Methods of obtainment and application of multipotent cell populations

FIELD: medicine.

SUBSTANCE: invention relates to the field of biotechnology and cell technology. The claimed invention is aimed at the creation of pluripotent, multipotent and/or self-renewing cells, which are able to start differentiating in a culture into various types of cells and are capable of further differentiation in vivo. The claimed invention is also aimed at the creation of populations of the required differentiating cells, which can be transplanted to patients, genetic modification of endogenic cells and treatment of patients, suffering from diseases, intensity of which can be reduced by means of the said methods.

EFFECT: invention also claims methods of prevention, treatment or retardation of a disease, associated with an infection of immunodeficiency virus.

17 cl, 1 dwg, 13 ex

 

Cross-reference to related applications

This application is the national phase in accordance with §371 of law No. 35 of the U.S. Code is continued in accordance with section 120 of act No. 35, United States Code international application PCT/US2008/065007, filed may 28, 2008, and in accordance with section 119 of act No. 35, United States Code claims priority to the provisional patent application U.S. 60/932020, filed may 29, 2007, provisional application for U.S. patent 60/933133 filed June 5, 2007, provisional application for U.S. patent 60/933670, filed June 8, 2007 the provisional patent application U.S. 61/006449, filed January 14, 2008, and provisional application for U.S. patent 61/064761 filed March 25, 2008, the full contents of which are included in the description by reference in their entirety.

BACKGROUND of INVENTION

The critical issue for medicine in the 21st century will be the replacement of damaged, worn or genetically weakened cells. Transcription factors that are specific to bind to the DNA, play a key role in the regulation of gene expression. Namely, the set of transcription factors in a cell determines which cell program active and which are not. As transcription factors play a crucial role in the determination and maintenance of cell identity, and the definition of the cellular vulnerability.

SUMMARY of INVENTION

The opportunity to get proliferating, self-renewing population(population) multipotent and pluripotent cells from naturepainter, nasloivshihsya cells can bring significant positive results in all areas, using cellular therapies. Data applications include bone marrow transplantation, Transfusiology and gene therapy and make it possible to retrieve patient-specific stem or other desired cell types. Similarly, the ability to initiate differentiation of cells in the nervous, muscular and various other desired cell population has and will be of great importance for medicine and industrial processes involving animals. Accordingly, this invention provides methods of genetic production and application of populations multipotent cells, populations of pluripotent cells, populations of neurons, populations of muscle cells and other required populations of cells, such as, for example, populations of cells resistant to HIV (human immunodeficiency virus).

By this invention it is assumed that the effective introduction or overexpression of specific transcription factors, alone or in combination with other determinants of cell development (notch, numb or numlike), makes possible mutual transformation of what has been defined as temporary (multipotent, pluripotent and/or self-renewing) or permanent (or somatic differentiated cell phenotypes. The ability to reliably induce phenotypic transformation or cell reprogramming makes it possible to obtain stem cells, replacement cells, tissues and organs that are appropriate for individual patients. In combination with the methods of gene therapy and methods cell culturing vzaimoprevrascheny cell types also provides for obtaining disease-resistant and genetically preparirovannyh cells suitable for transplantation.

The purpose of this invention is to present different ways to create populations(populations) proliferating, self-updating multipotent and/or pluripotent cells, as well as other required populations of cells either from fission or from non-dividing cells without the use of oncogenes. Populations of differentiated cells include cells expressing some but not all markers associated with belonging to a specific cell type. This document revealed that the expression of the corresponding isoforms of Numb in combination with other transgenes (especially transcription factors) makes it possible for the population is the second dividing pluripotent cells or populations of differentiated cells. Moreover, genetic vectors of this invention can be used to obtain genetic modification (for example, the expression of gene products that are missing from the patient) and for temporary or permanent induction of proliferation, self-renewal or characteristic of stem cells/precursor cells behavior in endogenous cells in vivo, such cells found in tissues that normally do not demonstrate or more do not exhibit this behavior. Finally, other genetic vectors of this invention can be used for genetic modification and/or to block proliferation, self-renewal or characteristic of stem cells/precursor cells behavior in cells, aberrant exhibiting such behavior (e.g., cancer cells). In addition, the present invention is the provision of therapeutic vectors, and cells that can Express the sequence of synthetic oligonucleotides to mitigate pathological processes. For example, this invention discloses the use of synthetic oligonucleotides to reduce the expression of genes crucial for infection, reproduction and spread of HIV and other immunodeficiency viruses.

This invention can be applied to any suitably the cells, including cells and vertebrate cells including fish, mammals, birds, amphibians and reptiles.

A BRIEF DESCRIPTION of GRAPHIC MATERIALS

Fig.1. Schematic map of the vector corresponding to the vector sequences from Example 13.

DETAILED DESCRIPTION

All patents, patent applications and publications cited in this application are incorporated herein by reference in their entirety.

As discussed in this document "DNA" refers to deoxyribonucleic acid and RNA" refers to a ribonucleic acid. As discussed in this document "cDNA" refers to complementary DNA, "mRNA" refers to the RNA; "siRNA" refers to small interfering RNA; "shRNA" refers to the small RNA, forming a hairpin; "microRNA" refers to microRNAs, such as single-stranded RNA molecules, typically about 20-30 nucleotides in length, which can regulate gene expression; "the trap", "trap-RNA, and RNA-trap" refers to the RNA molecule that mimics the natural binding domain for the ligand.

Used in this document the expression "reduced intensity" involves reducing effect, or reducing the damage, or to minimize the effect or impact of the action, activity or function and includes, for example, reduction of harmful effects ill the treatment or condition.

Used in this document the terms "inhibition" includes slowing or reducing the developmental effect or action and includes, for example, the slow development of the disease, slowing the rate of infection or other actions aimed at slowing or reducing the progression or development of the disease or condition.

Used in this document the expression "inducing agent" means a tool that helps as an aid or by itself effectively to cause the action. For example, an exogenous agent that affects the promoter, for example, by initiating or enhancing its activity and thereby affect the expression of a gene under the control of the promoter, can be called the inducing agent. For example, as inducing means you can apply tetracycline and as inducing means you can use doxycycline.

The sequence of the nucleic acid (e.g., a nucleic acid sequence encoding a polypeptide is called "functionally related" to another nucleic acid sequence (e.g. promoter), if the first nucleic acid sequence is in functional communication with the second sequence of nucleic acid. For example, a promoter functionally related is with the coding sequence, if the promoter affects the transcription or expression of the coding sequence. Used in this document the expression "under control" refers to a gene or coding sequence which is functionally linked to the promoter sequence, and the sequence of the promoter affects the transcription and expression of the coding sequence.

Used in this document the term "token" is a molecule that is detectable, or encodes a detectable molecule, or affects other molecules, so that the presence of the marker was detectable. "Marker protein" or "marker polypeptide" is a protein or polypeptide that is detectable in laboratory or clinical settings and options may not succumb to visual detection. "Marker gene" encodes a marker protein or marker polypeptide.

Used in this document the terms "HIV" ("HIV" means the human immunodeficiency virus and includes variants such as, for example, HIV-1, HIV-2. Other immunodeficiency viruses include human immunodeficiency virus monkeys (SIV) and human immunodeficiency virus in cats (FIV). Enzymes that are related to HIV can be HIV enzymes and include, for example, integrases is, protease, reverse transcriptase and transactivity regulatory protein (TAT).

It is believed that HIV infection is involved in the receptor, called "receptors of HIV". Such receptors can be many, some of them can be called "HIV coreceptors". As discussed in this document, the HIV coreceptors include CXCR4 and CCR5.

This document describes theoretical basis for embodiments of the present invention, however, this discussion in no way should be construed as mandatory or limiting to the present invention. Specialists in this field will understand that in practice it is possible to implement various embodiments of the present invention, regardless of the model used to describe theoretical basis for this invention.

In a preferred embodiment, cells "choose" from the available populations of dividing or non-dividing cells to obtain the required (a) populations of proliferating, multipotent or pluripotent cells differentiate b) populations of nerve cells, muscle cells, g) and/or any other desired cell population; moreover, the desired population of cells may be capable of further differentiation in vitro, in vivo, and/or appropriate for the fabric and appropriate for the region differ is nzioka in vivo.

Sources of cells selected for use in this invention

The selected cells can include any cell that is applicable in this invention. Cells selected for use in this invention (in this document called: "selected cells") may initially be endogenous cells, including cells derived from other organ systems; or originate from exogenous sources (including cells derived from cell lines of cryopreserved sources stored in banks sources and donors). Cells can also be selected from cells genetically modified by artificial or natural sequences of nucleic acids. Used in this document the expression "selected cells" does not include embryonic stem cells.

In embodiments implementing the present invention in order that they could be determined without the use of invasive procedures, the selected cells will preferably be readily available cells (e.g., peripheral blood leukocytes, circulating hematopoietic stem cells, epithelial cells (e.g., cells of buccal epithelium inside of the cheek (for example, Michalczyk et al., 2004)), adipose tissue (e.g., Gimble et al., 2007; Ma et al., 2007), umbilical cord blood cells (e.g., Zhao, et al., 2006, Tian et al., 2007) and the RV). However, stem cells in the bone marrow, spermatogonia (e.g., Guan et al., 2006, Takahashi et al., 2007), the primary germ cells (PGC), stem cells isolated from amniotic membranes (for example, Ilancheran et al., 2007), amniotic fluid (e.g., De Coppi et al., 2007), as well as cells isolated from the skin (for example, Tumbar, 2006; Dunnwald et al., 2001; Szudal'tseva et al., 2007) and others, are also covered by the present invention. Such cells can be isolated from tissues in which they are located, by means known in the art.

Cells spermatogonia can be distinguished using a two-step enzymatic cleavage with subsequent separation percale. Then the cells can be resuspendable in minimum essential medium (MEM) supplemented with bovine serum albumin to achieve a final concentration of 106/ml. More: surgically access the fragments canaliculi and dissect through the needle before treatment with 1 mg/ml trypsin, hyaluronidase and collagenase, and then 1 mg/ml hyaluronidase and collagenase, in MEM containing 0,10% sodium bicarbonate, 4 mm L-glutamine, nonessential amino acids, 40 μg/ml gentamicin, 100 ME 100 μg/ml penicillin-streptomycin, 15 mm HEPES (N-2-hydroxyethylpiperazine-N'-2-econsultancy acid). Further cells spermatogonia separated from the fragments of the canal is and by centrifugation at 30 times the force of gravity. After filtration through a nylon filter with a pore size of 77 and/or 55 microns cells are harvested and loaded onto a step gradient density percoll. Fractions with a purity of more than 40% of progenitor cells/stem cells/cells-spermatogonia washed and resuspended to the concentration of cells is equal to 106of progenitor cells/stem cells/cell spermatogonial on the ml. The cells are then cultivated and/or stored using any known in the art methods of cryopreservation.

The selected cells can be genetically modified cells, in particular cells that have been modified by any known in the prior art method, in order to encode therapeutic and commercial sequencing deoxyribonucleic acid (DNA) or ribonucleic acid (RNA).

In accordance with an aspect of the present invention proposes a method of obtaining the desired population of cells (e.g., pluripotent, neurons, muscle cells, and so on) of the selected cells.

Receiving populations multipotent, pluripotent and/or self-renewing cells

To obtain (a) the population of proliferating, self-renewing pluripotent cells of the selected cell(cell) and/or its(their) descendants transferout nucleotide posledovatel the ability(sequences), including sequences encoding "long(long)" (PRR insert +) isoforms(isoforms) of the gene numb mammals. Approximately at the same time, the selected cells can also be transliterate synthetic oligonucleotides, targeted to short isoforms of Numb or Numblike, then cultivated under conditions that promote growth of the selected cells with an optimal growth rate. The selected cell support in such conditions for a period of time sufficient to achieve the desired number of cells.

Cells grown with (optimal) growth rate, which is achieved by incubation with LIF (factor inhibiting leukemia), stem cell factor and/or with equivalent concentrations of IL-6, nmep-IL-6, IL-7, oncostatin-M and/or cardiotrophin-1; or such a growth rate, which is achieved in the presence of other cytokines that enhance cell growth (for example, under the conditions described for culturing pluripotent cells, e.g., Guan et al., 2006). The growth rate is determined by the doubling time of the selected cells in the specified growth culture medium. Similarly for multiplication and extension of the optimal growth rate of cells transfected with the long (PRR+) isoform(isoform) Numb, can be suitable culturing conditions, such as described in U.S. patent 6432711 and 5453357. Other acceptable the protocols and standard concentrations of cytokines were developed Koshimizu et al., 1996; Keller et al., 1996; Piquet-Pellorce, 1994; Rose et al., 1994; Park and Han, 2000; Guan et al., 2006; Dykstra et al., 2006; Zhang et al., 2007. Whatever it was the practice of the present invention is not limited to the details of these ideas.

In a preferred embodiment, the selected cells were cultured in standard growth medium (for example, in minimum essential medium with additives (e.g., glutamine and beta-mercaptoethanol) or without them). The environment can include basic fibroblast growth factor (bFGF), stem cell factor, factor, leukemia inhibitory (LIF),and/or factors with LIF-activity (for example, LIF, LIF receptor (LIFR), ciliary neurotrophic factor (CNTF), oncostatin M (OSM) OSM receptor (OSMR), cardiotrophin, interleukins (IL) such as IL-6, ranep-IL-6, GP130, and others), and horse serum. LIF, as well as other factors with LIF activity, prevents spontaneous differentiation of cells. Under such conditions, it is expected that the selected cells, transfetsirovannyh PRR+ isoform(isoform) Numb, and their offspring will become multipotent, pluripotent and/or self-renewing.

In a preferred embodiment, the selected cell(cell) and/or its(their) descendants transferout nucleotide sequence(nucleotide sequences), coding(coding) long(long)" (PRR insert +) isoforms(isoforms) Numb, and posledovatel the difficulties coding other transgenes. Many of these transgenes are listed below together with their respective identification numbers(access numbers) in the database sequences NCBI.

In another preferred embodiment, the selected cell(cell) and/or its(their) descendants transferout nucleotide sequence(nucleotide sequences), coding(coding) segment long(long)" (PRR insert +) isoforms(isoforms) Numb, as well as sequences encoding other transgenes. Many of these transgenes are listed below together with their respective identification numbers (access numbers) (code) in the database sequences NCBI.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding long (PRR+) isoforms of Numb, as well as sequences encoding other transgenes, including LIF.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding long (PRR+) isoforms of Numb, as well as sequences encoding other transgenes, including transgenes with LIF activity.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including LIFR.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including oncostatin M (OSM).

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including receptor oncostatin M (OSMR).

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including cardiotrophin-1.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including CNTF.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isofar the s) Numb, as well as sequences encoding other transgenes, including OST/4 and SOX2.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including NANOG, OCT/4 and SOX2.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including OST/4, and SOX2, and the transgene with LIF activity.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding other transgenes, including OCT3/4 and SOX2, and the transgene with LIF-aktivnosti.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including Notch (for example, Gaiano et al., 2000).

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, and serial is inotai, coding other transgenes, including OCT3/4, SOX2 and Notch (for example, notch 1 and/or notch 2).

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including OCT3/4, SOX2, NANOG and Notch.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including OCT3/4, SOX2, NANOG and transgenes with LIF activity.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including OCT3/4, SOX2, NANOG and multiple transgenes with LIF activity.

In a preferred embodiment, the selected cells and/or their progeny transferout sequences encoding a long(long) (PRR+) isoforms(isoforms) Numb, as well as sequences encoding other transgenes, including OCT3/4, Notch, HOXB4 and SOX2.

In the further can be described or developed other than that described in this document is those combinations of genes that can cause transformation of cells in multipotent, pluripotent, capable of self-renewal, or which can cause the beginning of differentiation. However, this patent application covers such "genetic reprogramming" any nucleated cells using electroporation with the introduction of the nucleic acid or protein (see Gagne et al., 1991; Saito et al., 2001; Yuan, 2008; Huang et al., 2007; Xia and Zhang, 2007; Cemazar and Sersa 2007; Isaka and Imai, 2007; Luxembourg et al., 2007; Van Tendeloos, 2007; Takahashi, 2007 and others), liposomes, nanocapsules, nanogranules and so on (see Goldberg et al., 2007; Li et al., 2007), and/or using a different approach that avoids viral integration or other random changes in the genome of the cells, since such funds increase safety and efficiency.

Category random changes, of course, exclude approaches, including methods of directional effects on genes and siteprovide methods developed for the introduction or removal of DNA in specific regions of the genome.

Also, this patent application covers the genetic reprogramming of any nucleated cells using electroporation with the introduction of the nucleic acid or protein, liposomes, nanocapsules, nanogranules and so on, and/or another approach, which avoids retroviral/lentiviruses integration or other cases, the social changes of the genome of the cells, since such funds increase safety and efficiency. These approaches and methods include all known in this field and is applicable in this invention.

In a preferred embodiment, nucleic acid(nucleic acid) or protein(proteins) that match specific gene or segment (in particular, referred to in this document, open software described in this document the ways or open other published methods; or known as inducing multipotent, pluripotency and/or self-renewal), is the only nucleic acid(nucleic acid) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cells.

In a preferred embodiment, nucleic acid(nucleic acid) or protein(proteins) that match specific gene or segment (in particular, referred to in this document, open software described in this document the ways or open other published methods; or known as inducing multipotent, pluripotency and/or self-renewal), is the only nucleic acid(nucleic acid) or protein(proteins), which sverkhekspressiya and/or entered for p is taking multipotency, pluripotent and/or self-renewing cells from the selected cell, and the method uses electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(proteins), which correspond to a single gene or segment (in particular, referred to in this document, open software described in this document the ways or open other published methods; or known as inducing multipotent, pluripotency and/or self-renewal), you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(proteins), which correspond to a single gene or segment (in particular, referred to in this document, open software described in this document the ways or open other published methods; or known as inducing multipotent, p is writtentest and/or self-renewal), you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Nanog, and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Nanog, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is E. is obtained population multipotency, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids viral integration or other random changes in the genome of the cell.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4 and Sox2, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids viral integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(proteins), which correspond to the Oct4/Sox2, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/and is another approach, used to prevent viral integration or other random changes in the genome of the cell.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to long (PRR+) isoforms of Numb and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids viral integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding long (PRR+) isoforms of Numb, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells; and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids viral integration or other random changes in the genome of the cell.

In before Occitania embodiment of the present invention only nucleic acid(nucleic acids) or protein(protein), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Nanog.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Nanog, and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Nanog, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic KIS is otami) or protein(protein), relevant Nanog, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), the corresponding gene with LIF activity.

In a preferred embodiment of the present invention only nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), the corresponding gene with LIF-aktivnosti and used method is electroporation, l is bosomy, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding gene with LIF-aktivnosti, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding gene with LIF activity, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverchek pressious and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4 and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Oct4, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Oct4, you can use another nekleenov the Yu acid(nucleic acid) or protein(proteins) as long while the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Sox2.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Sox2, and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

the individual preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), relevant Sox2, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Sox2, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding lin28.

In a preferred embodiment, a single nucleic acid(nucleic acids) or what Elcom(proteins), which sverkhekspressiya and/or entered for multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding lin28, and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding lin28, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or Samoobrona the I cells of the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to c-myc.

In a preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to c-myc, and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein) corresponding to c-myc, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein) corresponding to c-myc, you can use other nucleic acid(a nucleic acid) or protein(proteins) up until sybrandy cells will not be obtained population multipotency, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4 and Sox2.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4 and Sox2, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, the OS is enforced with nucleic acid(nucleic acids) or protein(protein), relevant Oct4 and Sox2, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Oct4 and Sox2, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to long (PRR+) isoforms of Numb.

In a separate preferred embodiment, a single nucleic Ki is lotay(nucleic acids) or protein(protein), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to long (PRR+) isoforms of Numb and used method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding long (PRR+) isoforms of Numb, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding long (PRR+) isoforms of Numb, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposome what we nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4, Sox2 and Nanog.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding Oct4, Sox2 and Nanog, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(proteins) that meet the relevant Oct4, Sox2 and Nanog, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), corresponding Oct4, Sox2 and Nanog, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, a single nucleic acid(nucleic acids) or protein(proteins), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to long (PRR+) isoforms of Numb.

In a separate preferred embodiment, a single nucleic acid(nucleotide sequence that is new acid) or protein(protein), which sverkhekspressiya and/or which impose to obtain multipotent, pluripotent and/or self-renewing cells from the selected cell, are nucleic acid(nucleic acid) or protein(protein), corresponding to long (PRR+) isoforms of Numb, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding long (PRR+) isoforms of Numb, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(protein), the corresponding long (PRR+) isoforms of Numb, use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population multipotent, pluripotent and/or self-renewing cells, and the method is electroporation, liposomes, nanocapsules, nanohana is seeking and/or a different approach, which avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

It should be understood that any described herein a combination of sequences of nucleic acids or proteins can be modified by excluding those that correspond to Numb and/or Numblike, until then, until you get the desired population of cells or achieved the desired behavior.

Similarly, it should be understood that the described herein ways initiation of differentiation apply to any induced or neindutsirovannom multipotent, pluripotent or self-renewing stem cells, other cells predshestvennikom or other selected cells, not only to the cells obtained are described in this document method.

It should be understood that any described herein a combination of sequences of nucleic acids or proteins can be modified by excluding sequences of nucleic acids or proteins corresponding to Numb and/or Numblike, until then, until you get the desired population of cells.

In another embodiment, using various combinations of nucleic acids or proteins described herein, with the exception of nucleic acids or proteins corresponding to isoforms of Numb is/or Numblike.

In a preferred embodiment, the selected cells and/or their progeny are cells that have been previously genetically modified.

In the preferred embodiment described in this document the stages of transfection are temporary transfection.

In an additional preferred embodiment of the invention such temporary transfection is performed with the use of vectors based on viruses that do not integrate into the host genome.

In another preferred embodiment of the invention such temporary transfection is carried out using standard methods of transfection (electroporation, chemically mediated transfection, confluent or nelimousine liposomes, nanocapsules, nanogranules and so on).

In the further can be described or open other combinations of genes that differ from those described in this document, which may cause transformation of cells in multipotent, pluripotent and/or self-renewing, and cause the beginning of differentiation. However, this patent application also covers genetic reprogramming any nucleated cells using electroporation with the introduction of the nucleic acid or protein (e.g., the methods described Gagne et al., 1991; Saito et al., 2001; Yuan, 2008; Huang et al., 2007; Xia and Zhang, 2007; Cemazar nd Sersa 2007; Isaka and Imai, 2007; Luxembourg et al., 2007; Van Tendeloos, 2007; Takahashi, 2007 and others), liposomes, nanocapsules, nanogranules and/or using a different approach that avoids viral integration or other random changes in the cellular genome, as these tools improve the safety and efficiency of the method.

In another preferred embodiment, the transfection of sequences encoding long (PRR+) isoforms of numb (and/or artificial nucleotides, aimed at numblike and short isoforms of numb), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding human LIF (for example, Du and Shi, 1996), oncostatin-M, cardiotrophin-1, IL-11, IL-6, IL-6-P, ranep-IL-6, LIFR, gp130, OST (OST), Nanog, SOX2 and/or FGF-4.

Simultaneous transfection of any subclass of data specific transgenic sequences can be performed by any known in the art methods, including the use of a genetic vector, multiple genetic vectors, serial transfection or selection based on specific marker proteins and/or endurance to antibiotics.

In another preferred embodiment, cells transfetsirovannyh long (PRR+) isoform(isoform) numb, cultivated in cell culture, the JV is to account for the optimal growth rate, as described above, and which includes EGF, bFGF, oncostatin, LIF (for example, Du and Shi, 1996), stem cell factor, IL-11, cardiotrophin-1, IL-6 and Hyper-IL-6, CNTF and/or soluble gp130.

Evaluation of Potentate and differentiation

Pluripotency and multipotential can be assessed by any known in the art ways, including: 1) transplantation, 2) cultivation in conditions conducive to the formation of embroidere calf, 3) the introduction of cells into the embryos of animals (excluding humans) at the blastocyst stage and the subsequent development and 4) analysis of expression of RNA (for example, RT-PCR or analyses based on the microarray) gene expression associated with differentiation, multipotentiality, pluripotency, and so on (see Guan et al., 2006), 5) formation of colonies, as well as on the morphology, similar to embryonic stem cells. One disclosed in this document approach to determine pluripotency of the selected cells and/or progeny comprises the transfection of a construct-reporter, which includes the Nanog promoter functionally linked to a gene of the fluorescent protein. This allows the identification and accumulation of cells expressing Nanog, using fluorescently-activated cell sorting (FACS), and so on

In a preferred embodiment, the endogenous cells (for example, CL is weave surrounding the burn or damage) transferout in vivo genetic vectors, encoding the long(long) (PRR+) isoforms(isoforms) numb, by itself or in combination with other transgenes used in this document that will be temporarily resumption of proliferation or increased cell proliferation. This approach can also find clinical application in the situation of gipoplasticheskaya tissues, disorders, in which the number of stem cells/precursor cells abnormally reduced, as well as other disorders in which the approach can be demonstrated as useful.

Obtaining populations of differentiated cells

To obtain populations b) nerve, muscle, and g) other cells able to further differentiate under the influence of the environment in vivo, the selected cell(cell) and/or its(their) descendants optional transferout sequence(sequences) long (PRR+) isoforms Numb and/or sequences of synthetic oligonucleotides and increasing by growing in sufficient time to reach the desired number of cells-descendants in vitro (as described above).

After this optional step, the selected cells and/or their progeny were washed off of cytokines and means, including an environment for optimal growing the a/extensions, and optional transferout nucleotide sequence(sequence) that encodes a gene Numblike and/or "short" (PRR-) isoforms(isoforms) Numb, and/or synthetic oligonucleotides, which purposefully act on long (PRR+) isoforms, and so on (for example, Zaehres et al., 2005), and then cultured under conditions that promote differentiation of the selected cells into the desired type(s) of cells.

In most cases the cells are then cultivated in the presence of 5-10% fetal bovine serum and tools(tools) that facilitate the differentiation of the selected cells and/or their progeny into the desired cell population. The presence of fetal bovine serum and tools(tools) provides growth or proliferation with a speed which is less than the optimal growth rate or speed increase, but also promotes the differentiation of cells into the desired cell population. Tools or specific culturing conditions selected in accordance with desired population of cells as described below.

Obtaining populations of neurons or nerve cells

If the desired population of cells is a population of nerve cells that successfully transfetsirovannyh cells are cultured under conditions that promote growth at a speed which is less than the optimum speed, and in the presence of funds(funds), which is obstet differentiation of cells into nerve cells. Conditions that promote differentiation into neurons, have been described in numerous publications, including (Benninger et al., 2003; Chung et al. 2005; Harkany et al., 2004; Ikeda et al., 2004; Ikeda et al., 2005; Wernig et al., 2002; Wernig et al., 2004). Moreover, the combined effects of retinoic acid in the presence of additional cytokines promotes specific differentiation in the type of nerve cells in vitro (for example, Soundararajan et al., 2006; Soundararajan et al., 2007; U.S. patent 6432711).

In a preferred embodiment, the differentiation of neurons or nerve cells in vitro in the presence of 50 ng/ml nerve growth factor (NGF).

In the preferred embodiment, if desired population of cells is a population of neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding Nurr1, REN, neurogenin-1, neurogenin-2, neurogenin-3, Mash 1, Phox2b, Phox2a, dHand, Gata3, Shh, FGF8, Lmx1b, Nkx2.2, Pet1, Lbx1l and/or Rnx.

In another preferred embodiment, if desired populations of neurons is a population of dopaminergic neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other the sequences, including a sequence selected from those encoding Mash1, Ngn2, Nurr1, Lmx1b and/or Ptx-3.

In another preferred embodiment, if desired populations of neurons is a population of serotonergic neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding Mash1, Phox2b, Lmx1b, Nkx2.2, Gata2, Gata3 and/or Pet1.

In another preferred embodiment, if desired populations of neurons is a population of cholinergic neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding MASH1, Phox2a and/or REST4.

In another preferred embodiment, if desired populations of neurons is a population of GABA-eliteskin neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding MASH1, Phox2a and/or REST4, facultative the subsequent cultivation in environments supplemented with LIF, neurotrophin-3 (NT3) and/or nerve growth factor (NGF).

In another preferred embodiment, if desired population of neurons is the population of noradrenergic neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding Mash1, dHand, Phox2a, Phox2b, Gata2 and/or Gata3.

In another preferred embodiment, if desired populations of neurons is a population of GABA-eliteskin neurons, the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding PITX2, Dlx2, Dlx5, antisense RNA Hes1 and/or other synthetic oligonucleotides, specifically affecting HES1.

In another preferred embodiment, if desired population is a population of neurons or populations of nerve cells, cells, transfetsirovannyh short (PPR-) isoforms numb/numblike), cultured in the medium for culturing cells, which promotes the differentiation, such as described above, and which is cancel one or more of the following tools: retinoic acid, NT3, NGF, glial-derived neurotrophic factor (GDNF) and interferon-gamma (IFN-gamma).

Obtaining populations of muscle cells

If the desired population of cells is a population of muscle cells, successfully transfetsirovannyh cells cultured in the presence of means for promoting cell differentiation in muscle cells and growth at speeds less than optimal speed. Conditions that promote differentiation in muscle cells, have also been previously described (Nakamura et al., 2003; Pal and Khanna, 2005; Pipes et al., 2005; Albilez et al., 2006; Pal and Khanna, 2007; Behfar et al., 2007; U.S. patent 6432711). Moreover, the impact on the selected cells and/or their progeny hexamethylene-bis-acrylamide or dimethylsulfoxide in the presence of additional cytokines contributes to the initiation of differentiation in muscle cells types in vitro.

In the preferred embodiment, if desired population is a population of cells of the cardiac muscle cell, transfetsirovannyh short (PRR-) isoforms numb/numblike), cultured in the medium for culturing cells, which promotes differentiation into cardiomyocytes (Not et al., 2003; Guan et al., 2007 and others) or which includes certain funds in concentrations that promote differentiation into cardiomyocytes (e.g., about 0.75%-1% dimethyl sulfoxide (DMSO), 20% normal bovine serum (NBS), 10(-7)mm retinoic acid is (RA) and 20% Wednesday, air-conditioned cardiomyocytes) (Hua et al., 2006).

In another preferred embodiment, if desired population is a population of cardiomyocytes, the cells also transferout nucleotide sequences which include sequences selected from those sequences that encode Gata4, Gata5 and Gata6.

In the preferred embodiment, if desired population of cells is a population of muscle cells, the transfection of sequences that encode short isoforms of numb and numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those that encode specific for muscle-type bHLH, MyoD, myogenin, Myf5, Myf6, Mef2, myocardin, Ifrd1 and/or other transcription factors in muscle cells.

In the preferred embodiment, if desired population of cells is a population of smooth muscle cells, transfection of sequences that encode short isoforms of numb and numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding nucleotide sequence specific for the cells of the muscle type myocardin.

In site Cetelem embodiment, if desired population of cells is a population of cells of skeletal muscle, the transfection sequences that encode short isoforms of numb and numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding nucleotide sequence specific for the cells of the muscle-type MyoD and myogenin.

In the preferred embodiment, if desired population of cells is a population of oligodendrocytes, the transfection sequences that encode short isoforms of numb and numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those that encode specific for oligodendrocytes nucleotide sequence of OLIG1, OLIG2 and Zfp488.

Simultaneous transfection of any subclass of data specific transgenic sequences above can be performed by any known in the art methods, including the use of multiple genetic vectors, serial transfection, and selection based on specific marker proteins and/or antibiotic resistance.

If desired population of cells is a population of hematopoietic cells is to, the environment for differentiation includes specific tools in concentrations that promote differentiation into hematopoietic precursor cells (e.g., growth factor vascular endothelial (VEGF), thrombopoietin and so on (for example, Ohmizono, 1997; Wang et al., 2005; Srivastava et al., 2007; Gupta et al., 2007) or differentiated hematopoietic cells (in accordance with known prior art techniques for differentiated types of hematopoietic cells from undifferentiated or pluripotent cells).

If the desired population of cells is a population of germ cells, the environment for the differentiation includes specific tools in concentrations that promote differentiation into germ cells (for example, Nayernia et al. 2006a, 2006b).

If the desired population of cells is a population of cells endoderm or insular cells of the pancreas, the environment for the differentiation includes specific tools in concentrations that promote differentiation into the cells of endoderm and insular cells of the pancreas (e.g., Xu et al., 2006; Denner et al., 2007; Shim et al., 2007; Jiang et al., 2007).

In a preferred embodiment, the differentiation of the selected cells and/or their offspring may occur in the environment for differentiation without transfection numblike, short isoforms of Numb or other transgenes, and the environment for differentiated the key can remain unchanged.

In embodiments, the implementation will use the same vector, which controls expression of the nucleotide sequence(sequence) that encodes a long isoforms(isoforms) of the gene numb mammals (and/or synthetic oligonucleotides, specifically affecting numblike or short isoforms of numb) one regulated promoter (e.g., the tetracycline-regulated promoter), whereas Numblike and short isoforms of Numb (and/or synthetic oligonucleotides, specifically affecting long (PRR+) isoforms) is expressed under the control of another individual, but also regulated promoter. Therefore, long (PRR+) isoforms(isoforms) numb can be expressed (and/or short isoforms to repressirovaniia), if you want to increase the selected cells and the culture medium was added to the inductor (e.g., tetracycline); can then be expressed numblike and short isoforms (and/or long (PRR+) isoforms(isoforms) numb suppressed), if required differentiation.

Similarly, proteins and peptides corresponding to isoforms of Numb, Notch, OCT3/4, SOX2 and other DNA sequences described in this document, you can type in a similar way in the selected cells and/or their progeny by electroporation (e.g., Koken et al., 1994; Ritchie and Gilroy, 1998), using nanoparticles, cationic lipids, merge the category of liposomes (e.g., Yoshikawa et al., 2005; 2007), and so on, instead of or in combination with genetic transfection. In General, electroporation provides a highly efficient transfection (and a high yield of the desired cells) without genomic integration of the transgene and, therefore, is related to enhanced security.

DNA or RNA encoding the protein(proteins) or polypeptide(a polypeptide), which promote proliferation, multipotency, pluripotency or differentiation of selected cells can be identified in accordance with standard techniques of genetic engineering (for example, by allocating such DNA from a cDNA library specific cell line) and place it into the appropriate expression vector, which is then transferout in the selected cells.

In another preferred embodiment, the desired population of cells are endodermal or insular cells of the pancreas, and the transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding Foxa2, Sox17, HLXB9 and/or Pdx1.

In another preferred embodiment, the desired population are hepatocytes, and transfection of the sequences encoding the short isoform numb/numblike), DOPOLNITEL replace temporary or permanent transfection of other sequences, including a sequence selected from those encoding hepatic nuclear factor (hepatic nuclear factor HNF-1, HNF-3, HNF-4, HNF-6 and creb-binding protein.

In another preferred embodiment, the desired population are hematopoietic cells, and transfection of the sequences encoding the short isoform numb/numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences selected from those encoding Runx1/AML1 and NOV(CCN3), and/or culturing cells in the presence of colony-stimulating factors specific to the desired population of cells. If you want engraftment of the transplant, then enter the Runx1 isoforms/AML1; if you want to differentiation, then enter the isoform b (Creemers et al., 2006).

In another preferred embodiment, the desired population are chondrocytes, and transfection of sequences that encode short isoforms of numb and numblike), Supplement, or replace a temporary or permanent transfection of other sequences, including sequences that encode Sox9, CREB-binding protein, Gata6 and/or Runx2.

In another preferred embodiment, the desired population are bone cells (especially osteoblasts), and transfection of sequences that encode the cor is die isoforms of numb and numblike), Supplement or replace a temporary or permanent transfection of other sequences, including Runx2.

In a preferred embodiment, genetic vectors, encoding the long isoform Numb (such as those described herein), introducing endogenous cells in vivo temporarily or under the control of a regulated promoter in order to force these cells to temporarily proliferate.

In a preferred embodiment, the endogenous cells (e.g. cells of the ependymal zone of the Central nervous system) transferout in vivo genetic vectors that encode the short isoforms of numb or protein(proteins) numblike, alone or in combination with other transgenes, specified in the present document, in order to temporarily or permanently facilitate the re-launch of differentiation or increased differentiation (especially neuronal differentiation and migration of progenitor cells/ependymal cells in the Central nervous system. This update or enhancement measure the largest number of cells exhibiting for the first time encountered the expression of markers associated with differentiation. This can be achieved by introducing into the system of bodies of genetic vectors using methods suitable for this purpose (see examples).

In a preferred variant of the implementation of endogenous cells (for example, cells of the ependymal zone of the Central nervous system) transferout in vivo genetic vectors that encode long isoforms(isoforms) numb and/or other information provided in this document transgenes, in order temporarily to facilitate the resumption of proliferation or increased proliferation of stem cells and subsequent differentiation of cells-descendants). This renewal or improvement is measured by the magnitude of the number of cells exhibiting for the first time encountered the expression of markers associated with the division predecessors. This can be achieved by introducing into the system of bodies of genetic vectors using methods suitable for this purpose (see examples).

Similarly, this approach is also suitable for induction starts again, differentiation or increased differentiation from other populations of stem cells in other tissues (such as skin and so on). This approach can be used, for example, in a clinical setting in porazenia Central nervous system, disorders of other tissues, in which the normal differentiation or migration violated, dysplastic disorders and other disabilities, when this approach is useful.

In a preferred embodiment, nucleic acid(nucleic acid) or protein(proteins) correspond to the s one gene or segment (in particular, referenced in this document, open as described in this document the ways that are open by other published methods; and/or known to be capable of initiating a desired differentiation), is the only nucleic acid(nucleic acid) or protein(proteins), which sverkhekspressiya and/or which is injected to initiate the differentiation of the selected cells.

In a preferred embodiment, nucleic acid(nucleic acid) or protein(proteins) that correspond to a single gene or segment (in particular, referred to in this document opened as described in this document the ways that are open by other published methods; and/or known to be capable of initiating a desired differentiation), is the only nucleic acid(nucleic acid) or protein(proteins), which sverkhekspressiya and/or which is injected to initiate the differentiation of the selected cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(proteins), which correspond to the CTD is linoma gene or segment (in particular, referenced in this document, open as described in this document the ways that are open by other published methods; and/or known to be capable of initiating a desired differentiation), you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population of differentiated cells.

In a separate preferred embodiment, together with nucleic acid(nucleic acids) or protein(proteins), which correspond to a single gene or segment (in particular, referred to in this document opened as described in this document the ways that are open by other published methods; and/or known to be capable of initiating a desired differentiation), you can use other nucleic acid(a nucleic acid) or protein(proteins) up until the selected cell is not received by the population of differentiated cells, and the method is electroporation, liposomes, nanocapsules, nanogranules and/or another approach that avoids retroviral/lentiviruses integration or other random changes in the genome of the cell.

It should be understood that any described herein a combination of sequences of nucleic acids or proteins can change is by excluding such which correspond Numb and/or Numblike, until then, until you get the desired population of cells or achieved the desired behavior.

Similarly, it should be understood that the described herein (or elsewhere) methods of initiation of differentiation apply to any induced or neindutsirovannom multipotent, pluripotent or self-renewing stem cells or other selected cells, not only to the cells obtained are described in this document method.

The sources of the selected cells

The selected population of cells may occur from a variety of stem cells, precursor cells or somatic cells. However, in particular, with the exception of somatic cells that have no nucleus (for example, a Mature human erythrocytes). Selected stem cells can be obtained from existing cell lines or isolated from stored already in the pot or cryopreserved sources. Typical sources of stem cells include bone marrow, peripheral blood, placentary blood, amniotic fluid (e.g., De Coppi et al., 2007), cord blood (e.g., Zhao, et al., 2006; Tian et al., 2007), adipose tissue (e.g., Gimble et al., 2007; Ma et al., 2007), the embryos of animals (except humans) and other cells. This way you can choose circulating leukocyte and other nestorova cells and place in such conditions, as described above, effective to purchase cells, thus, multipotential, pluripotency and/or ability to self-renew. Examples of other available somatic cells that can be used in this invention include lymphocytes and epithelial (e.g., buccal epithelium inside of the cheek) cells. The selection and collection of cells selected for use in the framework of the present invention can be performed by any method known in this technical field.

In embodiments, the implementation of the animal table cells derived from prostate, testis, fetal brain and intestine, are also disclosed as preferred sources of the selected cells.

In a preferred embodiment, the selected cells and/or their progeny grown in three-dimensional format.

A further purpose of the present invention is to provide cells for use in obtaining compatible with the patient and specific to the patient's tissues and organs for transplant patients, recognized need of such organs and tissues. In this paper reveals that pluripotent, multipotent and/or differentiated cells, obtained as described in this document the methods (or similar methods), used in combination with methodologies is and the receipt of such organs and/or tissues (e.g., Boland et al., 2006. Xu et al., 2006; Campbell and Weiss, 2007). Such use, in particular, is covered by the present invention.

For example, pluripotent, multipotent and/or differentiated cells derived or processed as described in this document the methods (or other published methods), can be grown using a two-dimensional or three-dimensional frameworks, designed to reflect the normal structure of the tissue and/or organ (for example, Yarlagada et al., 2005; Kim et al, 1998; WO/2003/070084; EP 1482871; WO 03070084; U.S. patent 2395698; 7297540; 6995013; 6800753; Isenberg et al., 2006).

Similarly, the frames, which should settle pluripotent, multipotent and/or differentiated cells can be obtained from cadaveric organ(organs) or tissue(tissues), then cadaveric organs and tissues (e.g. bone, heart, kidneys, liver, lungs and so on) can be processed in such a way as to remove immune cells in these tissues, as well as other unwanted or auxiliary host cell (for example, using ionizing radiation, sterilization (e.g., Mroz et al., 2006) and/or different methods of cell removal (patent United States 6734018; 6962814; 6479064; 6376244; U.S. patent 5032508; 4902508; 4956178; 5281422, 5554389; 6099567; and 6206931; 4361552 and 6576618; 6753181; patent application U.S. serial number 11/162715; WO/2001/048153; WO/2002/024244; WO 003002165; WO/2001/049210; WO/2007/025233; E. the European patents EP 1482871; EP 1246903; EP 1244396; EP 0987998; EP 1244396; EP 1333870; Rieder et al., 2004; Ott et al., 2008; Taylor et al., 1998)).

Similarly, it is expected that pluripotent, multipotent and/or differentiated cells of the present invention can be used in applications using "inkjet printing" for the purposes of tissue engineering (e.g., Boland et al., 2006. Xu et al., 2006; Campbell et al., 2007). Therefore, the use of cells obtained or processed in accordance with the methods described herein is covered.

In another preferred embodiment of the invention selected cells and/or their progeny are cultivated in hanging drops.

In accordance with another aspect of the present invention, the selected cells can be pre-genetically modified.

In accordance with another aspect of the present invention, the selected cells can be modified using DNA or ROAR, encoding a protein(protein or polypeptide(a polypeptide) that promote differentiation of the cells into the desired cell population.

Screening populations of cells

In one embodiment, the methods of this invention include screening cells from cell lines, donor source, umbilical cord blood and autologous or donor's bone marrow, blood, spermatogonia, primary germ cells, cells of buccal the th epithelium inside of the cheek or any other sources of cells, suitable in the present invention. The selected cells can be subjected to screening to confirm successful transfection useful sequence(useful sequences) or therapeutic vector(therapeutic vectors), and the successful initiation of differentiation using any known in the field of way (Guan et al., 2006; U.S. patent 6432711). In some embodiments, the implementation of cells subjected to screening using standard methods based on hybridization of nucleic acids and PCR, or by using the methods of fast typing. In preferred embodiments, the implementation of cells subjected to screening for gene expression reporters. In some embodiments, the implementation of the cells will powerhaul screening for expression of the marker gene encoded by a vector(vectors), expressing the transgenes, such as a gene for antibiotic resistance or a gene of the fluorescent protein (e.g., GFP).

Screening for therapeutic vectors and useful sequence

Cells can be screened for the presence of useful sequence(useful sequences) and therapeutic vector(therapeutic vectors) using any way(any way), known(known in the art to determine the specific sequence is th. Each sample of cells can be screened for a number of sequences. Alternatively, it is possible to perform simultaneous screening of many samples.

Cell differentiation can be monitored in several ways: including (i) morphological assessment, (ii) use of the polymerase chain reaction with reverse transcriptase (RT-PCR), Northern blotting or methods with microchips to track changes in gene expression, (iii) analysis of the cellular expression of specific markers, such as beta-tubulin III (for neurons), and so on (Ozawa, et al., 1985). In some embodiments, the implementation of the cells are screened for the successful initiation of differentiation using fluorescently-activated sorting of cells (FACS) based on the expression of specific cell type markers or transgenic markers (e.g., protein expression of antibiotic resistance or fluorescent protein) under the control of promoters that are specific for cells of this type, such as myosin promoter in muscle cells; the promoter of the human cardiac α-actin in cardiac myocytes; insulin promoter in the cells that produce insulin; promoter, neuron-specific enolase (NSE) for differentiation into neurons or promoters associated with neurotransmitters such as promoter, tyrosine hydroxylase in the dopamine is formed neurons; etc)

In some embodiments, the implementation of cells subjected to screening using standard methods based on hybridization of nucleic acids and PCR. In the private preferred embodiment, the cells are subjected to screening using rapid typing.

Screening for common types of leukocyte antigen (HLA)

In certain embodiments implementing the selected cells are selected on the basis of compatibility with HLA-typing. The HLA genotype can be determined by any well-known experts in this field means.

Cells used for screening may include cells taken directly from a donor, or from cell lines established from donor cells, or other applicable sources of cells. Cells can be screened for useful sequence(useful sequence) and/or therapeutic vector(therapeutic vectors), and HLA-type simultaneously or separately. Those cells that are successfully transliterowany useful sequence and show the corresponding genotype HLA, you can prepare for the transplant patient.

In certain embodiments of the implementation transfetsirovannyh cells transplanted without HLA-typing. In other embodiments, the implementation of cells subjected to HLA-typing for compatibility.

Screening is and means, contributing to the manifestation of cellular phenotype

The present invention also provides methods of screening for proteins and funds for their ability to induce phenotypic changes or differentiation of the selected cells and/or their offspring in the desired cell population. Briefly, vectors encoding the complementary DNA (cDNA) from the appropriate cDNA libraries, transferout in the selected cells and/or their offspring. After identifying specific cDNA that induces differentiation or other phenotypic changes, such cDNA can be extracted and cloned into an appropriate expression vector for production of the protein in the appropriate cells (e.g., COS cells) in vitro. Then the supernatant containing protein, you can make a culture of the selected cells to determine induce the differentiation of any secreted proteins of these cells. On the other hand, in the culture of the selected cells can be made the means proposed to determine induce the differentiation of any secreted proteins from these cells (see U.S. patent 6432711).

The present invention also provides methods of screening nucleic acids for their ability to induce multipotent, pluripotency and/or self-renewal or to initiate differentiation selected cleto and/or their offspring. In these methods, vectors, encoding the selected cDNA (cDNA or from the appropriate cDNA libraries, or other sequence) is introduced into the selected cells and/or their progeny using electroporation, nanocapsules, nanogranules, liposomes, retroviruses, lentiviruses and/or any other possible means of transfection. After identifying specific cDNA that induces phenotypic changes, multipotential, pluripotency and/or ability to renew such cDNA can be extracted and cloned into an appropriate expression vector. The analyses identify such changes include described in the text of this application.

Protein corresponding to the identified cDNA, it is possible to produce in the respective cells (e.g., COS cells) in vitro, to determine whether the supernatant containing the protein to contribute to the culture of the selected cells and can induce changes.

Finally, proteins can be entered in the selected cells and/or their progeny using electroporation, nanocapsules, nanogranules, liposomes, retroviruses, lentiviruses and/or other possible means transfection, and the cells can be assessed as described herein, multipotential, pluripotency, the ability to self-renewal or initiation of differentiation.

Transplantation glue is OK for patients

After screening the selected cells and/or their progeny can be subjected to cryopreservation, save in the form of cell lines in culture or to enter the patient. The selected cells can be subjected to cryopreservation or save in the culture by any means known in the art, and stored for future transplant procedures.

Preferably, the cells that need to be subjected to screening, obtained from available sources, allowing easy Assembly.

Regarding obtaining cells resistant to HIV: targeted somatic and stem cells of the present invention can be cells of any type capable of differentiation into cells that can be infected with HIV, which can support the transcription and/or replication of HIV, which can alter the immune response to HIV, or that can inhibit the progression to AIDS. Such stem cells include, without limitation, pluripotent cells derived from spermatogonia, primary sex cells, hematopoietic stem cells, cells of the peripheral blood cells of placental blood cells, amniotic fluid, umbilical cord blood cells, cells buccleugh epithelium inside of the cheek, the cells of adipose tissue (including stem cells derived from these tissues), reprogrammed cells, induced mu is typothetae cells, induced pluripotent cells, and so on, the embryos of animals (except humans) and/or any other type of cells that can form hematite and immune cells, the target cells of HIV and other cells.

Therapeutic vector(therapeutic vectors) expresses "a useful sequence(useful sequence)", intended for the conversion of transfected or infected cells less capable of maintaining transcription and replication of HIV. Genetic vectors expressing "useful sequence(useful sequence)", as well as any virus, obtained from such a genetic vector, termed herein "therapeutic vector.

After screening cells, transferrance desired therapeutic vector(therapeutic vectors and expressing useful sequence (with or without a compatible HLA genotype) can be increased ex vivo (in vivo) using standard methods of cultivation dividing cells and support in the form of stable cell lines (U.S. patent 6432711 and 5453357, incorporated herein by reference). On the other hand, these cells can enter the patient and increase in vivo.

The selected cells can be subjected to cryopreservation by any means known in the art, and x is unity for future transplant procedures.

Transplantation of the required populations of cells patients

In certain embodiments of the implementation of the population of cells prior to transplantation enrich stem cells. In the art of well-known various methods of selecting stem cells. For example, the sample of cells can be enriched by using monoclonal antibodies with fluorescent markers that recognize cell surface markers of undifferentiated hematopoietic stem cells (such as CD34, CD59, Thy1, CD38 low, C-kit low, lin-minus) to conduct sorting through fluorescently-activated sorting of cells (FACS).

In other embodiments, implementation of the selected sample of cells transplanted without enrichment.

In some embodiments, implementation prior to transplantation therapeutic stem cells reduce or eliminate endogenous stem cells in the bone marrow. Therapeutic stem cells determine how these stem cells, which contain useful sequence(useful sequence) or therapeutic vector(therapeutic vectors).

In some embodiments, the implementation of the transplant process may include the following phases: (1) air, (2) infusion of stem cells, (3) atropunicea phase, (4) phase engraftment and (5) the period after engraftment is transplantat.

In some embodiments, implementation prior to transplantation reduce or eliminate endogenous stem cells that normally form the desired cells (e.g., stem cells of the bone marrow). For processing bone marrow for the proper engraftment can be applied chemotherapy, irradiation, etc., and/or the methods similar to those described in U.S. patent 6217867. Finally, therapeutic stem cells can be transplanted to a patient using any known in the art method.

Construction of vectors encoding Numb, Numblike and other transgenes

In one embodiment, the transfection of the sequence(the sequence) of the nucleic acids encoding the isoforms(isoforms) numb/numblike, perform through viral transfection. The expression "vector(vectors) encoding Numb/Numb-like" refers to a vector comprising the sequence(sequence) of the nucleic acids encoding the isoforms(isoforms) numb/numblike and/or synthetic oligonucleotides, specifically affecting the isoforms of numb or numblike, and any additional sequence of the transgene, synthetic oligonucleotides, etc., and any supernatant associated with viral components, present in the vector sequence.

Vector(vector), Cody the existing Numb/Numblike, may include the expression vector. Appropriate expression vectors are vectors that can be used for transfection of DNA or RNA in eukaryotic cells. Such vectors include prokaryotic vectors, such as, for example, bacterial vectors; eukaryotic vectors, such as, for example, yeast vectors, or vectors based on mushrooms; as well as vectors based on viruses, such as, but without limitation, vectors based on adenoviruses, vectors based on adeno-associated viruses and vectors based on retroviruses. Examples of vectors based on retroviruses, which can be used include, but are not limited to, vectors derived from leukosis virus of mice, Malone [Moloney], sarcoma virus of mice [Moloney], rous sarcoma virus [Rous], FIV (human immunodeficiency virus in cats), HIV (HIV), SIV (human immunodeficiency virus monkeys, SIV) and hybrid vectors.

Revealed that the vector(vectors) encoding Numb/Numblike, can be used for transfection of cells in vitro and/or in vivo. The transfection can be performed using any known in the art means, in particular with virus obtained from cells packing viruses. This virus can be enclosed in a capsid in order to be able to infect a variety of cell types. However, any methodology based on the conclusion in the capsid, and allowing vizirovat selected types of cells and/or their progeny practicable in the context of this invention.

The design of a gene therapy vector(gene therapy vectors for human immunodeficiency virus (HIV)

"Therapeutic vector(therapeutic vectors) may include an expression vector. Appropriate expression vectors are vectors that can be used for transfection of DNA or RNA in eukaryotic cells. Such vectors include prokaryotic vectors, such as, for example, bacterial vectors; eukaryotic vectors, such as, for example, yeast vectors, or vectors based on mushrooms; as well as vectors based on viruses, such as, but without limitation, vectors based on adenoviruses, vectors based on adeno-associated viruses and vectors based on retroviruses. Examples of vectors based on retroviruses, which can be used include, but are not limited to, vectors derived from leukosis virus of mice, Malone [Moloney], sarcoma virus of mice [Moloney], rous sarcoma virus [Rous], FIV (human immunodeficiency virus in cats), HIV (HIV), SIV (human immunodeficiency virus monkeys, SIV) and hybrid vectors.

In the present invention revealed that therapeutic vector(therapeutic vectors) can be used for transfection of target cells in vitro and/or in vivo. The transfection can be performed using any known D. is authorized engineering tools, in particular with virus obtained from cells packing viruses. This virus can be enclosed in a capsid in order to be able to infect CD34+ cells and/or CD4+ cells. However, in some cases transferout other types of cells without the participation of proteins CD4 or CD34. However, any methodology conclusions in the capsid, allowing infection of these cell types, thus, can be included in the disclosure of the present invention.

Pseudohyperkalemia different proteins shell expands the list of host cells exposed to transduction with vectors based on viruses and therapeutic vectors, and allows us to concentrate the virus to high titers, in particular when pseudohyperkalemia glycoprotein membrane of vesicular stomatitis virus (VSV-G) (Li et al., 1998; Reiser et al., 2000).

Vector design

The present invention is used vectors based on viruses can be of different types, including hybrid vectors. For example, vectors can be vectors based on lentiviruses third generation, which may include only a small part of the native genome (Zufferey et al., 1998). Obtaining a vector(vectors) encoding(encoding) transgenes may also include seminative transport vectors (Zufferey et al., 1998; Miyoshi et al., 1998), excluding education full vector RNA after and is fitiavana target cells.

You can use vectors based on viruses unable to replicate due to violations of the expression of certain viral proteins required for normal replication. However, there is a possibility that the helper virus can run the replication of therapeutic virus. The probability of such phenomena can be reduced by applying seminariruumis vectors.

In a preferred embodiment, the transgenic sequence controlled ubiquitine promoter, a U6 promoter, the promoter EF-1 alpha promoter CMV, regulated promoters and/or promoters that are specific for the desired cell type.

Viral tropism

In a preferred embodiment, the virus-derived vector(vectors) encoding the isoforms of Numb/Numblike, therapeutic vector(therapeutic vectors) and/or other transgenic vector(other transgenic vectors) of this invention, pseudocyperus glycoprotein membrane of vesicular stomatitis virus to the concentration of the virus to high titers and facilitate infection of CD34+ cells.

The choice of the sequence

The application of any sequence with 70% or more identity (or complementarity) to any sequence related to the sequence NUMB or Numblike (with the capability, the capacity search using databases Entrez-Pubmed), covered by this invention when used in accordance with the method described in this invention.

The present invention also partly has to do with genetic vector that comprises a sequence that is able to significantly reduce the susceptibility of mammalian cells to infection by the viruses HIV-1 and HIV-2 (both herein referred to as HIV).

The present invention discloses a novel combination of synthetic oligonucleotides to reduce the expression of genes crucial for HIV/mechanism of AIDS.

The feasibility of combining synthetic oligonucleotides for the implementation of the "knock-down" of the receptor by the expression of TAR sequences(transactionware regulatory elements) and RRE(Rev-responsive regulatory elements) traps flows presented in this document claims that therapeutic approaches based on a combination of many genes involved simultaneously target the impact on 1) HIV infection, 2) the transcription of HIV, and 3) HIV replication in individual cells will probably give better therapeutic effects than any of these approaches separately.

Therapeutic vector(therapeutic vectors) expresses "a useful sequence(useful posledovatelno and)", designed for the conversion of transfected or infected cells less capable of maintaining transcription and replication of HIV. Genetic vector expressing "useful sequence(useful sequence)", as well as any virus, obtained from such a genetic vector, herein indicated by the expression "therapeutic vector.

This invention is in part directed to the genetic modification of cells susceptible to HIV infection or are able to reproduce HIV. These cells in this document are referred to by terms such as "target cells".

The present invention provides a composition and method of application of therapeutic vectors based on viruses in order to reduce the susceptibility of Mature or immature target cells, leukocytes, Gemalto, any stem cells/precursor cells and/or their offspring to HIV.

From this it follows that the present invention also provides a composition and method of application of therapeutic vectors based on viruses in order to reduce the susceptibility of reprogrammed cells, induced multipotent cells, induced pluripotent cells and/or their offspring to HIV.

A further purpose of this invention is to reduce the ability of Mature or illegal is elih of target cells, stem cells/progenitor cells (including reprogrammed cells, induced multipotential cells, induced pluripotent cells) and/or their offspring to maintain transcription and replication of the virus immunodeficita.

Another purpose of this invention is to achieve effective, long-term expression of therapeutic sequences in Mature or immature target cells, the other resting cells, stem cells/cells-the precursors and/or their offspring.

In one aspect, the invention provides a method of prevention or treatment of HIV infection. The method includes the transplantation of stem cells, transfected with therapeutic vector(therapeutic vectors) or sequence(sequences), patients with HIV infection.

Useful sequence(useful sequence) may be sequences that reduce the ability of HIV to infect cells, the transcription of viral DNA or replication within the infected cell, or a sequence that enhances the ability of cells to neutralize HIV-infection.

In certain embodiments of the implementation of a useful sequence(useful sequence) is(are) an artificial about gonucleotide(synthetic oligonucleotides), which(who) to prevent(inhibit) the penetration of HIV, including siRNA, shRNA, antisense RNA, or microRNA against any of the HIV coreceptors (including, but not limited to, CXCR4, CCR5, CCR2b, CCR3 and CCR1).

In a preferred embodiment, therapeutic vector(therapeutic vectors) includes(include) in a synthetic oligonucleotides, specifically affecting one or more of the HIV coreceptors, including CXCR4, CCR5, CCR1, CCR2, CCR3, CXCR6 and/or BOB.

In another preferred embodiment, therapeutic vector(therapeutic vectors) includes(include) in a synthetic oligonucleotides, specifically affecting the major HIV coreceptors - CXCR4 and CCR5

In a further preferred embodiment, therapeutic vector(therapeutic vectors) includes(include) in a synthetic oligonucleotides, specifically affecting one or more of the HIV enzymes such as reverse transcriptase, itegrate and HIV protease.

Suitable sequences for synthetic oligonucleotides are sequence 1) predicted by computer algorithms as effective in reducing target sequences, and 2) capable of successfully reducing the number of the target enzyme to >70% in the standard share of the public research RNA and in studies of the enzymatic activity or to the extent below therapeutic.

The phrase "target sequence" indicates that the specific sequence is a sequence of nucleotide bases having at least 70% identity to the viral genomic nucleotide sequence or its complementary chain (for example, the same as she or complementary to a viral genomic sequence), or the corresponding RNA sequence. In certain embodiments of the implementation of the present invention, this expression indicates that the sequence is at least 70% identical to the viral genomic sequence specific virus, against which is directed oligonucleotide, or its complementary sequence.

Any of numerous types of synthetic oligonucleotides can be expression as a result of transfection of therapeutic vector, and the present invention is directed to all possible combinations of such oligonucleotides.

In a preferred embodiment, the sequence of the synthetic oligonucleotides are controlled by cell-Milenio specific promoter(specific promoters).

In another preferred embodiment, the sequence of the synthetic oligonucleotides are controlled by the promoter(the promoter) U6.

Artificial oligonucleotides similarly can be included in the same therapeutic vector(therapeutic vectors) with RNA-trap.

RNA-trap

RNA traps are RNA sequences that are effective in binding to certain proteins and the inhibition of their functions.

In a preferred embodiment, therapeutic vector(therapeutic vectors) includes(include) the set of all sequences of the RNA traps.

In a further embodiment, the sequence of the RNA traps paired with sequences, providing stability sequence trap.

In another preferred embodiment, the sequence of the RNA traps are RRE sequences and/or TAR traps.

In a preferred embodiment, the sequence RRE and TAR traps are sequences of TAR and RRE obtained from HIV-2.

In another preferred embodiment, the sequence of traps also include a sequence of traps-Psi elements.

In the preferred embodiment, each of the sequences traps are under the control of the U6 promoter.

In another preferred embodiment, the sequence of traps are managed for specific target cells promoters.

In a preferred embodiment, therapeutic vector purposefully affects many the creation stages of the life cycle of HIV, encoding an artificial nucleotide sequence synthetic nucleotide sequence) in combination with sequences TAR and/or RRE-traps HIV-2.

In another preferred embodiment, the vector comprises the sequence of the microRNA oligonucleotides.

In another preferred embodiment, the vector includes to himself sequence of shRNA oligonucleotides.

In another preferred embodiment, the vector comprises the sequence of the oligonucleotides miRNAs.

In another preferred embodiment, the vector includes sequences of oligonucleotides for RNA interference.

In another preferred embodiment, the vector comprises sequences of the ribozymes.

In another preferred embodiment, the vector includes a combination of classes of synthetic oligonucleotides.

In a further embodiment, the sequence synthetic nucleotides interact purposefully with the HIV coreceptors such as CCR5, CXCR4, and so on

In a further embodiment, the sequence synthetic nucleotides targeted to such enzymes HIV integrase, protease, reverse transcriptase, TAT, and so on

In a further embodiment, the wasp is estline sequences of the ribozymes interact purposefully with the HIV coreceptors, as CCR5, CXCR4, and so on, or such enzymes HIV integrase, protease, reverse transcriptase, TAT, and so on

In a preferred embodiment, the virus created with the help of therapeutic vector(therapeutic vectors) and the virus is pseudoterminal.

In a preferred embodiment, the virus created with the help of therapeutic vector(therapeutic vectors), and the virus is not pseudoterminal, and this virus demonstrates inherent HIV tropism.

In a preferred embodiment, therapeutic vector(therapeutic vectors) is(are) the vector-based virus.

In a preferred embodiment, therapeutic vector(therapeutic vectors) is(are) the vector-based lentivirus.

In a preferred embodiment, therapeutic vector(therapeutic vectors) is(are) the vector-based lentivirus third generation.

In a preferred embodiment, therapeutic vector(therapeutic vectors) includes(include) a combination of classes of synthetic oligonucleotides.

In a preferred embodiment, expression of the synthetic nucleotide sequence is under the control of the promoter EF-1 alpha or other corresponding to the notches of target promoters.

In a preferred embodiment, expression of the synthetic nucleotide sequence is under the control of the U6 promoter or other corresponding to the target cells promoters.

In a preferred embodiment, expression of the synthetic nucleotide sequence is under the control of a combination of promoter EF-1 alpha and U6 promoter and/or other corresponding to the target cells promoters.

In a preferred embodiment, EF-1 alpha controls the expression of microRNAs, while the U6 promoter controls the expression of RNA-trap.

In a preferred embodiment, EF-1 alpha controls the expression of miRNAs, while the U6 promoter controls the expression of RNA-trap.

In a preferred embodiment, EF-1 alpha controls the expression of shRNA, whereas the U6 promoter controls the expression of RNA-trap.

In a preferred embodiment, therapeutic vector(therapeutic vectors) includes(include) the set of sequences of microRNAs directed against CXCR4, the set of all sequences of microRNAs directed against CCR5, the RRE sequence-trap HIV-2 and sequence TAR-trap HIV-2, and the vector is a vector-based virus.

In a preferred embodiment, l is an increase with the inclusion of therapeutic vector(therapeutic vectors) combined with other methods of treatment against retroviruses, including pharmacotherapy. Pharmacotherapy against retroviruses suitable for combination with therapeutic vector(therapeutic vectors) are those that have additive or synergistic effects in combination with therapeutic vector.

Target cells for gene therapy for HIV may include, but are not necessarily limited to, Mature T-lymphocytes in peripheral blood monocytes, tissue macrophages, precursor T-cells, precursor cells of macrophages-monocytes and/or multipotential hematopoietic stem cells, such as cells found in umbilical cord blood, peripheral blood and occupying areas of the bone marrow.

The present invention also relates to transfection of CD4+ T cells, macrophages, precursor T-cells, the precursors of macrophages-monocytes, CD34+ stem cells/precursor cells and/or any other resting cells, dividing cells, stem cells or cell precursor capable of differentiation in vitro or in vivo target cells for HIV, CD4+ T-cells, macrophages, precursor T-cells, the precursors of macrophages-monocytes and/or CD34+ stem cells/precursor cells. Transfetsirovannyh cells, therefore, may be endogenous cells in situ or exogenous cells derived from other cha the TEI of the organism or even from other individuals-donors. Cells selected for this purpose in this text are indicated by the expression "selected cells".

Similarly, self-renewing, multipotential and/or pluripotent stem cells (including and reprogrammed induced pluripotent cells) represent another logical target for gene therapy of HIV, and this invention specifically includes the use of them.

In one embodiment, this process is selected cells (e.g. hematopoietic stem cells, stem cells, cells of the umbilical cord, the primary germ cells (PGC), spermatogonia, any available somatic cell, and so on) 1) multiply in culture with the use of one or more cytokines, such as factor stem cell factor, leukemia inhibitory (LIF), cardiotrophin-1, IL-11, IL-6, IL-6 R, GP-130, CNTF, IGF-I, bFGF and/or oncostatin-M, and 2) transferout therapeutic vector(therapeutic vectors) or useful sequence(useful sequences) to differentiation using any known in the art methods such as methods described in U.S. patent 5677139, which is incorporated herein by reference, or by methods similar to described in U.S. patent 5677139 on other target cells.

In some cases, the implementation before transfect the th may require the implementation of various stages.

In some cases, the implementation with the aim of creating a population of pluripotent stem cells may need to perform only the steps of incubating the above.

Appropriate concentrations of LIF and factors of stem cells for reproduction/proliferation of stem cells/precursor cells, and other conditions of cell culture have been described previously (e.g., U.S. patent 6432711 and 5453357, incorporated herein by reference). Other relevant protocols and standard concentrations of cytokines were described Koshimizu et al., 1996; Keller et al., 1996; Piquet-Pellorce, 1994; Rose et al., 1994; Park and Han, 2000; Guan et al., 2006; Dykstra et al., 2006).

Population of target cells may include somatic cells, stem cells and precursor cells. Stem cells can be obtained from existing cell lines or isolated from stored already in the pot or cryopreserved sources. Typical sources of stem cells include bone marrow, peripheral blood, placental blood, amniotic fluid, umbilical cord blood, adipose tissue, embryos of animals (excluding humans), and so on

Somatic cells, in particular circulating leukocytes and other cells are not cells-precursors/stem cells can also be placed under the same culturing conditions as description is but higher for stem cells/precursor cells, effective to ensure that they have acquired the properties of stem cells/precursor cells.

The invention also discloses the receipt (for example, patent application U.S. 20030099621) of target cells from stem cells/precursor cells, which can be done relatively resistant to infection with HIV and/or HIV replication.

However, it is implied that any method of differentiation previously propagated stem cells/precursor cells/leukocytes in the desired target cells can be used within the scope of this invention as long until you have obtained the functional target cells, are relatively resistant to HIV infection and/or replication of HIV and/or HIV replication.

In a preferred embodiment, therapeutic vector-based virus is wrapped one or more membrane proteins native HIV, giving therapeutic virus ability to infect any cell that is capable of infecting native strains of HIV.

Cells selected for use in this invention, in some cases, will be available (for example, stem cells, umbilical cord stem cells in the bone marrow, spermatogonia and primary germ cells of the testis, stem cells isolated from amniotic fluid stem cells, separation of the data from the skin, and so on). Such cells can be isolated from tissues in which they reside, any known in the art means.

Other selected cells can include reprogrammed cells, induced multipotential cells, induced pluripotent cells, and so on

In accordance with an aspect of the present invention provides a method of obtaining a desired cell line, cell type, or class of cells from the selected cell. In General, the method comprises culturing the selected cells and/or their offspring in an environment that stimulates the growth of selected cells with an optimal growth rate. The resulting population of cells is then cultured under conditions that stimulate cell growth at speed, which is usually less than optimal speed, and in the presence of a tool to stimulate the differentiation of cells into the desired cell line, cell type, or class of cells (e.g., CD4+ T-cells).

The present invention also discloses a reproduction of the selected cells and/or their progeny in culture before or after transfection therapeutic any vector known in the art means (for example, patent application U.S. 20060099177). Such methods also include incubation with LIF, stem cell factor, IL-6, IL-7, oncostatin-M and/or cardiotrophin-1 and other cytokines, growth-enhancing,and so on

The present invention further discloses directed differentiation of cells, transfected with therapeutic vector(therapeutic vectors), in the required cell types by further incubation in media containing the appropriate cytokines and growth factors such as colony-stimulating factors such as M-CSF (CSF-1), GM-CSF, IL-7, any cytokine that stimulates the differentiation of CD4+ T-cells, and so on

Transfection

Genetic modification of the selected cells and target cells, whether exogenous cells or endogenous cells can be performed according to any published or unpublished method known in the art (for example, U.S. patents№№6432711, 05593875, 05783566, 5928944, 05910488, 05824547 and so on), or other conventional means. Suitable methods of transforming host cells can be found in the manual of Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989) and other laboratory manuals.

Successfully transfetsirovannyh cells can be identified using the Protocol selection involving markers, such as genes for resistance to an antibiotic, in addition to studies of RNA expression and morphological analyses. Clones from the successfully transfected cells expressing the corresponding exogenous DNA at the appropriate levels, you can save as whether the AI cells by cryopreservation (using any appropriate method of cryopreservation, known in this field).

Breeding markers (e.g., genes for resistance to antibiotics) can include markers that give resistance to drugs, such as G418, hygromycin, ampicillin and blasticidin etc. of the Cells containing the gene of interest can be identified by screening using drugs, where cells, in which was included breeding marker gene survive and others die.

This document describes theoretical rationale for embodiments of the present invention, however, the discussion in any case cannot be considered as binding or restricting the present invention. Specialists in the art will understand that in practice it is possible to implement various embodiments of the present invention, regardless of the model used to describe theoretical basis for this invention.

Hereinafter the invention will be described and illustrated based on examples; however, the scope of the present invention should not be limited by them.

Example 1: Construction of transgenic vectors, suitable for use in the present invention

Suitable vectors based on lentiviruses EGFP-Numb and EGFP-Numblike and EGFP-X (where X is any transgene described the present invention) can be obtained by cloning into an appropriate vector-based viruses (for example, Doheny vector HIV-EGFP-HSA (Reiser et al., 2000)). For PCR amplification of cDNA isoforms of Numb and Numblike and cloning in genetic vector, you can choose the primer-adapters. In preparation for gene cloning vector digested by enzymes. Then each cDNA transgene insert in encoding the nef site, previously occupied by the cDNA CSA. WSFB (EGFP - enhanced green fluorescent protein) and the promoter, corresponding to a population of cells (e.g., CMV-ie or EF-1 alpha), have been previously inserted into the viral coding section. Genetic constructs can include the main part of the vector and transactivator, which regulates the promoter functionally linked to a heterologous nucleic acid sequences.

Examples of vectors based on retroviruses, which can be used include vectors derived from leukosis virus of mice, Malone, sarcoma virus of mice, Malone, rous sarcoma virus, FIV and HIV, but are not limited to. Appropriate expression vectors are vectors that can be used for transfection of DNA or RNA in eukaryotic cells. Such vectors include, but are not limited to, prokaryotic vectors, for example, bacterial vectors; eukaryotic vectors, for example, yeast vectors, and the vectors on the basis of mushrooms; and vectors based on viruses, such as, but without limitation, etc) the market-based lentiviruses, vectors based on adenoviruses, vectors based on adeno-associated viruses and vectors based on retroviruses.

Unable to replicate the vector pcDNA 6.2/EmGFP-Bsd/V5-DEST is an example of a suitable expression vector (Invitrogen) and allows to Express the synthetic oligonucleotides (e.g., microRNA), moved from the vector pcDNA 6.2 GW/miR, having the ability to cleave the target sequence. These vectors include flanking sequences and looped sequence of the endogenous microRNA control cut designed microRNA of the longer transcript Pol II (pre-microRNA).

The combination of many sequences of microRNAs directed against specific endogenous species of RNA, increases the probability of success in reducing expression of a target sequence. The sequence of the microRNA can be functionally linked to regulated or tissue-specific promoters.

When using vectors based on lentiviruses for gene expression obtained(received) in the result vector(vectors) encoding(encoding) Numb/Numblike, and/or other transgenic vector(other transgenic vectors) of this invention be able to traducianist as dividing and non-dividing cell types.

In the preferred embodiment, is sushestvennee received(received) in the result vector(vectors), encoding(encoding) Numb/Numblike, and/or other transgenic vector(other transgenic vectors of this invention contain many sequences of synthetic oligonucleotides, under the control of one or more promoters, for reducing the expression of specific isoforms of numb and/or numblike.

Example 2: Another example of a suitable vector - vector-based retrovirus

Retroviruses are RNA viruses that contain RNA genome. Genes gag, pol and env are ornamented with sequences of the long terminal repeats (LTR sequences). 5' and 3' LTR sequences that facilitate transcription and polyadenylation mRNA.

Vector-based retrovirus can provide adjustable transactivity element, a part of the internal landing ribosomes (IRES), marker selection and heterologous target gene, controlled regulated promoter.

Alternatively, under the control of multiple promoters can be expressed many sequences. Finally, the vector-based retrovirus may contain operating in the CIS-position sequences necessary for reverse transcription and integration. When infection occurs, the reverse transcription of RNA into DNA, which effectively integrates into the host genome. The recombinant retrovirus of the present invention are genetically m is difiliroval thus, to some of retroviral, infection natural genes of the virus have been removed and in some cases replaced by a target sequence of nucleic acids for genetic modification of cells. Sequences can be exogenous DNA or RNA in its natural or modified form.

Example 3: Serve as an example how to create a vector(vectors) encoding(encoding) Numb/Numblike, and/or other transgenic vector(other transgenic vectors) of the present invention

How to create get(get) in the result vector(vectors) encoding(encoding) Numb/Numblike, and/or other transgenic vector (other transgenic vectors) of the present invention include the manner specified in the Viral Power Lentiviral Expression Systems Manual from Invitrogen, 2007. Briefly, the cartridge EmGFP-bsd clone as PmlI fragment-BlpI in vector pLenti6/R4R2/V5-DEST, while the cassette miR-long (PRR+) isoforms of numb or miR-short isoforms of numb/numblike simultaneously transferred BP-reaction in pDONR221. Then tapes regulated promoter(regulated promoters) and miR-isoforms crossed through Multisite LR reaction, the modified vector pLenti6/EmGFP-bsd/R4R2-DEST.

Thus you can create a set of vectors, including various combinations of synthetic oligonucleotides and transgenic cassettes.

The sequence of vector pLenti6/R4R2/V5-DEST (SEQ D NO: I):

Example 4: Additional ways to create a therapeutic vector(therapeutic vectors)

"Packing cell line, derived from human fibroblasts and/or animals receive as a result of transfection or infection lines of normal cells viral structural genes gag, pol and env. On the other hand, packing cell line produce RNA, devoid of psi-sequence, thus viral particles obtained from packing cells do not contain genes gag, pol or env. Once DNA therapeutic vector containing psi-posledovatelnosti (along with therapeutic gene), will be put into packing the cell by transfection or infection, packing cell can produce virions, is capable of carrying a therapeutic RNA in the end the target cell (e.g., CD4+ cell).

"The range of infectivity" therapeutic vector(therapeutic vectors) is determined by the packing line cells. There are many packing cell lines to get a virus that is appropriate to infect a wide range of types of human cells. These packing cell line is able to be enclosed in a capsid vectors based on viruses originating from viruses that nature usually infect times the ranks species of animals.

For example, vectors derived from SIV or MMLV, can be packaged comprising a capsid lines of cells GP120.

The following serves as an example of the retrieval Protocol supernatant with components of therapeutic virus:

1. Twenty micrograms of vector-based retrovirus mixed with 2-3 micrograms of viral DNA containing breeding marker gene (for example, the gene of resistance to antibiotics) easy tap in the 0.8-1 ml of buffered saline Hepes (pH=7,05) in a plastic tube with a volume of 1.5 ml

2. Seventy microlitres 2M CaCl2add to the mixture re-light tapping.

3. When the tube starts to appear blue precipitate, the product should be carefully applied to 30% confluent layer of packing cells (from any of several commercial vendors). The mixture of DNA should be applied only after the packing of the cells will be removed Wednesday.

4. Packing cells put on incubation for 20-30 minutes at room temperature (25 degrees Celsius), and then returned to the incubator where the temperature of 36-38 degrees Celsius, for 3.5 hours.

5. Within 3 minutes, add 3.5-4 ml of Hepes buffered saline containing 15% glycerol, then rinse the cell modified according to the method of Dulbecco medium Needle (DMEM) + 10% FBS x2.

6. Again add the e DMEM + 10% FBS and incubate the cells for 20 hours at 37 degrees Celsius.

7. Remove and strain the medium containing therapeutic viral particles.

Excess supernatant viral components immediately placed for safekeeping or concentrated and stored at -80 degrees Celsius. The supernatant can be stored with 5-8 micrograms of polybrene to increase the efficiency of infection of target cells. Otherwise, polybren may be excluded or added immediately before the infected.

8. Stable cell line-producers can be created by separating packing cell lines (1 to 20 or 1 to 40, and then the incubation of these cells for up to 10 days (changing the culture medium every three days) in the medium containing drug to the selection (for example, certain antibiotics, appropriate transfitsirovannykh resistance genes).

9. After 10 days, individual colonies were collected, divided into aliquots and frozen for storage.

The study infectivity/titer retrovirus perform application specific volume of supernatant with viral components on a confluent layer "test" cells, such as cells NIH T planted with confluently 20%. After 2-3 cell divisions (24-36 hours for cells NIH T) calculate colonies "test" cells, incubated at 37 degrees in a medium containing the antibiotic. The titer of the supernatant is calculated on the basis of this is about counting colonies using the following formula:

Colony-forming units/ml = identified colonies X 0.5 (separation factor)/volume of virus (ml)

The accuracy of this calculation increases, if you are testing a large volume of supernatant in many cups "test" cells.

The application of the supernatant with the components of therapeutic virus to target cells can be performed by various means, depending on the clinical situation.

Example 5: Growth environment for the selected cells

The selected cells can grow/grow in modified according to the method of Dulbecco environment Needle (DMEM) supplemented with glutamine, beta-mercaptoethanol, 10% (vol) horse serum and recombinant human factor, leukemia inhibitory (LIF). LIF eliminates the need to maintain the selected cells on feeder layers of cells (which can also be used) and is important for maintaining the selected cells in an undifferentiated, multipotent or pluripotent state, such cells can be maintained in a modified method of Dulbecco environment Needle (DMEM) supplemented with glutamine, beta-mercaptoethanol, 10% (vol) horse serum and recombinant human factor, leukemia inhibitory (LIF). LIF eliminates the need to maintain cells on feeder layers of cells (which can also be used) and is neo is required to maintain cells in an undifferentiated state (in accordance with U.S. patent 6432711).

To initiate differentiation of the selected cells into neurons, cells trypsinized, and washed from LIF, and placed in DMEM, supplemented with 10% FBS (fetal bovine serum). After resuspendable in DMEM and 10% FBS 1×106cells sown in 5 ml of DMEM, 10% FBS, 0.5 Microm retinoic acid in 60-mm bacteriological Petri dishes Fisher, where cells are expected to form small aggregates. Aggregation promotes proper cell differentiation. Highly efficient transfection of the corresponding neuronal transcription factors can be done before or after vysielanie in DMEM, FBS, and retinoic acid (see U.S. patent 6432711 and 5453357).

Example 6: Compliance HLA

Selected cells (e.g., umbilical cord blood or cells from any other suitable source and/or their offspring) can be subjected to screening, genetically modified (optional), to strengthen and to induce early differentiation into the desired type(required) types of cells (optional). The cells are then transplanted according to standard protocols stem cell transplant. In certain cases, the cells can be transplanted patients without HLA matching.

Example 7: In some rare cases you may need to enter patients vectors encoding the transgene to stimulate or inhib the encoded cell division or cell differentiation in vivo.

Example 8: the Genetic modification of the selected cells

Genetic modification in vitro exogenous or endogenous cells of the patient can be performed in accordance with any published or unpublished method known in the art (for example, U.S. patents№№6432711, 05593875, 05783566, 5928944, 05910488, 05824547 and so on), or other conventional means. Suitable methods of transforming host cells can be found in Sambrook et al. (Molecular Cloning: A Laboratory Manual, 2nd Edition, Cold Spring Harbor Laboratory press (1989)) and other laboratory manuals.

Successfully transfetsirovannyh cells identify Protocol selection involving markers, such as genes for antibiotic resistance, in addition to the study of RNA expression and morphological analyses. Clones from the successfully transfected cells expressing the corresponding exogenous DNA at the appropriate levels, can be saved as a line of cells by cryopreservation (using any appropriate method of cryopreservation, known in the art).

Breeding markers (e.g., genes for resistance to antibiotics) may include genes that give resistance to such drugs as G418, hygromycin and methotrexate. Cells containing the gene of interest can be identified by screening using Les is artenova means, in which cells, including breeding marker gene survive and others die.

This invention discloses the selection of genetically modified cells as "selected cells" of the present invention. The expression of the genetic modification refers to changes in the cell genotype through the introduction of natural or synthetic nucleic acids in cells and/or their progeny or an immortalized cell line and/or their progeny using any known in the art means. Alternatively, culturing conditions, which induce stable changes in gene expression patterns, as described in this document represent the genetic modification. Modification of stem cells, regardless if they are from the brain of the host, the endogenous donor sources, exogenous donor sources or cell lines, is a possible approach for the treatment of certain human diseases, especially diseases of the human nervous system.

Genetic modification covered by this disclosure include, but are not limited to the following: genetic modification performed in vivo; modifications that alter the activity or amount of metabolic enzymes expressed endogenous or exogenous in the good cells and/or their offspring; modifications that change the activity, quantity, or antigenicity of cellular proteins; modifications that alter the activity or amount of proteins involved in pathways of signal transduction; modifications that alter HLA-type, modification, altering cellular differentiation, modification, change neoplastic potential; modifying, altering cellular differentiation; modifications that change the number or activity of structural proteins; modifications that change the number or the activity of membrane-bound proteins (structural or enzyme); modifications that alter the activity or amount of proteins involved in DNA repair and maintenance of chromosomes; modifications that alter the activity or amount of proteins, involved in cellular transport; modifications that alter the activity or amount of enzymes; modifications that alter the activity or amount of proteins involved in the formation and maintenance of the synapse; modifications that alter the activity or amount of proteins involved in the growth of Narita or the growth and formation of axon; modifications that change the number or activity of enzymes that produce antioxidants within cells; modification leading to altered post-translational modification of cellular proteins, modification, change Akti the activity or amount of proteins, involved in other aspects of cell repair, and changes that increase the lifespan of cells (for example, the production of telomerase). Such proteins, such as those mentioned above can be encoded by DNA or RNA, derived from the human genome or other genomes of animals, plants, viruses or bacteria. This invention is also applicable to de novo designed sequences.

In addition, this invention relates to in situ genetic modification of the selected cells and/or cell-descendants for the treatment of the disease. Endogenous stem cells can be modified in situ by direct injection or by introduction of DNA or RNA vectors, including viruses, retroviruses, liposomes, etc., in the substance of a tissue or in the corresponding part of the ventricular system of the brain. Since 1992 we thus modified the thousands of stem cells/precursor cells and many thousands of cells-descendants. Our data show that this method is a modification of progenitor cells results in a huge variety of modified cell types throughout the nervous system, and this method has never resulted in negative consequences.

Example 9: the Introduction of genetic vectors into the host

In a preferred embodiment, the endogenous cells transferout vivo vectors, such as those described in this document, by administration of a therapeutic vector(therapeutic vectors) in the blood, tissue, nervous system, bone marrow, etc. of the owner. The best result can be achieved by modification of a large number of endogenous target cells. This can be achieved by using a device like a catheter of appropriate size or needle for injection of therapeutic vector(therapeutic vectors) in the system of venous or arterial circulation, in a certain tissue, for example muscle tissue, or nervous system. In a preferred embodiment, the virus pseudocyperus glikoproteinom VSV-G envelope and native env proteins of HIV-1.

Example 10: an Injection into the nervous system

Transplantation of selected cells from the growth medium or medium for differentiation in the embryonic nervous system, or the genetic modification of endogenous embryonic cells using genetic vectors can be performed as follows: in the sterile environment of the womb and the fruit visualize by ultrasound or other radiological device. Alternatively, the uterus may be subjected to surgical interference in order to facilitate direct identification of embryonic identification of points of the skull. The selected cells can C the same time to enter by injection (using a catheter or needle of the appropriate size) into the ventricular system its germinative zone(its germinative zone) or in the substance of the nervous system. Injections can be performed in certain cases through the abdominal wall of the mother, uterine wall and fetal membranes in the fetus. Precision injection control direct observation, ultrasound, contrast, methods based on the use of radiation and isotopes, or any other known means of x-ray control.

In appropriate sterile conditions direct identification of embryonic landmarks of the skull carried out visually and through physical examination and palpation with stereotactic guidance and guidance on radiation. After cultivation of the cells corresponding to the number of selected or differentiated cells can be administered by injection or other means into the ventricular system, its germinative zone or in the substance of the nervous system. Precision injection control direct observation, ultrasound or other radiological control.

Under certain neurological diseases of the nervous system in adults, such as Huntington's disease and Parkinson's disease selectively affected cells of a certain part of the brain. In the case of Parkinson's disease is the dopaminergic cells of the black substance. When such specific designated C is the problems affecting adults, localized cell transplantation can be performed using transplantation under radiological control differentiated cells in sterile conditions. Radiological control may include the use of CT (computed tomography) or MRI (magnetic resonance imaging), and you can use methods based on contrast or on the application of radioactive isotopes to track the input materials.

Under certain neurological diseases, such as certain disorders associated with the accumulation of metabolites affected cells located in different areas of the nervous system, and the best result can be achieved by genetic modification of endogenous cells or by introducing selected cells of the present invention (or of the culture growth medium, or from medium to differentiation) in the fabric in large quantities diffuse way. In the nervous system, these diseases can best be treated by intraventricular injections (using devices such as a catheter or needle of the appropriate size) (especially in the early stages of development), which make possible diffuse modification of endogenous cells or diffuse engraftment selected cells isolated from the growth medium and/or media is La differentiation. However, this also applies to the injection of the cells into the bloodstream for the same purpose. However, in relation to any breach, affecting multiple organs or diffuse organism (e.g., disorders associated with the accumulation of lysosomes, hemoglobinopathy, muscular dystrophy), cells isolated from the growth medium and/or environment for differentiation, can also preferably be injected directly into the bloodstream and/or visceral organs such as liver, kidneys, intestines, spleen, adrenal gland, pancreas, lungs and thymus, using endoscopic control and any such catheter devices of appropriate size, which makes it possible to diffuse the engraftment of the cells throughout the body, as well as specific introduction and infiltration of cells in the selected organs.

Example 11: the delivery of cells by injection into the blood current and the circulatory system

Disease of one organ systems can be treated with genetically modified cells from other organ systems. Also, in some cases it may become evident that the selected cells can integrate and differentiate yourself in vivo in sufficient quantities, if they are entered in arterial, venous or hepatic blood current after culturing in growth environments and/or environments for different the programme. The present invention extends to this approach. In the treatment of diffuse muscle disorders (e.g. muscular dystrophy), organs, tissues or blood (e.g., hereditary spherocytosis, sickle cell anemia, other hemoglobinopathy, and so on) can use, for example, injection of cells isolated from the growth medium or media for differentiation in a patient, in particular, in the circulatory system of the patient. I believe that this approach also facilitates ischemic injuries such as myocardial infarction, stroke and so on, as well as traumatic injuries of the brain and other tissues. For the practical implementation of the present invention is suitable injection of such cells obtained in accordance with this invention, directly into the bloodstream through a needle or catheter so that the cells were capable of "homing in the bone marrow, muscle, kidneys, lungs and/or any other system of organs and injection directly into the space of the bone marrow. Similarly, injections directly into the affected area with x-ray, ultrasound or fluoroscopic control, or without it, are also suitable for implementation in practice of the present invention.

How the selection of the selected cells suitable for the present invention include described by Zhao et al., 2006.

the preferred embodiment, genetic vectors, encoding the isoforms of numb and/or numblike include regulated promoters that are functionally associated with transgenes Numb or numblike.

In another preferred embodiment, the method of transfection is possible to choose from such methods of transfection, which provide temporary, not a permanent expression of isoforms of numb and numblike.

Example 12. Genetic modification, serve as example

It is expected that hundreds of diseases and clinical conditions can be treated and/or to facilitate using the methods of the present invention, including Canavan disease (ASP); disease Tay-Sachs (NEH); syndrome Lesch-Nyana (HRPT); Huntington's disease (NTT); mucopolysaccharidosis type VII; Niemann-pick disease type a and type b; disease Sandhoff (NEHU); Fabry disease (GLA); Niemann-pick disease type C (NPC1); disease Gaucher (GBA); Parkinson's disease (PARK2 and so on); disease background Hippel-Lindau, sickle cell anemia (RGR) and other thalassemia, and similar diseases, but not limited to. These transgenes can be an encoding section or part of the coding section of normal genes.

However, it should be understood that the scope of the present invention is not necessary to limit the above-described specific implementation options and examples. The invention can be implemented not only as specifically described, and it is the CoE will also remain within the scope of the attached claims.

Example 13: Serving as an example of the sequence of vector capable of transforming cells in pluripotent and expressing the nucleic acid sequence of long isoforms of Numb, Oct-4, Sox-2 and EmGFP under control sensitive to tetracycline promoters, is a (SEQ ID NO: 2):

Schematic map corresponding to the vector sequence given above, is shown in Figure 1.

The vector can be completely built using gene synthesis de novo or in part, by cloning of cDNA sequences Numb, Sox, and OCT3/4 in the position of LacZ in the vector pcDNA4tolacZ from Invitrogen. Similarly placed tetR gene in the vector Invitrogen pcDNA6/TR. Coding sequences mentioned genes are also suitable for cloning in the vector pcDNA4lacZ.

Alternatively, gene tetR can be transliterate in target cells separately by using the vector pcDNA6/TR, in combination with a vector comprising the sequence minus the tetR gene and its PCMV-promoter.

Similarly, you can use the set of vectors until there is not going to be the elements similar to the elements included in the above sequence. This is can reduce the likelihood of competition promoters. It is clear that instead of promoters that are sensitive to tetracycline, you can use other promoter elements, depending on the conditions.

Example 14. It is expected that the intravenous and other introduction pluripotent stem cells, obtained as described in this document the methods (or other published methods), one or more times can provide the body cells to replace, and that the result of such introduction may be the increase in life expectancy or improve the health of a patient suffering from age-related aging.

Example 15. Obtaining gametes

This invention extends to obtaining gametes from multipotent, pluripotent and/or self-renewing stem cells, obtained as described in this document or in accordance with other published methods). The receipt of such germ cells may be useful for the treatment of infertility and obtain embryos in vitro (e.g. Hubner et al., 2003; Kehler et al., 2005; Nayernia et al., 2006a; Nayernia et al., 2006b; Drusenheimer et al., 2007; Moore et al., 2007 and so on)

Example 16: the Creation of transgenic animals

The present invention extends to the creation of transgenic animals. As in the case of other pluripotent cells, pluripotent cells, obtained as described in this document the methods (or other published with the ladies), can be used to obtain transgenic animals by any known in the art method.

Example 17: building a therapeutic vectors

Examples of vectors based on retroviruses, which can be used include vectors derived from leukosis virus of mice, Malone, sarcoma virus of mice, Malone, rous sarcoma virus, FIV and HIV, but are not limited to. Appropriate expression vectors are vectors that can be used for transfection of DNA or RNA in eukaryotic cells. Such vectors include, but are not limited to, prokaryotic vectors, for example, bacterial vectors; eukaryotic vectors, for example, yeast vectors, and vectors based on mushrooms; vectors based on viruses, such as, but not limited to) the vectors based on lentiviruses, vectors based on adenoviruses, vectors based on adenoassociated viruses and vectors based on retroviruses.

Incapable of replication vectors pcDNA 6.2 GW/miR and pcDNA 6.2/EmGFP-Bsd/V5-DEST are examples of suitable expression vectors (Invitrogen) and allow you to Express the synthetic oligonucleotides (e.g., microRNAs) that have the ability to cleave the target sequence. These vectors include flanking sequences and looped sequence of the endogenous microRNA control of the Commissioner cutting designed microRNA of the longer transcript Pol II (pre-microRNA).

Alternatively, the inclusion of psi-sequence allows HIV therapeutic vector to compete with the natural genome of HIV for packaging into viral particles, also inhibiting the transmission of HIV.

By combining multiple sequences of microRNAs directed against a single target, increasing the likelihood of success in reducing expression of a target sequence. The sequence of the microRNA can be functionally associated with tissue-specific promoters such as the promoter EF-1 alpha, for any specific T-cell promoter or specific for macrophages promoter, ensuring expression in a desired cell types.

When using delivery vectors (DEST) based on lentiviruses from Invitrogen for gene expression obtained(received) in therapeutic vector(therapeutic vectors) becomes(be) able(able) to stable transfection as dividing and non-dividing cell types.

In a preferred embodiment, therapeutic vector(therapeutic vectors) contains multiple sequence synthetic oligonucleotides, under the control of one or more promoters to reduce the expression of CXCR4, CCR5 and/or any other cellular protein, which as known is but plays the role of coreceptor for HIV infection in target cells.

In one therapeutic vector (created in 2006) four sequences of microRNA, purposefully acting on the used CXCR4 and CCR5, were cloned into the vector pcDNA 6.2 GW/miR along with the sequences of the RNA traps that purposefully interact with TAR and RRE of HIV-2.

Genetic constructs can include the main part of the vector and transactivator, which regulates the promoter functionally linked to a heterologous nucleic acid sequences.

Another example of a suitable vector - vector-based retrovirus. Retroviruses are RNA viruses that contain RNA genome. Genes gag, pol and env are ornamented with sequences of the long terminal repeats (LTR). 5' and 3' LTR sequences that facilitate transcription and polyadenylation mRNA.

Vector-based retrovirus can provide adjustable transactivity element, a part of the internal landing ribosomes (IRES), marker selection and heterologous target gene, controlled regulated promoter.

Alternatively, the set of all sequences can be expressed under the control of multiple promoters. Finally, the vector-based retrovirus may contain operating in the CIS-position sequences necessary for reverse TRANS is reply and integration. When infection occurs, the reverse transcription of RNA into DNA, which effectively integrates into the host genome. The recombinant retrovirus of the present invention are genetically modified so that some of retroviral, infection natural genes of the virus have been removed and in some embodiments, the implementation replaced by a target sequence of nucleic acids for genetic modification of cells. Sequences can be exogenous DNA or RNA in its natural or modified form.

Example 18: how to create a therapeutic vector serving as an example

How to create a therapeutic vector(therapeutic vectors) include the methods presented in the Viral Power Lentiviral Expression Systems Manual from Invitrogen (incorporated by reference in this document). Briefly, the cartridge EmGFP-bsd clone as PmlI fragment-BlpI in vector pLenti6/R4R2/V5-DEST, while the cartridge miR-traps simultaneously transferred BP-reaction in pDONR221. Then the EF1a promoter and miR-trap hybrid Multisite LR reaction into the modified vector pLenti6/EmGFP-bsd/R4R2-DEST.

The sequence of vector pLenti6/R4R2/V5-DEST (SEQ ID NO: 1):

Serving as an example of the sequence of the cassette miR-trap (SEQ ID NO: 3):

Por the measures 19: modes of reproduction/proliferation of stem cells/precursor cells in vivo

In order to obtain large quantities of target cells, are relatively resistant 1) HIV and/or 2) HIV replication, and/or 3) HIV transcription, cell precursors/stem cells can be grown in modified according to the method of Dulbecco minimum essential medium (DMEM) supplemented with glutamine, beta-mercaptoethanol, 10% (vol) horse serum and recombinant human factor, leukemia inhibitory (LIF). LIF eliminates the need for the maintenance of progenitor cells/stem cells on feeder layers of cells (which can also be used) and is necessary for the maintenance of progenitor cells/stem cells in the undifferentiated state.

Example 20: Stem cells are collected from individuals, cells transferout therapeutic vectors, then prepared for transplantation by standard methods, with HLA-typing and correspondence or without it.

Example 21: Samples of umbilical cord blood is obtained from the cord blood Bank. The cells are then transferout therapeutic vector with useful sequences, then prepared for transplantation by standard methods, with HLA-typing and correspondence or without it.

Example 22: Examples of sequences of synthetic oligonucleotides that are suitable for inclusion in a therapeutic vector

Infusion is her invention includes any sequence of synthetic oligonucleotides, successfully reducing the protein expression of target sequences >70%.

The present invention also applies to any sequence of synthetic oligonucleotides, successfully reducing the ability of target cells to support the replication of HIV >70% or less, but therapeutic, or viral activity on HIV >70% or less, but therapeutic class.

Examples of microRNA sequences include the sequence of the microRNA obtained using the algorithm IVGN (Invitrogen). The sequence of the microRNA, purposefully affecting gene CXCR4 include upper chain: 5'-TGCTGATACCAGGCAGGATAAGGCCAGTTTTGGCCACTGACTGACTGGCCTTACTGCCTGGTAT-3' (SEQ ID NO: 4) and the lower chain: 5'-CCTGATACCAGGCAGTAAGGCCAGTCAGTCAGTGGCCAAAACTGGCCTTA TCCTGCCTGGTATC-3' (SEQ ID NO: 5); and the upper chain: 5'-TGCTGTGACCAGGATGACCAATCCATGTTTTGGCCACTGACTGACATGGAT TGCATCCTGGTCA-3' (SEQ ID NO: 6) and the lower chain: 5'-CCTGTGACCAGGATGCAATCCATGTCAGTCAGTGGCCAAAACATGGATTGGTCATCCTGGTCAC-3' (SEQ ID NO: 7).

Similarly, the sequence of the microRNA, purposefully affecting gene CCR5, include upper chain: 5'-TGCTGATCGGGTGTAAACTGAGCTTGGTTTTGGCCACTGACTGACCAAGCTCATTACACCCGAT-3' (SEQ ID NO: 8) and the lower chain: 5'-CCTGATCGGGTGTAATGAGCTTGGTCAGTCAGTGGCCAAAACCAAGCTCAGTTTACACCCGATC-3' (SEQ ID NO: 9); and the upper chain 5'-TGCTGATAGCTTGGTCCAACCTGTTAGTTTTGGCCACTGACTGACTAACAGGTGACCAAGCTAT-3' (SEQ ID NO: 10) and the lower chain: 5'-CCTGATAGCTTGGTCACCTGTTAGTCAGTCAGTGGCCAAAACTAACAGGTTGGACCAAGCTATC-3' (SEQ ID NO: 11).

Example 23: Examples of RNA-trap, suitable for inclusion in a therapeutic vector

The present invention also applies to any sequence of traps, successfully reducing the ability of target cells to support the replication of HIV >70% or less, but therapeutic, or viral activity on HIV >70% or less, but therapeutic class.

An exemplary sequence TAR-trap is (SEQ ID NO: 12) gtcgctctgcggagaggctggcagattgagccctgggaggttctctccagcactagcaggtagagcctgggtgttccctgctagactctcaccagtgcttggccggcactgggcagacggctccacgcttgcttgcttaaagacctcttaataaagctgc (Browning et al., 1999)

An exemplary sequence RRE-trap is (SEQ ID NO: 13)

Example 24: Flanking sequences, ensuring the stability of the RNA traps

Examples of suitable flanking sequences for RNA traps:

Previously it was demonstrated that sequence-trap, flanked studs on both sides, 19 nucleotides (ntds) RNA U6 5' side and 3'-stem, immediately preceding the terminator poly-U for POLIII, have a higher stability. It is expected that this scheme will protect against 3'-5' their endonuclease attack and reduce the possibility of the interaction of 3'-trailer with a loop RNA-insert. Since there are only the first 3/4 of the tRNA sequence, the 5' end of the insert must be protected, and export from the nucleus must be p editframe (Good et al., 1997).

Example 25: the Introduction of a therapeutic vector to the host

In a preferred embodiment, stem cells/precursor cells of the blood and target cells transferout therapeutic vector(therapeutic vectors) (or related therapeutic virus) in vivo by administration of a therapeutic vector(therapeutic vectors) in the blood, tissue or bone marrow of the host and so on, the Best result can be achieved by modification of a large number of endogenous target cells and stem cells/precursor cells. This can be done by using the device of the appropriate size, similar to the catheter or needle for injection of therapeutic vector(therapeutic vectors) in the system of venous or arterial circulation. In a preferred embodiment, the virus pseudohypericin glycoprotein shell VSV-G env proteins natural HIV-1.

Example 26: the Introduction of genetically modified cells into the host

Gamecity, such as Mature T-lymphocytes in peripheral blood, monocytes, macrophages, precursor T-cells, precursor cells of macrophages-monocytes and/or pluripotent hematopoietic stem cells (e.g., detectable in cord blood and occupying areas of the bone marrow), as well as other stem cells/glue the key precursors can be transliterate using therapeutic vector(therapeutic vectors) in vitro. The appropriate concentration of therapeutic vector(therapeutic vectors) can be concentrations in accordance with Browning et al., 1999. Then the cells grow(multiply) in vitro and then transferred into the host through the introduction of cells into the system venous or arterial circulation via an intravenous needle or catheter. Further cells, transfetsirovannyh therapeutic vectors capable of "homing in the bone marrow and other tissues.

It is clear that is described in this document, examples and embodiments of presents, for illustrative purposes only, and that in the light of qualified specialists in this field will be offered various modifications or changes, and they must be included in the essence and scope of this application and scope of the attached claims. All publications, patents and patent applications mentioned herein are hereby incorporated by reference in their entirety in all respects.

Example 27: Examples expressed or target transgenes used in this invention

Any sequence of the transgene, effective with the implementation of the present invention, suitable for use in the present invention. Suitable nucleotide sequence can be selected from any variety until then, the eye will not be obtained the desired cells or may not be the desired behavior. Similarly, the way to identify such sequences - letters or lower, or upper case - does not imply a specific kind. The following sequences stored in the database of NCBI (shown in accordance with an access number), are examples of sequences that are referenced above in this application. They also are examples of sequences encoding specific transgene (cds), suitable for use in the present invention, but in no case do not limit the practical implementation of the present invention:

cardiotrophin 1: 43030 (SEQ ID NO: 18):

CNTF:BC074964 (SEQ ID NO: 19):

GP130:NM_175767 (SEQ ID NO: 20):

IL6:BC015511(SEQ ID NO: 21):

HOXB4:NM_024015 (SEQ ID NO: 22):

IL6R:NM_000565 (SEQ ID NO: 23):

IL11:NM_133519(SEQ ID NO: 24):

LIF:NM_002309 (SEQ ID NO: 25):

LIFR:NM_002310 (SEQ ID NO: 26):

STATS:NM_003150 (SEQ ID NO: 27):

NUMB: AF171938 (SEQ ID NO: 28):

AF171939 (SEQ ID NO: 29):

AF 171940 (SEQ ID NO: 30);

AF171941(SEQIDNO:31):

Numblike:NM_00475 (SEQ ID NO: 32):

NANOG:NM_024865 (SEQ ID NO: 33):

Oncostatin (08M):NM (SEQ ID NO: 34):

OSMR:NM_003999 (SEQ ID NO: 35):

OCT3/4 (POU5F1):NM_203289 (SEQ ID NO: 36):

NM_002701 (SEQ ID NO: 37):

SOX2:NM_003106 (SEQ ID NO: 38):

FGF4:NM_002007 (SEQ ID NO: 39):

Gata2:NM_032638 (SEQ ID NO: 40):

Gata3:NM_001002295 (SEQ ID NO: 41):

Gata4:BC101580 (SEQ ID NO: 42):

Gata5:BC117356 (SEQ ID NO: 43):

Gata6:NM_005257 (SEQ ID NO: 44):

HNF1:NM_000458 (SEQ ID NO: 45):

NM_012669 (SEQ ID NO: 46):

HNF3:X74936 (SEQ ID NO: 47):

HNF3gammaX74938M (SEQ ID NO: 48):

HNF3betaX74937 (SEQ ID NO: 49):

HNF3G:AH008133 (SEQ ID NO: 50):

HNF3A:AH008132(SEQIDNO: 51):

HNF4alpha:NM_008261 (SEQ ID NO: 52):

HNF4a:NM_022180 (SEQ ID NO: 53):

HNF6:U95945 (SEQ ID NO: 54):

HLXB9:NM_001096823 (SEQ ID NO: 55):

(SEQ ID NO: 56)

NM_005515 (SEQ ID NO: 57):

Lbx1:NM_006562 (SEQ ID NO: 58):

Lrnx1b (SEQ ID NO: 59):

Neurogenin(NEUROG1):NM_006161 (SEQ ID NO: 60):

Neurogenin(NEUROG2):NM_024019 (SEQ ID NO: 61):

Neurogenin(NEUROG3) (SEQ ID NO: 62):

MASH1:NM_004316 (SEQ ID NO: 63):

MyoD:NM_010866 (SEQ ID NO: 64):

Myf5:NM_005593 (SEQ ID NO: 66):

Myf6:NM_002469 (SEQ ID NO: 67):

Ifrd1:NM_001007245 (SEQ ID NO: 68):

Mef2A:NM_013172 (SEQ ID NO: 69):

Myogenin:NM (SEQ ID NO: 70):

Nkx2.2:NM_002509 (SEQ ID NO: 71):

Notch

Notch1:NM_017617 (SEQ ID NO: 72):

NOTCH2 IS:NM_024408; NM_010928.

NOTCH3:NM_000435 (SEQ ID NO: 73):

Nurr1:NM_006186 (SEQ ID NO: 74):

NOV(CCN3):NM_002514 (SEQ ID NO: 75):

OLIG1:NM_138983 (SEQ ID NO: 76):

OLIG2:NM_005806 (SEQ ID NO: 77):

Pdx1:NM_000209 (SEQ ID NO: 78):

Pet1(FEV):BC138435; NM_017521 (SEQ ID NO: 79):

Phox2a:NM_005169 (SEQ ID NO: 80):

Phox2b:NM_003924 (SEQ ID NO: 81):

Pit1:NM_000306 (SEQ ID NO: 82):

PITX3:NM_005029 (SEQ ID NO: 83):

RUNX1:NM_001001890 (SEQ ID NO: 84):

Runx2:NM_001015 051 (SEQ ID NO: 85):

Shh:NM_000193 (SEQ ID NO: 86):

Sox9:NM_000346 (SEQ ID NO: 87):

Sox17:NM_022454 (SEQ ID NO: 88):

DLX2:NM_004405 (SEQ D NO: 89):

DLX5:NM_005221 (SEQ ID NO: 90):

HES1:NM_005524 (SEQ ID NO: 91):

FGF8:NM_006119 (SEQ ID NO: 92):

PITX2:NM_000325 (SEQ ID NO: 93):

REST4:DQ644039 (SEQ ID NO: 94):

CREB-svyazyvayuscyego:NM_ 134442 (SEQ ID NO: 95):

Zfp488:NM_001013777 (SEQ ID NO: 96):

Foxa2:NM_021784 (SEQ ID NO: 97):

Rnx

REN:NM_000537 (SEQ ID NO: 98):

dHAND(HAND2):NM_021973 (SEQ ID NO: 99):

aspartoacylase (Canavan disease) (ASPA):NM_000049 (SEQ ID NO: 100):

hexosaminidase (NEH):NM_000520 (SEQ ID NO: 101):

syndromes-Nyana (HRPT):NM_000194 (SEQ ID NO: 102):

Huntingtin; NM_010414;

GUSB; NM_000181 (SEQ ID NO: 103):

NPC1:NM_000271; NM_006432.

hexosaminidase:N_000521 (SEQ ID NO: 104):

galactosidase, alpha(GLA):N_000169 (SEQ ID NO: 105):

Kislaya-glucosidase(GBA):N_000157 (SEQ ID NO: 106):

supressoru background Hippel-Landau(VHL):N_000551 (SEQ ID NO: 107):

Betaglobin(HBB):N_000518 (SEQ ID NO: 108):

PARK2:NM_013988 (SEQ ID NO: 109):

The contents of all cited in parentheses publications and the following U.S. patents are noted and incorporated by reference in their entirety: 7211247, 5677139, and 6432711 5453357, 05593875, 05783566, 5928944, 05910488, 05824547.

1. The method of obtaining pluripotent cells, comprising the steps are:
- choose replyreport somatic cells;
introduce or sverkhekspressiya proteins or sequences containing one or more of the "long" (Prr+) isoforms numb, Oct4, Sox2 and Nanog;
- grow cells in a nutrient medium containing cytokines; and
- support cells in these culture conditions until, until you reach the desired number of pluripotent cells.

2. The method according to p. 1, characterized in that use(s) of nucleic acid(s) - acid(s) or protein(proteins) contains(at):
a. Prr+ Numb isoforms;
b. Prr+ Numb isoforms and one of: LIF, LIF gene with the activity, LIFR, oncostatin M, receptor oncostatin M, cardiotrophin-1 and CNTF;
c. Prr+ isoforms of Numb and Notch;
d. Prr+ Numb isoforms, OCT3/4, SOX2 and Notch;
e. Prr+ Numb isoforms, OCT3/4, SOX2, NANOG and Notch;
f. Prr+ Numb isoforms, OCT3/4, SOX2, NANOG and TRANS is Yong with LIF-activity;
g. Prr+ Numb isoforms, OCT3/4, SOX2, NANOG and multiple transgenes with LIF-activity;
h. those that are selected from the long coding Prr+ Numb isoforms, NANOG, OCT3/4, SOX2, transgenes with Notch activity, Hoxb4, FGF-4, LIF, LIFR, CNTF, oncostatin, receptor oncostatin, cardiotrophin-1, IL-6, IL6R, Hyper-IL-6, IL-11, gp130 and other transgenes with LIF-activity;
i. Prr+ Numb isoforms and is selected from LIF, LIFR, oncostatin-M, cardiotrophin-1, IL-11, IL-6, IL6R, Hyper-IL-6, LIFR, gp130 and FGF-4; and one or more of OCT3/4, SOX2, NANOG and FGF-4;
j. those that are selected from LIF, LIFR, oncostatin-M, cardiotrophin-1, IL-11, IL-6, IL6R, Hyper-IL-6, LIFR, gp130 and FGF-4; and one or more of OST/4, SOX2, NANOG and FGF-4;
k. Prr+ Numb isoforms and FGF-4;
l. FGF-4.

3. The method according to p. 2, characterized in that the "long" (PRR+) isoforms of numb, the coding sequence of the nucleic acid or protein:
a. complement other sequences of nucleic acids or proteins, including the nucleic acid sequences or proteins from a group comprising encoding the human LIF, oncostatin M, cardiotrophin-1, IL-11, IL-6, IL6R, Hyper IL-6, LIFR, gp130, OST (OST), NANOG, SOX2 and/or FGF-4; or
b. replace the transfection of other nucleic acid sequences or proteins, including the nucleic acid sequences or proteins from a group comprising encoding the human LIF, oncostatin M, cardiotrophin-1, IL-11, IL-6, IL6R, Hyper IL-6, LIFR, gp130, OST (OST), NANOG, SOX2 and/or FGF-4.

4. The method according to p. 1, distinguished by the different topics the selected cell to modify the expression:
A. telomerase that changes the life of the cell;
b. product of a gene which is absent in humans;
c. nucleic acid sequence that encodes a protein selected from aspartoacylase (ASP), HRPT, HTT, NPC1, GBA, PARK2, VHL, beta-glucuronidase, hexosaminidase AND (NEH), hexosaminidase IN (NEHU), HRPT, HTT, alpha-galactosidase (GLA), acid beta-glucosidase (GBA), the tumor suppressor von Hippel-Lindau (VHL), beta-globin (RGR), NPC1, PARK2.

5. The method according to p. 1, wherein the selected cell or its progeny to modify the expression:
a. significant sequences of nucleic acids;
b. synthetic oligonucleotides, complementary RNA (siRNA), small RNA, forming a hairpin (shRNA), small interfering RNA, antisense RNA;
c. nucleic acid sequence or protein to slow the infection by the virus;
d. nucleic acid sequence or protein that plays(his) cells and/or their progeny are less able to support viral replication;
e. nucleic acid sequence or protein that plays(his) cells and/or their progeny are less able to support transcription of the virus;
f. synthetic oligonucleotide directed against the co-receptor for human immunodeficiency virus;
g. RNA-trap;
h. psi-p the coherence of HIV;
i. nucleic acid sequence or protein that plays(his) cells and/or their progeny resistant to the disease.

6. The method according to p. 1, characterized in that the specified selected cell and/or her offspring incubated in a nutrient medium containing the cytokines selected from the group comprising EGF, bFGF, LIF, steel factor, IL-6 and Hyper-IL-6, IL-7, oncostatin M, cardiotrophin-1 and other cytokines that enhance growth.

7. The method according to p. 1, characterized in that the specified selected cell and/or her offspring differenceyou by overexpression or by introducing nucleic acid(s) acid(t) or protein(protein), corresponding to one or more transcription factor normally expressed in the target cells.

8. The method according to p. 1, characterized in that the said cells and/or their offspring additionally sverkhekspressiya transcription factor proteins or nucleic acids selected from the group including:
a. Mash1 (Ascl1), or part of them;
b. MyoD, myogenin, Myf5, Myf6, Mef2, myocardin, Ifrd1, a transcription factor in muscle cells and/or a sequence encoding a specific for the cells of the muscle-type bHLH or part thereof;
c. Foxa2, Sox17, HLXB9 and/or Pdx1 or parts thereof;
d. hepatic nuclear factor (HNF)-1, HNF-3, HNF-4, HNF-6 and/or CREB-binding protein or part thereof;
e. Runx1/AML1 and/or NOV (CCN3) or part thereof;
f. Sox9, CREB-binding protein, Gata6 and/or Run2 or parts thereof;
g. OLIG1, OLIG2 and/or Zfp488 or parts thereof;
h. MyoD, myogenin, myocardin, Myf5, Myf6, Mef2A, Gata4, Gata5 and Gata6 or parts thereof;
i. Gata4, Gata5 and/or Gata6 or parts thereof;
j. Myocardin or part;
k. Myogenin and MyoD or parts thereof;
l. Runx2 or part;
m. Mash1 (Ascl1), Ngn2, Nurr1, Lmx1b and/or Ptx-3, or part thereof;
n. Mash1 (Ascl1), Phox2b, Lmx1b, Nkx2.2, Pet1, Gata2, Gata3 and/or Pet1 or parts thereof;
o. Mash1 (Ascl1), Phox2a and/or REST4, or part thereof;
p. Mash1 (Ascl1), PITX2, Dlx2, Dlx5, synthetic oligonucleotides, specifically affecting HES1, Phox2a and/or REST4, or part thereof;
q. Mash1 (Ascl1), Phox2a, Phox2b, dHand, Gata2 and/or Gata3 or parts thereof;
r. Mash1 (Ascl1), Nurr1, REN, neurogenin 1, neurogenin 2, neurogenin 3, Mash1, Phox2b, Phox2a, dHand, Shh, FGF8, Lmx1b, Nkx2.2, Pet1, Lbx1, Rnx, Gata3 and/or antisense RNA Hes1 or parts thereof;
s. PRR-Numb or part thereof; or
t. Numblike or part.

9. The method according to p. 1, characterized in that the said cells and/or their offspring incubated in differentiating medium.

10. The method according to p. 1, characterized in that the said cells and/or their offspring incubated in differentiating medium including one or more means selected from the group including:
a. retinoic acid, neurotrophin 3 (NT3), nerve growth factor (NGF), a growth factor derived from glia cell line (GDNF) and/or interferon-γ (IFN-γ), hexamethylene-bis-acrylamide, dimethyl sulfoxide (DMSO), fetal bovine serum (FBS), normal bovine serum (NBS), retinoic acid, kondicionirovanie the environment for cardiomyocytes, growth factor vascular endothelial (VEGF), LIF, thrombopoetin, colony stimulating factor, M-CSF (CSF-1), GMCSF, IL-7, a cytokine that stimulates CD4+ T-cell differentiation, butyric acid sodium, activin A, the growth factor of the epidermis, the main growth factor, fibroblast, noggin, insulin-like growth factor and nicotinamide;
b. retinoic acid, neurotrophin 3 (NT3), nerve growth factor (NGF), a growth factor derived from glia cell line (GDNF) and/or interferon-γ (IFN-γ);
c. hexamethylene-bis-acrylamide or dimethylsulfoxide;
d. fetal bovine serum (FBS);
e. normal bovine serum (NBS), dimethyl sulfoxide, retinoic acid and/or air-conditioned environment for cardiomyocytes;
f. growth factor vascular endothelial (VEGF), thrombopoietin and colony-stimulating factors, corresponding to the type of target cells;
g. LIF, neurotrophin 3 (NT3) and/or nerve growth factor (NGF);
h. colony-stimulating factor, optional M-CSF (CSF-1), GM-CSF, IL-7, or a cytokine that stimulates CD4+ T-cell differentiation; and
i. butyric acid sodium, activin A, retinoic acid, growth factor, epidermal, the main growth factor, fibroblast, noggin, insulin-like growth factor II and nicotinamide.

11. The method according to p. 1, characterized in that the protein, nucleic acid, or a means is present for screening in relation to its ability to induce feneticheskii change the value or differentiation of the selected cells in the target cell population.

12. The method according to any of paragraphs.1-11, characterized in that the specified cell and/or its progeny cultured in three-dimensional or two-dimensional substrate, and these cells and/or their progeny grown in cell-free body or cell-free tissue or cells, or their progeny used in combination with the technology of inkjet printing to tissue engineering.

13. The method according to p. 1, characterized in that it is carried out in vivo.

14. The method according to p. 1, characterized in that use electroporation, liposomes, nanocapsules, nanogranules and/or other approaches that do not accept retroviral/lentiviral transfer Association, or any random replacement of the genome of the specified cells, including site-directed mutagenesis.

15. Pluripotent cell derived from a patient or donor, for use in areas using cell therapy, gene therapy or in the livestock sector, obtained using recombinant methods, by PP.1-14.

16. The use of cell population under item 15 in screening based on cell specific marker, transgenic marker expression under the control of cell-specific promoters or transgenic marker expression under the control of promoters that are associated with neurotransmitter.

17. A method of treating a patient with a condition or disease:
a. facilitate correction g is nationsi due to failure;
b. dependent on the expression of genes responsible for susceptibility;
c. facilitate renewed cell proliferation; or
d. characterized as dysplasia, cancer, or aberrant behavior of cells
including the introduction of the indicated patient a therapeutically effective amount of cells under item 15.



 

Same patents:

FIELD: biotechnology.

SUBSTANCE: biological sensor is described, as well as the method of creation of a biological sensor using thin films based on grapheme, graphene oxide or single-walled or multi-walled carbon nanotubes. The biological sensor comprises a substrate, a metal film on the surface of which the intermediate bonding layer is applied, made of a thin film of graphene or a thin film of graphene oxide or a thin film of carbon nanotubes. On the surface of the intermediate bonding layer the biospecific layer is adsorbed conformally and uniformly. The biospecific layer can be used as a layer of molecules of the binding partner of the analyte or a layer of a complex of biological molecules capable of interacting chemically with the molecules of the binding partner and forming a complex with them. Also the biospecific layer can be used as the hydrogel layer, on which the binding partner molecule and/or complex of binding partner molecules and biological molecules is deposited, which can form a chemical bond with the binding partner molecules. The described method of obtaining the biological sensor comprises the stages of applying a metal film, an intermediate bonding layer and a biospecific layer.

EFFECT: high sensitivity of the biosensor in combination with high biospecificity, expanding the range of application of the device, protection of the metallic film from the effects of the environment, the ability to detect large biological objects.

27 cl, 9 dwg

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biophysics. Claimed are methods of determining space-time distribution of proteolytic enzyme activity in heterogeneous system, in accordance to which: provided is system in vitro, which contains sample of blood plasma, whole blood, water, lymph, colloidal solution, crystalloid solution or gel, and proteolytic enzyme or its precursor; fluorogenic, chromogenic or luminescent substrate for said enzyme id added; space distribution of signal of released substrate label is registered at specified time moments and space-time distribution of proteolytic enzyme activity is obtained by solving reverse problem of type "reaction-diffusion-convection" taking into account label binding with medium components. Also described is device for realisation of methods in accordance with claimed invention and method of diagnosing hemostasis disorders, based on their application.

EFFECT: invention can be further applied in the study of blood coagulation system and diagnostics of diseases associated with blood coagulation disorders.

22 cl, 6 dwg

FIELD: biotechnologies.

SUBSTANCE: invention relates to the field of gene engineering, specifically, to development of test systems based on fluorescent probes, which may be used as substrates for phospholipases A1 and A2. The probe with the name 1-[3-(2,4-dinitrophenylamino)propanoyl]-2-[8-(9-anthryl)-7E-octenoyl)]-sn-glycero-3-phosphocholine represents an analogue of phosphatidyl choline witth modified fatty acid chains, one of which carries the fluorescent group, and the other one - grouping-suppressor of fluorescence. The fluophor-suppressor pair is: 9-anthryl vinyl - 2,4-dinitrophenyl. The produced probe is included into the test system to determine activity of A2 phospholipase, group IIA, which also includes a micellar matrix, a buffer solution, diglyme and A2 phospholipase of apitoxin as standard.

EFFECT: invention makes it possible to determine activity of A2 phospholipase in blood serum in case of acute pathological processes, in tissue and cell extracts.

2 cl, 3 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: phospholipide fluorescent probe characterised by the following name 1-[13-(4,4-difluoro-1,3,5,7-tetramethyl-4-bora-3a,4a-diaza-s-indacen-8-yl)tridecanoyl]-2-(10-{[(2-hydroxynaphthyl-1)azophenyl-4]azophenyl-4}decanoyl)-sn-glycero-3-phosphocholine, is used in the test system to determine activity of A2 phospholipase, group IIA (secFLA2(IIA)) in blood serum, which also contains vesicular and phospholipide matrix for inclusion of a probe, containing phosphatidyl choline, lisophosphatidyl choline and phosphatidyl glycerine, a buffer solution and A2 phospholipase of apitoxin as standard.

EFFECT: invention makes it possible to reliably detect activity of secFLA2 in human blood serum in clinical conditions.

2 cl, 5 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: enzyme immunoassay system for determining a probable time of the introduction of type 1 human immunodeficiency virus (HIV-1) infection, including group O HIV-1 in human serum (plasma). The system contains an immunosorbent of type 1 human immunodeficiency virus antigens (env HIV-1 and group O HIV-1), an assay diluent (PPC) and detecting reagents (conjugates, chromogen/substrate). The invention refers to a method for determining the probable time of the introduction of type 1 human immunodeficiency virus (HIV-1) infection, including group O HIV-1 in human serum (plasma) by analysing patient's blood serum with using the above enzyme immunoassay system.

EFFECT: invention enables the fast and simple determination of the probable time of the introduction of the HIV infection.

2 cl, 4 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to computer method, which uses biochemical databases in design of novel protein compounds. Design is performed by operator by means of specially written software PROTCOM basing on application of database of protein pentafragments. Design process consists in specifying and introduction into PROTCOM software of initial sequence of five amino acids (specified initial pentafragment) and written in binary system ten-digit number, which describes secondary structure of specified initial pentafragment. Search of said sequence is performed in database fold with the number, corresponding to specified ten-digit number. Search is performed until specified initial pentafragment is found in database. After its finding, said pentafragment is considered to be the first of possible number N of pentafragments of designed primary protein structure, and it, together with ten-digit number of fold, describing its secondary structure, is recorded into the programme working file. After that, secondary structures of each following number of (N-1) pentafragments are specified by introduction of the same or changed ten-digit number, describing secondary structure of the previous pentafragment into the programme, and search is performed in database of pentafragments, containing four amino acids of each of (N-1) pentafragments, recorded in working file, and one new one. When such pentafragments are found, one of new amino acids is selected and linked to four last amino acids of the previous pentafragment, new amino acid and ten-digit number of fold, describing secondary structure of each found pentafragment are recorded into working file. Obtained in working file sequence of amino acids, with corresponding description of its secondary structure, is considered to be designed primary structure of protein.

EFFECT: claimed method of designing primary structure of protein considerably simplifies and accelerates the task of designing proteins with specified secondary structure.

5 dwg, 21 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and a method of detecting O-glycosylated proteins in cell homogenates that are prepared for proteomic and phosphoproteomic analysis. The disclosed invention can be used to perform proteomic and phosphoproteomic analysis. The method involves performing two-dimensional electrophoresis, followed by identification of spots using MALDI-TOF spectroscopy and phosphoproteomic techniques. The cell homogenates are desalinated by gel-penetrating chromatography or dialysis. The cell homogenates are subjected to glycosylation based on a β-elimination principle in a 0.05 M NaOH solution which contains 38 mg/ml NaBH4 for 16 hours at +45°C, followed by addition of cyanine dye JC-1 in concentration of 10-6 M. The cell homogenates are incubated for 15 minutes at room temperature. The homogenates are concentrated by precipitation with 50% acetone, subjected to two-dimensional electrophoresis to form electrophoregrams which are analysed for fluorescence when illuminated on a blue light transilluminator with an amber light filter, which visually appears in form of strips which are fluorescent in the dark. Said strips are extracted from the gel and used to perform proteomic or phosphoproteomic analysis. Further analysis of intensity and arrangement of the extracted strips is performed by comparing silver nitrate-coloured electrophoregrams of homogenates before and after a deglycosylation procedure.

EFFECT: disclosed invention enables to identify proteins which change their composition or degree of O-glycosylation as a result of any physiological action on the cell.

5 dwg

Anti-mif antibodies // 2509777

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and immunology. Invention discloses a monoclonal antibody and its antigen-binding parts which specifically bind the C-end or central part of the macrophage migration inhibitory factor (MIF). The anti-MIF antibody and its antigen-binding part further inhibit biological function of the human MIF. The invention also describes an isolated heavy and light chain of immunoglobulins obtained from anti-MIF antibodies, and molecules of nucleic acids which encode such immunoglobulins.

EFFECT: disclosed is a method of identifying anti-MIF antibodies, pharmaceutical compositions containing said antibodies and a method of using said antibodies and compositions for treating diseases associated with MIF.

22 cl, 14 dwg, 16 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes a detection method of proteins in amyloid state, in which a specimen of lysate of yeast culture or tissue of a mammal is obtained, ionic detergent is added to the specimen, proteins are concentrated in an amyloid shape on a cellulose acetate membrane, and they are detected by means of aptomeres, their conjugates or antibodies specific to amyloid shape of proteins. Besides, a set for detection of proteins in amyloid state is proposed.

EFFECT: invention can be used in medicine for diagnostics of amyloid diseases.

9 cl, 6 dwg, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method involves preparation of a solution for dilution of serum, preparation of serum of donors for negative control with further dilution by means of a dilution solution; besides, serum does not include antibodies to toxoplasma, cytomegalovirus, viruses of herpes simplex and rubella, HBsAg, antibodies to HIV-1,2, to hepatitis C virus, preparation of serum of donors for positive control with its further dilution with a dilution solution; besides, serum includes antibodies to toxoplasma, cytomegalovirus, viruses of herpes simplex and rubella; introduction of liquid control specimens to pits of a board, lyophilic drying of positive and negative control, marking of positive control in red, and negative control in green.

EFFECT: invention allows obtaining general-purpose control specimens for all test systems for determination of an infection of TORCH group, which are incorporated in pits of a working board, which are user-friendly and safe.

1 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method provides placing a sperm cell drop and a culture medium drop in the Petri dish at a distance from each other of no more than 5 cm, coupling the drops with a viscous medium strip having a viscosity of 1-4 Pa·s, incubating the dish with its content for 30-90 min in the environment simulating natural environment of the female cervical canal. Before placing into the Petri dish, the culture medium and the viscous medium is incubated until pH value of 7.2-7.6 is achieved.

EFFECT: method enables higher quality of sperm cells selection possessing the highest fertility ability for extracorporeal fertilisation.

11 cl, 7 dwg, 2 tbl

FIELD: medicine.

SUBSTANCE: invention refers to medicine, biotechnology and cell technologies. A method for differentiating pluripotent stem cells presenting a human cell line in cells expressing markers specific for a formed endoderm line involves preparing the pluripotent stem cells in a medium differing by the fact that it is free from activin A and contains GDF-8 for the period of time adequate to differentiate the pluripotent stem cells in the cells expressing the markers specific for a formed endoderm line.

EFFECT: invention can be used in medicine for transplantation applications.

14 cl, 19 tbl, 27 dwg, 24 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes oligopeptide versions extracted from protein RAB6KIFL (KIFL20A), which can induce cytotoxic T lymphocytes (CTL) consisting of a complex with molecule HLA-A*0201. Besides, the following has been considered: a pharmaceutical composition and an elimination method of cells expressing RAB6KIFL and HLA-A*0201, an exosome, an extracted antigen-presenting cell and a method for its induction, a pharmaceutical composition and a method of CTL induction, use of active ingredients as per this invention to obtain a pharmaceutical composition for cancer treatment, as well as a polynucleotide coding the oligopeptide as per this invention.

EFFECT: invention can be further used in therapy of diseases associated with RAB6KIFL.

13 cl, 6 dwg, 1 tbl

Brewage method // 2531522

FIELD: food industry.

SUBSTANCE: invention relates to the field of food industry and represents a brewage method involving thermostable protease addition to the wort after the latter filtration but before cooking; protease thermostability means that such protease activity accounts for at least 70% of its activity measured in the following way: protease is diluted till concentration equal to 1 mg/ml in an analytic buffer (containing 100 mmol of succinic acid, 100 mmol of HEPES, 100 mmol of CHES, 100 mmol of CABS, 1 mmol of CaCl2, 150 mmol of KCl, 0.01% Triton X-100) with pH conditioned to 5.5 with the help of NaOH; the protease is pre-incubated i) in ice and ii) for 10 minutes at a temperature of 70°C; the substrate in relation whereto protease displays activity is suspended in 0.01% Triton X-100: for reaction beginning protease is added in an amount of 20 mcl into a test tube and incubated in an Eppendorf thermomixer at 70°C, 1400 rpm during 15 minutes; the reaction is stopped by way of the test tubes placement into ice; the samples are centrifuged in a cold condition at 14000 g during 3 minutes; the supernatant optic density OD590 is measured; the obtained OD590 value of samples without protease is subtracted from the obtained OD590 value of samples treated with protease; protease thermal stability is determined by way of calculation of protease percentage activity in the samples pre-incubated at a temperature of 70°C relative to protease activity in the samples incubated in ice as 100%-activity.

EFFECT: invention allows to enhance colloidal stability of wort and beer as well as preserve the level of total nitrogen in wort and beer due to protease addition to filtered wort.

16 cl, 1 dwg, 17 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: invention refers to cell biology, cell transplantology and tissue engineering. A method for increasing the angiogenic activity of stromal cells of the fatty tissue in tissues and organs involves recovering the stromal cells of the fatty tissue, culturing the recovered cells in the presence of tumour necrosis factor-alpha in amounts of 5 or 100 ng/ml for 24-72 hours, and transplanting into the tissues or organs.

EFFECT: invention can be used for repairing the injured tissues and arresting an ischemia-related developing pathology.

3 cl, 11 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: inventions deal with a membrane, used as a substrate for growing cells of retinal pigment epithelium, its application for supporting cells and a method of inoculating the cells on such a membrane. The characterised membrane is non-biodegradable and porous, covered from at least one side with a glycoprotein-containing coating, with pores with a diameter approximately from 0.2 mcm to 0.5 mcm, with a density of membrane pores constituting approximately from 1×107 to 3×108 pores per 1 cm2, and hydraulic conductivity of the membrane higher than 50×10-10 m sec-1 Pa-1,and having the maximal thickness of 11 mm.

EFFECT: claimed inventions make it possible to obtain a transplant for treatment of age-related macular degeneration.

19 cl, 4 dwg, 6 ex, 3 tbl

FIELD: medicine.

SUBSTANCE: invention relates to biotechnology, cell technologies and tissue surgery. A method for preparing a smooth muscle cell culture consists in cutting a blood vessel fragment, grinding it to a piece size of no more than 2 mm in any dimension, and incubating the pieces in a culture flask having its bottom preliminarily scratched and containing a culture medium containing 10% embyo foetal serum for at least ten days, but no more than 24 days at 37°C in the CO2 incubator environment; the method differs by the fact that the above blood vessel fragment is an ascending thoracic aorta fragment cut during the coronary artery bypass surgery; before the incubation, the above pieces of the ascending thoracic aorta fragment are kept in the culture medium containing 0.1% collagenase for at least 30 minutes, but no more than 60 minutes at 37°C and then washed in the cell culture medium.

EFFECT: invention enables preparing the cells of the aortic tissue directly from the patient's vital tissues for transplantology applications.

3 dwg

FIELD: medicine.

SUBSTANCE: method involves photodynamic exposure on a Vero cell culture of HSV-1 and HSV-2 infected African green monkey's kidney, on samples containing HSV-1 and HSV-2 and on a virus progeny; if observing a decrease of virus titre from a reference by 2 and more of lg TCD50/0.1 ml in the cell culture, samples containing the viruses, and in the virus progeny, the anti-herpetic action is considered to be effective.

EFFECT: using declared method enables more accurate assessment in vitro of the efficacy of the photodynamic therapy to study the mechanisms of various PDT options for the purpose of the further prediction of the PDT efficacy in the herpes-infected patients.

3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented solutions relate to field of immunology. Claimed are: pharmaceutical, containing peptide, obtained from HIG2 or URLC10, capable of inducing cytotoxic T-lymphocytes (CTL) by formation of antigen-presenting complex with antigen HLA-A0206. Described are isolated antigen-presenting cell and CTL and methods for their induction. Antigen-presenting cell is induced by contact of cell, expressing antigen HLA-A0206, with peptide, obtained from HIG2 or URLC10. Cytotoxic lymphocyte is induced by contact of CD8-positive T-cell with antigen-presenting cell, presenting on its surface complex of antigen HLA-A0206 and peptide, obtained from HIG2 or URLC10. Characterised are method and means of immune anti-tumour response induction by introduction to patient of medication, which contains peptide, capable of inducing CTL.

EFFECT: claimed inventions can be used in treatment of cancer disease, characterised by higher expression of HIG2 or URLC10.

12 cl, 8 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology. Particularly, the present invention presents a method for providing the higher expression of markers associated with pancreatic endocrine cell line with the use a TGF-beta receptor agonist, such as activin A, activin B, activin C, GDF-8, GDF-11 or GDF-15.

EFFECT: present invention presents methods for stimulating the differentiation of pluripotent stem cells.

7 cl, 4 dwg, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to compounds of formula

wherein A1 represents N or C (A2); A2 represents H, F, Cl or CN; B1 represents H, OR1, SO2R1, NHR1, NHC(O)R1, F or Cl; D1 and E1 represents H or Cl; Y1 represents H, CN, NO2, F, Cl, Br, CF3, R17, OR17, SO2R17 or C(O)NH2; or Y1 and B1 together with atoms to which they are attached, represent 5- or 6-merous heteroarene having 2-3 nitrogen atoms, wherein heteroarene rings are unsubstituted or substituted by (O); G1 represents H; Z1 represents uncondensed phenylene substituted by OR41; R41 represents 6-merous heteroaryl having 1 N atom, wherein heteroaryl is condensed with R43A, R43A represents 5-merous heteroarene having 1 N atom; Z2 represents monocyclic 6-merous heterocycloalkylene having 1-2 N atoms and 0 double bonds; Z1A and Z2A are both absent; L1 represents -CH2-; Z3 represents R38 or R40; R38 represents uncondensed phenyl; R40 represents cycloalkyl, wherein cycloalkyl represents a monocyclic ring system having 3 to10 C atoms and 0 double bonds, cycloalkenyl, wherein cycloalkenyl represents monocyclic 6-merous ring having 1 heteroatom specified in a group consisting of O and N, and 1 double bond, wherein cycloalkenyl is uncondensed or condensed with R40A; R40A represents cycloalkane, wherein cycloalkane represents a monocyclic ring having 3-10 C atoms and 0 double bonds, or heterocycloalkane, wherein heterocycloalkane represents monocyclic 6-merous ring having 1 N atom and 0 double bonds (the rest substitutes are those as specified in cl. 1 of the patent claim). The invention also refers to compounds of formula

and a pharmaceutical composition containing an effective amount of the compound of formula (I) or (II) or its pharmaceutically acceptable salt.

EFFECT: compounds of formula (I) or (II) inhibiting the activity of anti-apoptotic Bcl-2 proteins.

6 cl, 5 tbl, 378 ex

Up!