Kokumi flavouring agent

FIELD: biotechnologies.

SUBSTANCE: food composition contains 0.000001 to 0.005 wt % γ-Glu-Nva-Gly; 0.005 to 80 wt % of ingredients obtained from pork or veal, and other food ingredients. The invention also relates to a method for obtaining a food product, which involves a phase of addition of a kokumi flavouring agent representing the above composition to other food ingredients; a food product obtained by means of the above method, and a flavouring method of taste and/or smell of food product using the above composition.

EFFECT: invention allows obtaining food composition with agent γ-Glu-Nva-Gly that shows increased activity of CASR in comparison to known equivalents and has improved kokumi flavouring effect.

14 cl, 1 dwg, 10 tbl, 5 ex

 

The technical field

The present invention relates to an agent for imparting kokumi and complex agent to give kokumi containing peptide active CaSR agonist. In addition, the present invention also relates to a food composition containing the peptide active CaSR agonist, at a concentration of not less than the specified level.

The level of technology

Requirements of consumers to the taste and appeal of food products in recent years has increased, for example, because of the diversity of food habits of people. In this regard, the taste and appeal of food in a conventional manner expressed through the five basic tastes - sweet, salty, sour, bitter and umami ("meat" taste)but correspondingly increases the need to create a new agent, able to give food a wonderful kokumi. Kokumi refers to the taste, which cannot be expressed mentioned five basic tastes, because it provides additional sensations to the basic tastes, such as density, weight (fullness), continuity and harmony (Approx. "Kokumi"aboutcorresponds to the term "mouthfeel" -"mouth feel").

On the other hand, the calcium-sensing receptor (CaSR) is also called calcium receptor and signaling from this receptor can kontrolirovat the ü many biological functions in living organisms, therefore, substances active CaSR agonist, can be used as agents for imparting kokumi (see patent documents 1 and 2 and non-patent document 4, as described below).

There are various profiles of the development of taste in the said "kokumi". In this regard, there is a need to create an agent that is able to give food, kokumi the mid-palate and finish, and with a high titer. In addition, since the agent to give kokumi usually use in food, consequently, he must possess excellent stability.

Accordingly, it took the search among the many variants of compounds exhibiting the desired activity of the CaSR agonist, so as to detect a substance that is able to give kokumi other material (i.e. food or drinks)with a more prominent effect giving kokumi, in particular kokumi initial taste, which has excellent stability and which can be easily obtained with low cost, and thus to provide an agent for giving kokumi consisting of such substances, as well as comprehensive agent to give kokumi containing substance and other substances, active CaSR agonist, in combination.

On the other hand, in the case of some γ-glutamyl peptides, each of which carries an OS is atok γ-glutamine at the N-end known peptides synthesized as substrates, for example, for studies of the enzymatic activity (see patent document 3 and non-patent documents 1 to 3 mentioned later), but still do not know of any cases when γ-Glu-Nva-Gly actually used in food products, or of any of its isolation from natural materials to add to the food.

In addition, in the above patent document 1 is described, for example, that γ-Glu-X-Gly (where X represents an amino acid or its derivative) is a compound having the activity of a CaSR agonist, but in this patent document are not described, for example, in the examples that γ-Glu-Nva-Gly was synthesized in practice, and its effects are evaluated, and, more specifically, in this patent document is not described anywhere in particular, this Tripeptide. In this respect, the full contents of patent documents 1 and 2 are included here by reference, as if their contents were directly included in the present description.

The documents of the prior art

Patent documents

Patent document 1: WO 2007/055393, abstract;

Patent document 2: WO 2008/139945, abstract;

Patent document 3: WO 2007/066430, summary.

Non-patent documents

Non-patent document 1: Molecular Pharmacology (1982), 21(3), 629-36;

Non-patent document 2: Biokhimiya (Moscow) (1972), 37(4), 757-61;

Non-patent document is NT 3: The Journal of Biological Chemistry, (2010), 285 (2), 1016-22.

The invention

The present invention consists in detecting the majority of compounds exhibiting the desired activity of the CaSR agonist, so as to detect a substance that is able to give kokumi superior taste, in particular kokumi medium taste/aftertaste, and with excellent stability and high titer, in order thus to ensure the agent to give kokumi consisting of such substances, as well as comprehensive agent to give kokumi containing a combination of such substances with other substances, active CaSR agonist. Another object of the invention is the provision of food composition containing the above substance in a concentration of not less than the specified level.

Result of search of many compounds, the authors of this invention have unexpectedly found that γ-Glu-Nva-Gly (L-γ-glutamyl-L-Norwell-glycine) has a high activity of the CaSR agonist and the effect of imparting excellent kokumi, and that he, in particular, gives the food kokumi with a picture of the development of taste, appropriate kokumi medium taste/aftertaste. In addition, the inventors have found that the observed γ-Glu-Nva-Gly has a very high titer of not less than 10 times the titer observed for γ-Glu-Val-Gly as one of the tripeptides, SAS is different from γ-Glu-Nva-Gly, has excellent stability and has such a favourable character development of taste, which demonstrates a high ability to focus on kokumi medium taste/aftertaste. In addition, the inventors have further found that γ-Glu-Nva-Gly can serve as an independent agent to give kokumi. In addition, the inventors have likewise found that the preferred food composition with improved kokumi, can be obtained by the inclusion of γ-Glu-Nva-Gly in food products. In addition, a comprehensive agent to give kokumi can be obtained by combining the specified substances with other substances, each of which shows the activity of the CaSR agonist. The authors thus came to the present invention.

More specifically, the present invention herein relates to an agent for flavor, kokumi consisting of γ-Glu-Nva-Gly.

In addition, the present invention also relates to a food composition containing γ-Glu-Nva-Gly (herein, the composition identified as "food composition according to the invention"). The present invention also provides a complex agent to give kokumi containing in combination (a) γ-Glu-Nva-Gly and (b) one or at least two amino acids or peptide selected from the group consisting of γ-Glu-X-Gly, where X represents an amino acid or derivative is minamikata, γ-Glu-Val-Y, where Y represents an amino acid or derived amino acids, γ-Glu-Abu, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, y-Glu-Ile, γ-Glu-t-Leu, γ-Glu-Cys (S-Me).

The present invention provides an agent for giving kokumi with great action and, in particular, gives an excellent and unique kokumi medium taste/aftertaste, with the character development of taste, which has the profile shown, for example, in Fig. 1, and also has excellent stability and which can be easily obtained with low cost, as well as a complex agent to give kokumi containing it. In addition, the present invention provides excellent food composition comprising a substance having an excellent effect of imparting kokumi in a concentration not less than the specified level.

The use of an agent to make kokumi according to the invention may allow giving foods with low fat sensations or impressions density and smoothness as fat. Accordingly, received a food product containing the agent according to the invention can maintain the impression of a density similar to those observed in the original food to reduce the content of fat, even when the fat content is reduced, and, thus, agento the invention allows to obtain low-calorie foods, useful for health. Examples of such foods include foods containing meat, or related products and dairy products. In particular, when using a nutritional product containing the agent to give kokumi according to the invention, the user can get a sense of density and smoothness as fat, and not immediately at hand, and after a short time thereafter.

Brief description of drawings

In Fig. 1 shows the profile of the development of taste, observed for the agent to give kokumi medium taste/aftertaste.

The preferred embodiment of the invention

The substance of γ-Glu-Nva-Gly, used according to the invention, contains L-γ-glutamyl-L-Norvaline-glycine, in which two amino acids are linked together through a peptide bond, and/or its salts, in particular it suitable for consumption of salt.

The substance of γ-Glu-Nva-Gly has a great effect giving kokumi and, thus, it can be used as an agent to impart kokumi. γ-Glu-Nva-Gly you can use so that food composition, which give kokumi contains the Tripeptide in number (all parts and percentages are by weight) in the range from 0.1 mlrd (billions of shares) to 99.9 wt.%, preferably from 1 mlrd to 10 wt.% and more preferably from 0.01 ppm (ppm) up to 1 wt.% from on the total weight of the food composition. In other words, another variant of implementation of the present invention relates to a food composition containing γ-Glu-Nva-Gly, and preferably the nutritional composition containing γ-Glu-Nva-Gly in a quantity ranging from 0.1 mlrd to 99.9 wt.%. More preferably, the present invention relates to a food composition containing γ-Glu-Nva-Gly in a quantity ranging from 0.1 mlrd to 50 ppm

In addition, the agent for giving kokumi according to the invention or γ-Glu-Nva-Gly can also be used in combination with at least one additional ingredient spices selected from the group consisting of amino acids such as monosodium glutamate (MSG), nucleic acids such as insimenator (IMP), inorganic salts such as sodium chloride, organic acids such as citric acid, and various types of yeast extracts, so as to obtain provide benefits seasoning with improved kokumi, compared to kokumi obtained using such additional ingredients for seasonings separately.

According to the invention, the term "kokumi" refers to the taste, which cannot be expressed through the five basic flavors or sweet taste, salty taste, sour taste, bitter taste and minds, and, more specifically, refers to the taste, with secondary flavors of the basic tastes, t is such as density, weight (fullness), duration and harmony, strengthened in addition to the basic tastes. In addition, the term "giving kokumi" herein means that the five basic tastes, pronounced sweet taste, salty taste, sour taste, bitter taste and minds, reinforced, while the subject at the same time the impression of tastes, additional to the basic tastes, such as density, weight (fullness), duration and harmony associated with the first mentioned. In addition, it can be described also as the enhancement effect of the taste. Thus, γ-Glu-Nva-Gly, serving as agent for flavor according to the invention can likewise be termed as a "flavor enhancer". Agent to give kokumi according to the invention, or γ-Glu-Nva-Gly, can also be used as an amplifier of sweet taste, the amplifier salty taste, the amplifier sour taste, the amplifier bitter taste or amplifier minds.

In addition, the taste of food may change over time in consumption and after him, and these changes of taste is usually specified as the initial taste, average taste and aftertaste, in order, starting from the moment of eating. Although in reality they are a relative concept, but the initial taste, average taste and aftertaste of the subject, in General, is defined as the taste, on loudamy within the time continuing from 0 to 2 seconds 2 to 5 seconds and 5 seconds food intake accordingly. Taste, observed over time, continuing from 0 to 5 seconds, denoted herein as the "initial/average taste, and taste, observed in the course of time, lasting from 2 to about 30 seconds, is designated as "average taste/aftertaste" (see the data plotted on the graph in Fig. 1). As for the taste, if taste is divided into three divisions, for tasters (people who use the food to be evaluated) it is difficult to focus on the assessment, and habitually used by the test assesses taste split into two divisions.

The effects of the substance having the activity of CaSR, kokumi and character development of taste can be confirmed, for example, the way the human sensory test for the evaluation of taste. An example of such a human touch samples for the evaluation of taste illustrated in the examples of this patent application, but the touch test to evaluate taste, suitable according to the invention is not limited to this particular breakdown.

The term "CaSR"used in this description, refers to the calcium-sensing receptor, which belongs to the class From 7-Trevoga transmembrane receptor, and which, therefore, also referred to as calcium receptor". Term is n "CaSR agonist" is used in this description, refers to a substance that communicates with the above CaSR, to thus activate the receptor CaSR. In addition, the term "activate CaSR"used herein indicates that the ligand binds to CaSR, to thus activate protein associated with guaninom the nucleotide, and to transmit the signals received from him. In addition, the ability of a substance to form a relationship with CaSR, in order to activate it, is designated as "the activity of the CaSR agonist".

Currently, the method of screening compounds with the activity of the CaSR agonist specifically provided herein, but the screening phase, the compounds are not limited to the stages listed below.

1) the stage of adding the test substance to the system for measuring the activity of CaSR used to determine the CaSR activity, and stage of determining the activity of CaSR;

2) phase comparison CaSR activity observed when adding the test substance to the system for measuring the activity, with activity observed prior to the addition of substances; and

3) qualifying substances with the activity of the CaSR agonist when added to a system for measuring the activity of CaSR.

The determination of the activity of CaSR in this way can be performed using, for example, measurement using cells obladaushi the ability to Express the CaSR. The above cells may represent cells with endogenous expression of CaSR or genetically recombinant cells with exogenously introduced gene for the expression of CaSR. The above system for measuring the activity of CaSR is not limited to any specific system, while it allows the detection of the connection (or reaction) between activating CaSR substance and CaSR or until it can emit or issue subject detection signal in response to the education connection (or reaction) between activating CaSR substance and CaSR inside the cells by adding extracellular ligand (activating substance)specific CaSR, to the above-mentioned cells, which are able to Express the CaSR. If the CaSR activity detected during the reaction with the test substance, it can be concluded that the test substance has a desirable activity stimulation of CaSR.

An example of the above CaSR, preferably used herein is a human CaSR encoded by the genome of CaSR person registered in GenBank under the access number NM_000388. In this respect, however, CaSR is not limited to a protein encoded by a gene having the above sequence registered CaSR, and may be any protein that can be encoded gene, with at least 60%, preferably not less than 80%, and more preferably at least 90% sequence homology with the sequence of the above gene, provided that the protein encoded by this gene has the desirable function of the CaSR. In this regard, the function of the CaSR can be checked by obtaining cells expressing these genes, and then determine any changes in current and/or any changes in the concentration of calcium ion inside cells observed when adding calcium to the system containing the cells.

In respect of the above CaSR its source is not limited to any particular source, and it can be a CaSR obtained from a combination of animal species, including mice, rats and dogs, in addition to the above CaSR person.

As discussed above, the CaSR activity can be confirmed through the use of living cells that can Express the CaSR, or SNiP, of the membranes of cells that can Express the CaSR or its fragment, or systemin vitrocontaining CaSR or protein in the form of its fragment.

An example in which use such living cells below, but the present invention is absolutely no way limited to this example.

CaSR Express in cultured cells, such as oocytes Xenopus, cells of the ovary obtained from hamsters, and fetal cells of human kidney. This Express the human CaSR can be done by introducing, the plasmid with the exogenous gene, CaSR gene, which was subjected to processing by cloning in the form of plasmids or crnc obtained using the gene as a matrix. Suitable for detection of this reaction can be electrophysiological methods or fluorescence indicator for detection of any increase in the concentration of calcium inside the cells.

The expression of CaSR source was confirmed by the presence of any response observed when adding calcium or activator, having specificity to it. More specifically, suitable according to the invention as desired cells are cells in which the intracellular electric current detected when adding calcium at a concentration of about 5 mm, or cells, in which the emission of fluorescent rays see adding a fluorescent indicator. In this regard, the concentration of calcium added to the cells in different ways change to determine the dependence of the intensity of intracellular current on the concentration of calcium. Then the test substance was diluted to concentrations ranging from approximately 1 μm to 1 mm, the resulting suspension is added to the oocytes or cultured cells, and then the CaSR activity in the presence of the above test substance is measured, to thereby determine the asset is ity of the CaSR agonist for the test substance.

More specifically, as such a test for determining the activity of the CaSR agonist according to the invention are suitable, for example, the test shown in test examples described in this description, but the test for determining the activity is not limited to such specific test.

Amino acids or peptides used in complex agent to give kokumi according to the invention in combination with γ-Glu-Nva-Gly include, for example, one or at least two amino acids or peptide selected from the group consisting of γ-Glu-X-Gly (where X represents an amino acid or derived amino acid other than Nva), γ-Glu-Val-Y (where Y represents an amino acid or derived amino acid), γ-Glu-Nva, γ-Glu-Abu, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val; γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-ol, γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (O), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu, γ-Glu-Cys (S-Me). In this respect, the amino acids may likewise include, for example, neutral amino acids such as Gly, Ala, Val, Leu, Ile, Ser, Thr, Cys, Met, Asn, Gln, Pro, Hyp, and t-Leu; acidic amino acids such as Asp, Glu; basic amino acids such as Lys, Arg and His; aromatic amino acids such as Phe, Tyr and Trp; as well as homoserine, citrulline, ornithine, α-aminobutyric acid, Norvaline, norleucine and taurine. In addition, the amino acids used for the obreteniyu, can be a artificial amino acids (with non-protein structure), such as tert-leucine, cycloleucine, α-aminoadamantane acid, L-penicillamine, allochronic and alliteration. In this regard, the peptide: γ-Glu-X-Gly-X can represent the above amino acid or its derivative, but preferably used according to the invention are amino acids or their derivatives, other than Cys. One of them is preferably used according to the invention in combination with γ-Glu-Nva-Gly include, for example, γ-Glu-Val-Gly, γ-Glu-Abu-Gly, γ-Glu-tLeu-Gly, γ-Glu-Nva and γ-Glu-Abu.

In particular, the agent for giving kokumi according to the invention consists of γ-Glu-Nva-Gly and has the ability to make unique and excellent kokumi initial taste and profile development of taste (smell), shown in Fig. 1. Accordingly, it is preferable that γ-Glu-Nva-Gly was used in combination with a peptide, such as γ-Glu-Val-Gly with developmental profile of taste, different from the first mentioned.

In the description of this patent, the following abbreviated forms of amino acids (residues) represent the following amino acids, respectively:

(1) Gly: glycine;

(2) Ala: alanine;

(3) Val: valine;

(4) Leu: leucine;

(5) Ile: isoleucine;

(6) Met: methionine;

(7) Phe: phenylalanine;

(8) Tyr: tyrosine;

(9) Trp: tryptophan;

(10) His: histidine;

(11) Lys: lysine;

(12) Arg: ar is Yining;

(13) Ser: serine;

(14) Thr: threonine;

(15) Asp: aspartic acid;

(16) Glu: glutamic acid;

(17) Asn: asparagine;

(18) Gln: glutamine;

(19) Cys: cysteine;

(20) Pro: Proline;

(21) Orn: ornithine;

(22) Sar: sarcosine;

(23) Cit: citrulline;

(24) N-Val: (or Nva): Norvaline (2-aminosalicilova acid);

(25) N-Leu (or Nle): norleucine;

(26) Abu: α-aminobutyric acid;

(27) Tau: taurine;

(28) Hyp: hydroxyproline;

(29) t-Leu: tert-leucine;

(30) Cle: cycloleucine;

(3l) Aib: α-amino-somalina acid (2-methylalanine);

(32) Pen: L-penicillamine;

(33) ALLO-Thr: allochrony;

(34) ALLO-Ile: alliteration.

In addition, the term "derived amino acids"used herein refers to the many derivatives of the foregoing amino acids, and specific examples include a special amino acids and synthetic amino acids, aminoalcohols or amino acids, amino acid side chains of which, such as carboxyl groups, amino groups and/or thiol group of cysteine, are replaced by many deputies. Examples of such substituents include alkyl group, acyl group, hydroxyl group, amino group, alkylamino, a nitrogroup, sulfonyloxy group or different protective groups. Thus, examples of amino acid derivatives include Arg (NO2): N-γ-nitroarginine, Cys (SNO): S-nitro is istein, Cys (S-Me): S-methylcysteine, Cys (S-allyl): S-allylcysteine, Val-NH2: valinamide, and Val-ol: valinol (2-amino-3-methyl-1-butanol). At the same time, the peptide: γ-Glu-Cys(SNO)-Gly, used according to the invention is a peptide represented by the following structural formula, and the symbol: "(O)"presented in the above formulas: γ-Glu-Met (O) and γ-Glu-Cys (S-Me) (O), means that each of these peptides has sulfoxide structure. Symbol(γ)from γ-Glu means that another amino acid is linked to glutamic acid via carboxyl group, located at the γ-position of the latter.

[Chemical formula 1]

γ-Glu-Nva-Gly and the amino acids and peptides used in combination according to the invention can be a commercially available amino acids and peptides, if you can buy them on the market, or they can be obtained by any known method, such as (l) methods of chemical synthesis or (2) the method using an enzymatic reaction, but more convenient is the use of the method of chemical synthesis. γ-Glu-Nva-Gly, used according to the invention is very short in length because it contains only three amino acid residue and, thus, is more convenient to adopt the method of chemical synthesis. For this reason, the use of this Tripeptide is quite predominant promyshlennoi point of view. In addition, during the chemical synthesis of γ-Glu-Nva-Gly, used according to the invention, and amino acids and peptides used in combination with them, obtaining them can be made by synthesis or poluentes these oligopeptides using the device for the synthesis of peptides. As such a method of chemical synthesis of these peptides according to the invention may be suitable, for example, the method of solid-phase peptide synthesis. Thus obtained peptide can then be cleaned by conventional means, such as ion-exchange chromatography method, the method obremenitve high-performance liquid chromatography or a method of affinity chromatography. This method of solid-phase peptide synthesis and then used the method of purifying peptides is well known in this field.

Alternatively, upon receipt of γ-Glu-Nva-Gly, used according to the invention, and amino acids and peptides used in combination with it, when using the enzymatic reaction, obtaining them can be done using the method described in the International patent documentation, publicly available, WO 2004/011653. More specifically, they can be obtained by reaction of the amino acid or peptide, in which the terminal carboxyl group is esterified or aminirovanie with another amino acid, amino group which nah who is in a free state (for example, amino acid, the carboxyl group of which is protected) in the presence of peptidase enzyme and then by purification of the resulting dipeptide or Tripeptide. Examples of such peptidebased enzymes are the culture of microorganisms having the ability to produce the peptide; the cell bodies of microorganisms isolated from the culture; or the product obtained by processing cell bodies of microorganisms; or peptidase enzyme derived from microorganisms. At the same time in this document assume that the description of WO 2004/011653 included in the description of this application.

In addition to the above methods of enzymatic obtain and methods chemical synthesis of peptides used according to the invention, are often included in natural products such as plants, such as vegetables and fruits, microorganisms such as yeast and other natural resources. When they are present in natural substances, they can be extracted from these substances, and the resulting selected products can likewise be used according to the invention.

Agent to give kokumi or complex agent to give kokumi according to the invention can be used as a seasoning without any special further processing or can be mixed with carriers suitable for food and drink, or with Ingrid the customers for other spices, so you get a variety of seasonings. Examples of such other ingredients for spices include the spices, sugars, sweeteners, food fibers, vitamins, amino acids such as monosodium glutamate (MSG), a nucleic acid, such as insimenator (IMP), inorganic salts such as sodium chloride and organic acids such as citric acid, as well as various kinds of yeast extracts.

In particular, foods with low fat content, preferred as food compositions, each of which contains the agent to give kokumi or complex agent to give kokumi according to the invention are, by nature, foods containing fats, and, in particular, foods, the fat content of which is reduced. In this regard, the term "fat(s)" is synonymous with the term "oil and grease", where fats include fats in solid and liquid forms, and they can be an animal fat or vegetable fat.

Examples of such food products with reduced fat include dairy products such as milk, yogurt, butter and cream; animal fats and fat-containing oils and/or vegetable oil and fat-containing foods such as margarine, milk, coffee, sauces and seasoning for sauces; emulsified food products, such kakshapati for salads and mayonnaise; different types of curries and stews that contain recycled or subjected to cooking meat or the like; and a variety of soups containing meat extracts, or meat essence. In addition, these foods with reduced fat this way include, for example, steak, grilled meat or the like, each of which consists of meat with low fat, baked snack foods, non-food eateries, subjected to normal processing roasting. Which one is preferable as such food products with reduced fat include, for example, food products, each of which has a fat content of from 1/2 to 1/3 of the content in common food products.

If the agent is to give kokumi according to the invention include the above foods with low fat, foods become able to give the consumer a strong impression of density and smoothness as fat, not at the initial stage and at the next stage, when consuming these foods with low fat content.

In this regard, conventional dairy products and yogurt have a fat content ranging from 3 to 4%, but also known, such as milk and yogurt, milk and yogurt, available from kako what about any fat (the fat content of approximately 0.1%). Agent to give kokumi or complex agent to give kokumi according to the invention likewise is effective for foods with low fat content.

In addition, the agent for giving kokumi or complex agent to give kokumi according to the invention particularly preferably be added to the food product containing an ingredient derived from pork. More specifically, the present invention herein relates to a food composition containing γ-Glu-Nva-Gly and an ingredient derived from pork. Food containing an ingredient derived from pork, are not limited to any particular food product, but can be listed, for example, extracts of pork, sausages and soups for ready-to-eat noodles. In this respect, the content of ingredient derived from pork intended for inclusion in these foods is not limited to any particular range, but examples of such food products containing an ingredient derived from pork, include food products with a content of about 0.005 to 80 wt.%.

In addition, it is also preferable to enable the agent to give kokumi or complex agent to give kokumi according to the invention in a food product containing an ingredient derived from gavage the s. More specifically, the present invention herein relates to a food composition containing γ-Glu-Nva-Gly and an ingredient derived from beef. Food containing an ingredient derived from beef, are not limited to any particular food product, but can be listed, for example, extracts of beef, corned beef, soup, made with beef and sauces using beef. In this respect, the content of ingredient derived from beef intended for inclusion in these foods is not limited to any particular range, but examples of such food products containing an ingredient derived from beef, include food products with a content of about 0.005 to 80 wt.%.

γ-Glu-Nva-Gly, used according to the invention, and amino acids or peptides used in combination with them, can similarly include amino acids or peptides in the form of their salts. If γ-Glu-Nva-Gly, used according to the invention, and amino acids or peptides used in combination with them, are present in the form of their salts, the salts are not limited to specific salts until they are pharmacologically suitable soluble salts, and specific examples include ammonium salts, alkali metal salts, such as the three-and potassium, salts of alkaline earth metals such as calcium and magnesium, aluminum salts, zinc salts, salts of organic amines such as triethylamine, ethanolamine, morpholine, pyrrolidine, piperidine, piperazine and dicyclohexylamine, and salts of basic amino acids, such as arginin and lysine and acidic groups such as carboxyl groups. In addition, examples of the above compounds in a similar manner include the salts of inorganic acids such as hydrochloric acid, sulfuric acid, phosphoric acid, nitric acid and Hydrobromic acid; salts of organic carboxylic acids, such as acetic acid, citric acid, benzoic acid, maleic acid, fumaric acid, tartaric acid, succinic acid, tannic acid, butyric acid, hibenzoic acid, pamula acid, enanthic acid, cekanova acid, teolinda acid, salicylic acid, lactic acid, oxalic acid, mandelic acid and malic acid; and salts of organic sulfonic acids, such as methanesulfonate acid, benzolsulfonat acid and p-toluensulfonate acid, with the main groups of compounds.

Agent to give kokumi, food composition or a complex agent to give kokumi according to the invention can be used in any form, such as dry powders, pastes and mortars, without any limitation of the x physical properties.

Agent to give kokumi, food composition or a complex agent to give kokumi according to the invention can be used to enable, for example, many food and beverage products, such as foods, drinks and condiments.

If the agent is to give kokumi, food composition or a complex agent to give kokumi according to the invention is used to enable, for example, many food and beverage products, such as foods, drinks and condiments, the final amount of γ-Glu-Nva-Gly and the final amount of amino acid or peptide used in combination with it, is not limited to any particular number, as long as it can achieve the desired effects according to the invention, however, each of the number of γ-Glu-Nva-Gly and/or the number of amino acids or peptide falls within the range from about 0.1 mlrd to 99.9 wt.%, and preferably, from about 1 mlrd to 10 wt.% and more preferably, from about 0.01 ppm to 1 wt.% the weight of each respective food product, beverage, condiment or other

Many foods, such as food, drink or condiment, each of which has enabled the agent to give kokumi, food composition or complex of the agent to give kokumi according to the invention may further is entrusted to contain, for example, any solid or liquid carrier and/or suitable ingredients condiments, suitable for food and beverage.

As the above media can be listed, for example, glucose, lactose, sucrose, starch, mannitol, dextrin, glycerides of fatty acids, polyethylene glycol, gidroxiatilkrahmal, ethylene glycol, esters of fatty acids and polyoxyethylenesorbitan, gelatin, albumin, amino acids, water and physiological salt solution.

The above ingredients for seasoning are not limited to any one particular ingredient and can be any of the ingredients currently used in this area, but their specific examples are examples already described above.

The content of the above carriers, other ingredients, seasoning or the like is not limited to a particular content.

Among the above ingredients, seasonings yeast extract is not specifically limited to any of the cell bodies of microorganisms of which is the extract, the conditions of cultivation of microorganisms and methods of its extraction, and, accordingly, any yeast extract can be used in the products according to the invention furthermore, these yeast extracts can be the extracts that were subjected to, nab is emer, heat treatment, processing enzyme, the treatment concentration and/or processing for turning extract in powder.

The present invention relates also to a method for production of a variety of food products and beverages, including the state add to the many semi-finished products used for various kinds of food products and beverages, γ-Glu-Nva-Gly in such a way that the resulting food products and beverages contain γ-Glu-Nva-Gly in an amount in the range from 1 mlrd to 99.9 wt.%. In this regard, various types of food products and beverages preferably are foods with low fat content.

The present invention also relates to a method for obtaining a variety of food products or beverages, including the state include food composition according to the invention in semi-finished products used for various kinds of foods or drinks. In this regard, various types of food products and beverages preferably are foods with low fat content.

As for the method according to the invention to obtain a semi-finished product used for receiving other foods or drinks, using the agent for giving kokumi is preferable that the method include the stage of the adding amplifier VK is sa, consisting of γ-Glu-Nva-Gly, food ingredients (such as giving umami ingredients, protein hydrolysates or meat extracts) during mixing and, depending on the need, additional cooking the mixture of food ingredients, in order thus to obtain food, or drinks, or intermediates for their preparation.

In this respect, the stage of adding the flavor enhancer consisting of γ-Glu-Nva-Gly, food ingredients preferably includes a step of controlling the concentration of γ-Glu-Nva-Gly in the material used to obtain food or drink, in the range from 0.01 to 999900 ppm, and preferably from 0.1 to 200,000 ppm

In addition, it is also preferable that the method further include stage add cake mix to get food or drinks other food ingredients (such as agricultural products, seafood, meat, dairy products or processed products) monitoring the concentration of γ-Glu-Nva-Gly received food or drinks at the level of from 0.01 to 50 ppm, and preferably from 0.05 to 20 ppm

In addition, the stage of adding the flavor enhancer consisting of γ-Glu-Nva-Gly, the ingredient of the food product during mixing, preferably includes a step of controlling the concentration of γ-Glu-Nva-Gly who received food or drinks at the level of from 0.01 to 50 ppm and preferably, from 0.05 to 20 ppm

In the above method of obtaining is preferable to have food or drinks were a food or beverage containing ingredients derived from beef. In this case, each food product or beverage preferably contains from 0.01 to 50 ppm of γ-Glu-Nva-Gly; 0.005 to 80% of ingredients derived from beef and other ingredients of each respective food product.

In addition, food products intended for the present invention preferably include, in addition to the above foods, foods (sweet type)belonging to the category of desserts and confectionery, mainly intended for sweet taste, such as ice cream, honey, marmalade and strawberry jam; and food products (chili type), for example, processed foods and/or products everyday food, mostly intended for salty taste, such as chicken soup.

The present invention is described herein in more detail with reference to the following examples, but the present invention is not limited to these specific examples.

Example

(Synthesis example 1): Synthesisγ-Glu-Nva-Gly (γ-L-glutamyl-L-Norvaline-glycine):

In methylene chloride (CHCl2, 100 ml) was dissolved Boc-Nva (t-butoxycarbonyl-L-Norvaline, 4.44 g, 20,4 mm) and Gly-OBzl•HCl (hydrochloride benzyl ester of glycine, 4.12 g, 20,4 mm). Then to the reaction solution was added triethylamine (Et3N, 3.13 g, 1.1 EQ., 22,4 mm), HOBt•H2O (1-hydroxybenzotriazole, 3,44 g, 1.1 EQ., 22,4 mm) and WSC•HC1 (hydrochloride of 1-ethyl-3-(3-dimethylaminopropyl)-carbodiimide, 4,30 g, 1.1 EQ., 22,4 mm), while maintaining the reaction solution at 0°C. the Temperature of the reaction solution was gradually raised and stirred at room temperature overnight (16 hours). Then the reaction solution was concentrated under reduced pressure, the precipitate obtained was added ethyl acetate (150 ml), the organic phase is washed with water (50 ml), twice with 5% aqueous citric acid solution (50 ml), saturated sodium chloride solution (50 ml), twice with 5% aqueous sodium hydrogen carbonate solution (50 ml) and saturated sodium chloride solution (50 ml), and then the organic phase was dried over anhydrous magnesium sulfate. The magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced pressure. When the residue was added n-hexane, was formed crystals, and they were isolated by filtration and dried under reduced pressure to obtain thus Boc-Nva-Cly-OBzl (6,88 g, 18,9 mm) in the form of crystals.

To Boc-Nva-Gly-OBzl (6,88 g, 18,9 mm) solution was added 4 N HCl/dioxane (94,5 ml), and the CME is ü stirred at room temperature for one hour. The dioxane was removed during the concentration of the mixture under reduced pressure, and the obtained precipitate was added n-hexane (30 ml), and then the resulting mixture was concentrated under reduced pressure. In this respect, the last two stages were repeated 3 times, so as to obtain H-Nva-Gly-OBzl•HCl with a quantitative yield.

The product after the previous stage: H-Nva-Gly-OBzl•HCl was dissolved in methylene chloride (130 ml), and the reaction solution was maintained at 0°C. To the reaction solution was added Z-Glu-OBzl (benzyl ester of N-α-carbobenzoxy-L-glutamic acid, 7,03 g, 18,9 mm), triethylamine (2,90 ml, 1.1 EQ., 20,8 mm), HOBt•H2O (3,20 g, 1.1 EQ., 20,8 mm) and WSC•HC1 (3.98 g, 1.1 EQ., 20,8 mm). The temperature of the reaction solution was gradually raised and stirred at room temperature overnight (16 hours). Then the reaction mixture was concentrated under reduced pressure, the precipitate obtained was added ethyl acetate (1000 ml) and then the organic phase is washed with water (100 ml), twice with 5% aqueous citric acid solution (100 ml), saturated solution of sodium chloride (100 ml), twice with 5% aqueous sodium hydrogen carbonate solution (100 ml) and a saturated solution of sodium chloride (100 ml) and then the organic phase was dried over anhydrous magnesium sulfate. After heating the solution to 50°C magnesium sulfate was removed by filtration, and the filtrate was concentrated under reduced the output pressure. After the beginning of crystallization to the obtained concentrate was added n-hexane, so that the crystals are sufficiently separated. The crystals were collected by filtration and then dried under reduced pressure to obtain thus Z-Glu(Nva-Gly-OBzl)-OBzl (10,16 g, 16.4 mm) in the form of crystals.

To a mixed solution of ethanol (250 ml) and water (30 ml) was added Z-Glu(Nva-Gly-OBzl)-OBzl (10,16 g, 16.4 mm) and 5% palladium on carbon (5% palladium/carbon, 1.20 g)and a catalytic reduction reaction was carried out at 50°C overnight (14 hours) in the atmosphere of hydrogen gas. In the reaction system was added water (100 ml) in small portions during the reaction. Palladium/carbon was removed from the reaction system by filtration, and the obtained filtrate was concentrated under reduced pressure. The residue was recrystallized from a small amount of water and ethanol, to thereby obtain γ-Glu-Nva-Gly (4.59 g, 15.1 mm) in the form of white crystals. Typical values for are shown below:

ESI-MS:(M+H)+=304,1

1H-NMR (400 MHz, D2O): δ (ppm): of 0.82 (3H, t, J=7,4 Hz), of 1.23 to 1.37 (2H, m), 1,55-1,75 (2H, m), 2,01-of 2.09 (2H, m), 2,38-2,48 (2H, m), and 3.72 (1H, t, J=6,4 Hz), a 3.87 (1H, DD, J=17.8 and 20,GC), is 4.21 (1H, DD, J=4.4 and 8,GC).

Test example 1: Receive CaSR-expressing plasmids

CaSR-expressing plasmid was obtained according to the following methods:

Synthesized synthetic oligo-DNA used for the FPIC of the scale PCR (i.e. direct primer (Sequence No. 3: ACTAATACGACTCACTATAGGGACCATGGCATTTTATAGCTGCTGCTGG) and reverse primer (Sequence No. 4: TTATGAATTCACTACGTTTTCTGTAACAG) based on DNA sequences registered in NCBI (CaSR (calcium receptor): NM_000388, Sequence No. 1 and 2).

Methods PCR was performed under the conditions listed below, using cDNA (available from the company Clontech)derived from human kidney as material, using the above primers and DNA polymerase Pfu Ultra (available from the company Stratagene): the Reaction system was treated at 94°C for 3 minutes and then at 94°C for 30 seconds, at 55°C for 30 seconds, and 72°C for 2 minutes, where these stages were repeated 35 times, and the system performed the final reaction at 72°C for 7 minutes. Then the reaction system was subjected to processing by electrophoresis in agarose as support, the agarose stained with means for staining DNA and then it was irradiated with ultraviolet rays color for detecting whether the cDNA is amplified by means of PCR or not. At the same time picture electrophoresis was compared to that of marker DNA, electrophoretic size of which is known, to thus confirm the length of the chains of PCR products.

The plasmid vector pBR322 was digested with restriction enzymes EcoRV (available from Tikara Co., Ltd) and a fragment of a gene, am limitirovany ways PCR, ligated into the plasmid vector according to the site of cleavage, using a set of ligation (available from the company Promega). CellsEscherichia colistrain DH5 transformed reaction solution, followed by selection of transformants containing plasmid, which was cloned amplificatory the PCR product, and then amplificatory the PCR product was confirmed by sequence analysis of the DNA bases.

This recombinant plasmid was used to obtain plasmids expressing CaSR person, hCaSR/pcDNA3.1.

(Test example 2): evaluation of the activity of the CaSR agonist

293E cells (EBNA1-expressing HEK293 cells, ATCC No. CRL-10852) were cultured in DMEN/Ham's-F12 (containing 3,15/ml glucose modified by way of Dulbecco environment, Needle, available from Nakalai Tesque)supplemented with 10% fetal calf serum, in the presence of 200 μg/ml G418 (Geneticin). The cultured cells were inoculable in a bottle F25 at a density of 3×106cells/10 ml vial was allowed to stand for 24 hours in CO2-incubator (5% CO2, 37°C, and then transformed or transfusional a plasmid expressing CaSR person hCaSR/pcDNA3.1 using the reagent Fugene6 transfection (available from Roche). Transtitional plasmid was maintained in CO2-incubator for 6-7 hours, then cells were recovered using the receiving containing 10% fetal calf serum DMEM/Ham's-F12 and the cells were inoculable to each well coated with poly-D-lysine 96-well tablet (BDBiocoat) at a density of 70,000 cells/well.

96-well plate was allowed to stand for 24 hours in CO2-the incubator, and then the culture medium was removed from each well of 96-hole tablet, which was inoculable cells, and then adding to each well of a fluorescent indicator Ca2+from a set of Calcium 4 Assay (available from the company Molecular Devices), dissolved in buffer for analysis (containing 146 mm NaCl, 5 mm KC1, 1 mm MgSO41 mg/ml glucose, 20 mm HKPES (pH of 7.2) and from 0.75 to 1.25 mm CaCl2), in the amount of 200 μl/well, and then allowed 96-well plate to stand at 37°C for one hour and then at room temperature for 10 minutes, so that the indicator was included in the cell.

In each well of 96-hole tablet was added to each test compound, dissolved in the buffer for analysis, containing 0.1% BSA, 50 μl/well, and then any changes in the intensity monitorrole for 3 minutes using the install FLEX (available from the company Molecular Devices).

(Method of determining EC50):

The difference (RFU (Max-Min)between the maximum and minimum intensities of fluorescence observed for each well before and after you add each individual test compounds, opredelyayuszthim automatic calculation using the install FLEX. Expected level of activity, while the value of the RFU (Max-Min)observed when the connection is added to the maximum concentration, defined as 100%, and the value of the RFU (Max-Min)observed when using buffer for analysis, containing 0.1% BSA, free from any of the tested compounds was determined as 0%, with subsequent exposure of the received data procedures of selection curves using the software for spreadsheet Xfit or Graph-Pad Prism to thereby determine EC50, which represented the concentration with the degree of activity of 50%. Thus obtained results are summarized in the following table 1. In addition, repeating the same methods for determining EC50used above except for using other tripeptides, as in the comparative examples. Thus obtained results are summarized in the following tables 2 and 3. In this regard, the data listed in table 3, described in non-patent document 3.

Table 1
ConnectionEC50, mcm
γ-Glu-Nva-Gly0,055
γ-Glu-Val-Gly 0,075

Table 2
ConnectionEC50, mcm
γ-Glu-Ala-Gly0,016
γ-Glu-tLeu-Gly0,09
γ-Glu-Thr-Gly2,8

Table 3
ConnectionEC50, mcm
γ-Glu-Val-Gly0,039
γ-Glu-Abu-Gly0,025
γ-Glu-Cys-Gly0,7

Unexpectedly, the above results show that γ-Glu-Nva-Gly has a high activity of the CaSR agonist, almost identical to the activity observed for other peptides, each of which has the structure of γ-Glu-X-Gly.

Example 1: evaluation of the activity of giving kokumi

This example was examined γ-Glu-Nva-Gly by the power of his activity give kokumi under test quantitative sensory evaluation.

This test is a quantitative sensory evaluation was performed following the method of the mi.

Force activity give kokumi observed for each of the tested compounds was determined as the value observed when mixing from 0.000001 to 0.1 g/DL of the respective test compounds with distilled water containing sodium glutamate (0.05 g/DL), monophosphate Yasinovka acid (0.05 g/DL) and sodium chloride (0.5 g/DL). In this regard, when the sample showed acidic character after dissolving the test compound compared to a control without test compound, the pH of the sample was made using NaOH to pH (observed for control) ±0,2 prior to the practical use of the design in the assessment. Evaluation criteria were as follows: control: 0 points: strong: 3 points; very strong: 5 points. In addition, to make the criteria clearer, elementary/middle taste and aftertaste of γ-Glu-Cys-Gly took over 3.0 points, respectively. Scoring or classification was performed using a standard linear method, and, more specifically, they were carried out by specifying each of the corresponding points on the straight line marked points corresponding -5~0~5. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for food for at least one year aggregate period of time and who ogle to judge the difference in titer between theγ-Glu-Cys-Gly andγ-Glu-Val-Gly added to the solution, with taste umami/ savory taste, is approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with n (the number of participating tasters)=4. In this regard, the term "elementary/middle taste" refers to the development of taste, detektirovanie over time, continuing from 0 to 5 seconds after the taster kept the sample in the mouth, while the term "finish" refers to the development of taste, detektirovanie after that. For the tested compounds showed activity give kokumi widely around the above-mentioned range, it added concentrations. However, the results observed for typical concentrations, are summarized in the following table 4.

The result revealed that all tripeptides, other than γ-Glu-Nva-Gly, studied above, showed the CaSR activity, of order at most 10 times higher than the activity observed for glutathione (γ-Glu-Cys-Gly), but for γ-Glu-Nva-Gly unexpectedly showed higher activity CaSR, about more than 100 times higher than the activity observed for glutathione.

td align="justify"> Basically enhanced density and filling at the stage of medium taste/aftertaste.
Table 4
ConnectionTo the TS. (g/DL)The intensity of kokumiComments to the assessment
Elementary/middle tasteFinish
Control--00--
γ-Glu-Cys-Gly0,013,03,0Enhanced density, thickness, and duration.
γ-Glu-Val-Gly0,0012,53,0Basically reinforced maturity, density and content.
0,0053,54,0Basically reinforced maturity, density and content.
γ-Glu-Nva-Gly0,000052,72,9Basically enhanced density and filling at the stage of medium taste/aftertaste.
0,00013,03,3
0,0014,04,0The taste was completely condensed. The taste was too strong.
γ-Glu-Abu-Gly0,0023,02,0Average taste was enhanced in comparison with γ-Glu-Val-Gly.
γ-Glu-Ala-Gly0,0013,32,3The density of the initial taste was strong, but the aftertaste was implicit.
γ-Glu-Abu-GlyA0,0012,73,0Weak astringent taste was observed at the stage aftertaste.
γ-Glu-tLeu-Gly0,0012,53,0Shows such a tendency that the aftertaste was quite strong. Weak astringent taste remained in my mouth.

Activity give kokumi γ-Glu-Nva-Gly approximately 100 times higher than the activity observed for γ-Glu-Cys-Gly, is at least approximately 10 times higher activity, observed for γ-Glu-Val-Gly, such. In addition, γ-Glu-Nva-Gly never had any taste (such as astringent taste in the aftertaste), in contrast to γ-Glu-Ala-Gly, γ-Glu-Abu-Gly and γ-Glu-tLeu-Gly, and are, respectively, shows that γ-Glu-Nva-Gly is excellent compared to other studied tripeptides.

Example 2: evaluation of the activity of giving kokumi

This example was examined γ-Glu-Nva-Gly by the power of his activity give kokumi under test quantitative sensory evaluation, taking into account the individual subject assessment to clarify that this Tripeptide is a Tripeptide medium taste/aftertaste.

This test is a quantitative sensory evaluation was performed in the following ways :

In this test, for easy detection medium taste/aftertaste use monophosphate Yasinovka acid in the liquid used for the evaluation were excluded, thus reducing minds on stage medium taste/aftertaste in the liquid. More specifically, due to the activity of giving kokumi observed for each of the tested compounds was determined as the value observed when mixing from 0.000001 to 0.1 g/DL of the respective test compound in the sample with distilled water containing sodium glutamate (0.1 g/DL) and sodium chloride (0.4 g/DL). In this regard, when the sample showed the acidic nature of the R after dissolving the test compound compared to a control without test compound, the pH of the sample was made using NaOH to pH (observed for control) ±0,2 prior to the practical use of the design in the assessment. Evaluation criteria were as follows: control: 0 points: strong: 3 points; very strong: 5 points. In addition, to make the criteria clearer, elementary/middle taste and aftertaste of γ-Glu-Cys-Gly took over 3.0 points, respectively. Scoring or classification was performed using the method of the linear scale, and, more specifically, they were carried out by specifying each of the corresponding points on the straight line marked points corresponding -5~0~5. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for food for at least one year aggregate period of time and which could be judged that the difference in titer between theγ-Glu-Cys-Gly and γ-Glu-Val-Gly added to the solution, with taste umami/ savory taste, is approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with n (the number of participating tasters) =4. In this regard, the term "initial taste" refers to the development of taste, detektirovanie over time, continuing from 0 to 2 seconds after the taster kept the sample in the mouth, while the term "average the taste/aftertaste" refers to the development of taste, detektirovanie after that. For the tested compounds showed activity give kokumi widely around the above-mentioned range, it added concentrations. However, the results observed for typical concentrations, are summarized in the following table 5.

These results similarly show that for γ-G1u-Val-Gly showed activity give kokumi approximately 10 times higher than the activity observed for glutathione (γ-Glu-Cys-Gly), while for γ-Glu-Nva-Gly showed higher activity CaSR, about more than 100 times higher than the activity observed for glutathione.

Table 5
ConnectionConc. (g/DL)The intensity of kokumiComments to the assessment
The initial tasteAverage taste/aftertaste
Control--00--
γ-Glu-Cys-Gly0,0133Strengthened PLO is ness, the density and duration.
γ-Glu-Val-Gly0,00123Basically enhanced smoothness, density and content.
γ-Glu-Nva-Gly0,0000523Density and filling strengthened mainly during the middle of the taste/aftertaste.
0,000134Density and filling strengthened mainly during the middle of the taste/aftertaste.

The result was found that γ-Glu-Nva-Gly was quite outstanding. This is due to the fact that he has an excellent activity to focus on kokumi, has the characteristics of mid-taste/aftertaste in relation to his profile development of taste and is free from any flavor (such as astringent taste). The cut, γ-Glu-Nva-Gly active giving kokumi approximately 100 times higher than the activity observed for γ-Glu-Cys-Gly, and at least about 10 times higher than the activity observed, for example, γ-Glu-Val-Gly. For this reason, γ-Glu-Nva-Gly can be used in extremely low concentration of the. Accordingly, the present invention can thus provide an agent for giving kokumi, which can be easily obtained at low cost, and thus, the present invention can be quite effective from a manufacturing point of view.

Example 3: evaluation of the activity of giving kokumi in food

Tested, exhibits or no γ-Glu-Nva-Gly effect giving kokumi stronger than the effect observed for γ-Glu-Nva-Gly with a high titer, according to test quantitative sensory evaluation, with the actual inclusion of the first mentioned in the food product.

A quantitative test of the sensory evaluation was performed in the following ways :

As food is considered with a strong average taste/aftertaste, commercially available ice cream, honey, marmalade and strawberry jam used in this example as a typical food (sweet type)belonging to the category of desserts and confectionery, mainly destined for the sweet taste. As examples of typical food products (chili type)belonging to the category of processed foods, daily food and eateries food, mainly destined for the salty taste, used commercially available chicken soup, weight, sod is readuy mashed potatoes and 0.1 wt.% commercially available pepper powder; commercially available ginger paste; and mass containing mashed potatoes and 2 wt.% oil. The amount of γ-Glu-Val-Gly as a comparison object to be additive, was adopted at the level of 0.002 wt.%, at which its effect was detectable. The Tripeptide γ-Glu-Nva-Gly tested for improvement (intensity activity give kokumi) General development of taste when mixed with each test food product in an amount of from 0.0000001% to 0.01 wt.%. In this case, the control served every food product that is free from adding any Tripeptide. Evaluation criteria were adopted the following, in order not to get any small differences, such as the fractional part of each score: control: ±; strong enough: +; strong: ++ : very strong: +++. In addition, a score of + was defined as 1 point; score ++ was defined as 2 points and evaluation +++ defined as 3 points, and if the average numerical value was, for example, 2,2, decimal approximately equated to 2=++ by rounding numbers to the nearest integer. Tasters to participate in this test was defined as individuals who worked on the development of seasonings for food for at least one year aggregate period of time and which could be judged that the difference in titer between theγ-Glu-Cys-Gly and γ-Glu-Val-Gly added to the solution, with taste umami/ savory taste, which leaves approximately 10 times (with regular confirmation of the ability of these persons). The evaluation was performed with n (the number of participating tasters) =4. To test the connection γ-Glu-Nva-Gly showed activity give kokumi widely around the above-mentioned range, it added concentrations. However, only the results that you can definitely use the purpose of comparison, are summarized in the following tables 7 and 8.

Table 7
SampleConc. (wt.%)Improving the overall development of taste (smell)
Ice creamHoneyMarmaladeStrawberry jam
γ-Glu - Val-Gly0,002++++
γ-Glu - Val-Gly0,00015+±±±
0,00028++±±±
0,0004++++++

Table 8
SampleConc. (wt.%)Improving the overall development of taste (smell)
Chicken soupGinger pastePepper powderOil pasta
γ-Glu - Val-Gly0,002++++
γ-Glu - Val-Gly0,00015++±±
0,00028++++++
0,0004++++++++++

The results of the above test show that for γ-Val-Nva-Gly showed promising activity give kokumi, able to improve the ability of the overall development of taste in all existing food products, which are characteristic average taste/aftertaste, and which extend from acute food type food products sweet type. In addition, the above results also show that for γ-Val-Nva-Gly showed an extremely high activity give kokumi in existing food products, from 5 to more than 13 times higher than the activity of giving kokumi observed for γ-Glu-Val-Gly. Accordingly, the use of γ-Val-Nva-Gly in an unusually low number can improve the quality of food, even when a large number of additional ingredients cannot be included in each specific food product to ensure the intended stability of quality, when there are demands to further increase its quality. In addition, the agent for giving kokumi can be provided at low cost.

Example 4: Effectγ-Glu-Nva-Gly on extracts pork:

Found that the activity giving kokumi γ-Glu-Nva-Gly can be improved at an early stage after the use of its containing food product compared to the activity of giving kokumi observed for γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly. Under these conditions, confirmed, according to test quantitative sensory evaluation that γ-lu-Nva-Gly was significantly effective for improving the development of the taste of pork extract, the development of taste which is not fully type on the mid-palate, but the taste is improved a little earlier compared to the effect observed for γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly.

A quantitative test of the sensory evaluation was performed in the following ways :

Commercially available pork extract (solid content: 55,1 wt.%, salt content: 9.3 wt.%) was dissolved in hot water so that the concentration of the extract was made up to 5.0 wt.%, in order to obtain the solution of the extract of pork. Then this solution extract of pork mixed γ-Glu-Nva-Gly, γ-Glu-Cys-Gly or γ-Glu-Val-Gly as a sample. According to the criterion of the pairwise comparisons among the tasters demanded comparative evaluation of the following three samples and solutions, "which one was preferred or favorable, because it could enhance the smell and taste of pork extract without changing the balance between them: (1) 0.02 wt.% γ-Glu-Cys-Gly, activity give kokumi which was identical 0,0003% wt. γ-Glu-Nva-Gly; (2) 0,0003% wt. γ-Glu-Val-Gly, the amount of which was identical 0,0003% wt. γ-Glu-Nva-Gly; (3) 0.002 wt.% γ-Glu-Val-Gly, activity give kokumi which was identical to the activity observed for 0,0003% wt. γ-Glu-Nva-Gly. The evaluation was performed with N (the number of participating tasters)=9. The following table 9 shows the number of tasters, who decided that 0,0003 in the S.% γ-Glu-Nva-Gly was preferred or favorable because it could enhance the smell and taste of pork extract without changing the balance between them."

From the thus obtained results we can conclude the following: for γ-Glu-Nva-Gly showed a significant effect of what he can definitely enhance the smell and taste of pork extract without changing the balance between them, even when the titles of kokumi identical to each other, as in cases (1) and (3).

Table 9
N=9
SampleConc. (wt.%)SampleConc. (wt.%)No. tasters*
(1) γ-Glu-Nva-Gly0,0003γ-Glu-Cys-Gly0,028/9**
(2) γ-Glu-Nva-Gly0,0003γ-Glu-Val-Gly0,00038/9**
(3) γ-Glu-Nva-Gly0,0003γ-Glu-Val-Gly0,0028/9**
*: The number of tasters, who decided that γ-Glu-Nva-Gly is what camping is more preferable, because it could enhance the smell and taste of pork extract, without changing the balance between them.
**: The result shows that γ-Glu-Nva-Gly is preferred since it can enhance the smell and taste of pork extract without changing the balance between them, at the significance level 5%.

The above results clearly indicate that for γ-Glu-Nva-Gly following quite a noticeable effect: it can strengthen and make more favorable smell and taste of pork extract without changing the balance between them", when compared with the effect observed for γ-Glu-Cys-Gly and γ-Glu-Val-Gly, used in concentrations able to demonstrate such activity give kokumi. Ingredients derived from pork, which is widely used all over the world, such as seasonings, soups, processed meat products, prepared and processed food, confectionery and snack bars food. As discussed above, γ-Glu-Nva-Gly may allow improved smell and taste of food at low cost, using it at the same time only in trace amounts, and, therefore, its use is quite predominant industrial point of view.

Example 4: Effectγ-Glu-Nva-Gly on extracts of beef:

Found that the activity giving kokumi γ-Glu-Nva-Gly can Ulu is to address at an early stage after the use of its containing food product compared to the activity of giving kokumi, observed for γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly. Under these conditions, confirmed, according to test quantitative sensory evaluation that γ-Glu-Nva-Gly was significantly effective for improving the development of the taste of beef extract, development of taste which is not fully type on the mid-palate, but the taste is improved a little earlier compared to the effect observed for γ-Glu-Cys-Gly (glutathione) and γ-Glu-Val-Gly.

A quantitative test of the sensory evaluation was performed by the following methods: Commercially available beef extract (solid content: 61,2 wt.%, salt content: 12.2 wt.%) was dissolved in hot water so that the concentration of the extract was brought to 3.0 wt.%, in order to obtain the solution of extract of beef. Then this solution extract of beef mixed γ-Glu-Nva-Gly, γ-Glu-Cys-Gly or γ-Glu-Val-Gly as a sample. According to the method of criterion pairwise comparisons (paired test) tasters demanded comparative evaluation of the following three samples and solutions, "which one was preferred or favorable, because it could enhance the smell and taste of beef extract without changing the balance between them: (1) 0.02 wt.% γ-Glu-Cys-Gly, activity give kokumi which was identical 0,0003% wt. γ-Glu-Nva-Gly; (2) 0,0003% wt. γ-Glu-Val-Gly, the amount of which was identical 0,0003% wt. γ-Glu-Nva-Gly; (3) 0.002 wt.% γ-Glu-Val-Gly, act what you want to make make kokumi which was identical activity, observed for 0,0003% wt. γ-Glu-Nva-Gly. The evaluation was performed with N (the number of participating tasters) =9. The following table 10 shows the number of tasters, who decided that 0,0003% wt. γ-Glu-Nva-Gly was preferred or favorable, as it could enhance the smell and taste of beef extract without changing the balance between them."

From the thus obtained results we can conclude the following: for γ-Glu-Nva-Gly showed a significant effect of what he can definitely enhance the smell and taste of beef extract without changing the balance between them", even when the titles of kokumi identical to each other, as in cases (1) and (3).

Table 10
N=9
SampleConc. (wt.%)SampleConc. (wt.%)No. tasters*
(1) γ-Glu-Nva-Gly0,0003γ-Glu-Cys-Gly0,029/9**
(2) γ-Glu-Nva-Gly0,0003γ-Glu-Val-Gly0,00038/9***
0,0003γ-Glu-Val-Gly0,0028/9***
*: The number of tasters, who decided that γ-Glu-Nva-Gly was preferred because it could enhance the smell and taste of beef extract without changing the equilibrium between the

them.
**: The result shows that γ-Glu-Nva-Gly is preferred since it can enhance the smell and taste of beef extract without changing the balance between them, at the significance level of 1%.
***: The result shows that γ-Glu-Nva-Gly is preferred since it can enhance the smell and taste of beef extract without changing the balance between them, at the significance level 5%.

The above results clearly indicate that for γ-Glu-Nva-Gly following quite a noticeable effect: it can strengthen and make more favorable smell and taste of beef extract without changing the balance between them" when compared with the effect observed for γ-Glu-Cys-Gly and γ-Glu-Val-Gly, used in concentrations able to demonstrate such activity give kokumi. Ingredients beef, widely used in isout worldwide for example, seasonings, soups, processed meat products, prepared and processed food, confectionery and snack bars food. As discussed above, γ-Glu-Nva-Gly may allow improved smell and taste of food at low cost, using it at the same time only in trace amounts, and, therefore, its use is quite predominant industrial point of view.

1. Food composition comprising from 0.000001 to 0.005 wt.% γ-Glu-Nva-Gly; 0.005 to 80 wt.% ingredients derived from pork or beef, and other food ingredients.

2. A method of obtaining a food product, comprising the steps:
add agent to give kokumi containing γ-Glu-Nva-Gly in the amount of from 0.000001 to 0.005 wt.% and 0.005 to 80 wt.% food ingredients derived from pork or beef, other food ingredients, mixing them together; and
if you want, cooking the mixture of food ingredients.

3. The method according to p. 2, wherein said product is in the form of a drink.

4. The method according to p. 2, wherein said product is a semi-finished product to obtain a food product.

5. The method according to claim 2, wherein said product is a semi-finished product to obtain a food product in the form of a drink.

6. The method according to any of p is.2-5, in which stage the agent is added to give kokumi consisting of γ-Glu-Nva-Gly, food ingredients derived from pork or beef, mixing it together, additionally includes a step of controlling the concentration of γ-Glu-Nva-Gly in the material used for receiving the food product, in the range from 0.000001 to 99.9 wt.%.

7. The method according to claim 6, further comprising the stage of adding semi-finished product to obtain food to other food ingredients when controlling the concentration of γ-Glu-Nva-Gly received in the food product at a level of from 0.000001 to 0.005 wt.%.

8. The method according to claim 6, in which stage the agent is added to give kokumi consisting of γ-Glu-Nva-Gly, food ingredients by mixing them together, includes a step of controlling the concentration of γ-Glu-Nva-Gly received in the food product at a level of from 0.000001 to 0.005 wt.%.

9. A food product obtained by the method according to any of claim 2 to 8.

10. A food product according to claim 9, wherein said product is in the form of a drink.

11. A food product according to claim 9, wherein said product is a semi-finished product to obtain a food product.

12. A food product according to claim 9, wherein said product is a semi-finished product to obtain a food product in the form of a drink.

13. The way to enhance the taste and/or smell of food, including drink including the stage of adding the food composition according to claim 1 in a food product.

14. The method according to item 13, wherein said product is in the form of a drink.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: disclosed is a method of producing pure crystalline D-isoglutamyl-D-trytophan which involves a step of removing protection from essentially pure N-tert-butoxycarbonyl-D-isoglutamyl-D-tryptophan or diester thereof to yield essentially pure D-isoglutamyl-D- tryptophan. An amorphous ammonium alt of D-isoglutamyl-D- tryptophan (1:1) is also disclosed. Also disclosed is a method of producing a pure monoammonium salt of D-isoglutamyl-D-tryptophan from essentially pure N-tert-butoxycarbonyl-D- isoglutamyl-D-tryptophan. Disclosed is a compound H-D-Glu-(γ-D-Trp-OR2)-α-OR1 and pharmaceutically acceptable acid addition salts thereof. Disclosed is a solid pharmaceutical composition and use thereof as an immunodepressant or anti-psoriasis agent.

EFFECT: improved method.

51 cl, 14 ex, 8 dwg, 1 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to crystalline modifications: 1 (polymorphous form F), 2 (polymorphous form I) and 3 (polymorphous form X) of monosodium salt of D-isoglytamyl-D-tryptophan (1:1) characterised by powder X-ray pattern peaks presented in the application materials, as well as to pharmaceutical compositions containing them. The invention describes their use for treating various diseases and body conditions of at least one autoimmune diseases specified in a group consisting of psoriasis, atopic dermatitis and rheumatoid arthritis.

EFFECT: present invention describes the methods for producing the declared crystalline modifications of monosodium salt of D-isoglytamyl-D-tryptophan (1:1).

42 cl, 4 ex, 9 dwg

The invention relates to products derived from histamine and, in particular, the condensation products of histamine or methylsiloxanes histamine and amino acids, the method of their preparation and use as active principle in areas such as therapy and cosmetology, as well as the factor (agent), improving the stability of compositions used in therapy, cosmetology, agriculture and food industry (region)

The invention relates to medicine, namely to new peptide structures with immunomodulatory properties, and preparations on their basis

The invention relates to medicine, namely to compounds having immunomodulatory properties

FIELD: food industry.

SUBSTANCE: base contains organic acids, amino acids, peptides, aroma substances and 0.01 wt % - 80 wt % of compounds produced by way of extraction of raw materials of vegetal, animal or microbiological origin, fermentation or biocatalysis, such substances chosen from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The natural flavour base production method envisages fermentation on a substrate, with application of Corynebacterium, Brevibacterium, Bacillus genus microorganisms, and cells destruction leading to production of a primary extract including cell debris. The base is used in various food products, for example, in broths, soups, sauces and beverages. The natural flavour base is added to food in an amount of 0.01 - 50 wt % of the total food weight.

EFFECT: flavour base is natural, has no chemical residual savour and has long storage life.

28 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: alternative methods are proposed to produce a yeast extract to give taste of "kokumi" to food products, containing peptide γ-Glu-X or γ-Glu-X-Gly. One version of proposed methods includes growing of yeast in a nutrient medium containing peptide selected from the group that consists of γ-Glu-X, γ-Glu-X-Gly and X-Gly, and preparation of the yeast extract from the produced cells. Another version includes interaction of γ-glutamiltransferase on the yeast extract containing X or X-Gly, produced from yeast grown in the nutrient medium, to which amino acid X or peptide X-Gly is added. X is an amino acid or its derivative, different from Cys and its derivatives. The yeast extract is described to give "kokumi" taste to food products and produced by the specified methods, containing peptide selected from the group that consists of γ-Glu-X and γ-Glu-X-Gly, in the amount of 0.005% or more of dry weight of the yeast extract, differing by the fact that X is amino acid or its derivative, different from Cys and its derivatives.

EFFECT: invention makes it possible to produce a yeast extract with improved properties.

24 cl, 8 dwg, 14 tbl, 13 ex

FIELD: food industry.

SUBSTANCE: culinary supplement contains decreased amount of monosodiumglutamate (MSG) from 1 to 2 wt %, inosine monophosphate (IMP) and guanosine monophosphate (GMP) from 0.05 to 0.1 wt %, from 10 to 20 wt % of food acids and sugars, from 20 to 45 wt % of macromolecules. Method of preparation of this culinary supplement involves cutting vegetables and/or meat in mixture or separately, blanching vegetables, enzymatic hydrolysis of vegetables and/or meat in mixture or separately, stopping hydrolysis and concentrating.

EFFECT: method of giving and/or intensifying tones of dish taste involves adding a culinary supplement in the amount of 0,001 to 10% in conversion to the total dish weight; invention ensures storage stable culinary supplement providing refined taste in food products without unnecessary chemical aftertaste.

20 cl, 3 ex, 2 dwg

FIELD: food industry.

SUBSTANCE: culinary supplement contains decreased amount of monosodiumglutamate (MSG) from 1 to 2 wt %, inosine monophosphate (IMP) and guanosine monophosphate (GMP) from 0.05 to 0.1 wt %, from 10 to 20 wt % of food acids and sugars, from 20 to 45 wt % of macromolecules. Method of preparation of this culinary supplement involves cutting vegetables and/or meat in mixture or separately, blanching vegetables, enzymatic hydrolysis of vegetables and/or meat in mixture or separately, stopping hydrolysis and concentrating.

EFFECT: method of giving and/or intensifying tones of dish taste involves adding a culinary supplement in the amount of 0,001 to 10% in conversion to the total dish weight; invention ensures storage stable culinary supplement providing refined taste in food products without unnecessary chemical aftertaste.

20 cl, 3 ex, 2 dwg

FIELD: biotechnologies.

SUBSTANCE: alternative methods are proposed to produce a yeast extract to give taste of "kokumi" to food products, containing peptide γ-Glu-X or γ-Glu-X-Gly. One version of proposed methods includes growing of yeast in a nutrient medium containing peptide selected from the group that consists of γ-Glu-X, γ-Glu-X-Gly and X-Gly, and preparation of the yeast extract from the produced cells. Another version includes interaction of γ-glutamiltransferase on the yeast extract containing X or X-Gly, produced from yeast grown in the nutrient medium, to which amino acid X or peptide X-Gly is added. X is an amino acid or its derivative, different from Cys and its derivatives. The yeast extract is described to give "kokumi" taste to food products and produced by the specified methods, containing peptide selected from the group that consists of γ-Glu-X and γ-Glu-X-Gly, in the amount of 0.005% or more of dry weight of the yeast extract, differing by the fact that X is amino acid or its derivative, different from Cys and its derivatives.

EFFECT: invention makes it possible to produce a yeast extract with improved properties.

24 cl, 8 dwg, 14 tbl, 13 ex

FIELD: food industry.

SUBSTANCE: base contains organic acids, amino acids, peptides, aroma substances and 0.01 wt % - 80 wt % of compounds produced by way of extraction of raw materials of vegetal, animal or microbiological origin, fermentation or biocatalysis, such substances chosen from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The natural flavour base production method envisages fermentation on a substrate, with application of Corynebacterium, Brevibacterium, Bacillus genus microorganisms, and cells destruction leading to production of a primary extract including cell debris. The base is used in various food products, for example, in broths, soups, sauces and beverages. The natural flavour base is added to food in an amount of 0.01 - 50 wt % of the total food weight.

EFFECT: flavour base is natural, has no chemical residual savour and has long storage life.

28 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: food composition contains 0.000001 to 0.005 wt % γ-Glu-Nva-Gly; 0.005 to 80 wt % of ingredients obtained from pork or veal, and other food ingredients. The invention also relates to a method for obtaining a food product, which involves a phase of addition of a kokumi flavouring agent representing the above composition to other food ingredients; a food product obtained by means of the above method, and a flavouring method of taste and/or smell of food product using the above composition.

EFFECT: invention allows obtaining food composition with agent γ-Glu-Nva-Gly that shows increased activity of CASR in comparison to known equivalents and has improved kokumi flavouring effect.

14 cl, 1 dwg, 10 tbl, 5 ex

FIELD: food industry.

SUBSTANCE: base includes organic acids or their salts, amino acids, peptides and aromatic compositions and 8 - 80 wt % of natural compositions taken from the group consisting of glutamate, inosine monophosphate and guanosine monophosphate. The base is produced by way of procariotic fermentation with bacteria taken from the group consisting of Corynebacterium glutamicum, Corynebacterium ammoniagenes, Corynebacterium casei, Corynebacterium efficiens, Brevibacterium lactofermentum and Bacillus subtilis; the said base is unpurified. The base is applied in various food products, for example, in broths, dehydrated soups, sauces, beverages, cereals and sponge-cakes. The culinary food product contains the pungent base in an amount of 0.01 - 50 wt %.

EFFECT: taste base is used for taste intensification, is natural and stable during storage and has no yeast after-taste.

27 cl, 5 ex

FIELD: biotechnology.

SUBSTANCE: invention also relates to a nutritional composition comprising herbs and/or spices obtained from plants belonging to Labiatae, "miso" or tomato, the method of preparing a food product comprising the step of adding the agent for imparting Kokumi to food ingredients, food product obtained using the said method, and the method of enhancing taste and/or odour of the food product using the agent for imparting Kokumi.

EFFECT: invention enables to obtain the agent for imparting Kokumi γ-Glu-Nva, which exhibits enhanced activity CASR compared with the known analogues, and has the improved effect of imparting Kokumi.

20 cl, 1 dwg, 6 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and food industry. Disclosed is a kokumi-imparting agent which is γ-Glu-Abu. Also disclosed is a complex kokumi-imparting agent, which includes a combination of not less than 1000 ppm γ-Glu-Abu; and at least one or two amino acids or peptides selected from a group consisting of γ-Glu-X-Gly, where X is an amino acid or amino acid derivative, γ-Glu-Val-Y where Y is an amino acid or amino acid derivative, γ-Glu-Ala, γ-Glu-Gly, γ-Glu-Cys, γ-Glu-Met, γ-Glu-Thr, γ-Glu-Val, γ-Glu-Orn, Asp-Gly, Cys-Gly, Cys-Met, Glu-Cys, Gly-Cys, Leu-Asp, D-Cys, γ-Glu-Met (O), γ-Glu-γ-Glu-Val, γ-Glu-Val-NH2, γ-Glu-Val-"ол", γ-Glu-Ser, γ-Glu-Tau, γ-Glu-Cys (S-Me) (0), γ-Glu-Leu, γ-Glu-Ile, γ-Glu-t-Leu and γ-Glu-Cys (S-Me). Also disclosed is a seasoning composition which includes not less than 1000 ppmw γ-Glu-Abu. The invention also describes methods of producing a food product and a beverage, as well as intermediate products for producing said food product and beverage, which include a step of adding γ-Glu-Abu to other ingredients to obtain said end products containing more than 0.002 g/dl (20 ppm) γ-Glu-Abu. The invention also describes a food product, a beverage and intermediate products for producing said food product and beverage, obtained using said methods and containing more than 20 ppm (specifically less than 200 ppm) γ-Glu-Abu and optionally at least one edible organic acid or a salt thereof, table salt, along with a carrier acceptable for food products and/or at least one or two seasoning ingredients. The invention discloses methods of boosting taste of a food product or beverage, which include a step of adding not less than 400 ppmw γ-Glu-Abu to the food product or beverage.

EFFECT: invention enables to impart kokumi to food products and beverages.

34 cl, 1 dwg, 7 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to crystalline modifications: 1 (polymorphous form F), 2 (polymorphous form I) and 3 (polymorphous form X) of monosodium salt of D-isoglytamyl-D-tryptophan (1:1) characterised by powder X-ray pattern peaks presented in the application materials, as well as to pharmaceutical compositions containing them. The invention describes their use for treating various diseases and body conditions of at least one autoimmune diseases specified in a group consisting of psoriasis, atopic dermatitis and rheumatoid arthritis.

EFFECT: present invention describes the methods for producing the declared crystalline modifications of monosodium salt of D-isoglytamyl-D-tryptophan (1:1).

42 cl, 4 ex, 9 dwg

FIELD: chemistry.

SUBSTANCE: disclosed is a method of producing pure crystalline D-isoglutamyl-D-trytophan which involves a step of removing protection from essentially pure N-tert-butoxycarbonyl-D-isoglutamyl-D-tryptophan or diester thereof to yield essentially pure D-isoglutamyl-D- tryptophan. An amorphous ammonium alt of D-isoglutamyl-D- tryptophan (1:1) is also disclosed. Also disclosed is a method of producing a pure monoammonium salt of D-isoglutamyl-D-tryptophan from essentially pure N-tert-butoxycarbonyl-D- isoglutamyl-D-tryptophan. Disclosed is a compound H-D-Glu-(γ-D-Trp-OR2)-α-OR1 and pharmaceutically acceptable acid addition salts thereof. Disclosed is a solid pharmaceutical composition and use thereof as an immunodepressant or anti-psoriasis agent.

EFFECT: improved method.

51 cl, 14 ex, 8 dwg, 1 tbl

FIELD: biotechnologies.

SUBSTANCE: food composition contains 0.000001 to 0.005 wt % γ-Glu-Nva-Gly; 0.005 to 80 wt % of ingredients obtained from pork or veal, and other food ingredients. The invention also relates to a method for obtaining a food product, which involves a phase of addition of a kokumi flavouring agent representing the above composition to other food ingredients; a food product obtained by means of the above method, and a flavouring method of taste and/or smell of food product using the above composition.

EFFECT: invention allows obtaining food composition with agent γ-Glu-Nva-Gly that shows increased activity of CASR in comparison to known equivalents and has improved kokumi flavouring effect.

14 cl, 1 dwg, 10 tbl, 5 ex

FIELD: biotechnology.

SUBSTANCE: invention also relates to a nutritional composition comprising herbs and/or spices obtained from plants belonging to Labiatae, "miso" or tomato, the method of preparing a food product comprising the step of adding the agent for imparting Kokumi to food ingredients, food product obtained using the said method, and the method of enhancing taste and/or odour of the food product using the agent for imparting Kokumi.

EFFECT: invention enables to obtain the agent for imparting Kokumi γ-Glu-Nva, which exhibits enhanced activity CASR compared with the known analogues, and has the improved effect of imparting Kokumi.

20 cl, 1 dwg, 6 tbl, 4 ex

Up!