fluorescence (Fig.2). Accordingly, less fluorescence possessed probes with telomeric repeats GTTAGG, TAGGGT and GGTTAG. It was found that such a gradation reduction of fluorescence in the green spectrum is associated with the location of guanine at the nucleotide sequence.

An assumption was made that the fluorescent dye in the composition of the DNA probes on the basis of telomeric sequences acquires new properties due to quantum associated with DNA status, like the widely used and ligand binding to the fluorophores. However, the mechanism of quantum bound state is completely different, as fluorophore group carboxyfluorescein not included with DNA in direct contact (not intercalary inside between the bases and are not associated with its groove). In these conditions it is assumed the establishment of a special quantum communication, which, as will be shown in example 3 is carried out remotely. Was installed on the one link between the location of the nucleotides and other fluorescence dyes in other ranges of visible light. It was shown that when establishing quantum-associated fluorescence spectrum of the dye can be free in solution, being not associated with the 5'- or 3'-ends of DNA sequences. It should be noted that the spatial arrangement of the molecules of the fluorophore affect the specificity of the resulting spectrum by establishing the direction of migration of energy in the study of the nucleotide sequence.

Described observations in General can be formulated in the form of phenomena specific changes in fluorescence of the dye solution with free fluorophore groups when adding DNA sequences. Thus, the modification of the fluorescence dye in the corresponding emission spectrum depends on the nucleotide sequence of the DNA fragment, namely the arrangement of nitrogenous bases. The mentioned phenomenon was the basis of the claimed method of spectral analysis of the fluorescence properties of nucleotide sequences of DNA.

The General scheme of performing spectral analysis of the fluorescence properties of DNA with the help of dye molecules with free fluorophore groups

The first option for the DNA-spectral fluorescence analysis is the use of a fluorescent dye comprising a nucleotide probes in the form of match is, freely based on its 5' or 3' end. When this plane heterocycles molecules of the dye and its fluorophore groups reside freely in space and do not interact with DNA bases. Thus, saved the absence of intercalation and intramolecular interactions. The production of such probes is carried out according to standard techniques limit the modification of oligonucleotides during standard phosphoramidite synthesis. As a label used any fluorescent dyes depending on the spectral characteristics of the studied spectrum of DNA. The use of such probes containing end carboxyfluorescein to study the fluorescence properties of telomeric sequences in the green visible light spectrum, shown in examples 1-3. An important condition is the quality of inclusion in the probe fluorescent label and quencher, if it is used. For an adequate comparison of the fluorescent properties of sequences between a quality label will be included in them should be the same. Otherwise, differences in fluorescence probes will be associated with the effectiveness of the inclusion of the label or the quencher, and not be detected by fluorescence properties of the target DNA sequence. In this regard, by using the services of commercial buildings, the ski companies, involved in the synthesis of modified oligonucleotides, you must require careful control at all stages of their modification.

The experiments showed that the oligonucleotide sequence of DNA labeled with a combination of the fluorophore-quencher at opposite ends, can be used for spectral analysis along with solutions free dye molecules. However, there are some differences in their use, related to the proximity of the fluorophore to the 5' or 3' end, which determines the appropriate direction of migration of energy and its value. In this regard, the results of the DNA spectral analysis by using free dye or end location in the structure of the probe may vary.

A special kind of implementation DNA-spectral fluorescence analysis is a contactless option, in which the interaction of DNA sequences in the composition of the probes is carried out remotely. Thus the solutions of the quantum-interacting probes affect each other at a distance of a few centimeters, placed in different test tubes (example 3).

The following variant of the method is the use of a fluorescent dye as an aqueous solution of molecules, completely free with respect to the structure of DNA. The first stage is preparing the original solutions of fluorescent dyes, the respective main fluorescence spectra of DNA: the green channel (FITC, FAM, R110, TET and analogues), yellow-green (R6G, JOE, HEX, VIC, YakimaYellow and analogues), yellow (TAMRA, Cy3 and analogues), orange-red channel (ROX, SuperROX, Cy3.5 and analogues), red (Cy5, Cy5.5, TexasRed and analogues), near IR (Cy7, Cy7.5 and analogues).

The study of the visible violet and blue channels of fluorescence at the moment hampered by the lack of suitable dyes. Available in spectrum of the dyes should include pyrene (Pyrene). However, it does not satisfy the demands of the free locations fluorophoric groups, as intercalary not only in the duplex, but actively binds to single-stranded DNA. Widely used dye DAPI is also not suitable for spectral analysis, because, firstly, also interacts with the DNA structure, and secondly, has a selectivity in binding to at-areas, which limits its use for the analysis of GC-containing sequences.

Feature of the proposed method is the possibility to study not only the visible spectrum of fluorescence, but also the full spectrum of light, including ultra-violet and infrared, which requires the development of appropriate dyes. In addition, the study of UV and IR ranges requires detailed sampling of the spectrum, the wavelengths of excitation and emission.

) The public benefit of the inventive method is the ability to use any fluorescent dye, which meets the requirement of the absence of interaction with the internal structure of DNA. In the future you may use any appropriate range of fluorophores, widely available on the market, including never-before-used for molecular studies of nucleic acids and proteins. This significantly simplified the search for suitable dyes for all color channels and especially for purple and blue. Today there is a wide range of fluorophores, fluorescent different wavelengths of the visible spectrum by UV irradiation. This can greatly facilitate and reduce the cost of creating detectors-fluorimetric that work only on one length of the excitation in the UV region.

For all cases the spectral analysis necessary condition specific to the dilution of the dye, which provides the background fluorescence, convenient to register the instrument software. She is chosen empirically so that its background is easily detected by exposure of DNA sequences. Thus it is necessary to consider the available upper and lower limits of cultivation, the use of which is determined by the direct dependence of the increase in fluorescence of the dye under the influence of DNA from its initial concentration. Adding the same amount of DNA it solutions to the of Asites with different concentrations increase in fluorescence of the dye is proportional to the change of its original background. In this regard, the background is too diluted fluorescence of the dye can not notice the influence of the fluorescent properties of DNA. On the other hand, a very high concentration of dye will complicate the detection results.

The use of fluorescence quencher when designing probes provides the necessary reduction of the level of intrinsic fluorescence of the dye, which mimics the diluted solution of the free dye. The breeding range of each dye or the concentration of the labeled probes is chosen empirically so as to provide approximately the same quantum yield of fluorescence per unit time for all dyes used for an adequate comparison of the intensity of the color channels. An important condition is compliance with the same intensity (brightness) of the exciting radiation for all colors of the spectrum corresponding to the peak of the fluorescence of the dye, as it was found that the influence of DNA sequence on their fluorescence proportional to this factor. The use of waves of excitation, which do not correspond to the peak excitation of the dye leads to a lower increase in the fluorescence of a solution under the influence of DNA in proportion to the fall in the total fluorescence intensity of the dye at the wavelength.

Described patterns of svidetel what there about against the background of the establishment of General quantum-associated spectrum of DNA is dependent fluorescent properties with respect to the amount of dye and the intensity of the exciting radiation. DNA adds or takes away fluorescence in the investigated range according to the quantity and proportional to the intensity of the excitation source and the level of fluorescence of the dye solution.

Thus, the first phase of DNA-spectral fluorescence analysis with the use of free dye molecules is measured background fluorescence its solution. The measurement is carried out using conventional fluorescence analysis using specifically designed for that purpose devices (fluorimetric, photometers-fluorometers, fluorescence detectors, and the like). The action of these devices is based on excitation of fluorescence by using a light source corresponding to the maximum absorption of the used dye and issue registration with filters corresponding to the maximum of its fluorescence.

In the second stage analysis after obtaining the values of the background fluorescence of the dye solution is added to the sample DNA and mix thoroughly. If we are talking about synthetic oligonucleotide sequences of nature, it is convenient to add n is mediocre solution in very small amounts (not more than 1/10), for example, 1-2 ál 20 ál of dye solution. However, an increase in the volume of the solution does not affect the change of the background fluorescence.

If the study is exposed to a solution of native DNA, for example a pattern of telomeric overhangs, it is concentrated to the desired volume. In another embodiment, the method pre-defined background fluorescence of a solution of a given concentration of dye in the investigated volume of the solution overhangs. It is assumed that all solutions in the specified volume have approximately the same fluorescence, which requires the use of a dye with a stable quantum yield.

The change in fluorescence of the dye solution recorded immediately after addition of the DNA sample and record values within the first ten minutes to obtain the averaged values. It should be noted that DNA is the quantum-dynamical system unlike molecules of a fluorescent dye, a quantum yield which in time changes slightly. Therefore, during the first minutes after adding the sample DNA to the solution of dye fluorescence values can vary. This is due to the establishment of complex quantum resonance relations migration energy in time arising between the nitrogenous bases in the sequence is lnasty DNA and between them and the dye molecule.

In this regard, it is recommended to take an average value for intervals of time which correspond to the first three, five and ten minutes, as in most cases this is enough time to establish a stable quantum yield of the bound spectrum of the DNA-dye. However, in some cases, the study of the dynamics of the fluorescence of the solution for a longer time can give a more detailed view of the dynamic component of the spectrum of DNA. In this regard, it is recommended to use longer periods of measurement at the request of the researcher. The stability of the results in this case indicates the establishment of the energy balance between the paired processes of absorption and emission of light quanta in the studied range. If one does not occur and the change in fluorescence continues, it suggests a particular mode of saturation of the DNA sequences of light energy. Such a special regime of saturation was observed in the second half of 2012 for mononucleotide and telomeric DNA sequences (Fig.7 and 10).

It should be noted that a significant advantage of the proposed method is using the standard fluorometric devices, without the use of photomultiplier technology. When this register is the increase in fluorescence is easily detected and can reach 100% or more from baseline background fluorescence of the solution. When observing the effect of superfluorescence telomeric repeat TTAGGG, which took place on 21 September 2012, the increase in fluorescence was 260% within 48 hours (Fig.7). When the observation of a similar effect for containing cytosine sequence 19 June 2012 the increase of fluorescence was 124% in the first hour (Fig.10). The increase in fluorescence of pure dye in the sample was several orders of magnitude less compared with samples containing DNA. This clearly testifies to the unique properties of DNA sequences to increase the quantum-associated fluorescence dye.

Check this significant increase in fluorescence, in contrast to the fixation of single photons using photomultiplier, indisputable and is reliable results. The recorded increase in fluorescence of the dye is evidenced by the large quantum contributions of DNA in the total fluorescence their associated spectrum, which can easily be seen and visible to the naked eye (Fig.1). Thus, the quantum yield of fluorescence of the DNA in General quantum-associated spectrum, comparable with those for the fluorescent dye. This demonstrates outstanding potential DNA as a source of photons of the visible spectrum.

As a device for registering the fluorescence in the example of the use of the invention, used fluorescent detector FDG-001 (joint development by the author and the Institute of theoretical and experimental Biophysics, Pushchino, Russia). A detector constructed according to generally accepted principles of fluorimetry using multichotomous led lights, and a set of filters that allows detection of the following dyes (FAM, FITC, R6G, JOE, HEX, TAMRA, ROX) with sensitivity, not inferior to commercial devices. The intensity of fluorescence detected using the appropriate filter on the matrix high-sensitivity monochrome camera and stored in an image file. Image files were processed using specialized software image processing LabWorks 4.6. (UVP, England), which made it possible to convert the results in numeric format and to get the value of significant fluorescence in arbitrary units. The results were presented in form of bar charts or curves showing the change in fluorescence of the dye solution after addition of the DNA sample in arbitrary units. One of the forms of representation of the results of DNA-spectral fluorescence analysis was the preparation of the spectral maps in the studied wavelength range, and color markers resulting fluorescence study of nucleotide sequences.

Brief description chere the hedgehogs

Figure 1. The image of the fluorescent dyes FAM and ROX before and after the addition of sample DNA. Image obtained using a highly sensitive video camera detector FDG-001 using green (520 nm) and red (605 nm) channel detection. The fluorescence values are given according to the program LabWorks 4.6. (UVP, England).

And - dye FAM, to which was added mononucleotide sequence oligo d(C)12 in terms of the spectral code of fluorescence DNA on June 19, 2012; image demonstrates the phenomenon of prolonged gipernatsiya studied sequence of green fluorescence within 20 minutes.

B - ROX dye, to which were added a sequence CAGATGGCTGCTCCCACACTTC gene cyclina D2 person in terms of the spectral code of fluorescence DNA at the end of June 2012.

Figure 2. Fluorescence DNA probes based on variations of telomeric repeat DNA of a person, marked by a combination of dye FAM and the quencher RTQ1.

A - image of the fluorescence probes, obtained by the video camera detector FDG-001 using green (520 nm) filter. The upper row corresponds to a probe FAM-RTQ1, lower - RTQ1-FAM probes. The fluorescence values for each probe are shown in the LabWorks 4.6. (UVP, England).

B and b - values of fluorescence probes containing variations of the bodies of the measuring loop, presented in the form of bar charts.

Figure 3. Dynamics of the green channel fluorescence telomeric repeats of human DNA for example FAM-RTQ1 labeled probes (characteristic corresponds to a spectral code fluorescence DNA on March 2012). Displays fluctuation changes the saturation levels of telomeric DNA green fluorescent energy in time within existing at the time of the study the spectral DNA code.

Figure 4. Schedule changes FAM-associated fluorescence telomeric repeat TTAGGG under the influence of remote influence sequences of other options telomeric repeat DNA of the person. Demonstrates the nature of quantum resonance relations migration energies that arise between different sequences telomeric repeat. The experiment was conducted in the period of stable existence of the spectral code of DNA at the time of the study (first half of April 2012).

Figure 5. Chart of the increase in fluorescence of the dyes FAM, TAMRA, and ROX in the respective colors of the visible spectrum under the influence of the possible variants of telomeric repeat DNA of the person. Shows the spectral characteristics of the endings of telomeric overhangs corresponding spectral code DNA at the end of April 2012.

Figure 6. Growth graph of fluorescence dye FAM p is on the influence of variations of the telomeric repeat. Displays the dynamics of the slow saturation of telomeric sequences by green fluorescence in modied spectral DNA code at the end of September 2012.

Figure 7. Growth graph of fluorescence dye FAM in time under the influence of variations of the telomeric repeat. Displays the dynamics of the periodic gipernatsiya telomeric sequences on the basis of repeat TTAGGG green fluorescence in modied spectral code DNA (21 September 2012).

Figure 8. Chart of the increase in fluorescence of the dye TAMRA and ROX in the respective colors of the visible spectrum under the influence of the possible variants of telomeric repeat DNA of the person. Shows the spectral characteristics of the endings of telomeric overhangs in yellow and red fluorescence spectra in terms of the modified spectral DNA code at the end of June 2012.

Figure 9. Chart of the increase in fluorescence of the dyes FAM, TAMRA, and ROX in the respective colors of the visible spectrum under the influence of the different options mononucleotide DNA sequences. Shows the spectral characteristics of the nitrogenous bases, the corresponding spectral code DNA at the end of April 2012.

Figure 10. Growth graph of fluorescence dye FAM in time under the influence of mononucleotide sequences. Displays the dynamics per the methodological gipernatsiya green fluorescence sequence, containing cytosine in terms of the modified spectral code DNA (19 June 2012).

Figure 11. Chart of the increase in fluorescence of the dye TAMRA and ROX in the respective colors of the visible spectrum under the influence of mononucleotide sequences. Shows the spectral characteristics of the nitrogenous bases in yellow and red fluorescence spectra in terms of the modified spectral DNA code at the end of June 2012.

Figure 12. Growth graph of fluorescence dye FAM in time under the influence of mononucleotide sequences. Displays the dynamics of the slow saturation of the green fluorescence of nitrogenous bases in terms of the modified spectral code DNA (late October 2012).

Figure 13. Chart of the increase in fluorescence of the dyes FAM, TAMRA, and ROX in the respective colors of the visible spectrum under the influence of fragments of negative and positive circuits DNA genes cycline B1 and D2 of the person. Shows the spectral characteristics of the fluorescence of these gene sequences in terms of the spectral code of fluorescence DNA at the end of April 2012.

Figure 14. Growth graph of fluorescence dye FAM in time under the influence of the sequence minus and plus chain tsiklonov B1 and D2 of the person. Displays the dynamics of the saturation of the green fluorescence sequences under conditions of change in the military spectral DNA code (mid October 2012).

Figure 15. Chart of the increase in fluorescence of the dye TAMRA and ROX in the respective colors of the visible spectrum under the influence of the sequence minus and plus chain tsiklonov B1 and D2 of the person. Shows the spectral characteristics of the gene sequences in yellow and red fluorescence spectra in terms of the modified spectral DNA code at the end of June 2012.

Figure 16. Example of compiling spectral maps and color markers resulting fluorescence sequences telomeric repeat DNA of the person in the wavelength range 520-605 nm. According to the fluorescent dyes FAM, R6G, TAMRA, and ROX on April-the month of may 2012.

The implementation of the invention

The claimed method is illustrated by several examples, demonstrating his versatility as a method of analysis of the spectral properties of the genome of the cell (spectral genomics). The main characteristic spectral properties of the genome is the ratio of the levels of fluorescence of the primary color channels of nucleotide sequences that vary in time. Spectral properties of mononucleotide sequences allows to identify their own contribution of each type of nitrogenous base in the fluorescence of a DNA sequence without affecting other types of azetilirovaniu, its constituent, as in the case of heteronuclei sequence (example 5).

The study heteronuclear sequences of different lengths displays the total range of their fluorescence, which occurs when the interaction they are composed of nitrogenous bases. It is the sum of the balance of the processes of emission and absorption of fluorescence in different colors of the spectrum.

Of particular importance for the regulation of cell division is the study of the fluorescence properties of telomeric sequences of overhangs, which are determined by the nucleotide composition of their endings, presents variants of terminal telomeric repeat (examples 1-4).

The study of various gene sequences allows us to investigate the mechanisms of spectral color-coding genetic information and quantum saturation of genestructure with the aim of establishing control of the laser-active medium of the genome (example 6).

Example 1. DNA spectral analysis of the fluorescence of telomeric DNA repeats of the man in the green range of visible light using end-labeling of probes by a combination of carboxyfluorescein and suppressor RTQ1.

In the experiment we used aqueous solutions of the following oligonucleotide probes containing the possible options telomeric repeat (underlined):

W is Roy set of probes, the same nucleotide sequence, contain a combination of the label and the quencher at opposite ends, namely 5'-RTQ1 and 3'-FAM.

Each probe contained one of the options full-telomeric repeat and the same for all sequences of 4 of cytosine residues, which allowed to extend the probe to the optimum length. It should be noted that similar experiments can be used sequences of probes consisting entirely of telomeric sequences without the influence of cytosine, is not part of the native telomeric DNA of a person. Used design of probes containing all his variants of the same poly(dC)-the sequence is consistent with the purposes of this study, as it allows you to save unambiguous discrimination influence the sequence of the telomeric repeat. While the presence of short poly(dC)-sequence contributes to the establishment of more revealed the shade of fluorescent potential varieties telomeric repeat depending on the nucleotide sequence. This is due to the influence of the fluorescent properties of cytosine with maximum energy potential in the green spectrum.

Probes were synthesized in the company "Synthol" (Russia) in terms of the unmodified spectral code fluorescence DNA FAM-RTQ1 - April 2009 and RTQ1-FAM - January 2012). The sequence obtained standard phosphoramidite way with a high degree of inclusion of the dye and quencher are the same for all probes. In this regard, differences in the fluorescence of the probes was determined by the peculiarities fluorophosphates fluorescence DNA sequences of the probes in the green spectrum at the time of synthesis, not quality including labels.

To measure fluorescence probes were prepared the same 10 μm aqueous solutions in a volume of 20 µl. For the purposes exclude the effects of intra - and magsomovich interaction sequences with the formation of duplex GGG/CCC solution was heated briefly to a temperature of 70°C, followed by a gradient of decrease to 37°C. Measurement of fluorescence was performed using a fluorescent detector FDG-001 under the same conditions the intensity of the excitation radiation, and extracts the signal of the detecting camera.

The results are shown in figure 2, where the graphical image of each probe (A) provides a significant amount of fluorescence in arbitrary units according to image analysis LabWorks 4.6 (UVP, England). The ratio of the signal levels of each probe for easier comparison of fluorescent potentials of telomeric repeats is illustrated in the form of bar charts (Fig.2B and C).

From the analysis polucen the x data shows, when both variants labeling remained characteristic of the gradation values of fluorescence probes, depending on the position of guanine in the telomeric repeat. The highest fluorescence in both cases, the tagging has the third probe containing telomeric TTAGGG repeat, ending with the maximum number of guanine. Lower fluorescence had the probe with the telomeric repeat GTTAGG, ending in two guanine. Further decreasing the energy potential was located probes with telomeric repeats TAGGGT and GGTTAG. The lowest values of fluorescence possessed probes with telomeric repeats GGGTTA and AGGGTT.

Thus, the use of end carboxyfluorescein labeling for the study of nucleotide sequences telomeric repeat the person revealed their specific spectral characteristics. It was found that the options telomeric repeat sharply differ in their fluorescence potential in the green visible light spectrum. In the specified range of fluorescence observed following gradation energy potential options telomeric repeat from maximum to minimum: 1. TTAGGG; 2. GTTAGG; 3. TAGGGT; 4. GGTTAG; 5. AGGGTT and 6. GGGTTA.

Thus the value of the energy potential of repetitions depended on the location of the molecules of the fluorophore. The maximum value of the differences between Autorama was observed at the 5'-end location carboxyfluorescein (Fig.2B). Thus, the use of different end position of the label in the probe in the implementation of the proposed method allowed us to identify the role of the position of the fluorophore in the formation of quantum-associated spectrum.

In the cell the maximum differences in fluorescence may have telomeric overhang ending variety of telomeric repeats at the location of the fluorophore closer to the 5'-end. As sources of fluorescence (fluorophores) can be amino acids proteins in connection with telomeric DNA. For example, protein NOT having affinity for telomeric sequences Averchenkov, has a number of amino acid residues tyrosine and phenylalanine, an aromatic heterocycles which come into close contact with the planes of nitrogenous bases. In this regard, telomeric repeats, located outside the binding site of the protein ROT towards the 3'-end of DNA have a higher fluorescence than standing in front of him. This creates unique conditions for the maximum differences in fluorescence green spectrum for different variants of terminal telomeric repeats. This mechanism ensures the existence in the cell different photoregion characteristic of non-proliferating and activated to divide the States of the cells. Their appearance is directly related to changes in the nucleotide completing the deposits of telomeric overhangs and the existence of a balanced equilibrium and non-equilibrium profiles of the terminal nucleotide.

In relation dened above features of fluorescence probes, it was shown that the green channel fluorescence is a spectral-specific sequences telomeric repeat DNA of the person. It provides the main trigger mechanism for switching the intensity of the color channels when activated cell division associated with rearrangements of the endings of telomeric overhangs in the cycle pronucleotides offsets. A balanced profile of the terminal nucleotides characteristic of non-dividing state of the cells and of activated phases to cell division after trigger point start dividing in early G1 phase, has a high content of AGG and TAG terminal triplets. These triplets are composed of terminal telomeric repeats of Averchenkov determine their high level of fluorescence in the green spectrum. Trigger the transition to the activated to the division of the state is accompanied by rearrangements endings of telomeric overhangs and unbalanced development of non-equilibrium profile of their terminal nucleotide with a predominance of TTA terminal triplet. As can be seen from the obtained data, GGGTTA triplet in the composition of the studied probes has the lowest fluorescence in the green spectrum, several times smaller than that for repeat GTTAGG characteristic of the equilibrium profile. Thisway, activation of cell division is accompanied by a sharp drop in the intensity of the green channel fluorescence of terminal telomeric repeats of human DNA.

In this regard, the study of the dynamics of changes of the green channel fluorescence telomeric DNA repeats as a kind of spectral genomics monitoring is an example of research in quantum optical processes activation of cell division.

The next aspect of applying end-labeling of DNA probes in DNA-spectral analysis of fluorescence in the visible range is the study of the dynamics of their background fluorescence over time. An example of such research could be the study of the dynamics of the green channel fluorescence telomeric DNA repeats within the DNA-probes in the period March 2012. We used the above-described concentration of synthetic probes, containing varieties of telomeric repeat and labeled by a combination of dye FAM at the 5'end and quencher RTQ1 on the 3'-end. The results of the monitoring are presented in the form of graphs showing the levels of fluorescence in the green spectrum for different variants of telomeric repeat the person in the specified date of the analysis (Fig.3).

Conducted using the claimed process monitoring demonstrates the dynamic component of the genome within the current specification of the Central code at which is stored a General view of the correlation energy contribution of each type telomeric repeat in the green spectrum, which grows in the direction: 6th, 5th, 1st, 4th, 2nd and 3rd options repeat. However, the energy levels vary and identify periods of growth (13.03.2012) and fall (5.03.2012 and 27.03.2012). The graph shows a further increase in fluorescence after the last measurement point (28.03.2012), which probably indicates the presence of the next boom period. For this monitoring period, the maximum variation of the values of fluorescence in the green spectrum for some variants of telomeric repeat reached more than 50%. This shows that the dynamic component of the green spectrum fluorophosphates fluorescence telomeric DNA.

The concept of trigger mechanism for switching the color channels when activated cell division, formulated by the author of the proposed method assumes that the adequacy of its functioning depends on the balance of the fluorescence intensity of the colors. First of all, this applies to the energy level of the color channel, most spectral-discriminatory main nucleotide transitions endings of telomeric overhangs. Based on this significant change in the level of fluorescence in the green channel is for the genome of the cells vulnerable moment. This is because in these conditions should be maintained adequacy trigger mechanisms change channels and associated processes of modification endings telomeric DNA.

In this regard, a possible cause of malignant degeneration of cells and different genomic damage can be various violations occurring in such spectral-unstable moments. Therefore, the identification of time critical changes in the level of the main spectral-specific channel fluorescence of telomeric overhangs, namely green, is an important preventive task spectral genomic monitoring that can be performed using the inventive method.

Example 2. Description of the processes of emission and absorption of fluorescent green energy in the visible light spectrum sequences telomeric DNA in the sample mixtures options telomeric repeat, labeled carboxyfluorescein and damper RTQ1.

The experiment was conducted in the days of stable existence of a spectral code fluorophore-linked fluorescence DNA (second half of March 2012).

Received evidence that the nucleotide composition of the probes affects their fluorescence and spectral characteristics suggest that the probes bearing different options telomeric repeat, will influence who and the fluorescence of each other. This statement is of great importance for understanding the role of aggregate telomeric G-overhangs ending in different telomeric repeats, as a system, the various components which separate G-overhang) influence each other and the end result of their overall interaction. The role of the criterion of this interaction can execute the resulting fluorescence of overhangs in green FAM-associated spectrum.

In this example of the invention was studied mutual influence FAM-RTQ1 probes at each other as the model antagonistic interaction options telomeric repeat in green fluorescence spectrum. The experiment was to study the influence of background fluorescence probe FAM-TTAGGGCCCC-RTQ1 probes with other telomeric repeats. The studies were conducted in different spectral stability of the days in March, 2012. These days the typical dependence of the level of green fluorescence of telomeric repeats on the number of guanine in terminal triplet manifested in varying degrees. Test probe was taken as the variant with the maximum background fluorescence, containing telomeric repeat, ending with three guanine residue.

The study period corresponded to the period between the first maximum fluorescence (13.03.12) and followed by a minimum (27.03.12), which corresponds to the speaker the fluctuation changes in fluorescence in the green spectrum for telomeric repeats in March 2012 in the previous example (Fig.3).

For the study were taken the same number of probes (20 picomole) in the final volume of a mixture of 20 µl. theoretically expected fluorescence of the mixture was calculated as the sum of the two mean values of the background fluorescence for each probe in the mixture: Ftheory=F1+F2. The average background value for each probe was calculated separately for five independent solutions. As can be seen from table 1, the actual fluorescence of a mixture of probes was different from theoretically expected and determined the value of the difference ΔF (ΔF=Ffact-Ftheory).

The experiment has allowed to establish that the options telomeric repeat come together in the quantum resonance relations. In the green channel fluorescence was shown that each of the options telomeric repeat, having a certain ratio of radiative and absorptive properties, affects the properties of other repeats that are located together in a mixture. Variant telomeric repeat GGGTTA having a maximum absorbing properties in the green emission spectrum of the mixture with TTAGGG-repeat, showed the biggest understatement of the fluorescence compared to the other mixtures. When the probes are clearly divided into two groups. The first group consisted of probes with TTAGGG repeats, GTTAGG and TAGGGT, for which the maximum period is dominated by radiative t is above the absorbing (positive ΔF). In the fall the total fluorescence intensity in the green spectrum in the interim period and the period of the minimum positive value ΔF is preserved only for TTAGGG-repeat. It says its special properties as the main donor fluorescent green energy in terms of the basic spectral code DNA. In the period of the minimum intensity of green fluorescence of all the other probes showed increased negative value ΔF, indicating its critical role in the saturation of the genome green fluorescence, see table.

The telomeric fluorescence FAM-RTQ1 probes in two-component mixtures for example TTAGGGCCCC probe in different periods of intensity
The combination of numbers of probes in the mixtureThe variations of combinations of telomeric repeat (terminal triplet underlined)ΔF 13.03.12 the period of the maximumΔF
21.03.12 intermediate
ΔF 27.03.12 period of at least
3-1TTAGGG+GGTTAG-0,4-1,83-2,15
3-2TTAGGG+GTTAGG-1,26-1,58
3-3TTAGGG+TTAGGG+5,67+3,75+1,16
3-4TTAGGG+TAGGGT+0,46of-2.1-2,37
3-5TTAGGG+AGGGTT-1,56-2,34-2,48
3-6TTAGGG+GGGTTA-1,79-2,98-4,49

For probes of the second group (GGGTTA, AGGGTT, GGTTAG), especially for telomeric repeat GGGTTA, the absorption of green light energy always prevailed over radiation (negative AF). There was observed a tendency to increase the absorption in times of minima compared with periods of highs, reflecting a General trend of decrease in the intensity of fluorescence in the green spectrum.

In conclusion, it should be noted that regardless of the dynamic component of the spectral properties of telomeric repeats, consisting of alternating periods of maximum and minimum fluorescence, sobranetska gradation increase their energy potential in the green spectrum, depending on the mutual position of nucleotides in their composition: 1. GGGTTA; 2. AGGGTT; 3. GGTTAG; 4. TAGGGT; 5. GTTAGG; 6. TTAGGG.

To study the correlation properties of the emission and absorption of light energy by the DNA sequences plays a specific role of remote non-contact version of the method that is presented in the following example embodiment of the invention.

Example 3. Contactless method of studying the processes of emission and absorption of fluorescent green energy in the visible light spectrum sequences telomeric DNA sample options telomeric repeat, labeled carboxyfluorescein and damper RTQ1. The experiment was conducted in the days of stable existence of a spectral code fluorophosphates fluorescence DNA (the first half of April 2012).

In the experiment used the same oligonucleotide probe as in examples 1 and 2. The original was preparing control 1 μm aqueous solution of the probe FAM-TTAGGGCCCC-RTQ1 against which assessed the impact of telomeric repeats of other probes. After dilution of the effluent with a high concentration of the solution was subjected to isolation from the remote actions of any of the sequences within 2 hours. During this time, the initially high fluorescence of control solution, saturated quanta from the original flow naturally reduce the alas to a certain starting level. This state of control solution is called quantum-unsaturated and describes his own energy potential, in contrast to the original quantum-saturated solution obtained immediately after dilution of the effluent with a high concentration.

The starting value of the fluorescence in the experiment was 28,79% (point 1 on the graph of Fig.4). Before the experiment studied the variance of the measurement error by five-time measurement starting value of the fluorescence after shaking the solution on a vortex. Shaking on a vortex allowed to perform the reorientation of the dipole of the fluorophore and redistribute quantum saturation of the overall system. In this regard, in the course of the experiment prior to each measurement, fluorescence, we were doing the shaking and briefly centrifuging the solution.

The dispersion of the values of the starting level of fluorescence of the probe was not more than 0.05% Is a small amount of error associated with the orientation of the dipole of the fluorophore in space, turned out to be substantially less than the obtained value changes of fluorescence of the control probe under the influence of other sequences of the probes. In this regard, the results obtained are accurate and adequately demonstrate the mutual influence of variations telomeric by the Torah to each other.

The solutions of the probes, the effect of which was studied, prepared in advance. They consisted of a 10 μm solution volume of 20 µl. The probes were stored frozen in the other room. The solution immediately before the survey was taken out of the freezer, thawed, heated to 37°C for 1 minute. After shaking the control and test samples were placed in a rack in close proximity to each other at a distance of 1.5 cm for 5 minutes. Then control sample was shaken again and were subjected to measuring the level of fluorescence, and the tube pressure probe was located at a distance of not more than 5 cm, that is preserved condition for quantum communication between the solutions of the probes. The values of fluorescence probes correspond to points 2, 4, 6, 8, 10 and 12 on the graph of Fig.4. After measuring the fluorescence of control solution test probe was carried to another room and placed in the freezer. Next, the control sample was subjected to shaking, after which he was for 5 minutes in isolation without the influence of any of the sequences. After isolation of the control solution was again subjected to shaking and measuring fluorescence (white dots in figure 3, 5, 7, 9, 11 and 13). The described procedure was repeated for all of the test probes in the specified graph sequence to the right n left (Fig.4).

Contactless remote variant of the proposed method has allowed to establish that the sequence of the telomeric DNA, represented by different telomeric repeat, have a unique correlation of the processes of emission and absorption. It was shown that relative to the green channel fluorescence of the six possible sequences telomeric repeat clearly distinguished two groups.

The first group consists of TTAGGG repeats, GTTAGG and TAGGGT. They have the property of emitting green fluorescence, mainly on absorption. A special role plays TTAGGG-variant telomeric repeat, as it possesses the highest qualities of the fluorescence radiation in this range, while it has no visible absorption. It is the maximum donor green light energy in the telomeric DNA of cells in the conditions of operation of the fluorophore-linked fluorescence. Other options telomeric repeat of this group possess this property to a lesser extent depending on the nucleotide sequence. Replays GTTAGG and TAGGGT can be both donors and sinks of energy, depending on the quantum saturation of the system. Additional experiments similar to example 6, has allowed to establish that if the repetitions GTTAGG and TAGGGT precede the TTAGGG probe with Maxim the school emissivity, they will also be emitters. After exposure to repeat TTAGGG other repetitions of this group become scavengers and inhibit quantum saturation of the system, as shown in example TAGGGT-repeat (point 8 of the graph of Fig.4). However, after removing TAGGGT-repeat system is returned to its quantum saturation occurred due to the action of TTAGGG-repeat, which clearly shows the rise of the dashed line connecting points 7 and 9 on the chart.

The second group includes the GGGTTA repeats, AGGGTT and GGTTAG whose property resonant absorption of green light energy mainly dominates the radiation that was demonstrated in the contact version of the method in example 4. A special place among them is GGGTTA repeat, which is pronounced antagonist TTAGGG repeat in green fluorescence spectrum, as it has across most pronounced absorbing properties of prolonged action. The drop in fluorescence continued even after the control solution has been in seclusion (point 13 of the graph of Fig.4). Outstanding absorption properties GGGTTA repeat demonstrates the downward dotted lines showing the quantum saturation of the system after exposure of the probe and connecting the light spots 11 and 13 of schedule. Similar results were obtained in the contact experiments, in which the s was also shown the maximum prevalence of absorbing fluorescent properties on radiative repeat GGGTTA. The second property acquisitions green fluorescence are AGGGTT and GGTTAG repetitions.

In the case of primary quantum-saturated solutions the control sample with a high degree of energy saturation obtained from the source runoff with high concentrations, all of telomeric repeats resulted in a decrease of fluorescence in different degrees depending on their energy potential, defined by nucleotide sequence.

Thus, the ratio of absorptive and radiative properties of telomeric repeats both the first and second groups, subject to the General rule, but it depends on the ratio of their energy potential and the saturation level of a General quantum system of the dye solution. If the level of saturation of the total quantum system more, as, for example, in the case of primary quantum-saturated solution or after exposure of the preceding energetically more rich repeat observed that the apparent absorption of energy in the form of a drop in the fluorescence of the solution. Conversely, if the level of quantum saturation of the system is less than the energy potential of repetition, for example, after exposure of the preceding repeat with a lower potential, the observed increase in fluorescence of the solution and increase the overall quantum saturation of the system is.

An important advantage of contactless method is that it allows to evaluate the influence of several telomeric sequences in the form of contiguous sequences of one variant over another that simulates natural replacement endings of telomeric overhangs in the activation process of cell division. Thus the study of the processes of emission and absorption of light energy is possible in any of the color channels due to the use of dyes corresponding fluorescence spectrum.

Thus, the use of different variants of the method (both contact and contactless) has allowed to establish that telomeric overhang represent the elements of a single quantum resonance system and influence each other not only being in one solution, but being in different test tubes (remotely). Drawing an analogy between the closed volume of the microtube and individual cells, the use of the claimed method acquires a great importance for understanding the mechanism of remote interaction between cells and the existence of a uniform light field of the cell and organism as a whole.

The result of the quantum-resonant interaction of telomeric overhangs, distinguished by its length and nucleotide endings, is the maintenance of the luminous flux certain intense the values and spectral characteristics, that is the basis mutageneticheskogo radiation of the visible range, the control cell division. In this regard, the claimed method is a unique, unparalleled tool of his research, which may find wide application in medicine and basic biology.

Example 4. DNA spectral analysis of fluorescence visible range of synthetic sequences of the G-chain telomeric DNA of man, represented by different telomeric repeat (variant implementation of the method using a fluorescent dye in aqueous solution free molecules).

Were used in the experiment group sequences of synthetic oligonucleotides with a length of 12 N. O., which consisted of a variety of possible endings telomeric G-overhangs, presents six variants of terminal telomeric repeat. Each oligonucleotide consisted of two full-telomeric repeats, different from previous choices offset by one nucleotide.

All sequences were synthesized standard phosphoramidite way in "Evrogen" (Russia):

1. GGTTAG GGTTAG;

2. GTTAGG GTTAGG;

3. TTAGGG TTAGGG;

4. TAGGGT TAGGGT;

5. AGGGTT AGGGTT;

6. GGGTTA GGGTTA.

The experiment was preparing the original aqueous solutions of dyes (FAM, TAMRA, ROX) volume of 20 μl in the end is concentratie 0.25-0.5 µg/ml depending on their quantum yield so to the cultivation provided approximately the same background fluorescence in each of the color channels of detection for their adequate comparison.

As the dyes used commercial preparations of N-hydroxysuccinimide esters produced by "Synthol" (Russia), which in the absence of amino groups in the conditions of the experiments meet the requirements of chemical free dye was not interacting with the analyzed DNA sequences. Measured background fluorescence of these solutions in three replications to compute the average values of the background and establishment of the maximum variation of the natural fluctuations of the fluorescence of the dye solution. Then to the solution was added an equal number of investigated oligonucleotide (40 pmol in 1 mm aqueous solution), the sample was thoroughly mixed and a measurement was performed fluorescence in threefold repetition to calculate the average value within the first ten minutes after mixing. Levels of fluorescence, corresponding to the three, five and ten minutes after mixing were averaged and a criterion of achieving quantum equilibrium solution. In the absence of reaching equilibrium and the continued growth of fluorescence measurements were continued at fixed intervals of time.

All change is rhenium was performed using a fluorescent detector FDG-001 using appropriate channels of detection, namely green filter (520 nm) for detection FAM, yellow-green filter (550 nm) for R6G dye, a yellow filter (580 nm) for TAMRA and orange-red filter (605 nm) for dye ROX. All measurements were carried out with the same intensity of the exciting radiation corresponding spectrum and equal exposure times of the signal on the matrix of the detecting camera that provided comparable conditions of accumulation of the light signal and estimating the change in fluorescence.

The measurement results were calculated by how many standard units increased or decreased fluorescence of the original dye solution after adding an appropriate sample of the oligonucleotide. The results were presented in form of charts and graphs showing the levels of fluorescence dyes. The ratio of the obtained values of increase in fluorescence shows the spectral characteristics of the fluorescent properties of the studied sequences telomeric repeat in the studied spectra of visible light.

The study was conducted from April to September 2012, which resulted in the establishment of different spectral characteristics of telomeric DNA (Fig.5-8), demonstrating the unique process of changing the saturation regime of telomeric DNA green light energy recorded in the period.

The establishment of polymorphs is and the terminal telomeric nucleotides of overhangs and the associated cycle pronucleotides offsets their 3'-end, allowed to identify the presence of specific balance options endings of telomeric overhangs, characteristic for the primary and non-dividing activated to divide the state of the cells. In this regard, the study of spectral properties of possible variants of the terminal repeats, which telomeric end overhang, namely, the balance sheet ratios of the main colors of the spectrum fluorescence at different stages of the cell cycle is the actual problem. It allows you to define specific spectral markers are activated by cell division that occurs during major transitions nucleotide endings of telomeric overhangs GTTAGG→GGTTAG→GGGTTA.

In the study of all three colors of the visible spectrum fluorescence during continuous shifts one sample after another was seen the effect of the so-called "residual field DNA". It is that place scanning the sample in the detector continued to carry information about its fluorescence in the form of weak fields even after its removal. In this regard, the fluorescent properties of the samples was influenced by previous DNA sequence. Therefore, special importance was the scanning sequence of samples.

Given the detected effects of previous samples in the subsequent, we could follow the same scheme of alternation samples when conducting and the aleesa all the studied sequences as telomeric, and gene or mononucleotide. In Fig.5 shows the spectral characteristics of telomeric repeats in sequence from left to right, one through six options. The specified values of fluorescence corresponded existed at the time of the study the spectral condition code DNA (late April 2012).

Detection of the effect of the residual field DNA" in relation to the telomeric sequences of overhangs is of great importance in the light of the understanding of the speed and sequence of changes in their terminal nucleotides in the activation process of cell division. In this regard, we have studied the sequence of samples corresponding to main navigation terminal triplets in the cell that occurs when the activation of cell division: 1.TAG→6.TTA→5.GTT→4.GGT→3.GGG→2.AGG.

For the red spectrum is the change in the sequence of samples affected significantly only on fluorescence telomeric repeat with terminal triplet GTT. All other options telomeric repeat overhangs was similar to the first sequence of sample values. Fluorescence telomeric repeat AGGGTT in the second case, the sequence of samples was +43,12, which is significantly higher compared to the original sequence of samples (+28,13 chart 5). From this we can conclude is that the increase in fluorescence in the near-red spectrum for GTT-terminal triplet depends precedes it in time guanine-rich triplets (AGG,GGG and GGT) or occurs after them, feeling their overwhelming influence. This fact reveals the energetic feasibility of the existing cycle transitions terminal triplets of telomeric overhangs during activation of cell division. It consists in maintaining the highest level of the red channel fluorescence on the drop of the green in the transition of most of the endings in the terminal triplet TTA. In addition, the level of red fluorescence when activated cell division is supported by the switching telomeric repeat with terminal triplet GTT in a state of high fluorescence in the absence of the overwhelming influence of repeat AGG (Fig.16D, the activated state of the cell*). On the contrary, the high content of GTT terminal triplet (25-27%) in non-dividing state of the cell is characterized by its reduced variant of fluorescence, as it is influenced simultaneously present with him goingsomewhere triplet AGG equal.

Thus, the application of the inventive method in this study shows that each variant telomeric repeat, which can end telomeric overhang, has the special the specific spectral properties and, first of all, the unique ratio of red and green fluorescence. The most obvious demonstration of these properties shows the spectral map for the studied wavelength range 520-605 nm using dyes FAM (520 nm), R6G (550 nm), TAMRA (580 nm) and ROX (605 nm) (Fig.16). The conversion of the received spectral data in the RGB system of color coding the information presented in the form of a token resulting fluorescence for each variant telomeric repeat. All study the colors of the spectrum in the investigated wavelength range is represented as the resulting ratio of the red and green color channels. In particular, the yellow-green channel fluorescence (550 nm) was seen as the result of the predominance of green above the red in the ratio 2:1, orange-red channel (605 nm) as a result of the dominance of red over green in the ratio of 1.8:1. The yellow channel fluorescence (580 nm) was presented as the ratio of the red and green colors in the ratio of 1:0.9 to. The result of the interaction of these colors are presented in the form of a color marker, as the resulting ratio R/G red and green color channels in the investigated range of the light spectrum.

As can be seen from consideration of Fig.16, markers resulting fluorescence differ not only in tone color, but also on its intensity (brightness) on a scale HSL (HSB). From e the CSOs should, different variants of terminal telomeric repeats of Averchenkov develop into the overall picture of the resulting fluorescence intensity, which is a color marker specific brightness characteristic of cells at a certain stage of the cell cycle.

It should be noted that the main differences in the spectral properties of telomeric repeats are associated with the green channel fluorescence corresponding to the dye FAM with a maximum emission of 520 nm. Similar evidence largest spectral specificity green spectrum for sequences telomeric repeat, were obtained also when using their end-FAM-tagging (example 1).

For the middle of the red spectrum with a maximum emission 605 nm, corresponding to the dye ROX, differences for options telomeric repeat less severe compared to the green spectrum. Perhaps use within the claimed method other type dyes Cy5, Cy7, and their analogues, fluorescence spectrum which is shifted in a more far red region, including infrared, will allow to understand better the spectral differences telomeric repeats.

Changes that affect the levels of fluorescence of the primary color channels, may have a more global impact than established by the fluctuations of energeticheskoj the potential of fluorescently-labeled DNA probes in example 1.

Use for carrying out the proposed method of dye solutions in the form of free molecules has allowed to establish significant changes in the spectral properties of DNA that occurred in the period between April and September 2012. The nature of these changes are mainly associated with changes in the saturation of telomeric DNA by green fluorescence, which plays the role of the main trigger switch when activated cell division.

The study of green fluorescence spectrum sequences telomeric repeat at the end of September 2012 is shown in Fig.6. The graph shows the dynamics of accumulation of the fluorescence signal of carboxyfluorescein in time, which displays them slow prolonged saturation of green light energy under the influence of the different options telomeric repeat. A characteristic feature of the analysis at this stage was the lack of offensive energy balance in the quantum-coupled system of DNA-dye, that is, fluorescence continued to grow slowly throughout the study period.

A comparison of the data of the chart of Fig.5 and the graph of Fig.6 shows that the change in the spectral code telomeric DNA is associated with a sharp drop in fluorescence in the green spectrum. For April 2012, the results of the analysis of the green spectrum fluorescent the AI telomeric repeats using solutions of free dye molecules were similar to the results of the analysis, carried out using labeled probes in example 1, as can be seen from a comparison of the diagrams of Fig.2B and Fig.5. In September 2012 the results obtained using these two options analysis. Most likely, this is due to the influence of different spatial arrangement of molecules of the fluorophore relative to the sequence of the telomeric DNA, simulating various natural photon saturation in the cell.

Thus, the major changes of the spectral properties of telomeric DNA are related to saturation of its light energy green spectrum. It is determined by the quantum-associated fluorescence spectrum of free fluorescent molecules in a cage outside with her in close contact. When this mode saturation telomeric DNA, defined DNA-binding proteins, has changed slightly. This is evidenced by the preservation in September 2012, the fluorescence properties of the labeled on the ends of the probes on the basis of variations of the telomeric repeat. Perhaps saving fluorescent properties of the probes is associated with a special kind of quantum memory, which retained their fluorescence properties characteristic of the unmodified spectral DNA code at the time of synthesis of the probes.

The main feature of the modified saturation mode light energy telomeric DNA in the green spectrum are the two the moose is not only very slow saturation, but the existence of periods of almost complete lack of it, as well as periods of hyperfluorescence telomeric DNA. An example of detection of periodic hyperfluorescence telomeric repeat TTAGGG is the dynamics of saturation from 21 September 2012 (Fig.7). As can be seen from chart analysis, the maximum potential for saturation had telomeric repeat TTAGGG, much less potential had a variation of this repeat, ending with the triplet TTA. Variant telomeric repeat GTTAGG different from repeat TTAGGG shift by only one nucleotide, revealed the lowest saturation.

In the study of the dynamics of the saturation of the green fluorescent energy telomeric sequences surveyed control sample of pure dye solution FAM without the addition of DNA (Fig.6-7). It is important to note that this study control sample, taking into account the effect of the residual field of the DNA should be without the influence of the samples containing the test on this day oligonucleotides. It is better to implement it in a special day, to wait as much as possible the amount of time after the conducted prior to this research DNA. The observed slight increase in the background fluorescence of the control sample of pure dye is associated with residual fields DNA in the scanning Department fluorescent the second detector. Such phantom effects can influence the fluorescence of the control dye for several days after the earlier studies of DNA. However, the increase in fluorescence of pure dye is many times less in comparison with samples containing telomeric DNA, unequivocally testified about the specific properties of the latter to increase the quantum-associated fluorescence in common with the dye spectrum.

The data obtained indicate that the saturation mode telomeric DNA green fluorescence carried out free of fluorescent molecules in the cell was changed to a General reduction of saturation with its prolongation and the simultaneous existence of periods of gipernatsiya.

It was shown that changes in green fluorescence spectrum, which began in late June 2012, coupled with a small decrease in absorption in the yellow range for some telomeric repeats and a simultaneous increase in red fluorescence (Fig.8). This observation argues in favor of approval of the interconnectedness of the fluorescence channels and integration multichotomous of the emission spectrum of DNA. The observed data are correlated with changes in properties mononucleotide sequences in example 5, indicating that the overall character of the property changes, AZ is chistyh basis for the change in the spectral code DNA. The decrease in absorption in the yellow spectrum for thymine, which was observed in the study mononucleotide sequences correlated with the decrease of absorption in this spectrum for options telomeric repeat TAGGGT and AGGGTT ending this nitrogenous base.

In conclusion, the use of the proposed method for the study of telomeric sequences should be noted that the spectral properties of the DNA dynamic, especially in the second half of 2012. First of all it concerns the establishment of quantum-associated spectrum radiation DNA-free fluorescent molecules. This is due to the formation of mixed migration energy in DNA sequences, undirected to the 5' or 3' ends, as in the case of using labeled on the ends of the probes.

Example 5. DNA spectral analysis of fluorescence visible range mononucleotide DNA sequences with the help of free molecules of fluorescent dyes.

The researchers used synthetic mononucleotide sequence length of 12 N. O. production company "Evrogen" (Russia) received standard phosphoramidite way of synthesis.

DNA spectral analysis was performed similarly to the procedure described in example 4.

The measurement results were calculated, how much did the criminal units increased or decreased fluorescence of the original dye solution after adding the appropriate sample mononucleotide. The results of the study in terms of unmodified DNA code in April 2012 are presented in the form of a graph showing the levels of fluorescence of the dyes associated with the types of nitrogenous bases of DNA (Fig.9). The ratio of the obtained values increase in their fluorescence shows the spectral characteristics of the fluorescent properties of the studied mononucleotide sequences in the analyzed spectra of visible light. Based on these results, it is possible to have an idea about the spectral properties of each of the four types of nitrogenous bases in the absence of their mutual influence on each other, as in the case of heteronuclei sequence.

It is the spectral properties of the nitrogenous bases form the basis of the spectral code DNA as a universal characteristic of its spectral properties, defines the unique value of the processes of absorption and emission of fluorescence within the visible light spectrum. The basis of spectral DNA code is the ratio of the levels of fluorescence of the primary color channels, which is a dynamic component, and is expressed in the alternate peaks of the highs and lows of their intensity.

The study was conducted in the period April to October 2012. The result was the construction of various dynamic spectra of fluorescence the nitrogenous bases of DNA (Fig.9-12), demonstrating a unique process of changing the spectral code of fluorescence DNA recorded in the study period.

The use of the claimed method has allowed to establish that the spectral DNA code in April 2012 was characterized by a marked gradation of the quantum yield of fluorescence of nitrogenous bases in the green spectrum, corresponding to the dye FAM. While thymine, guanine and cytosine showed increasing positive growth, and adenine - negative increase in fluorescence of the dye (Fig.9).

Comparison of results obtained for telomeric repeats spectra with the spectra of fluorescence mononucleotide sequences under conditions of unaltered spectral code in April 2012 (Fig.5 and 9) shows that the appearance of green fluorescence is largely due to the establishment of quantum-resonance interactions between the different nitrogenous bases within DNA sequences. So, mononucleotide sequence consisting of one type of nitrogenous bases, showed a much smaller increase in fluorescence energy in the green spectrum compared to heteronormativity sequences, which include telomeric DNA and gene. This indicates a special quantum-resonant nature of the green fluorescence DNA sequences which showed their highest spectral specificity compared to yellow and red spectra.

Yellow fluorescence spectrum mononucleotide sequences, as well as telomeric and gene was characterized by absorption for all types of nitrogenous bases, and middle red emission. Thus, the main feature of the spectral code fluorophore-linked fluorescence DNA is the presence of distinct channels of fluorescence emission in the red and green spectra with simultaneous absorption in the intermediate yellow spectrum. The red channel fluorescence more powerful than green, but less spectral-specific nucleotide sequences. In this regard, it is the green channel fluorescence is the basis of spectral encoding of genetic information, as it allows to distinguish between the nucleotide sequence of the DNA. The ratio of the color channels of fluorescence is the basis of the spectral-optical regulation of the genome.

Detection of the effect of the residual field DNA" in relation to mononucleotides sequences is of great importance in the light of the understanding of the mechanisms of entry of the genetic information in the form of alternating nitrogen bases along the polynucleotide chain of DNA. Examination of the samples in the order of oligo(dA)12→(dT)12→(dG)12→(dC)12describes the possible interaction types and autistic grounds during migration energy along the nucleotide sequence in DNA ATGC. In this sequence of samples, as can be seen from the diagrams in Fig.9, for the yellow channel of the dye TAMRA maximum absorption possessed poly(dA)- poly(dT)samples that were studied first. Study of the effect of changing the sequence of the samples was conducted under conditions of unaltered spectral code fluorescence DNA (April-may 2012). A change in the sequence of samples, in which poly(dC)sample was studied first, followed by a poly(dG)-, poly(dA)- poly(dT)samples showed values of fluorescence dye TAMRA: -10,53; -3,81; -5,69; -9,03 respectively. From this it follows that for yellow fluorescence spectrum the first nucleotide in the DNA sequence has greater absorption than subsequent the same nucleotides (the effect of the initial position). Especially this property is expressed for cytosine, because changing the position of the poly(dC)of the oligonucleotide sequence analysis of samples from the first to the fourth led to the fall of absorption of more than three times. For the remaining samples in the yellow spectrum reordering affected less significantly.

In the red spectrum, a change in the sequence of samples on the reverse oligo(dC)12→(dG)12→(dT)12→(dA)12showed the following values for the increase in fluorescence of the dye ROX: +22,48; +34,03; +25,99 and +37,64 matched with the public. In this spectrum the effect of provisions mainly affected the properties of poly(dT) sequence and is associated with its position relative to the poly(dG) of the sample in the series of samples. If poly(dT)sequence was preceded by a poly(dG)model, the increase in fluorescence of the dye was increased by half. Less apparent primary effect of provisions for poly(dA)- poly(dC)samples. Their primary position in comparison with the last in a series of samples increased increase in fluorescence of the dye ROX.

In the green spectrum changing the order of the samples on the reverse showed the following values of fluorescence dye FAM: dC12(+15,31); dG12(+9,96); dT12(+5,12); dA12(-2,52). It showed the effect of initial conditions for poly(dA)of the sample. Its absorbing properties is most clearly revealed in the primary position in the series of samples, similar to increased radiative properties of poly(dC)of the sample during its initial position (+15,31). Thus, the adsorption properties of the primary poly(dA)of the sample was somewhat understated flare UPS fluorescence for subsequent samples in the original order. When changing the order on the back of high energy potential primary poly(dC)sequence influenced all subsequent samples, and caused a decrease of the absorption properties in the last row of the floor is(dA)sample (-2,52).

The main changes in the spectral code, which started in June 2012, have been associated with izmenenie spectral properties of thymine, guanine and cytosine in the green spectrum. The first stage of such changes is displayed on the combined graph of the dynamics of saturation mononucleotide sequence of green fluorescent energy from 19 June 2012 (Fig.10). From the comparison of the obtained graph with the graph of Fig.9 shows that the changes are related to the fact that in the first ten minutes after adding the samples of poly(dT) and poly(dG)sequences to the FAM dye solution was observed decrease in fluorescence of the solution. Positive growth was maintained only poly(dC)sequence. This has changed the saturation of the fluorescent energy, which is stretched out in time. For the entire period of time the measurement has not come energy balance and grew constantly fluorescent energy. The observed hyperfluorescence poly(dC)sequence was similar to hyperfluorescence telomeric repeat TTAGGG observed in the previous example (Fig.7). She also wears a periodic character. This hyperfluorescence poly(dC)of the sample was much higher than that of telomeric repeat. The increase in fluorescence of the dye FAM for the first hour measurement was 124%. It was reported more significant is luorescence potential of cytosine in the green spectrum compared with other nitrogen bases. Fixed the phenomenon represented the first stage of the changes in the spectral properties of nitrogenous bases that occurred in the second half of 2012. Thus, it was found that the change in the saturation regime of telomeric sequences was primarily associated with changes in the overall spectral properties of bases.

In the first phase of changes in the spectral code of fluorescence DNA in June 2012 adenine showed spectral-stable properties in the studied spectra and did not reveal any significant changes. With the decline of the energy potential of thymine in the green spectrum substantially decreased absorption in the yellow spectrum for poly(dT) sequences (Fig.11). For the remaining sequences substantial changes to yellow spectrum was observed. Changes in the red spectrum were mainly for the increase in fluorescence for guanine and cytosine with the General trend of the alignment of the energy potential for all kinds of nitrogenous bases in this spectrum.

It should be noted that described in the month of June the change in the spectral characteristics of the DNA code in 2012 was not completed. They merely represent the stages of perestroika, to study which the claimed method is a unique, unparalleled tool. Continued research is for, who testified further spectral changes of DNA followed by June 2012. Subsequent the trend of changes was associated with a further drop of saturation of the DNA sequences of the green fluorescence due to the changed properties of guanine and cytosine with a simultaneous increase in fluorescence associated with the adenine (Fig.12). If in the month of April guanine and cytosine showed maximum fluorescence in the green spectrum, and adenine maximum absorption, subsequently after June guanine and cytosine began to absorb slow positive growth (saturation) of the fluorescent energy. When poly(dA)sequence immediately after adding to the solution of dye FAM changed absorption gains radiation with the same slow saturation. The consequence of this process was observed ratio of the energy potentials of telomeric repeats in green fluorescence spectrum in the month of September 2012 (Fig.6). The results show a General trend of changes of the green channel fluorescence for mononucleotide sequences, which is associated with the maintenance of the spectral differences between the nitrogenous bases. This distinction provides the basis of spectral encoding nucleotide sequences under conditions of changed what about the status of the spectral code DNA. In this particular value, both in terms of the modified and unmodified spectral DNA code are the differences between adenine and guanine. This is due to the fact that these nitrogenous bases determine the specificity of fluorescence endings of telomeric overhangs when mostly non-proliferating and activated to divide the States of the cells.

Example 6. DNA spectral analysis of fluorescence visible range of the fragments of gene sequences cycline B1 and D2 of the person by means of free molecules of fluorescent dyes.

The researchers used a synthetic oligonucleotide sequence produced by "Evrogen" (Russia) for genes cyclina person:

1. TGCCAGTGCCAGTGTCTGAGCC (CNB1 gene, the minus strand of chromosome 5);

2. GGTCTGACTGCTTGCTCTTCCTC (CNB1 gene, a plus strand of chromosome 5);

3. GTGCTGTCTGCATGTTCCTGGC (gene CND2, the minus strand of chromosome 12);

4. CAGATGGCTGCTCCCACACTTC (gene CND2, plus strand of chromosome 12).

DNA spectral analysis was carried out similar studies of oligonucleotide sequences in the previous examples. The results are presented in the form of bar charts and graphs, figures 13-15.

Chart of Fig.13 shows the ratio of the fluorescence channels in the three primary colors of the visible spectrum in April 2012. Thus, the conditions of the unmodified spectral code fluoresc is ncii DNA in this period show a pronounced spectral differences not only mononucleotide and telomeric sequences, but gene.

The results testified to the fact that changes in the spectral code of DNA that occurred at the end of June 2012, has also affected the spectral properties of gene sequences. The nature of these changes differed significantly from those for telomeric sequences.

Reconstruction of the spectral code DNA in the second half of 2012, associated with changes in properties of nitrogenous bases, had different effects on the properties of polynucleotide sequences of DNA. These differences are related to their nucleotide composition, namely the number of nitrogenous bases guanine and adenine. These nitrogenous bases most changed their spectral properties when establishing quantum-associated fluorescence spectrum of the free dye molecules in modied spectral code DNA. For the sequence G-chain telomeric DNA containing a regularly repeating sequence of three guanine, modifying the nitrogenous base has led to a sharp decrease in green fluorescence. Gene sequence, more flexible in terms of nucleotide composition, not only not reduced, but increased its fluorescence in this spectrum. This proves the importance of saturation of green fluorescence to the genome of the cell. It is in green with ectra fluorescence were obtained the greatest differences between the nucleotide sequences of DNA, especially in terms of the unmodified spectral DNA code that existed before June 2012.

In terms of the modified spectral code of prolonged saturation of the green fluorescence characteristic of telomeric sequences were not observed for gene sequences (Fig.14). This fact indicates fundamental differences telomeric sequences from the gene. It telomeric sequences have unique feeding mechanism of genome green fluorescence, which performs the basic functions of the spectral encoding genetic information.

Changes in other spectra for the studied gene sequences as well as for mononucleotide and gene, were associated with a slight drop in the level of fluorescence in the yellow spectrum and the increase in the red. At the end of June 2012, a slight decrease of absorption in the yellow spectrum was observed only for sequences plus chains of both genes, which might be related with limit position in them thymine (Fig.15). In the red spectrum of all the studied sequence revealed an increase in fluorescence, except for the minus circuit cycline B1. Perhaps this is due to the change of absorption at the emission in the green spectrum.

Thus, the spectral unstable position occupied by succession shall alnost negative chain cycline B1, which was replaced by the absorption at the emission in the green spectrum. In this regard, the detection by the inventive method is similar to the spectral-unstable parcel genes, along with the spectral-stable, plays an important role for the understanding of the functioning of the genome.

Using the inventive method allows to obtain the views of significant differences of gene sequences from the telomere. The use of DNA-spectral fluorescence analysis using free of dyes has allowed to establish that the change in the spectral code in the second half of 2012 mainly reflected on the properties of telomeric sequences. It telomeric DNA was characterized by the largest drop in the saturation of the green fluorescent energy. This has changed the mode of its saturation, which is in contrast to gene sequences became slow and stretched over time, demonstrating periodic bursts of rapid gipernatsiya (Fig.6 and 7). Extremely spectral unstable turned out to be almost all of telomeric repeats. This was especially true in GGGTTA repeats, GGTTAG and TTAGGG, which regulate the existence of basic quantum States of telomeric overhangs characteristic of non-proliferating and activated by cell division. This may be due to the lack of a nitrogenous base C is tosina in the structure of telomeric DNA of a person, which has a maximum, and therefore, the most stable fluorescence in the green spectrum. The latter fact demonstrates the enormous importance of the process of changing the spectral properties of DNA and its monitoring by means of the inventive method for the regulation of cell division and identify risk factors of malignancy cells.

Comparison of spectra obtained in examples 4-6, showed that the variants of telomeric repeat revealed no less remarkable differences in the ratio of green and red fluorescence channels than gene or mononucleotide sequence. This confirms the idea that in the framework of the nucleotide code telomeric DNA provides the necessary existence in the genome of the terminal nucleotide sequences, particularly differ in their spectral and fluorescent properties. It is through them is the regulation of the resulting fluorescence as part mutageneticheskogo radiation, which is a necessary condition for launching and carrying out the process of cell division.

In this regard, the proposed method is a universal mechanism by which to assess changes in the level of fluorescence in the cell, which occurs due to the rearrangements of the endings of telomeric overhangs as the basis mutageneticheskogo radiation of the visible range, the UE is allaudio cell division. Thus, expanding the concept of mutageneticheskogo radiation, which is in contrast to the classical understanding, founded A. G. Gurvich in the first half of the twentieth century, includes not only the UV region, but the entire visible spectrum of fluorescence.

Molecules used fluorescent dyes are universal model, which examines the impact of telomeric DNA sequences by fluorescence in the cell. In the cell can be many such fluorescent molecules that can be a source mutageneticheskogo radiation in the UV and visible range of light. Sources of UV fluorescence can be amino acids tryptophan, tyrosine, phenylalanine, cysteine and cystine, which are included in the composition of proteins, fluorescence maximum which corresponds to the 300-350 nm. In the green region of the spectrum fluoresce oxidized flavoprotein (510-540 nm). Sources of red fluorescence can be some derivatives of porphyrins. The sources of the blue fluorescence is restored pyridine nucleotides NADH and NADPH (440-480 nm), and connection type thiochrome (a derivative of vitamin B1). With food the person can also consume a fluorescent substance. For example, plant chlorophyll is a powerful source of red fluorescence, and some derivatives of alkaloids (flora the CSOs quinine) have a strong blue fluorescence. Thus, many of the metabolites of the human body possess fluorescent properties in the visible light range and can form DNA associated multichotomous range, which is the basis of quantum-optical regulation of the genome.

According to conventional wisdom native fluorescence of DNA is very weak and belongs to the UV spectrum. However, it was shown that DNA itself emits light in a wide range of the visible spectrum in the form of very weak fields (work Popp, Germany). In this regard, the described properties of DNA to form a quantum-associated spectrum and to increase the fluorescence of some dyes can be applied to different fluorescent molecules in the cell, and thus can be a source of light more power. This is a new understanding of the role of DNA in generating uniform light field cells, sufficient for the formation of the laser-active medium of the genome. Theoretical and experimental developments regarding the existence of DNA coherent radiation of photons in the visible spectrum, forming a laser-active medium contained in the research group Popp (Popp F. A., K. H. Li, Cu G. Recent Advances in Biophoton Reseach and its Application (Kaiserslantern, Word Scientific, 1992) and gariaev p.p. (Wave gene. Moscow, 1994; Wave genetic code. Moscow, 1997). Despite this, the existence of super-weak laser is about radiation DNA in the range of visible wavelengths is still controversial.

Until today, researchers continue to search for sources with appropriate capacity for the existence laser fields DNA as basis for quantum-optical recording genetic information. The development of the idea of recording of genetic information by laser contributed to progress in opto-electronics associated with the creation of the laser, the fluorescent dyes. It was shown that the fluorophores with high quantum yield can be used as components of the active medium of the laser. One of the main directions of the use of such laser was declared the transfer of large amounts of information. In this regard, the idea of recording in a similar fashion to the vast amount of genetic information on DNA suggests itself. In addition, the main feature created on the basis of fluorescent dye lasers was the use of ultrashort light pulses. This brings to thought about DNA, how about a similar environment, coherent photons which correspond ultrashort Pico - and femtosecond pulses. There is an unresolved question about the required radiation power of DNA.

Controversial data on ultra-weak emission DNA hindered progress in this area. The main methodological error of researchers was the consideration of the fluorescence of the DNA separately without quantum communication with others is fluorescense molecules. The opening of the fluorophore-linked fluorescence DNA explains the existence of more powerful radiation source DNA, had been adopted earlier than sufficient for forming a laser-active medium. The use of the claimed method has allowed to establish that the formation of quantum-associated spectrum between the dye (fluorophore) and DNA in the General solution can lead to a strong increase of the initial fluorescence of the dye solution, reaching in some cases 100% or more. A unique fact, detected using the proposed method, is detected periodic hyperfluorescence DNA sequences. It describes the mechanisms of saturation of the genome of the cells of the light energy at the expense of the unknown science source. The increase in fluorescence of the dye in the presence of DNA depends on its nucleotide sequence and can reach more than 260%, depending on the duration of monitoring.

This demonstrates the unique imaging capabilities of DNA, is directly dependent fluorescence capacity of the fluorophore with which it forms associated spectrum. It was found that the quantum yield of the fluorophore-linked fluorescence DNA in direct proportion depends on the intensity and spectral characteristics of light excitation and comparable with those for specialized kr is sites. This suggests the possibility of the existence in the cell of the laser medium on the basis of quantum-associated spectrum of DNA and fluorescent molecules. For the formation of the excitation radiation is essential for the photo mode of the cell, the intensity and spectral characteristics of which are determined by the number and composition of its constituent fluorescent molecules. On the one hand the fluorophore-linked range of DNA is determined by the fluorescent molecules that make up DNA total range, on the other hand, these molecules use other suitable range of molecules for their excitation. Thus, control of the composition of the fluorescent molecules in the body and the spectrum of radiation is a unique management tool fluorescence of DNA as the basis of fiber-optical functioning of the genome. For these purposes, the use of different options for implementing the proposed method provides great opportunities.

Naturally present in the body at its fluorescent potential of significantly inferior to specialized dyes. However, the power of the photon saturation (light field) DNA in each particular spectrum of radiation is enhanced fluorescent properties of the fluorescent molecules, not only are given in the th cell, but due to the whole population of such molecules in the body. In the aggregate, it may be sufficient photon pumping required for the formation of the laser-active medium of the genome. Given the ultra-short pulses of radiation, it will provide sufficient power level to create a laser field of DNA.

About the possibility of remote gipernatsiya DNA photons indicative of the detected remote effect of some fluorescently-labeled DNA sequences on the other, are in a separate test tube at a distance of a few centimeters (example 3). In this regard, the possibilities of explanations remote fotoacademie genome of the organism not only from their own fluorescent molecules, but also from surrounding objects animate and inanimate nature. Using the inventive method in the form of contactless option exercise opens up prospects for the application of remote corrective impact on Biosystems. To influence the photoprocesses of the body can be used physical light sources or DNA sequence that has its own fluorescence, including enhanced fluorophores, as well as pure solutions of fluorophores without DNA sequences. This aspect of the proposed method covered in the last paragraph of the claims.

In studying the latter qualities are undeniable advantage has the option contact method in which the dye solution is added than one DNA sequence, and uses a mixture of DNA fragments. For example, the study of mixtures of synthetic oligonucleotide probes that mimic different ways of telomeric repeats in example 2. In this case, the use of declared SPO is both provides a unique opportunity to describe the spectral characteristics of the variations of the telomeric repeat which can end telomeric overhang in the cell.

Of particular urgency is the perspective of the study of native faction of telomeric overhangs using the inventive method to determine their spectral characteristics, which can be color markers activation of cell division and completion phases of the cell cycle.

Using the inventive method it was shown that telomeric DNA has a unique fluorescent properties and spectral characteristics. Recent data on nucleotide polymorphism endings telomeric DNA has led to a new understanding of canonical hexanucleotide repeat as six variants of possible sequences (GGTTAG, GTTAGG, TTAGGG, TAGGGT, AGGGTT and GGGTTA), each of which has a unique fluorescent properties and spectral characteristics. Therefore, the phenomenon reconstructions terminal nucleotide endings telomeric DNA directly connected with the phenomenon of the fluorophore-linked fluorescence DNA in the visible range of light, open using the inventive method.

Depending on the variation of nucleotide end of the 3' and 5'-ends of telomeric DNA the sum of its G-overhangs is a heteromorş populations that differ in nucleotide composition of telomeric repeats. Depending on the 5'-end-chain t is lamerei DNA sequence of each single strand of overhang G-chain is an n-th one of the six options full repeat. This overhang might not end full repetition. In this regard, it becomes clear the role of their terminal triplets in determining the resulting fluorescence.

It was found that the activation of cell division in the first hours of exposure to the stimulus associated with the rearrangement of terminal telomeric nucleotides of overhangs. It is shown that the cell is most sensitive to the change in the sequence of the last telomeric repeat at the 3'-end of DNA. The result of this process may be the change of the spectral characteristics of the resulting fluorescence, defined the 3'end of telomeric overhangs cells.

According to the received view channels integrated fluorescence DNA form the basis of the trigger mechanism of activation of cell division due to the switching of the two main colors of the spectrum. One of the colors is red, and the second, antagonistic color can be represented by green or blue. This scheme provides a clear spectral discrimination of the optical signal, which takes the cell to start preparation for cell division.

It has been shown that in accordance with the spectral code fluorophore-linked fluorescence of human DNA to regulate the processes of cell division used green and red coding proliferative detail is rmacie. Changes in the spectral code that occurred in June 2012, associated with a significant change in the saturation regime of telomeric DNA is human green fluorescence. Using the proposed method represents a unique opportunity for studying the mechanism of quantum saturation of telomeric DNA and allowed to establish a new mode of its functioning in the green spectrum (example 4).

The study of the terminal nucleotides of the G-chain telomeric DNA made it possible to establish the existence of balanced and unbalanced profiles of terminal telomeric nucleotides of overhangs. Using the proposed method allowed us to associate them with the existence of different quantum States of the cells associated with telomeric ends of overhangs. These States are characterized by a different balance of green and red channels of the radiation depending on changes in their nucleotide endings. First, it was found that the main non-dividing state of the cell is accompanied predominant telomeric end of overhangs on guanine. Activation of cell division in the first hours of exposure to the stimulus is accompanied by a sharp increase in the content of the endings of telomeric overhangs for adenine. The difference of the spectral properties of nitrogenous bases, installed using the proposed method allows to link these Amu is amidnye adjustment with changes in telomere fluorescence of overhangs. Non-dividing state of the cell is characterized by the predominance of the emission fluorescence of telomeric overhangs in the spectrum, corresponding to the end of the guanine. For stable conditions the existence of a spectral code telomeric DNA of the person in this spectrum is green. It is green range was the most spectral-specific for different endings telomeric G-overhangs.

It was found that the activation of fission is accompanied by an increase in the maintenance of telomeric endings for adenine, which is directly related to the conservation of the red spectrum of radiation, and a sharp drop of the green. In these conditions, especially in the first hours of activation fission, the nucleus of activated cells "red" due to changes resulting fluorescence endings of telomeric overhangs. This is evidenced by the drafting of the spectral maps and color of the marker resulting fluorescence telomeric repeat GGGTTA in the wavelength range 520-605 nm (Fig.E). Specified characteristic can be used as a diagnostic color marker activated by cell division. In the hours that followed the further progression of the cycle reconstructions of the terminal nucleotides leads to the gradual decline of the red signal. On the background of decrease again increases the green channel fluorescence until the ratio of the characteristic is La non-dividing cells. When this color marker resulting fluorescence endings of telomeric overhangs again receives a strong green component. The main contribution in this process contributes to telomeric repeat GTTAGG that demonstrates its spectral map and a color marker, the resulting fluorescence (Fig.16B).

The terms of the modified spectral code, which emerged in the second half of 2012, apparently associated with a significant conversion scheme described above to activate the division. Mostly it is associated with a slow saturation of the green fluorescent energy telomeric repeats, which provides spectral differentiation. In the green spectrum dominance fluorescence GTTAGG repeat (for primary non-dividing state cells) over GGGTTA repeat (main activated by cell division) was observed after two hours of studying the dynamics of their saturation (Fig.6).

Thus, the ratio of the main channel encoding proliferative information submitted fluorescent radiation of telomeric overhangs, it is possible to judge about the stages of activation of cell division. This can form the basis of the latest DNA spectral analysis, which can be widely used in medicine. Any changes on the stages of reconstruction of the terminal nucleotides can be diagnosed not only directly, but by using the proposed method through the establishment of the balance of green and red fluorescence channels of telomeric overhangs.

In conclusion, it should be noted that telomeric overhang are the only variable genetic substrate cells capable of rapid reflex changes in response to changes in environmental conditions. This is due to the fact that genomic DNA conservative in its structure and is supported by strong mechanisms of replication and repair. The existence in the cell mechanisms ectonucleoside impact on the 5'- and, mainly, on the 3'- ends of telomeric DNA is the basis of quick reflex response of cells to the effects of stimulus for cell division. What if this changes in the spectral characteristics of the fluorescence of telomeric overhangs can serve as an important criterion for assessing the proliferative properties of the cells. In this regard, the claimed method can form the basis of a new direction in molecular diagnostics DNA-spectral fluorescence analysis of telomeric overhangs, which is to establish the ratios of the main channels of telomere fluorescence of Averchenkov during activation of cell division and the main stages of the cell cycle.

Another area of application of the proposed method is DNA spectral analysis of the fluorescence gene sequences. In this case, as the samples used synthetic consistently the ti genes amplified fragments of genomic DNA, chromosomal regions, etc. of the DNA-spectral analysis is a powerful tool for studying the genome of the cells, especially in connection with the consideration of the concept of quantum-optical encoding genetic information. This concept assumes that each nucleotide has a specific spectral characteristics and contributes to the resulting fluorescence of the DNA sequence. Each sequence regardless of the length may be represented by a characteristic fluorescence spectrum as a result of the interaction of the primary color channels. A case study on the role of the main types of nitrogenous bases in the visible spectrum fluorescence DNA can serve as a study mononucleotide sequences in example 5.

Studies of the role of each type of nitrogenous bases, and their combinations in a particular nucleotide sequence allows rethink the value of single nucleotide polymorphisms and point mutations in the genome of the cell. Further development of DNA technologies in this direction may lead to the compilation of spectral color maps, plots gene, full gene sequence or regulatory elements that will help to understand the mechanisms of their functioning. Example 6 shows that the different parts, is provided plus and minus DNA strands, within the sequence of one gene differ in their spectral characteristics, especially in terms of stable spectral DNA code (April 2012).

Spectral mapping of chromosomes and their fragments will allow for a new way to explain their contribution to the formation of a common light field cells and to understand the significance of chromosomal rearrangements in its genome.

These new directions in the study of the genome of the cells that become possible with the use of the proposed method, it is indisputable practical importance and advantage over existing methods of studying the fluorescence of DNA. Until now there was no way to illuminate the question of how processes of absorption and emission of quanta of light in the visible spectrum depending on the specific nucleotide sequence of DNA. The claimed method has allowed to establish that the spectral code fluorophore-linked fluorescence of human DNA major fluorescent channels in the visible range of light are red and green and yellow spectrum is absorbed. Observed after mid-June 2012 changes in the spectral code of fluorescence DNA mainly affected properties telomeric sequences, which changed the saturation mode green fluorescence.

For the first time before the its way to learn fluorescence DNA allowed us to assess the contribution of each nucleotide of the target sequence in the formation of the resulting radiation flux balance as the primary colors of the visible spectrum. It became possible to study the quantum resonance of the relationship between individual sequences, based on the effects of migration of energy between the nucleotides in the studied color channels. The use of different variants of the method allows to study the influence of specific areas of migration energy, namely the 5'-end or 3'-terminal direction, depending on the location of the dye in the composition of the target DNA sequence probe. Conditions there are no preferred directions of migration energy are studied using dye in the form of molecules, freely surrounding the target DNA sequence in solution. The special role of the use of free dye molecules plays for the purpose of the study the saturation regime of the nucleotide sequences of the fluorescent energy of a certain spectrum.

Great importance is acquired as part of the comprehensive study population of telomeric overhangs as the molecular substrate of the control light flow regulating cell division. Using a patented method allows to investigate the quantum-resonant relationship between the individual telomeric Ovorhangay, which include the balance of the processes of emission and absorption of quanta of a certain range depending what their nucleotide sequence.

Using the claimed process was installed universal remote mechanism of quantum interactions that occur between nucleotides within themselves sequences, and between different sequences. Was revealed to the remote influence of solutions of synthetic analogues of overhangs on fluorescence of each other at a distance of a few centimeters in different test tubes. This mechanism differs from those described in the literature mechanisms of inductive resonance and exchange resonance migration energy, requiring close contact or overlap of the electron clouds between the molecules of the donor and acceptor. Thus, it was found that telomeric overhang can affect each other, not just being in the same cell, but also to affect the fluorescence of Averchenkov surrounding cells and tissues. The latter fact is particularly relevant in order to study the mechanisms of formation of the unified field of cell, organ and organism as a whole, as well as for the development of systems for remote diagnosis and correction processes.

1. The method of spectral analysis of the fluorescence properties of nucleotide sequences of DNA used for the purposes of genetic testing, research mutageneticheskogo radiation cells, coding hereditary and proliferative the information consisting in the study of the emission spectrum of solutions of fluorescent dyes, quantum associated with the test sequence, and implemented in the following stages:
a) preparation of aqueous solutions of dyes of the primary colors of fluorescence type FAM in the green spectrum, R6G in the yellow-green spectrum, TAMRA in the yellow spectrum, ROX in the orange-red spectrum and similar with freely arranged in space fluorophore groups and which in relation to the internal structure of the DNA deintercalation and not communicating with the grooves molecules at a concentration of 0.25-0.5 μg/ml, providing the same fluorescence intensity in each color channel detection;
b) measurement of background fluorescence of the dye solutions in the respective channels detection using a fluorescent detector FDG-001;
C) adding to the solution of dyes DNA sample in the amount of 150-200 ng, which allows you to track the changes of fluorescence dyes under the influence of DNA with reliable sensitivity;
g) measuring the fluorescence of the dye solutions, which selectively responds to the addition of sample DNA, depending on the fluorescence and spectral characteristics of the studied nucleotide sequence registered in the wavelength ranges by setting BEGO quantum bound of the emission spectrum of the DNA-dye;
d) registration of the results of the analysis as representing values in conventional units of positive or negative increase in fluorescence of the dyes with respect to their initial background before adding the DNA sample in the form of constructing bar charts or curves growth dynamics of the signal in time;
(e) interpretation of results the increase in fluorescence dyes, which indicate changes in net fluorescence properties of the investigated DNA sequences in the corresponding range of the spectrum, resulting nucleotide alterations endings telomeric DNA point mutations and gene polymorphisms, chromosomal rearrangements, changes in karyotype or genome of the cell.

2. The method according to p. 1, characterized in that solutions of dyes represented by the probes, in which the plane fluorophoric groups remain free with respect to the internal structure of the DNA and attached to its free 5' or 3'-end, or incorporated into a modified nucleosides, including using a combination of dampers, providing the necessary level of understating fluorescence dyes; thus studied the effect of the sequence of a fluorescently-labeled probe or other DNA fluorescence dyes in the composition of the probe.

3. Way, p. 1, wherein t is m, the sample DNA sequence, including as a fluorescently-labeled probes used in the form of a separate solution without adding to the solutions of dyes; studied remote contactless influence of DNA sequence on the fluorescence of solutions of pure dye or dyes in the composition of the probes.

4. The method according to p. 1, characterized in that the DNA samples for the spectral analysis are: a) synthetic oligonucleotides of different lengths, as well as their double-stranded duplexes, representing mononucleotide, telomeric or gene sequences, including regulatory elements and non-coding region; b) extensive gene sequences, including cloned in the vector; C) fractions of double-stranded telomeric DNA or single-stranded telomeric of overhangs; g) total genomic DNA or DNA of individual chromosomes and their fragments.

5. The method according to p. 1, characterized in that the fluorescent spectrum of solutions of dyes represented by the waves of visible light in the range from violet to red, the specification of which is determined by the spectral characteristics of the fluorophores and the peculiarities of their fluorescence at specific wavelengths by using the detecting devices.

6. The method according to p. 1, otlichayushiesya, that fluorescent spectrum of solutions of dyes represented by the wave UV and IR ranges, the specification of which is determined by the spectral characteristics of the fluorophores and the peculiarities of their fluorescence at specific wavelengths by using the detecting devices.

7. The method according to p. 1, characterized in that for carrying out spectral analysis uses a set of fluorescent dyes with different spectral characteristics, allowing to investigate the influence of the nucleotide sequence in different fluorescence spectra as monocanal when each dye represented by a separate solution, and multi-channel, when using a mixture of several dyes in one solution; however, the intensity of excitation radiation corresponding to the peak of the fluorescence of each dye, the same for all colors of the spectrum.

8. The method according to p. 1, characterized in that the measurement of the fluorescence of the dye solutions by using fluorimetric, fluorimetric-spectrophotometers, fluorescence scanners and detectors according to the conventional technique fluorimetry and spectrometry with the use of appropriate dyes used filters or svetorasseivateley for the study of broad-spectrum bandwidth for the main CEE is s fluorescence, as well as the discretization for individual wavelengths within the individual colors of the spectrum.

9. The method according to p. 1, characterized in that at the stage of registration of the results of spectral analysis, assess the color intensity of the fluorescence channels RGB and HSB, HSL scales encoding of color information in the development of a spectral maps or color markers resulting fluorescence of the studied DNA in the range of wavelengths corresponding to the dyes used.

10. The method according to p. 1, wherein the spectral analysis is used to study gene sequences, represented by a separate plus and minus ranges, and their duplexes, including gene regulatory elements and non-coding region, with the aim of obtaining spectral maps and color markers resulting fluorescence, including for the spectral diagnosis of point mutations and polymorphisms of genes and the study of photon saturation genestructure as a mechanism of quantum-optical recording and spectral encoding genetic information.

11. The method according to p. 1, wherein the spectral analysis applied to the study of DNA fractions of individual chromosomes and their fragments with the aim of obtaining spectral maps and color markers resulting fluorescence, and exploring the role of changes in x is de chromosomal rearrangements and abnormal karyotype of the cells.

12. The method according to p. 1, wherein the spectral analysis is used to study synthetic telomeric sequences, represented by different variations of the telomeric DNA repeats and endings, as well as their double-stranded duplexes, with the aim of obtaining spectral maps and color markers resulting fluorescence and study their photon saturation as a mechanism of quantum-optical recording and spectral encoding proliferative information.

13. The method according to p. 1, wherein the spectral analysis is used to study native factions telomeric DNA and telomere of overhangs to study changes in their spectral characteristics, in particular for determining the ratio of the main channels of fluorescence and color markers during activation of cell division and the main stages of the cell cycle.

14. The method according to p. 1, characterized in that for remote spectral diagnostics as samples for the study are used to living biological systems as sources of DNA in cell cultures and tissues, organs and parcel of a living organism, the organism as a whole; however, solutions of dyes or labeled probes are used as biosensors and are located in close proximity to the object under investigation and allow to obtain the total spectral maps of the well, to change which to judge the functional state of the research object.

15. The method according to p. 1, characterized in that the use of contact or non-contact variations of its implementation is used for the generation and use of schemes corrective impact on Biosystems, acting on the basis of: a) physical sources of photons, including laser and led matrix; b) fluorescent molecules, including in combination with DNA; C) specific DNA sequences as sources of biofluorescence; corrective effect is characterized by a certain intensity, spectral characteristics and duration of radiation, including specific mode switch color channels in the case of multichotomous spectrum.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to the field of molecular biology and biochemistry. A device consists of a light source, the radiation of which is directed on a transparent substrate with oligonucleotides immobilised on its surface and a system of detecting the intensity of light, which passed through the substrate, located under it. The substrate contains at least two zones, with a layer of oligonucleotides, non-specific to the nucleotide sequence under study, being immobilised on the surface of one of them, and a layer of nucleotides, specific to the nucleotide sequence under study, being immobilised on the surface of the other zone. The detection system contains at least two photosensitive independent sections, each of which is illuminated by the radiation, which passed through only one zone.

EFFECT: device makes it possible to carry out the qualitative and quantitative analysis of the nucleotide sequences, increases the accuracy of the identification of the nucleotide sequences.

3 cl, 5 ex

FIELD: measurement equipment.

SUBSTANCE: invention relates to a measuring method of variations of fluorescence intensity of voltage-sensitive fluorochrome depending on a potential gradient or ionic strength, which involves addition to the voltage-sensitive fluorochrome of an ionising compound to induce variation of potential or ionic strength, as well as addition of vitamin E and/or cholesterol to increase variation of potential or ionic strength as to voltage-sensitive fluorochrome. Besides, the invention relates to a potential measuring method of actions of cultivated cardiomyocytes.

EFFECT: invention provides measurement of fluorescence intensity of voltage-sensitive fluorochromes or voltage-dependent quantitative variations of their fluorescence intensity without using any such materials (membrane carriers), as cells or two-layer lipidic liposomes.

10 cl, 3 ex, 5 dwg

FIELD: chemistry.

SUBSTANCE: invention can be used when determining content of benzene, toluene and xylene (BTX) vapour in urban air, air in residential facilities, chemical laboratories, filling stations and oil processing enterprises, in gas emissions of industrial plants. The method of determining concentration of benzene, toluene and xylene vapour in a gaseous mixture comprises placing material containing boron difluoride dibenzoylmethane (BF2DBM) fluorophore or a methyl- or methoxy derivative thereof into the gas mixture, illuminating the material with light in the wavelength range of 355-400 nm and measuring fluorescence intensity of the material in the wavelength range of 400-550 nm. Unlike the existing method, measurement is carried out on not less than two spectral channels, wherein the number of channels is selected not less than the number of determined components in the mixture plus one. The measured values are then used to calculate relative intensity of spectra of the fluorophore and exciplexes thereof with benzene, toluene and xylene. Concentration of benzene, toluene and xylene is then determined from the ratio of intensities of the corresponding exciplex to the intensity of BF2DBM.

EFFECT: simultaneous continuous selective measurement of benzene, toluene and xylene in gaseous mixtures in a wide range of concentrations with short reaction time.

2 cl, 4 dwg, 1 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biochemistry. Claimed is a method of evaluating cell viability in a microbioreactor by means of an optical light guide. The method includes the placement of cells into a membrane compartment of a replaceable cell unit of the microbioreactor, application of a working solution of a vital dye, introduction of the dye into the microbioreactor compartment. After the introduction incubation of the cells in the vital dye solution and removal of the vital dye solution, which has not bound with the cells, are performed. Removal is performed by the replacement of the incubation solution with a growth medium, which does not contain dye. The optical light guide, connected to a spectrometer, is brought into contact with an optically transparent material with the replaceable cell unit under the membrane compartment of the microbioreactor. After that, the support spectrum of a fluorescent signal is measured as an integral of the intensity of fluorescence on the membrane compartment of the microbioreactor, in which the cells to be analysed are absent. Also measured is the spectrum of the fluorescent signal as the integral of the intensity of fluorescence on the membrane compartment of the microbioreactor with the analysed cells. After that, the support spectrum of the fluorescent signal for the membrane compartment of the microbioreactor without the cells to be analysed is subtracted from the obtained spectrum of the fluorescent signal for the membrane compartment with the analysed cells. The quantity of the viable cells in the membrane compartment of the microbioreactor is calculated on the basis of the obtained value of the fluorescence signal intensity.

EFFECT: invention makes it possible to quickly determine viability of the cells under an impact of influencing factors in a real time mode in the microbioreactor.

6 cl, 3 dwg, 5 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to application of bis(2,4,7,8,9-pentamethyldipyrrolylmethen-3-yl)methane dihydrobromide as fluorescent zinc (ii) cation sensor.

EFFECT: invention will make it possible to increase fluorescent activity of heterocyclic organic compound with respect to zinc (II) ion in presence of other ions of metals.

1 tbl, 40 ex

FIELD: machine building.

SUBSTANCE: invention refers to the field of DNA sequencing, in particular, to the DNA sequencing with the use of time-controlled fluorescence determination for identification of DNA bases The device comprises a field of embedding for containment of the sequencing reaction components, light sources featuring a capability of emitting the light pulse of a definite wave length, detector pixel, detector, output featuring a capability of transmitting an electric signal from the detector pixel, gating means for detector gating, at that, the detector pixel comprises additionally the first and the second storage batteries The first storage battery is provided with a capability of accumulating electric signal from the detector in response to the first light pulse, while the second storage battery is provided with a capability of accumulating electric signal from the detector in response to the second light pulse.

EFFECT: increased rate of receiving sequencing results.

12 cl, 7 dwg

FIELD: chemistry.

SUBSTANCE: sensor includes semiconductor nanocrystals (quantum dots), imbedded into a near-wall layer of track pores of polyethylene terephthalate membranes, with the pores remaining empty. If ammonia vapours are present in an air sample, ammonia molecules bind with quantum dot surfaces, which results in decrease of quantum dot luminescence.

EFFECT: invention solves the tasks of increasing sensitivity, accuracy of determination of ammonia vapour concentration, terms of exploitation and simplification of the sensor manufacturing.

5 dwg, 1 ex

FIELD: instrumentation.

SUBSTANCE: mix of test gases is forced through test cell. Fluorescent radiation is excited therein by readjustable solid-state lasers with wavelengths corresponding to lines with maximum absorption by isotopes 129I and 127I and nitrogen dioxide. Concentration of said isotopes 129I and 127I and nitrogen dioxide are defined in analysed mix by formulae that allow for the composition of buffer gases.

EFFECT: higher sensitivity of determination.

2 cl, 2 dwg

FIELD: ecology.

SUBSTANCE: method comprises placing the fluorescent test-objects in the control and analyzed samples, irradiation with the excitation light, definition of fluorescence characteristics, by which change the toxicity of the controlled environment is assessed. Microalgae of species Scenedesmus apiculatus are used as test-objects, which are previously isolated from environmentally safe areas of the test water reservoirs.

EFFECT: use of the claimed method enables to assess quickly and accurately the toxicity of water and bottom sediments of the Azov and Black Seas.

6 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biophysics. Claimed are methods of determining space-time distribution of proteolytic enzyme activity in heterogeneous system, in accordance to which: provided is system in vitro, which contains sample of blood plasma, whole blood, water, lymph, colloidal solution, crystalloid solution or gel, and proteolytic enzyme or its precursor; fluorogenic, chromogenic or luminescent substrate for said enzyme id added; space distribution of signal of released substrate label is registered at specified time moments and space-time distribution of proteolytic enzyme activity is obtained by solving reverse problem of type "reaction-diffusion-convection" taking into account label binding with medium components. Also described is device for realisation of methods in accordance with claimed invention and method of diagnosing hemostasis disorders, based on their application.

EFFECT: invention can be further applied in the study of blood coagulation system and diagnostics of diseases associated with blood coagulation disorders.

22 cl, 6 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to the field of molecular biology and biochemistry. A device consists of a light source, the radiation of which is directed on a transparent substrate with oligonucleotides immobilised on its surface and a system of detecting the intensity of light, which passed through the substrate, located under it. The substrate contains at least two zones, with a layer of oligonucleotides, non-specific to the nucleotide sequence under study, being immobilised on the surface of one of them, and a layer of nucleotides, specific to the nucleotide sequence under study, being immobilised on the surface of the other zone. The detection system contains at least two photosensitive independent sections, each of which is illuminated by the radiation, which passed through only one zone.

EFFECT: device makes it possible to carry out the qualitative and quantitative analysis of the nucleotide sequences, increases the accuracy of the identification of the nucleotide sequences.

3 cl, 5 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to biochemistry. Disclosed are versions of a method of screening and monitoring cancerous diseases, which includes collecting tissue samples, extracting RNA from the tissue sample, synthesis of cDNA, amplification by multiple reverse transcription polymerase chain reaction, followed by analysis of the amplified products. The polymerase chain reaction is carried out using a primer composition with sequences SEQ ID NO: 1-24 and 26-29, which are specific to mRNA of genes MAGEA1-6, GAGE1-8, NY-ESO-1, SSX1, 2, 4, XAGE1, TRAG3 and MAGEC1. Analysis of the amplified products is also carried out using probes represented by sequences SEQ ID NO:30-35 and 37. Also disclosed are versions of a kit for screening and monitoring cancerous diseases. The kit includes primers with sequences SEQ ID NO: 1-24 and 26-29, and can further include probes with sequences SEQ ID NO: 30-35 and 37.

EFFECT: invention increases accuracy of diagnosing cancerous diseases of different body parts.

7 cl, 3 dwg, 2 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to molecular biology and biotechnology and a dry mixture for nucleic acid amplification and a method for production thereof. The described mixture contains a thermally stable DNA polymerase, a reverse transcriptase, a first stabiliser selected from a group including monosaccharides, disaccharides, polyalcohols and a second stabiliser selected from a group including polysaccharides, albumins and polyvinylpyrrolidone. The method of producing the dry mixture includes preparation of an aqueous solution containing said substances and lyophilisation thereof. The obtained product can be stored for up to 1 year at temperature higher than 0°C while preserving reverse transcriptase and DNA polymerase activity.

EFFECT: invention can be used for amplification of DNA and RNA simultaneously and separately.

26 cl, 13 dwg, 7 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly a synthetic oligonucleotide set for detecting DNA of periodontal-pathogenic microorganism Tannerella forsythensis via a polymerase chain reaction. Said set includes Tannerella forsythensis gene bspA fragment specific primers 5'-TGGCACCCTCCGATGCCGAC-3' and 5'-GCGCAGACCGTTGGGTTTCA-3', as well as a probe (BHQ1)-5'-CCGCGCCCGA(FdT)GCGTCGCTGGC-3'-P, wheree BHQ1 denotes a dark fluorescence extinguisher attached to the 5'-terminal nucleotide, and FdT is a fluorescent dye FAM attached to the nucleotide T.

EFFECT: present invention provides reliable detection of presence of Tannerella forsythensis in biological material.

FIELD: biotechnology.

SUBSTANCE: group of inventions relates to the field of biotechnology and is directed to nucleic acid molecules which encode a protein exhibiting properties of a biosensor for detection of hydrogen peroxide in living cells having fluorescence in the red region of the spectrum. The nucleic acid molecules are derived by method of genetic engineering. Protein for detection of hydrogen peroxide has the amino acid sequence shown in SEQ ID NO:2. The host cell and the expression cassette are also provided, comprising the said nucleic acid molecules.

EFFECT: use of the inventions enables to carry out microscopy in thick layers of tissues, and provides the possibility of joint microscopy of several fluorescent structures.

4 cl 7 dwg

FIELD: medicine.

SUBSTANCE: device for polymerase chain reaction comprises at least four portions, each of which has two flat parallel surfaces perpendicular to a common axis, and holes. The portions are rotated in relation to each other and the common axis. The first portion has at least six through holes connecting its two flat surfaces, at least four holes of which are provided with hydrophilic filters mounted to contact the flat surface of the second portion. The second portion is configured with at least two through holes connecting its two flat surfaces, at least one hole of which comprises a sorbent fixed by the hydrophilic filters contacting the flat surfaces of the first and third portions. The third portion has at least two through holes connecting its two flat surfaces, at least one hole of which comprises the hydrophilic filter mounted to contact the flat surfaces of the second and fourth portions, and at least three blind holes, each of which comprises the hydrophilic filters mounted to contact the flat surface of the second portion. The fourth portion is provided with at least one blind optically transparent through hole, comprising the hydrophilic filter mounted to contact the flat surface of the third portion non contacting the bottom of the hole containing it.

EFFECT: enhancement involving carrying out the stages of nucleic acid recovery and PCR in the same apparatus with detecting reaction results and simplifying the device.

8 cl, 5 dwg

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of molecular genetics, genetic systematics and pharmacognosy, and is intended for species identification of spiny eleuterococus, eleutherococcus (Eleutherococcus senticocus (Rupr. Et Maxim.) Maxim.). The set of synthetic oligonucleotides for PCR with fragment ITS2 of nuclear DNA is proposed, comprising forward and reverse primers and a destructible probe.

EFFECT: set has a high sensitivity and specificity and enables to identify quickly and reliably the medicinal plant.

1 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to molecular genetics, genetic classification and pharmacognosy and aims at identifying a species of cotton weed (Filaginella uliginosa (L.) Opiz). What is presented is a kit of synthetic oligonucleotides for PCR with ITS2 fragment of a nuclear DNA comprising upstream and downstream primers and a degradable probe.

EFFECT: kit possesses high sensitivity and specificity, and enables fast and reliable identification of a medicinal herb.

1 dwg, 1 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to the field of molecular genetics, genetic systematics and pharmacognosy, and is intended for species identification of Japanese angelica tree (Aralia elata (Miq.) Seem.). The set of synthetic oligonucleotides for PCR with fragment ITS2 of nuclear DNA is proposed, comprising forward and reverse primers and destructible probe.

EFFECT: set has a high sensitivity and specificity and enables to identify quickly and reliably the medicinal plant.

1 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention relates to the field of radiobiology and experimental medicine. A method of estimating pharmacological and toxicological properties of substances consist in the following: a substance to be analysed is introduced into a nutritional medium of larvae and flies of Drosophila melanogaster, combining in their genome hypomorphic mutations of ss- and CG5017-genes. The larvae and flies are irradiated with ionising rays with a dose of 1-10 roentgen. Viability, structures of extremities and a level of transcription of CG 1681, CYP6G1 and ss-genes are estimated. The obtained characteristics of the flies, grown on a medium, containing the analysed substance, and the flies, grown on a medium, which does not contain the analysed substance, irradiated and non-irradiated are compared, and pharmacological properties of the substance are determined by the results of comparison of viability, quantity of tarsal segments of extremity and the level of transcription of CG 1681, CYP6G1 and ss-genes in the flies of all formed groups.

EFFECT: method makes it possible to realise effective fast targeted selection and determine the properties of substances with toxicoperotective, radioprotective, toxicosensibilising and radiosensibilising properties.

7 dwg, 2 tbl, 2 ex

FIELD: medicine, psychiatry.

SUBSTANCE: one should isolate DNA out of lymphocytes of peripheral venous blood, then due to the method of polymerase chain reaction of DNA synthesis one should amplify the fragments of hSERT locus of serotonin carrier gene and at detecting genotype 12/10 one should predict the risk for the development of hallucino-delirious forms of psychoses of cerebro-atherosclerotic genesis.

EFFECT: more objective prediction of disease development.

3 ex

Up!