Agent for imparting kokumi

FIELD: biotechnology.

SUBSTANCE: invention also relates to a nutritional composition comprising herbs and/or spices obtained from plants belonging to Labiatae, "miso" or tomato, the method of preparing a food product comprising the step of adding the agent for imparting Kokumi to food ingredients, food product obtained using the said method, and the method of enhancing taste and/or odour of the food product using the agent for imparting Kokumi.

EFFECT: invention enables to obtain the agent for imparting Kokumi γ-Glu-Nva, which exhibits enhanced activity CASR compared with the known analogues, and has the improved effect of imparting Kokumi.

20 cl, 1 dwg, 6 tbl, 4 ex

 

The technical field

The present invention relates to an agent for imparting kokumi and complex agent to give kokumi containing peptide active CaSR agonist. In addition, the present invention also relates to a seasoning containing peptide active CaSR agonist, at a concentration of not less than the specified level.

The level of technology

Requirements of consumers to the taste and appeal of food products in recent years has increased, for example, because of the diversity of food habits of people. In this regard, the taste and appeal of food in a conventional manner expressed through the five basic tastes - sweet, salty, sour, bitter and umami ("meat" taste)but correspondingly increases the need to create a new agent, able to give food a wonderful kokumi. Kokumi refers to the taste, which cannot be expressed mentioned five basic tastes, because it provides additional sensations to the basic tastes, such as density, weight (fullness), continuity and harmony (approx. "Kokumi"aboutcorresponds to the term "mouthfeel" -"mouth feel").

On the other hand, the calcium-sensing receptor (CaSR) is also called calcium receptor, and signaling from this receptor can control the number is about biological functions in living organisms, therefore, substances active CaSR agonist, can be used as agents for imparting kokumi (see Patent documents 1 and 2 and non-Patent document 4, as described below).

There are various profiles of the development of taste in the said "kokumi". In this regard, there is a need to create an agent that is able to give food, kokumi the mid-palate and finish, and with a high titer. In addition, since the agent to give kokumi usually use in food products, respectively, it should have excellent stability. Additionally, the substance to give kokumi should have a low cost of production.

Accordingly, it took the search among the many variants of compounds exhibiting the desired activity of the CaSR agonist, so as to detect a substance that is able to give kokumi other material (i.e., foods or drinks)with a more prominent effect giving kokumi, in particular, kokumi initial taste, which has excellent stability, and which can be easily obtained with low cost, and thus to provide an agent for giving kokumi consisting of such substances, as well as comprehensive agent to give kokumi containing substance and other substances, active CaSR agonist, in combination.

<> On the other hand, in the case of some γ-glutamyl peptides, each of which carries the remainder of the γ-glutamine at the N end of the known peptides, synthesized as substrates, for example, for studies of the enzymatic activity (see Patent document 3 and non-Patent documents 1 to 3 mentioned later), but still do not know of any cases when γ-Glu-Nva-Gly actually used in food products, or of any of its isolation from natural materials to add to food. In this respect, the full contents of Patent documents 1 and 2 are included here by reference, as if their contents were directly included in the present description.

The documents of the prior art

Patent documents

Patent document 1: WO 2007/055393, abstract;

Patent document 2: WO 2008/139945, abstract;

Patent document 3: WO 2007/066430, summary.

Non-patent documents

Non-patent document 1: Molecular Pharmacology(1982), 21(3), 629-36;

Non-patent document 2: Agricultural and Biological Chemistry(1981), 45(12), 2893-45;

Non-patent document 3: The Journal of Biological Chemistry, (1979), 254 (12), 5184-90;

Non-patent document 4: The Journal of Biological Chemistry, (2010), 285 (2), 1016-22.

The invention

The present invention consists in detecting the majority of compounds exhibiting the desired activity of the CaSR agonist, to thus detect the ü substance, able to give kokumi superior taste, in particular, kokumi medium taste/aftertaste, and has excellent stability, and having a high titer, in order thus to ensure the agent to give kokumi consisting of such substances, as well as comprehensive agent to give kokumi containing a combination of such substances with other substances, active CaSR agonist. Another object of the invention is the provision of seasoning containing the above substance in a concentration of not less than the specified level.

Result of search of many compounds, the authors of this invention have unexpectedly found that γ-Glu-Nva-Gly (L-γ-glutamyl-L-Norwell-glycine) shows high activity of the CaSR agonist and gives a wonderful kokumi, and that he, in particular, gives the food kokumi with a picture of the development of taste, appropriate kokumi medium taste/aftertaste. In addition, the inventors have found that the observed γ-Glu-Nva-Gly has a very high titer of not less than 10 times the titer observed for γ-Glu-Val-Gly as one of the tripeptides, similar to γ-Glu-Nva-Gly, has excellent stability and has such a favourable character development of taste, which demonstrates a high ability to focus on kokumi medium taste/aftertaste. In addition, the inventors have further found that γ-Glu-Nva-Gly can serve as an independent agent to give kokumi. In addition, the inventors have likewise found that the preferred seasoning with improved kokumi can be obtained by the inclusion of γ-Glu-Nva-Gly in the food composition. In addition, a comprehensive agent to give kokumi can be obtained by combining the specified substances with other substances, each of which shows the activity of the CaSR agonist. The authors thus came to the present invention.

More specifically, the present invention herein relates to an agent for flavor, kokumi consisting of γ-Glu-Nva.

In addition, the present invention also relates to a food composition containing γ-Glu-Nva (herein, the composition identified as "food composition according to the invention"). The present invention also provides a complex agent to give kokumi containing, in combination, (a) γ-Glu-Nva and (b) one or at least two amino acids or peptide selected from the group consisting of γ-Glu-X-Gly, where X represents an amino acid or derived amino acids, γ-Glu-Val-y, where Y represents an amino acid or derived amino acids, γ-Glu-Abu, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met(O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu, γ-Glu-Cys (S-Me).

The present invention is to provide is to place the agent to give kokumi with great action and in particular, gives an excellent and unique kokumi medium taste/aftertaste, with the character development of taste, which has the profile shown, for example, in Fig.1, and also has excellent stability, and which can be easily obtained with low cost, as well as a complex agent to give kokumi containing it. In addition, the present invention provides an excellent seasoning with excellent effect give kokumi in a concentration of not less than the specified level.

Agent to give kokumi according to the invention demonstrates the developmental profile of kusarigama similar to that of table salt, and thus, when using this agent to give kokumi, he can give foods with low salt content or similar products of salinity and initial salty taste. Accordingly, received a food product containing the agent according to the invention can maintain a sense of salty taste of the product to reduce its salt content, even when the salt content of this product is reduced, and thus, the agent according to the invention allows to obtain food products with health benefits. Examples of such foods include a variety of soups and different types of sauces. In particular, when the consumption of the food product containing the agent to give kokumi according to the invention, the user morepolice clear sense of the salty taste and effect (or making) the initial taste immediately after its consumption.

Brief description of drawings

In Fig. 1 shows the profile of the development of taste, observed for the agent to give kokumi initial taste.

The method of carrying out the invention

Substance, γ-Glu-Nva used according to the invention, contains L-γ-glutamyl-L-Norvaline, in which two amino acids are linked together through a peptide bond, and/or its salts, in particular, it is suitable for the consumption of salt.

Substance, γ-Glu-Nva, has excellent effect give kokumi and thus, it can be used as an agent to impart kokumi. γ-Glu-Nva can be used in such a way that the food composition, which give kokumi contains dipeptide in number (all parts and percentages are by weight) in the range from 0.1 billion.D. (billions of shares) to 99.9 wt.%, preferably, from 1 billion.D. up to 10 wt.% and more preferably, from 0.01 M. D. (ppm) up to 1 wt.% the total weight of the food composition. In other words, another variant of implementation of the present invention relates to a food composition containing γ-Glu-Nva, and preferably, the food composition containing γ-Glu-Nva in a quantity ranging from 0.1 billion.D. to 99.9 wt.%, preferably, from 1 billion.D. up to 10 wt.% and more preferably, from 0.01 m on up to 1 wt.%. More specifically, the present invention relates, for example, to food composition containing γ-Glu-Nva in quantity is not less than 0.1 billion.D., not less than 0,005 memorial plaques, not less than 0.02 m etc. or from not less than 0.01 wt.% to not more than 99.9 wt.%, not more than 90.0 wt.%, not more than 50 wt.%, not more than 600,000 memorial plaques, not more than 100000 memorial plaques, not more than 80 memorial plaques, not more than 30 meters etc. or not more than 10 m, DV by weight.

Moreover, the agent for giving kokumi according to the invention or γ-Glu-Nva can also be used in combination with at least one additional ingredient spices selected from the group consisting of amino acids such as monosodium glutamate (MSG), nucleic acids such as insimenator (IMP), inorganic salts such as sodium chloride, organic acids such as citric acid, and various types of yeast extracts, so as to obtain provide benefits seasoning with improved kokumi, compared to kokumi obtained when using such additional ingredients spices separately. When using γ-Glu-Nva in combination with the above ingredients for seasonings concentration of the first mentioned can easily or appropriately to determine or set the person skilled in the art after study of, for example, through sensory evaluation.

According to the present invention, the term "kokumi" refers to the taste, which cannot be expressed through the five basic flavors or sweet taste, salty taste, sour taste, Gore is one taste and minds, and more specifically, refers to the taste, with secondary flavors of the basic tastes, such as density, distribution (filling of the mouth), the duration and harmony, strengthened in addition to the basic tastes. In addition, the term "giving kokumi" herein means that the five basic tastes, pronounced sweet taste, salty taste, sour taste, bitter taste and minds, reinforced, while the subject at the same time creates a feeling of tastes, additional to the basic tastes, such as density, distribution (filling of the mouth), the duration and harmony associated with the first mentioned. Moreover, it can be described also as the enhancement effect of the taste. Thus, γ-Glu-Nva, acts as the agent for giving kokumi according to the invention can likewise be termed as a "flavor enhancer". Agent to give kokumi according to the invention, or γ-Glu-Nva, can also be used as an amplifier of sweet taste, the amplifier salty taste, the amplifier sour taste, the amplifier bitter taste or amplifier minds.

In addition, changing the taste of food over time in consumption and after it, usually designated as the initial taste, average taste and aftertaste, in order, starting from the moment of intake. Although in reality they are understood relative is e, but the initial taste, average taste and aftertaste of the subject, in General, is defined as the taste, the observed within-time, continuing from 0 to 2 seconds 2 to 5 seconds and 5 seconds after food intake, respectively. Taste, observed over time, continuing from 0 to 5 seconds, denoted herein as the "initial/average taste, and taste, observed in the course of time, lasting from 2 to about 30 seconds, is designated as "average taste/aftertaste" (see the data plotted on the graph in Fig. 1). As for the taste, if taste is divided into three divisions, for tasters (people who use the food to be evaluated) it is difficult to focus on the assessment, and habitually used by the test assesses taste split into two divisions.

Moreover, the combined initial taste and a middle taste is designated as "primary/secondary taste", and the combined average taste and aftertaste is designated as "average taste/aftertaste".

The effects of the substance, active CaSR agonist, kokumi and character development of taste can be confirmed, for example, the way the human sensory test for the evaluation of taste. An example of such a human touch samples for the evaluation of taste illustrated in the examples of this patent application, but the touch Pro is for evaluation of taste, suitable according to the invention is not limited to this particular breakdown.

The term "CaSR"used in this description, refers to the calcium-sensing receptor, which belongs to the class From 7-Trevoga transmembrane receptor, and which, therefore, also referred to as calcium receptor". The term "CaSR agonist", as used in this description, refers to a substance that communicates with the above CaSR, to thus activate the receptor CaSR. In addition, the term "activate CaSR"used herein indicates that the ligand binds to CaSR, to thus activate protein associated with guaninom the nucleotide, and to transmit the signals received from him. Moreover, the ability of a substance to form a relationship with CaSR, in order to activate it, is designated as "the activity of the CaSR agonist".

Currently, the method of screening compounds exhibiting agonist activity CaSR specifically provided herein, but the screening phase, the compounds are not limited to the stages listed below.

1) the stage of adding the test substance to the system for measuring the activity of CaSR used to determine the CaSR activity, and stage of determining the activity of CaSR;

2) phase comparison CaSR activity observed when adding the test substance to logon activity measurement, activity observed prior to the addition of substances; and

3) qualifying substances, active CaSR agonist when added to a system for measuring the activity of CaSR.

The determination of the activity of CaSR in this way can be performed using, for example, measurement using cells having the ability to Express the CaSR. The above cells may represent cells with endogenous expression of CaSR or genetically recombinant cells with exogenously introduced gene for the expression of CaSR. The above system for measuring the activity of CaSR is not limited to any specific system, while it allows the detection of the connection (or reaction) between activating CaSR substance and CaSR, or until it can emit or issue subject detection signal in response to the education connection (or reaction) between activating CaSR substance and CaSR inside the cells by adding extracellular ligand (activating substance)specific CaSR, to the above-mentioned cells, which are able to Express the CaSR. If the CaSR activity detected during the reaction with the test substance, it can be concluded that the test substance has a desirable activity stimulation of CaSR.

An example of the above CaSR, preferably used in the present document, CaSR is human, to direly CaSR gene of the person, registered in GenBank under the access number NM_000388. In this respect, however, CaSR is not limited to a protein encoded by a gene having the above sequence registered CaSR, and may be any protein that can be encoded gene, with at least 60%, preferably at least 80%, and more preferably at least 90% sequence homology with the sequence of the above gene, provided that the protein encoded by this gene has the desirable function of the CaSR. In this regard, the function of the CaSR can be checked by obtaining cells expressing these genes, and then determine any changes in current and/or any changes in the concentration of calcium ion inside cells observed when adding calcium to the system containing the cells.

In respect of the above CaSR, its source is not limited to any particular source, and it can be a CaSR obtained from a combination of animal species, including mice, rats and dogs, in addition to the above CaSR person.

As discussed above, the CaSR activity can be confirmed through the use of living cells that can Express the CaSR, or SNiP, of the membranes of cells that can Express the CaSR or its fragment, or systemin vitrocontaining CaSR isobloc in the form of its fragment.

An example in which use such living cells below, but the present invention is absolutely no way limited to this example.

CaSR Express in cultured cells, such as oocytes Xenopus, cells of the ovary obtained from hamsters, and fetal cells of human kidney. This expression of CaSR can be done by introducing, in the plasmid with the exogenous gene, CaSR gene, which was subjected to processing by cloning in the form of plasmids or crnc obtained using the gene as a matrix. Suitable for detection of this reaction can be electrophysiological methods or fluorescence indicator for detection of any increase in the concentration of calcium inside the cells.

The expression of CaSR source was confirmed by the presence of any response observed when adding calcium or activator, having specificity to it. More specifically, suitable according to the invention as desired cells are cells in which the intracellular electric current detected when adding calcium at a concentration of about 5 mm, or cells, in which the emission of fluorescent rays see adding a fluorescent indicator. In this regard, the concentration of calcium added to the cells in different ways change the definition of dependent is the intensity of intracellular current on the concentration of calcium. Then the test substance was diluted to concentrations ranging from approximately 1 μm to 1 mm, the resulting suspension is added to the oocytes or cultured cells, and then the CaSR activity in the presence of the above test substance is measured, to thereby determine the activity of the CaSR agonist for the test substance.

More specifically, as such a test for determining the activity of the CaSR agonist according to the invention are suitable, for example, the test shown in test examples described in this description, but the test for determining the activity is not limited to such specific test.

Amino acids or peptides used in the agent for giving kokumi according to the invention in combination with γ-Glu-Nva include, for example, one or at least two amino acids or peptide selected from the group consisting of γ-Glu-X-Gly (where X represents an amino acid or derived amino acid), γ-Glu-Val-Y (where Y represents an amino acid or derived amino acid), γ-Glu-Abu, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val; γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu, γ-Glu-Cys (S-Me). In this respect, the amino acids may likewise include, for example, neutral amino acids such as Gly, Aa, Val, Leu, Ile, Ser, Thr, Cys, Met, Asn, Gln, Pro, Hyp, t-Leu; acidic amino acids such as Asp, Glu; basic amino acids such as Lys, Arg, His; aromatic amino acids such as Phe, Tyr, Trp; as well as homoserine, citrulline, ornithine, α-aminobutyric acid, Norvaline, norleucine and taurine. Moreover, the amino acids used according to the invention, can be a artificial amino acids (with non-protein structure), such as tert-leucine, cycloleucine, α-aminoadamantane acid, L-penicillamine, allochronic and alliteration. In this regard, the peptide: γ-Glu-X-Gly-X can represent the above amino acid or its derivative, but preferably used according to the invention are amino acids or their derivatives, other than Cys. One of them is preferably used according to the invention in combination with γ-Glu-Nva include, for example, γ-Glu-Val-Gly, γ-Glu-Abu-Gly, γ-Glu-tLeu-Gly, γ-Glu-Nva-Gly and γ-Glu-Abu.

In particular, the agent for giving kokumi according to the invention consists of γ-Glu-Nva, and this agent has a unique and excellent effect of imparting kokumi initial taste and profile development of taste (taste), as shown in Fig. 1. Accordingly, it is preferable that γ-Glu-Nva used in combination with a peptide, such as γ-Glu-Val-Gly with developmental profile of taste, different from the first mentioned.

In the description of this patent application, each of the second amino acid (residue) is expressed as the following designation abbreviated form:

(1) Gly: glycine;

(2) Ala: alanine;

(3) Val: valine;

(4) Leu: leucine;

(5) Ile: isoleucine;

(6) Met: methionine;

(7) Phe: phenylalanine;

(8) Tyr: tyrosine;

(9) Trp: tryptophan;

(10) His: histidine;

(11) Lys: lysine;

(12) Arg: arginine;

(13) Ser: serine;

(14) Thr: threonine;

(15) Asp: aspartic acid;

(16) Glu: glutamic acid;

(17) Asn: asparagine;

(18) Gln: glutamine;

(19) Cys: cysteine;

(20) Pro: Proline;

(21) Orn: ornithine;

(22) Sar: sarcosine;

(23) Cit: citrulline;

(24) N-Val: (or Nva): Norvaline (2-aminosalicilova acid);

(25) N-Leu (or Nle): norleucine;

(26) Abu: α-aminobutyric acid;

(27) Tau: taurine;

(28) Hyp: hydroxyproline;

(29) t-Leu: tert-leucine;

(30) Cle: cycloleucine;

(3l) Aib: α-amino-somalina acid (2-methylalanine);

(32) Pen: L-penicillamine;

(33) ALLO-Thr: allochrony;

(34) ALLO-Ile: alliteration.

Moreover, the term "derived amino acids"used herein refers to the many derivatives of the foregoing amino acids, and specific examples include a special amino acids and synthetic amino acids, aminoalcohols or amino acids, amino acid side chains of which, such as carboxyl groups, amino groups and/or thiol group of cysteine, are replaced by many deputies. Examples of such substituents include alkyl group, acyl group, hydrox the optimum group, the amino group, alkylamino, a nitrogroup, sulfonyloxy group or different protective groups. Thus, examples of amino acid derivatives include Arg (NO2): N-γ-nitroarginine, Cys (SNO): S-nitrosation, Cys (S-Me): S-methylcysteine, Cys (S-allyl): S-allylcysteine, Val-NH2: valinamide, and Val-ol: valinol (2-amino-3-methyl-1-butanol). At the same time, the peptide: γ-Glu-Cys(SNO)-Gly, used according to the invention is a peptide represented by the following structural formula, and the symbol: "(O)"presented in the above formulas: γ-Glu-Met (O) and γ-Glu-Cys (S-Me) (O), means that each of these peptides has sulfoxide structure. Symbol(γ)from γ-Glu means that another amino acid is linked to glutamic acid via carboxyl group, located at the γ-position of the latter.

[Chemical formula 1]

S-nitrosoglutathione (GNSO)

γ-Glu-Nva and amino acids and peptides used in combination according to the invention can be a commercially available amino acids and peptides, if you can buy them on the market, or they can be obtained by any known method, such as (l) methods of chemical synthesis or (2) the method using an enzymatic reaction, but more convenient is the use of the method of chemical synthesis. γ-Glu-Nva used according to the invention is chenkaladi length because it contains only two amino acid balance, and thus is more convenient to adopt the method of chemical synthesis. More specifically, it can be obtained simply and with low cost in comparison with any Tripeptide containing three amino acid balance, and accordingly, the use of this dipeptide is quite preferable from the industrial point of view. In addition, during the chemical synthesis of γ-Glu-Nva used according to the invention, and amino acids and peptides used in combination with them, obtaining them can be made by synthesis or poluentes these oligopeptides using the device for the synthesis of peptides. As such a method of chemical synthesis of these peptides according to the invention may be suitable, for example, the method of solid-phase peptide synthesis. Thus obtained peptide can then be cleaned by conventional means, such as ion-exchange chromatography method, the method obremenitve high-performance liquid chromatography or a method of affinity chromatography. This method of solid-phase peptide synthesis and then used the method of purifying peptides is well known in this field.

Alternatively, upon receipt of γ-Glu-Nva used according to the invention, and amino acids and peptides used in combination with it, when used and the enzymatic reaction, obtaining them can be done using the method described in the International patent documentation, publicly available, WO 2004/011653. More specifically, they can be obtained by reaction of the amino acid or peptide, in which the terminal carboxyl group is esterified or aminirovanie, with another amino acid, the amino group of which is in a free state (for example, amino, carboxyl group which is protected) in the presence of peptidase enzyme and then by purification of the resulting dipeptide or Tripeptide. Examples of such peptidebased enzymes are the culture of microorganisms having the ability to produce the peptide; the cell bodies of microorganisms isolated from the culture; or the product obtained by processing cell bodies of microorganisms; or peptidase enzyme derived from microorganisms. At the same time in this document assume that the description of WO 2004/011653 included in the description of this application.

In addition to the above methods of enzymatic obtain and methods of chemical synthesis, the peptides used according to the invention, are often included in natural products, for example, plants such as vegetables and fruits, microorganisms such as yeast and other natural resources. When they are present in natural ve is the EU ETS, they can be extracted from these substances, and the resulting selected products can likewise be used according to the invention.

Agent to give kokumi or complex agent to give kokumi according to the invention can be used as a seasoning without any special further processing or can be mixed with carriers suitable for food and beverage products, or ingredients for other spices, so you get a variety of seasonings. Examples of such other ingredients for spices include the spices, sugars, sweeteners, food fibers, vitamins, amino acids such as monosodium glutamate (MSG), a nucleic acid, such as insimenator (IMP), inorganic salts such as sodium chloride, and organic acids such as citric acid, as well as various types of yeast extracts.

In particular, foods with low salt content, preferred as food compositions, each of which contains the agent to give kokumi or complex agent to give kokumi according to the invention are essentially salty foods, and, in particular, food products, content of salt which is reduced.

Examples of such foods low in salt include dairy products such as butter and cheese; the abdomen is haunted fats and fat-containing oils and/or vegetable oil, and fat-containing foods such as margarine, sauces and seasoning for sauces; emulsified food products such as salad dressings and mayonnaise; different types of curries and stews; and a variety of soups that contain meat or meat extracts essences and/or cream. Moreover, these foods with reduced salt content in this way include, for example, fermented or fermented foods such as miso and soy sauce; processed vegetable foods, such as pickled vegetables and pickles; food processing of meat, such as ham and sausage; processed seafood such as a paste of boiled fish, dried seafood and food boiled in soy; cooked meatballs, chopped steak; fried foods and grilled chicken. Of these preferred foods low in salt are foods that have a concentration of salt, at their consumption, in the range from 0.01 to 0.5 wt.%.

If the agent is to give kokumi according to the invention include the above foods low in salt, food products become able to give the user a strong sense of taste, like salt, and feeling (or making) the initial taste on the initial stage, when the consumption of these p the food low in salt.

In addition, when considering the present invention from another point of view, herbs and spices derived from plants belonging toLabiatae(the mint family), or foods to which you add these herbs and spices derived from plants belonging toLabiataelike, are preferred as food compositions containing an agent for making kokumi or complex agent to give kokumi according to the invention. Examples of herbs that are obtained from plants belonging toLabiataeinclude anise, oregano, sage, thyme, mint, Japanese peppermint, bergamot, marjoram, mint, lavender and rosemary in addition to pechenocna and the Basilica, however, the present invention is not limited to these specific herbs. In the case of food products, each of which contains such herbs and/or spices derived from plants belonging toLabiataeand the agent for giving kokumi or complex agent to give kokumi according to the invention, the above-mentioned food products preferably are food products containing herbs and/or spices in quantities in the range from 0.01 to 10 wt.%, as expressed respect to the content of dry matter observed in their consumption.

Examples of such food products, each of which contains γ-Glu-Nva and herbs and/or spices, the scientists from plants, belonging toLabiataeare sauces, salad dressings, soups, snack foods or food processing of meat (such as ham and sausage).

Moreover, if we consider the present invention from another point of view, foods containing "miso", are also preferred according to the invention as a food composition containing the agent to give kokumi or complex agent to give kokumi according to the invention. Examples of such "miso" include "miso", obtained using solozhenko rice, malt (solozhenko barley) and orogenic soybeans, as well as mixed "miso", which is obtained by mixing at least two of them, however, the present invention is not limited to these specific "miso". Such foods containing "miso", are not limited to specific food products, since they contain "miso", but you can list, for example, soups miso", various kinds of processed foods containing "miso" as a seasoning, seasoned with "miso"containing "miso" soup for Chinese noodles and containing "miso" sauces. In the case of food products containing "miso" and the agent to give kokumi or complex agent to give kokumi according to the invention, preferred are the above containing "m is" food, in which "miso" or similar is present in amounts in the range from 0.01 to 99.9 wt.%, as expressed respect to the content of dry matter, with their consumption.

In addition, if we consider the present invention from another point of view, is also preferred as food compositions containing an agent for making kokumi or complex agent to give kokumi according to the invention, are containing tomato food. Such containing tomato food products are not limited to specific food products, since they contain tomatoes, but specific examples include tomato sauces, tomato ketchup, tomato paste and lots containing tomato soups. In the case of food products containing tomato and agent to give kokumi or complex agent to give kokumi according to the invention, containing the above tomato food products preferably contain tomato or similar in amount in the range from 0.01 to 99.9 wt.%, as expressed respect to the content of dry matter observed in their consumption.

γ-Glu-Nva used according to the invention, and amino acids or peptides used in combination with them, can similarly include amino acids or peptides in the form of their salts. If γ-Glu-Nva used according to the invention, and amino acids or peptides used in Combi the purpose with him, present in the form of their salts, the salts are not limited to specific salts until they are pharmacologically suitable soluble salts, and specific examples include ammonium salts, alkali metal salts such as sodium and potassium, salts of alkaline earth metals such as calcium and magnesium, aluminum salts, zinc salts, salts of organic amines such as triethylamine, ethanolamine, morpholine, pyrrolidine, piperidine, piperazine and dicyclohexylamine, and salts of basic amino acids, such as arginin and lysine and acidic groups such as carboxyl groups. Moreover, examples of the above compounds in a similar manner include the salts of inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid and Hydrobromic acid; salts of organic acids such as acetic acid, citric acid, benzoic acid, maleic acid, fumaric acid, tartaric acid, succinic acid, tannic acid, butyric acid, hibenzoic acid, pamula acid, enanthic acid, cekanova acid, teolinda acid, salicylic acid, lactic acid, oxalic acid, mandelic acid and malic acid; and salts of organic sulfonic acids, such as methanesulfonate acid, benzolsulfonat acid and p-toluensulfonate acid, with about the main groups of compounds.

Agent to give kokumi, food composition or a complex agent to give kokumi according to the invention can be used in any form, such as dry powders, pastes and mortars, without any limitation of their physical properties.

Agent to give kokumi, food composition or a complex agent to give kokumi according to the invention can be used to enable, for example, many food and beverage products, such as foods, drinks and condiments.

If the agent is to give kokumi, food composition or a complex agent to give kokumi according to the invention is used to enable, for example, many food and beverage products, such as foods, drinks and condiments, the final amount of γ-Glu-Nva and the final amount of amino acid or peptide used in combination with it, is not limited to any particular number, as long as it can achieve the desired effects according to the invention, however, each of the number of γ-Glu-Nva and/or the number of amino acids or peptide falls within the range of from about 0.1 MLR.D. to 99.9 wt.%, and preferably, from about 1 billion.D. up to 10 wt.% and more preferably, from about 0.01 meters on up to 1 wt.% the total weight of each respective food product, beverage, condiment or so

Many foods, such as food, drink or condiment, each of which has enabled the agent to give kokumi, food composition or a complex agent to give kokumi according to the invention may additionally contain, for example, any solid or liquid carrier and/or suitable ingredients condiments, suitable for food and beverage.

As the above media can be listed, for example, glucose, lactose, sucrose, starch, mannitol, dextrin, glycerides of fatty acids, polyethylene glycol, gidroxiatilkrahmal, ethylene glycol, esters of fatty acids and polyoxyethylenesorbitan, gelatin, albumin, amino acids, water and physiological salt solution.

The above ingredients for seasoning are not limited to any one particular ingredient and can be any of the ingredients currently used in this area, but their specific examples are examples already described above.

The content of the above carriers, other ingredients seasoning or similar is not limited to a particular content.

Among the above ingredients, spices, yeast extract is not specifically limited to any of the cell bodies of microorganisms of which is the extract from the by the conditions of cultivation of microorganisms and methods of its extraction, and accordingly, any yeast extract can be used in the products according to the invention moreover, these yeast extracts can be the extracts that were subjected to, for example, heat treatment, processing enzyme, the treatment concentration and/or processing for turning extract in powder.

Agent to give kokumi, food composition or a complex agent to give kokumi according to the invention can be used in any form, such as dry powders, pastes and mortars, without any limitation of their physical properties.

Agent to give kokumi, food composition or a complex agent to give kokumi according to the invention can be used to enable, for example, many food and beverage products, such as foods, drinks and condiments.

The present invention relates also to a method for production of a variety of food products and beverages, including the state add to the many semi-finished products used for various kinds of food products and beverages, γ-Glu-Nva in such a way that the resulting food products and beverages contain γ-Glu-Nva in amount in the range of 1 billion.D. to 99.9 wt.%. In this regard, various types of food products and beverages preferably are foods low in salt.

<> The present invention also relates to a method for obtaining a variety of food products or beverages, including the state include food composition according to the invention in semi-finished products used for various kinds of foods or drinks. In this regard, various types of food products and beverages preferably are foods low in salt.

As for the method of producing semi-finished product used for other food or beverage according to the invention, it is preferable that the method include the stage of adding the flavor enhancer consisting of γ-Glu-Nva, to the ingredient of the food product (such as giving to the minds ingredient, protein hydrolysates or herbs and/or spices) during mixing and, depending on the need, additional cooking the mixture of food ingredients, in order to get food or drinks, or intermediates for their preparation.

In this respect, the stage of adding the flavor enhancer consisting of γ-Glu-Nva, to the ingredient of the food product, preferably includes a step of controlling the concentration of γ-Glu-Nva in the material used to obtain food or drink, in the range from 0,005 to 600000 M. D. and preferably from 0.1 to 100000 m is.

In addition, it is also preferable that the method further include stage add cake mix to get food or drinks other food ingredients (such as agricultural products, seafood, livestock products, dairy products or processed products) monitoring the concentration of γ-Glu-Nva in the resulting food or drinks at the level of 0.005 to 30 M. D. and preferably from 0.05 to 10 M. D.

Moreover, the stage of adding the flavor enhancer consisting of γ-Glu-Nva, to the ingredient of the food product during mixing, preferably includes a step of controlling the concentration of γ-Glu-Nva in the resulting food or drinks at the level of 0.005 to 30 M. D. and preferably from 0.05 to 10 M. D.

In the above method of production, it is preferable to have food or drinks were a food or beverage containing herbs and/or spices derived from plants belonging toLabiatae(such as sauces, salad dressings, soups, snack foods or products meat processing). In this case, each food product or beverage preferably contains 0.005 to 30 meters D. γ-Glu-Nva; from 0.01 to 10 wt.% herbs and/or spices derived from plants belonging toLabiataeand other food ingredients.

More then what about, in the above method of production, it is preferred that the food product or drink was a food or drink containing "miso". In this case, each product or beverage preferably contains from 0.02 to 80 M. D. γ-Glu-Nva; from 0.01 to about 99.9 wt.% (or more preferably, from 0.1 to 90.0 wt.%) "miso"; and other food ingredients.

Moreover, in the above method of production, it is preferred that the food product or drink was a food or drink containing tomato. In this case, each product or beverage preferably contains from 0.02 to 80 M. D. γ-Glu-Nva; from 0.01 to 99.9 wt.% (or more preferably, from 0.1 to 90.0 wt.%) tomato; and other food ingredients.

Moreover, the present invention also relates to a method of enhancing the taste of food or beverages, including the stage of adding the composition containing γ-Glu-Nva to foods or beverages in amounts in the range from 0.01 to 50 wt.%. In this regard, it is preferable that the increasing taste was a stage giving kokumi.

The present invention is described herein in more detail with reference to the following examples, but the present invention is not limited to these specific examples.

Example

(Synthesis example 1): Sint is C γ-Glu-Nva (γ-L-glutamyl-L-Norvaline)

In methylene chloride (CH2Cl2, 60 ml) was dissolved Boc-Nva·DCHA (t-butoxycarbonyl-L-Norvaline·salt DICYCLOHEXYL-ammonium, 3,39 g, 25 8,49 mm) and benzyl alcohol (1.01 g, 9.34 mm). Then to the resulting solution was added DMAP (4-dimethylaminopyridine, 0.21 g, 0.2 EQ., 1,70 mm) and WSC·HCl (hydrochloride of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, is 1.81 g, 1.1 EQ., 9.34 mm), while maintaining the reaction solution at 0°C. the Temperature of the reaction solution was gradually raised and stirred at room temperature overnight (16 hours). Then the reaction solution was concentrated under reduced pressure, the precipitate obtained was added ethyl acetate (500 ml), the temperature of the organic phase was raised to 60°C, then washed with water (100 ml), twice with 5% aqueous citric acid solution (100 ml), saturated solution of sodium chloride (100 ml), twice with 5% aqueous sodium hydrogen carbonate solution (100 ml) and a saturated solution of sodium chloride (100 ml), and then the organic phase was dried over anhydrous magnesium sulfate. The magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. Crystals precipitiously during concentration under reduced pressure, and thus, the crystals were collected by filtration and subsequent drying under reduced pressure to obtain crystals of Boc-Nva-OBzl (2,41 g, 7,3 mm).

To Boc-Nva-OBzl, combined with the separately synthesized Boc-Nva-OBzl (2,68 g, 8,72 mm), was added a solution of 4 N HCl/dioxane (43,6 ml)and the mixture was stirred at room temperature for one hour. The reaction system was concentrated under reduced pressure to remove dioxane, and to the obtained precipitate was added n-hexane (30 ml) and then the resulting mixture was concentrated under reduced pressure. In this respect, the last two stages were repeated three times, to thereby obtain H-Nva-OBzl·HC1 with quantitative yield.

The obtained H-Nva-OBzl·HC1 was dissolved in methylene chloride (60 ml)and the resulting reaction solution was maintained at 0°C. To the reaction solution was added Z-Glu-OBzl (benzyl ester of N-α-carbobenzoxy-L-glutamic acid, 3,24 g, 8,72 mm), triethylamine (of 1.34 ml, 1.1 EQ., 9,59 mm), HOBt·H2O (1-hydroxybenzotriazole (1.47 g, 1.1 EQ., 9,59 mm) and WSC·HCl (1.84 g, 1.1 EQ., 9,59 mm). The temperature of the reaction solution was gradually raised and stirred at room temperature overnight (16 hours). Then the reaction solution was concentrated under reduced pressure, the precipitate obtained was added ethyl acetate (200 ml), and then the organic phase is washed with water (80 ml), twice with 5% aqueous citric acid solution (80 ml), a saturated solution of sodium chloride (80 ml), twice with 5% aqueous sodium hydrogen carbonate solution (80 ml) and saturated the solution of sodium chloride (80 ml), and then the organic phase was dried over anhydrous magnesium sulfate. The magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. The precipitate was recrystallized from ethyl acetate and n-hexane, the resulting crystals were collected by filtration and dried under reduced pressure to obtain crystals of Z-Glu(Nva-OBzl)-OBzl (4,06 g).

To a mixed solution of ethanol (150 ml) and water (30 ml) was added Z-Glu(Nva-OBzl)-OBzl (4,06 g) and 5% palladium on carbon (5% palladium/carbon, 0,70 g), and a catalytic reduction reaction was carried out at 50°C overnight (14 hours) in the atmosphere of hydrogen gas. In the reaction system was added water (50 ml) in small portions during the reaction. Palladium/carbon was removed from the reaction system by filtration, and the obtained filtrate was concentrated under reduced pressure. The residue was recrystallized from a small amount of water and ethanol, to thereby obtain γ-Glu-Nva (1.50 g) as white crystals. Then the crystals were dissolved in water (100 ml) followed by lyophilization of the solution to obtain γ-Glu-Nva (1.27 g, 5,16 mm) in the form of a white powder. Typical values for are shown below:

ESI-MS: (M+H)+=247,1; (M-H)-=245,2.

1H-NMR (400 MHz, D2O): δ (ppm): of 0.77 (3H, t, J=7,3 Hz), of 1.18 and 1.33 (2H, m), 1,50-of 1.73 (2H, m), 1,97-of 2.08 (2H, m), a 2.36 (2H, DD, J=,6 and 8.4 Hz), 3,68 (1H, t, J=8,4 Hz), 4,15 (1H, DD, J=5,2 and 8.8 is C).

(Synthesis example 2: Synthesisγ-Glu-Nle (γ-L-glutamyl-L-norleucine) (Comparative example)

In methylene chloride (CH2Cl230 ml), was dissolved Boc-Nle·0,2 AcOEt (t-butoxycarbonyl-L-norleucine·0.2 M acetate, 0.51 g, 2.00 mm) and benzyl alcohol (0.24 g, mm). Then to the resulting solution was added DMAP (4-dimethylaminopyridine, 0.05 g, 0.2 EQ., 0.40 mm) and WSC·HCl (hydrochloride of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, of 0.43 g, 1.1 EQ., 2,20 mm), while maintaining the reaction solution at 0°C. the Temperature of the reaction solution was gradually raised and stirred at room temperature overnight (16 hours). Then the reaction solution was concentrated under reduced pressure, the precipitate obtained was added ethyl acetate (100 ml)then the organic liquid phase was washed with water (30 ml), twice with 5% aqueous citric acid solution (30 ml), saturated sodium chloride solution (30 ml), twice with 5% aqueous sodium hydrogen carbonate solution (30 ml) and then saturated sodium chloride solution (30 ml), and then the organic phase was dried over anhydrous magnesium sulfate. The magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure, to thereby obtain Boc-Nle-OBzl (0,61 g, 1,90 mm) in the form of oil product.

To Boc-Nle-OBzl (0,81 g, 1,90 mm) solution was added 4 N HCl/dioxane (9,40 ml) and the mixture was stirred at room temperature during the one hour. The reaction system was concentrated under reduced pressure to remove dioxane. To the obtained precipitate was added n-hexane (6.0 ml), and then the resulting mixture was concentrated under reduced pressure. In this regard, the last two stages were repeated three times, to thereby obtain H-Nle-OBzl·HCl with a quantitative yield.

The obtained H-Nle-OBzl·HC1 was dissolved in methylene chloride (30 ml)and the resulting reaction solution was maintained at 0°C. To the reaction solution was added Z-Glu-OBzl (benzyl ester of N-α-carbobenzoxy-L-glutamic acid, 0,70 g, 1,90 mm), triethylamine (0,29 ml, 1.1 EQ., 2,10 mm), HOBt·H2O (1-hydroxybenzotriazole (0.32 g, 1.1 EQ., 2,10 mm) and WSC·HC1 (0,41 g, 1.1 EQ., 2,10 mm). The temperature of the reaction solution was gradually raised and stirred at room temperature overnight (16 hours). Then the reaction mixture was concentrated under reduced pressure, the precipitate obtained was added ethyl acetate (100 ml), and then the organic phase is washed with water (30 ml), twice with 5% aqueous citric acid solution (30 ml), saturated sodium chloride solution (30 ml), twice with 5% aqueous sodium hydrogen carbonate solution (30 ml) and a saturated solution of sodium chloride (30 ml), and then the organic phase was dried over anhydrous magnesium sulfate. The magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure, the Obtained residue was recrystallized from ethyl acetate and n-hexane, thus obtained crystals were collected by filtration and dried under reduced pressure to obtain a Z-Glu(Nle-OBzl)-OBzl (0,91 g).

To a mixed solution of ethanol (60 ml) and water (10 ml) was added Z-Glu(Nle-OBzl)-OBzl (of 4.05 g) and 5% palladium on carbon (5% palladium/carbon, 0.40 g)and a catalytic reduction reaction was carried out at 50°C overnight (14 hours) in the atmosphere of hydrogen gas. In the reaction system was added water (10 ml) in small portions during the reaction. Palladium/carbon was removed from the reaction system by filtration, and the obtained filtrate was concentrated under reduced pressure. The residue was recrystallized from a small amount of water and ethanol, to thereby obtain γ-Glu-Nle (0.29 grams) in the form of hygroscopic crystals. Then the crystals were dissolved in water (30 ml) followed by lyophilization of the solution to obtain γ-Glu-Nle (of 0.13 g, 0.50 mm) in the form of a white powder. Typical values for are shown below:

ESI-MS: (M+H)+=261,1; (M-H)-=259,0.

1H-NMR (400 MHz, D2O): δ (ppm): of 0.79 (3H, t, J=7,1 Hz), 1,18-of 1.30 (4H, m), 1,60-1,70 (1H, m), 1,70-1,80 (1H, m), 2,04 is 2.10 (2H, m), 2,38 is 2.44 (2H, m), of 3.73 (1H, t, J=6.3 Hz), 4,19 (1H, DD, J=5,0 and 8.8 Hz),

Test example 1: Receive CaSR-expressing plasmids

CaSR-expressing plasmid was obtained according to the following methods.

Synthesized synthetic oligo-DNA used for PCR methods (i.e. direct p is aimer (Sequence No. 3: ACTAATACGACTCACTATAGGGACCATGGCATTTTATAGCTGCTGCTGG) and reverse primer (Sequence No. 4: TTATGAATTCACTACGTTTTCTGTAACAG) based on DNA sequences registered in NCBI (CaSR (calcium receptor): NM_000388, Sequence No. 1 and 2).

Methods PCR was performed under the conditions listed below, using cDNA (available from the company Clontech)derived from human kidney as material, using the above primers and DNA polymerase Pfu Ultra (available from the company Stratagene): the reaction system was treated at 94°C for 3 minutes, and then at 94°C for 30 seconds, at 55°C for 30 seconds, and 72°C for 2 minutes, where these stages were repeated 35 times, and the system performed the final reaction at 72°C for 7 minutes. Then the reaction system was subjected to processing by electrophoresis in agarose as support, the agarose stained with means for staining DNA, and then it was irradiated with ultraviolet rays color for detecting whether the cDNA is amplified by means of PCR or not. At the same time, the picture electrophoresis was compared to that of marker DNA, electrophoretic size of which is known, to thus confirm the length of the chains of PCR products.

The plasmid vector pBR322 was digested with restriction enzymes EcoRV (available from Tikara Co., Ltd) and a fragment of the gene amplificatory ways PCR League is ovale in the plasmid vector according to the site of cleavage, using set for ligating (available from the company Promega). CellsEscherichia colistrain DH5 transformed reaction solution, followed by selection of transformants containing plasmid, which was cloned amplificatory the PCR product, and then amplificatory the PCR product was confirmed by sequence analysis of the DNA bases.

This recombinant plasmid was used to obtain plasmids expressing CaSR person, hCaSR/pcDNA3.1.

(Test example 2): evaluation of the activity of the CaSR agonist

293E cells (EBNA1-expressing HEK293 cells, ATCC No. CRL-10852) were cultured in DMEN/Ham's-F12 (containing 3,15/ml glucose, modified by way of Dulbecco environment, Needle, available from the company Nakaraitesk), supplemented with 10% fetal calf serum, in the presence of 200 μg/ml G418 (available from Genetisin). The cultured cells were inoculable in a bottle F25 at a density of 3x106cells/10 ml vial was allowed to stand for 24 hours in CO2-incubator (5% CO2, 37°C), and then transformed or transfusional a plasmid expressing CaSR person hCaSR/pcDNA3.1, using the reagent Fugene6 transfection (available from Roche). Transtitional plasmid was maintained in CO2-incubator for 6-7 hours, then cells were recovered using a containing 10%embryonic those who Yak serum DMEM/Ham's-F12 and the cells were inoculable to each well coated with poly-D-lysine 96-well tablet (BDBiocoat) at a density of 70,000cells/well.

96-well plate was allowed to stand for 24 hours in CO2-the incubator, and then the culture medium was removed from each well of 96-hole tablet, which was inoculable cells, and then adding to each well of a fluorescent indicator Ca2+from a set of Calcium 4 Assay (available from the company Molecular Devices), dissolved in buffer for analysis (containing 146 mm NaCl, 5 mm KCl, 1 mm MgSO41 mg/ml glucose, 20 mm HKPES (pH of 7.2) and from 0.75 to 1.25 mm CaCl2), in the amount of 200 μl/well, and then allowed 96-well plate to stand at 37°C for one hour and then at room temperature for 10 minutes, so that the indicator was included in the cell.

In each well of 96-hole tabletwas added to each test compound, dissolved in the buffer for analysis, containing 0.1% BSA, 50 μl/well, and then any changes in the intensity monitorrole for3 minutesusing install FLEX (available from the company Molecular Devices).

(Method of determining EC50)

The difference (RFU (Max-Min)between the maximum and minimum intensities of fluorescence observed for each well before and after you add each individual test the connection is to be placed, determined by the automatic calculation using the install FLEX. Expected level of activity, while the value of the RFU (Max-Min)observed when the connection is added to the maximum concentration, defined as 100%, and the value of the RFU (Max-Min)observed when using buffer for analysis, containing 0.1% BSA, free from any of the tested compounds was determined as 0%, with subsequent exposure of the received data procedures of selection curves using the software for spreadsheet Xfit or Graph-Pad Prism to thereby determine EC50, which represented the concentration with the degree of activity of 50%. Thus obtained results are summarized in the following table 1.

In addition, repeating the same methods for determining EC50used above except for using other dipeptides, as in the comparative examples. Thus obtained results are summarized in the following table 2.

Table 1
ConnectionEC50, mcm
γ-Glu-Nva0,12
γ-Glu-Nle
Table 2
ConnectionEC50, mcm
γ-Glu-Abu0,21
γ-Glu-Ala1,24
γ-Glu-Val1,03
γ-Glu-tLeu3,06
γ-Glu-Cys0,16
γ-Glu-Ser11
γ-Glu-Thr6,97
γ-Glu-Aib15,4

When compared with other dipeptides found that γ-Glu-Nva has a strong activity of the CaSR agonist compared to the activity observed for γ-Glu-Cys. It is known that the peptide of low molecular weight having the activity of a CaSR agonist, is suitable as an agent for giving kokumi (see Patent document 1, above) and, accordingly, suggested that γ-Glu-Nva can serve as a particularly excellent agent to give kokumi.

Example 1: evaluation of the activity of giving kokumi

This example was examined γ-Glu-Nva p is the power of his activity give kokumi under test quantitative sensory evaluation.

This test is a quantitative sensory evaluation was performed in the following ways. Force activity give kokumi observed for each of the tested compounds was determined as the value observed when mixing from 0.00001 to 0.5 g/DL of the respective test compounds with distilled water containing sodium glutamate (0.05 g/DL), monophosphate Yasinovka acid (0.05 g/DL) and sodium chloride (0.5 g/DL). In this regard, when the sample showed acidic character after dissolving the test compound compared to a control without test compound, the pH of the sample was made using NaOH to pH (observed for control) ±0,2 prior to the practical use of the design in the assessment. Evaluation criteria were as follows: control: 0 points: strong: 3 points; very strong: 5 points. Moreover, to make the criteria clearer, the initial taste and a middle taste/aftertaste γ-Glu-Val-Gly took over 3.0 points, respectively. Scoring or classification was performed using the method of the linear scale, and more specifically, they were carried out by specifying each of the corresponding points on the straight line marked points corresponding -5~0~5. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for the food product is in for a period of not less than one year total period of time and which could judge, the difference in titer between theγ-Glu-Cys-Gly andγ-Glu-Val-Gly added to the solution, with taste umami/ savory taste, is approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with n (the number of participating tasters) = 4. In this regard, the term "initial taste" refers to the development of taste, detektirovanie over time, continuing from 0 to 2 seconds after the taster kept the sample in the mouth, while the term "average taste/aftertaste" refers to the development of taste, detektirovanie after that. For the tested compounds showed activity give kokumi widely around the above-mentioned range, it added concentrations. However, the results observed for typical concentrations, are summarized in the following table 3.

In addition, γ-Glu-Val-Gly, γ-Glu-Cys, γ-Glu-Val, γ-Glu-Ala, γ-Glu-Ser similarly tested for their effect giving kokumi, the same methods as used above. The results are also listed in table 3.

Table 3
ConnectionConc. (g/DL)The intensity of kokumiThe sensory profile is evaluation
The initial tasteAverage taste/aftertaste
Control--00--
γ-Glu-Val-Gly0,0013,03,0Basically reinforced maturity, density and content.
γ-Glu-Nva0,00013,62,8Basically strengthened primary and secondary tastes.
γ-Glu-Cys0,013,13,1Basically reinforced the average taste and aftertaste, and the sample gave a faint smell of sulfur.

γ-Glu-Val0,013,12,4The aftertaste was quite weak.
γ-Glu-Ala0,24,54,3Basically gain the us tastes, similar to sour and sweet taste, during and after the initial taste.
γ-Glu-Ser0,23,63,0The initial taste was strong, but found the taste.

Thus, it is found that γ-Glu-Nva has excellent activity give kokumi, and that it is also perfectly enhances the initial taste towards the development of taste or character seasoning. This is a great increase in the initial taste, observed for γ-Glu-Nva, which is one of the extremely preferred features compared with what was observed for γ-Glu-Cys. Moreover, γ-Glu-Nva also has excellent stability, and it is also preferable in comparison with γ-Glu-Cys. Relative activity give kokumi, γ-Glu-Nva has a high titer greater than that of the well-known titles of dipeptides. In addition, γ-Glu-Nva has a short chain length, because it contains only two amino acid residue. Accordingly, it can be relatively easy to obtain at low cost in comparison with obtaining any Tripeptide containing 3 amino acid residue, and accordingly, the agent according to the invention likewise has sufficient advantages from a manufacturing point of view.

Primer: Effect γ-Glu-Nva to Basil

γ-Glu-Nva is a dipeptide of the initial taste. However, found that the consumption of the dipeptide in food, it is the effect of giving kokumi and action a little later than most well-known dipeptide initial taste, with high titers, such as γ-Glu-Abu, γ-Glu-Val. On the other hand, found that when comparing this dipeptide with generally accepted tripeptides medium taste/aftertaste, such as γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly, a dipeptide can quickly show the effect of giving kokumi. The authors of this invention have paid attention to this issue and conducted a search of herbs and/or spices that can be synchronized with the time during which the γ-Glu-Nva may be the effect of giving kokumi and activity, so as to enhance the taste of the first mentioned, and the inventors have investigated them in detail. In this regard, such characteristics not found in other γ-Glu peptides, which have a strong effect giving kokumi and activity.

More specifically, a quantitative test of the sensory evaluation was performed in the following ways. Commercially available typical herbs/spices in powdered form was dispersible in water in a concentration of 0.5 wt.%, in order thus to obtain a solution of herbs/spices. This solution was mixed with γ-Glu-Nva, γ-Glu-Cys-Gly, or γ-Glu-Abu in the quality of the ve test connection. According to the criterion of the pairwise comparison, the tasters were required comparative evaluation of the following three samples and solutions, "which one was preferred because it could exacerbate kusayama solution herbs/spices without changing the balance between them: (1) 0.02 wt.% γ-Glu-Cys-Gly, activity give kokumi which was identical 0,00015% wt. γ-Glu-Nva; (2) 0,00015% wt. γ-Glu-Abu, the amount of which was identical 0,00015% wt. γ-Glu-Nva; and (3) of 0.003 wt.% γ-Glu-Abu, the activity of giving kokumi which was identical to the activity observed for 0,00015% wt. γ-Glu-Nva. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for food for at least one year aggregate period of time and which could be judged that the difference in titer between theγ-Glu-Cys-Gly and γ-Glu-Val-Gly added to the solution, with taste umami/ savory taste, is approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with N (the number of participating tasters)=9.

In the following table 4 shows the number of tasters, who decided that 0,00015% wt. γ-Glu-Nva was preferred because it could reinforce kusayama solution herbs/spices without changing the balance between them." For herbs and/or spices derived from plants belonging toLabiataedefinitely shows the desired effects, however, the results observed for the Basilica, is shown as a typical example.

From the thus obtained results we can conclude the following: for γ-Glu-Nva showed a noticeable effect, as it may significantly and greatly enhance kusayama herbs and/or spices derived from plants belonging toLabiataeeven in cases where the titles of kokumi identical to each other, as in cases (1) and (3).

Table 4
N=9
SampleConc. (wt.%)SampleConc. (wt.%)No. tasters*
(1) γ-Glu-Nva0,00015γ-Glu-Cys-Gly0,029/9**
(2) γ-Glu-Nva0,00015γ-Glu-Abu0,000159/9**
(3) γ-Glu-Nva0,00015γ-Glu-Abu0,0038/9***
*: The number of tasters, who decided that γ-Glu-Nva was more repectfully, because it could reinforce kusayama solution Basilica belonging to aLabiataewithout changing the balance between them.
**: The result shows that γ-Glu-Nva is more preferred because it can increase kusayama solution Basilica belonging to aLabiataewithout changing the balance between them, at the significance level of 1%.
***: The result shows that γ-Glu-Nva is more preferred because it can increase kusayama solution Basilica belonging to aLabiataewithout changing the balance between them, at the significance level 5%.

The above results clearly indicate that for γ-Glu-Nva shown next noticeable effect: it can strengthen and make more favorable kusayama herbs and/or spices derived from plants belonging toLabiataewithout changing the balance between them", when compared with the effect observed for γ-Glu peptides with high activity give kokumi, such as γ-Glu-Cys-Gly and γ-Glu-Abu, in concentrations that are able to demonstrate such activity give kokumi. Examples of herbs and/or spices derived from plants belonging toLabiataeinclude a variety of plants, in addition to pechenocna and the Basilica, anise, oregano, sage, thyme, mint, Japanese peppermint, bergamot, marjoram, mint, lavender and rosemary, and the x is widely used all over the world, for example, spices, soups, sauces, processed meat products, ready-made and processed food and confectionery products, including Italian dishes. As discussed above, γ-Glu-Nva may allow improving the taste and flavor of food products that use herbs and/or spices derived from plants belonging toLabiataeat low cost, using it at the same time only in trace quantities, and thus, its use is quite preferable from the industrial point of view.

Example 3: Effectγ-Glu-Nva "miso"

γ-Glu-Nva is a dipeptide of the initial taste. However, found that the consumption of the dipeptide in food, it is the effect of giving kokumi and action a little later in comparison with other known dipeptide initial taste, with high titers, such as γ-Glu-Abu, γ-Glu-Val. On the other hand, found that when comparing this dipeptide with generally accepted tripeptides medium taste/aftertaste, such as γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly, a dipeptide can quickly show the effect of giving kokumi. The authors of this invention have paid attention to this question and searched for condiments or the like, which can be synchronized with the time during which the γ-Glu-Nva may be the effect of giving kokumi and the asset is awn, in order to enhance the taste of the first mentioned, and the inventors have investigated them in detail. In this regard, such characteristics not found in other γ-Glu peptides, which have a strong effect giving kokumi and activity.

More specifically, a quantitative test of the sensory evaluation was performed in the following ways. Commercially available "miso" (ingredients: soybean and barley) for common use was dispersible in hot water at a concentration of 10.0 wt.%, in order to obtain the solution "miso". This solution was mixed with γ-Glu-Nva, γ-Glu-Cys-Gly or γ-Glu-Abu in the quality of your connection. According to the method of criterion pairwise comparisons (paired test), the tasters were required comparative evaluation of the following three samples and solutions, "which one was preferred or favorable, because it could increase kusayama solution "miso" without changing the balance between them: (1) 0.02 wt.% γ-Glu-Cys-Gly, activity give kokumi which was identical 0.0001 wt.% γ-Glu-Nva; (2) to 0.0004 wt.% γ-Glu-Abu, the amount of which was identical to 0.0004 wt.% γ-Glu-Nva; and (3) of 0.003 wt.% γ-Glu-Abu, the activity of giving kokumi which was identical to the activity observed for 0,0004% wt. γ-Glu-Nva. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for food during not less than one year total period of time and which could judge, the difference in titer between γ-Glu-Cys-Gly and γ-Glu-Val-Gly added to the solution, with taste umami/savory taste, is approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with N (the number of participating tasters)=9.

In the following table 5 shows the number of tasters, who decided that to 0.0004 wt.% γ-Glu-Nva was preferred because it could reinforce kusayama solution "miso" without changing the balance between them."

From the thus obtained results we can conclude the following: for γ-Glu-Nva showed a noticeable effect, as it may significantly and greatly enhance kusayama "miso", even in cases where the titles of kokumi were identical to each other, as in cases (1) and (3).

Table 5
N=9
SampleConc. (wt.%)SampleConc. (wt.%)No. tasters*
(1) γ-Glu-Nva0,0004γ-Glu-Cys-Gly0,028/9**
(2) γ-Glu-Nva0,0004γ-Gl-Abu 0,00049/9***
(3) γ-Glu-Nva0,0004γ-Glu-Abu0,0039/9***
*: The number of tasters, who decided that γ-Glu-Nva was preferred because it could reinforce kusayama solution "miso", without changing the balance between them.
**: The result shows that γ-Glu-Nva is more preferred because it can increase kusayama solution "miso", without changing the balance between them, at the significance level 5%.
***: The result shows that γ-Glu-Nva is more preferred because it can increase kusayama solution "miso", without changing the balance between them, at the significance level of 1%.

The above results clearly indicate that for γ-Glu-Nva shown next noticeable effect: it can strengthen and make more favorable kusayama "miso" without changing the balance between them", when compared with the effect observed for γ-Glu peptides with high activity give kokumi, such as γ-Glu-Cys-Gly and γ-Glu-Abu, in concentrations that are able to demonstrate such activity give kokumi, "miso" is widely used, for example, the seasoning is, soup or broth, sauces and ready-made and processed food. As discussed above, γ-Glu-Nva may allow improving the taste and flavor of food products that use "miso", at low cost, using it at the same time only in trace amounts and therefore, its use is quite preferable from the industrial point of view.

Example 4: Effectγ-Glu-Nva in tomato ketchup

γ-Glu-Nva is a dipeptide of the initial taste. However, found that the consumption of the dipeptide in food, it is the effect of giving kokumi and action a little later in comparison with other known dipeptide initial taste, with high titers, such as γ-Glu-Abu, γ-Glu-Val. On the other hand, found that when comparing this dipeptide with generally accepted tripeptides medium taste/aftertaste, such as γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly, a dipeptide can quickly show the effect of giving kokumi. The authors of this invention have paid attention to this question and searched for condiments or the like, which can be synchronized with the time during which the γ-Glu-Nva may be the effect of giving kokumi and activity, so as to enhance the taste of the first mentioned, and the inventors have investigated them in detail. In this regard, these characteristics are not found, weeny other γ-Glu peptides possessing a strong effect giving kokumi and activity.

More specifically, a quantitative test of the sensory evaluation was performed in the following ways. Commercially available tomato ketchup for common use was dispersible in hot water at a concentration of 33.3 wt.%, in order to obtain the solution of tomato ketchup. This solution was mixed with γ-Glu-Nva, γ-Glu-Cys-Gly or γ-Glu-Abu in the quality of your connection. According to the method of criterion pairwise comparisons (paired test), the tasters were required comparative evaluation of the following three samples and solutions, "which one was preferred or favorable, because it could increase kusayama solution of tomato ketchup without changing the balance between them": (l) 0.02 wt.% γ-Glu-Cys-Gly, activity give kokumi which was identical to 0.0004 wt.% γ-Glu-Nva; (2) to 0.0004 wt.% γ-Glu-Abu, the amount of which was identical to 0.0004 wt.% γ-Glu-Nva; and (3) of 0.003 wt.% γ-Glu-Abu, the activity of giving kokumi which was identical to the activity observed for 0,0004% wt. γ-Glu-Nva. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for food for at least one year aggregate period of time and which could be judged that the difference in titer between γ-Glu-Cys-Gly and γ-Glu-Val-Gly added to the solution, with taste minds/ Olenin taste, approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with N (the number of participating tasters)=9.

In the following table 6 shows the number of tasters, who decided that to 0.0004 wt.% γ-Glu-Nva was preferred because it could reinforce kusayama solution of tomato ketchup without changing the balance between them." For other sauces or similar, containing tomato as an ingredient definitely shown the desired effects. However, the results observed for tomato ketchup, shown in table 6 as a typical example.

From the thus obtained results we can conclude the following: for γ-Glu-Nva showed a noticeable effect, as it may significantly and greatly enhance kusayama tomato, even in cases where the titles of kokumi were identical to each other, as in cases (1) and (3).

9/9**
Table 6
N=9
SampleConc. (wt.%)SampleConc. (wt.%)No. tasters*
(1) γ-Glu-Nva0,0004γ-Glu-Cys-Gly0,02
(2) γ-Glu-Nva0,0004γ-Glu-Abu0,00049/9**
(3) γ-Glu-Nva0,0004γ-Glu-Abu0,0039/9**
*: The number of tasters, who decided that γ-Glu-Nva was preferred because it could reinforce kusayama solution of tomato ketchup, without changing the balance between them.
**: The result shows that γ-Glu-Nva is more preferred because it can increase kusayama solution of tomato ketchup, without changing the balance between them, at the significance level of 1%.

The above results clearly indicate that for γ-Glu-Nva shown next noticeable effect: it can strengthen and make more favorable tomato kusayama, for example, seasonings and sauces containing tomato, without changing the balance between them", when compared with the effect observed for γ-Glu peptides with high activity give kokumi, such as γ-Glu-Cys-Gly and γ-Glu-Abu, in concentrations that are able to demonstrate such activity give kokumi. Tomato is widely used, for example, seasonings, soup or Boo gone, the sauces and ready-made and processed food. As discussed above, γ-Glu-Nva may allow improving the taste and flavor of food products that use tomato, at low cost, using it at the same time only in trace amounts and therefore, its use is preferred from the viewpoint of production.

1. Agent to give kokumi consisting of γ-Glu-Nva.

2. Food composition comprising from 0,0000005 to 0.003 wt.% γ-Glu-Nva; from 0.01 to 10 wt.% herbs and/or spices derived from plants belonging to Labiatae; and any other food ingredients.

3. Food composition comprising from 0,000002 to 0.008 wt.% γ-Glu-Nva; from 0.01 to 99.9 wt.% "miso"; and any other food ingredients, based on 100 parts by weight of the food composition.

4. Food composition comprising from 0,000002 to 0.008 wt.% γ-Glu-Nva; from 0.01 to 99.9 wt.% tomato; and any other food ingredients, based on 100 parts by weight of the food composition.

5. A method of obtaining a food product, comprising the steps:
add agent to give kokumi consisting of γ-Glu-Nva to other food ingredients, mixing them together; and
if you want, cooking the mixture of food ingredients.

6. The method according to p. 5, in which the food product contains the herb and/or spice obtained from a plant belonging to Labiatae.

7. The way is on p. 5, where these food ingredients include "miso".

8. The method according to p. 5, in which these food ingredients include tomato.

9. The method according to p. 5, wherein said product is in the form of a drink.

10. The method according to p. 5, wherein said product is a semi-finished product to obtain a food product.

11. The method according to p. 5, wherein said product is a semi-finished product to obtain a food product in the form of a drink.

12. The method according to any of paragraphs.5-11, in which stage the agent is added to give kokumi consisting of γ-Glu-Nva to food ingredients by mixing them together includes a step of controlling the concentration of γ-Glu-Nva in the semi-finished food product from 0,0000005 to 60 wt.%.

13. The method according to p. 12, further comprising the stage of adding the obtained semi-finished product to other food ingredients when controlling the concentration of γ-Glu-Nva in the resulting food product from 0,0000005 to 0.003 wt.%.

14. The method according to any of paragraphs.5-11, in which stage the agent is added to give kokumi consisting of γ-Glu-Nva to food ingredients by mixing them together includes a step of controlling the concentration of γ-Glu-Nva in the resulting food product, including the food product in the form of a drink, at the level of 0,0000005 to 0.003 wt.%.

15. A food product obtained by the method according to any of paragraphs.5-14.

16. P the food product p. 15, which is in the form of a drink.

17. Food product under item 15, which is a semi-finished product to obtain a food product.

18. Food product under item 15, which is a semi-finished product to obtain a food product in the form of a drink.

19. The way to enhance the taste and/or smell of the food product, including the state of the agent is added to give kokumi under item 1 or food composition according to any one of paragraphs.2-4, containing γ-Glu-Nva in a food product.

20. The method according to p. 19, wherein said product is in the form of a drink.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: food composition contains 0.000001 to 0.005 wt % γ-Glu-Nva-Gly; 0.005 to 80 wt % of ingredients obtained from pork or veal, and other food ingredients. The invention also relates to a method for obtaining a food product, which involves a phase of addition of a kokumi flavouring agent representing the above composition to other food ingredients; a food product obtained by means of the above method, and a flavouring method of taste and/or smell of food product using the above composition.

EFFECT: invention allows obtaining food composition with agent γ-Glu-Nva-Gly that shows increased activity of CASR in comparison to known equivalents and has improved kokumi flavouring effect.

14 cl, 1 dwg, 10 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: disclosed is a method of producing pure crystalline D-isoglutamyl-D-trytophan which involves a step of removing protection from essentially pure N-tert-butoxycarbonyl-D-isoglutamyl-D-tryptophan or diester thereof to yield essentially pure D-isoglutamyl-D- tryptophan. An amorphous ammonium alt of D-isoglutamyl-D- tryptophan (1:1) is also disclosed. Also disclosed is a method of producing a pure monoammonium salt of D-isoglutamyl-D-tryptophan from essentially pure N-tert-butoxycarbonyl-D- isoglutamyl-D-tryptophan. Disclosed is a compound H-D-Glu-(γ-D-Trp-OR2)-α-OR1 and pharmaceutically acceptable acid addition salts thereof. Disclosed is a solid pharmaceutical composition and use thereof as an immunodepressant or anti-psoriasis agent.

EFFECT: improved method.

51 cl, 14 ex, 8 dwg, 1 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to crystalline modifications: 1 (polymorphous form F), 2 (polymorphous form I) and 3 (polymorphous form X) of monosodium salt of D-isoglytamyl-D-tryptophan (1:1) characterised by powder X-ray pattern peaks presented in the application materials, as well as to pharmaceutical compositions containing them. The invention describes their use for treating various diseases and body conditions of at least one autoimmune diseases specified in a group consisting of psoriasis, atopic dermatitis and rheumatoid arthritis.

EFFECT: present invention describes the methods for producing the declared crystalline modifications of monosodium salt of D-isoglytamyl-D-tryptophan (1:1).

42 cl, 4 ex, 9 dwg

The invention relates to products derived from histamine and, in particular, the condensation products of histamine or methylsiloxanes histamine and amino acids, the method of their preparation and use as active principle in areas such as therapy and cosmetology, as well as the factor (agent), improving the stability of compositions used in therapy, cosmetology, agriculture and food industry (region)

The invention relates to medicine, namely to new peptide structures with immunomodulatory properties, and preparations on their basis

The invention relates to medicine, namely to compounds having immunomodulatory properties

FIELD: food industry.

SUBSTANCE: base includes organic acids or their salts, amino acids, peptides and aromatic compositions and 8 - 80 wt % of natural compositions taken from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The base is produced by way of procariotic fermentation with bacteria taken from the group consisting of Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium casei, Corynebacterium efficiens, Brevibacterium lactofermentum and Bacillus subtilis; the said base is unpurified. The base is applied in various food products, for example, in broths, dehydrated soups, sauces, beverages, cereals and sponge-cakes. The culinary food product contains the pungent base in an amount of 0.01 - 50 wt %.

EFFECT: taste base is used for taste intensification, is natural and stable during storage and has no yeast after-taste.

27 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: food composition contains 0.000001 to 0.005 wt % γ-Glu-Nva-Gly; 0.005 to 80 wt % of ingredients obtained from pork or veal, and other food ingredients. The invention also relates to a method for obtaining a food product, which involves a phase of addition of a kokumi flavouring agent representing the above composition to other food ingredients; a food product obtained by means of the above method, and a flavouring method of taste and/or smell of food product using the above composition.

EFFECT: invention allows obtaining food composition with agent γ-Glu-Nva-Gly that shows increased activity of CASR in comparison to known equivalents and has improved kokumi flavouring effect.

14 cl, 1 dwg, 10 tbl, 5 ex

FIELD: food industry.

SUBSTANCE: base contains organic acids, amino acids, peptides, aroma substances and 0.01 wt % - 80 wt % of compounds produced by way of extraction of raw materials of vegetal, animal or microbiological origin, fermentation or biocatalysis, such substances chosen from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The natural flavour base production method envisages fermentation on a substrate, with application of Corynebacterium, Brevibacterium, Bacillus genus microorganisms, and cells destruction leading to production of a primary extract including cell debris. The base is used in various food products, for example, in broths, soups, sauces and beverages. The natural flavour base is added to food in an amount of 0.01 - 50 wt % of the total food weight.

EFFECT: flavour base is natural, has no chemical residual savour and has long storage life.

28 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: alternative methods are proposed to produce a yeast extract to give taste of "kokumi" to food products, containing peptide γ-Glu-X or γ-Glu-X-Gly. One version of proposed methods includes growing of yeast in a nutrient medium containing peptide selected from the group that consists of γ-Glu-X, γ-Glu-X-Gly and X-Gly, and preparation of the yeast extract from the produced cells. Another version includes interaction of γ-glutamiltransferase on the yeast extract containing X or X-Gly, produced from yeast grown in the nutrient medium, to which amino acid X or peptide X-Gly is added. X is an amino acid or its derivative, different from Cys and its derivatives. The yeast extract is described to give "kokumi" taste to food products and produced by the specified methods, containing peptide selected from the group that consists of γ-Glu-X and γ-Glu-X-Gly, in the amount of 0.005% or more of dry weight of the yeast extract, differing by the fact that X is amino acid or its derivative, different from Cys and its derivatives.

EFFECT: invention makes it possible to produce a yeast extract with improved properties.

24 cl, 8 dwg, 14 tbl, 13 ex

FIELD: food industry.

SUBSTANCE: culinary supplement contains decreased amount of monosodiumglutamate (MSG) from 1 to 2 wt %, inosine monophosphate (IMP) and guanosine monophosphate (GMP) from 0.05 to 0.1 wt %, from 10 to 20 wt % of food acids and sugars, from 20 to 45 wt % of macromolecules. Method of preparation of this culinary supplement involves cutting vegetables and/or meat in mixture or separately, blanching vegetables, enzymatic hydrolysis of vegetables and/or meat in mixture or separately, stopping hydrolysis and concentrating.

EFFECT: method of giving and/or intensifying tones of dish taste involves adding a culinary supplement in the amount of 0,001 to 10% in conversion to the total dish weight; invention ensures storage stable culinary supplement providing refined taste in food products without unnecessary chemical aftertaste.

20 cl, 3 ex, 2 dwg

FIELD: food industry.

SUBSTANCE: culinary supplement contains decreased amount of monosodiumglutamate (MSG) from 1 to 2 wt %, inosine monophosphate (IMP) and guanosine monophosphate (GMP) from 0.05 to 0.1 wt %, from 10 to 20 wt % of food acids and sugars, from 20 to 45 wt % of macromolecules. Method of preparation of this culinary supplement involves cutting vegetables and/or meat in mixture or separately, blanching vegetables, enzymatic hydrolysis of vegetables and/or meat in mixture or separately, stopping hydrolysis and concentrating.

EFFECT: method of giving and/or intensifying tones of dish taste involves adding a culinary supplement in the amount of 0,001 to 10% in conversion to the total dish weight; invention ensures storage stable culinary supplement providing refined taste in food products without unnecessary chemical aftertaste.

20 cl, 3 ex, 2 dwg

FIELD: biotechnologies.

SUBSTANCE: alternative methods are proposed to produce a yeast extract to give taste of "kokumi" to food products, containing peptide γ-Glu-X or γ-Glu-X-Gly. One version of proposed methods includes growing of yeast in a nutrient medium containing peptide selected from the group that consists of γ-Glu-X, γ-Glu-X-Gly and X-Gly, and preparation of the yeast extract from the produced cells. Another version includes interaction of γ-glutamiltransferase on the yeast extract containing X or X-Gly, produced from yeast grown in the nutrient medium, to which amino acid X or peptide X-Gly is added. X is an amino acid or its derivative, different from Cys and its derivatives. The yeast extract is described to give "kokumi" taste to food products and produced by the specified methods, containing peptide selected from the group that consists of γ-Glu-X and γ-Glu-X-Gly, in the amount of 0.005% or more of dry weight of the yeast extract, differing by the fact that X is amino acid or its derivative, different from Cys and its derivatives.

EFFECT: invention makes it possible to produce a yeast extract with improved properties.

24 cl, 8 dwg, 14 tbl, 13 ex

FIELD: food industry.

SUBSTANCE: base contains organic acids, amino acids, peptides, aroma substances and 0.01 wt % - 80 wt % of compounds produced by way of extraction of raw materials of vegetal, animal or microbiological origin, fermentation or biocatalysis, such substances chosen from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The natural flavour base production method envisages fermentation on a substrate, with application of Corynebacterium, Brevibacterium, Bacillus genus microorganisms, and cells destruction leading to production of a primary extract including cell debris. The base is used in various food products, for example, in broths, soups, sauces and beverages. The natural flavour base is added to food in an amount of 0.01 - 50 wt % of the total food weight.

EFFECT: flavour base is natural, has no chemical residual savour and has long storage life.

28 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: food composition contains 0.000001 to 0.005 wt % γ-Glu-Nva-Gly; 0.005 to 80 wt % of ingredients obtained from pork or veal, and other food ingredients. The invention also relates to a method for obtaining a food product, which involves a phase of addition of a kokumi flavouring agent representing the above composition to other food ingredients; a food product obtained by means of the above method, and a flavouring method of taste and/or smell of food product using the above composition.

EFFECT: invention allows obtaining food composition with agent γ-Glu-Nva-Gly that shows increased activity of CASR in comparison to known equivalents and has improved kokumi flavouring effect.

14 cl, 1 dwg, 10 tbl, 5 ex

FIELD: food industry.

SUBSTANCE: base includes organic acids or their salts, amino acids, peptides and aromatic compositions and 8 - 80 wt % of natural compositions taken from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The base is produced by way of procariotic fermentation with bacteria taken from the group consisting of Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium casei, Corynebacterium efficiens, Brevibacterium lactofermentum and Bacillus subtilis; the said base is unpurified. The base is applied in various food products, for example, in broths, dehydrated soups, sauces, beverages, cereals and sponge-cakes. The culinary food product contains the pungent base in an amount of 0.01 - 50 wt %.

EFFECT: taste base is used for taste intensification, is natural and stable during storage and has no yeast after-taste.

27 cl, 5 ex

FIELD: biotechnology.

SUBSTANCE: invention also relates to a nutritional composition comprising herbs and/or spices obtained from plants belonging to Labiatae, "miso" or tomato, the method of preparing a food product comprising the step of adding the agent for imparting Kokumi to food ingredients, food product obtained using the said method, and the method of enhancing taste and/or odour of the food product using the agent for imparting Kokumi.

EFFECT: invention enables to obtain the agent for imparting Kokumi γ-Glu-Nva, which exhibits enhanced activity CASR compared with the known analogues, and has the improved effect of imparting Kokumi.

20 cl, 1 dwg, 6 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and food industry. Disclosed is a kokumi-imparting agent which is γ-Glu-Abu. Also disclosed is a complex kokumi-imparting agent, which includes a combination of not less than 1000 ppm γ-Glu-Abu; and at least one or two amino acids or peptides selected from a group consisting of γ-Glu-X-Gly, where X is an amino acid or amino acid derivative, γ-Glu-Val-Y where Y is an amino acid or amino acid derivative, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-"ол", γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (0), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and γ-Glu-Cys (S-Me). Also disclosed is a seasoning composition which includes not less than 1000 ppmw γ-Glu-Abu. The invention also describes methods of producing a food product and a beverage, as well as intermediate products for producing said food product and beverage, which include a step of adding γ-Glu-Abu to other ingredients to obtain said end products containing more than 0.002 g/dl (20 ppm) γ-Glu-Abu. The invention also describes a food product, a beverage and intermediate products for producing said food product and beverage, obtained using said methods and containing more than 20 ppm (specifically less than 200 ppm) γ-Glu-Abu and optionally at least one edible organic acid or a salt thereof, table salt, along with a carrier acceptable for food products and/or at least one or two seasoning ingredients. The invention discloses methods of boosting taste of a food product or beverage, which include a step of adding not less than 400 ppmw γ-Glu-Abu to the food product or beverage.

EFFECT: invention enables to impart kokumi to food products and beverages.

34 cl, 1 dwg, 7 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to crystalline modifications: 1 (polymorphous form F), 2 (polymorphous form I) and 3 (polymorphous form X) of monosodium salt of D-isoglytamyl-D-tryptophan (1:1) characterised by powder X-ray pattern peaks presented in the application materials, as well as to pharmaceutical compositions containing them. The invention describes their use for treating various diseases and body conditions of at least one autoimmune diseases specified in a group consisting of psoriasis, atopic dermatitis and rheumatoid arthritis.

EFFECT: present invention describes the methods for producing the declared crystalline modifications of monosodium salt of D-isoglytamyl-D-tryptophan (1:1).

42 cl, 4 ex, 9 dwg

Up!