Pharmacodynamic markers, induced by alpha interferon

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to immunology. Claimed are versions of applying versions of sets of genes (pharmacodynamic (PD) markers) with increased regulation of expression or action, induced by alpha interferon (αIFN). Described are versions of method of identifying patients for obtaining MEDI-545 by identification of such profiles of expression of αIFN-induced FD markers.

EFFECT: application of invention ensures identification of patients, for which treatment with neutralising antibody MEDI-545 can be really effective, which can be applied in medicine.

10 cl, 90 dwg, 33 tbl, 22 ex

 

The technical field to which the invention relates.

The present invention relates to pharmacodynamic (PD) markers induced by interferon alpha (Ifnα), probes and kits that detect PD markers, and methods of use thereof.

Background of invention

The present invention includes PD markers induced by Ifnα. PD markers may be used in methods of treatment of therapeutic agent that binds to and modulates the action of Ifnα, methods of identifying patients as candidates for the application of therapeutic agent that binds to and modulates the action of Ifnα, methods of diagnosing a patient's disorder associated with elevated levels of Ifnα, methods of monitoring disease progression in a patient receiving treatment with a therapeutic agent that binds to and modulates the action of Ifnα, and ways to identify promising drugs for the treatment of Ifnα-mediated disorders.

Brief description of the invention

In one of the embodiments of the present invention describes a method of identifying a patient as a candidate for treatment with a therapeutic agent that binds to and modulates the action of Ifnα. In the sample taken from the patient, identify the presence or absence of the expression profile And The α-inducible PD markers.

In another embodiment, the present invention describes a method of treating a patient with a disease or disorder mediated IFN of the first type (IFN type I) or Ifnα. An agent that binds to and modulates the activity of IFN type I or Ifnα, is administered to the patient. The agent will neutralize the patient profile the expression of PD markers induced IFN type I or Ifnα.

In another one of the embodiments of the present invention describes a method of treating autoimmune disease in a patient who manifests moderate or pronounced IFN type I or Ifnα PD marker profile. An agent that binds to and modulates the activity of IFN type I or Ifnα, is administered to the patient. The agent will neutralize the patient profile the expression of PD markers, indutsiruemykh IFN type I or Ifnα.

Another variant implementation of the present invention relates to a method of neutralizing the patient, in need thereof, the expression profile of PD markers induced IFN type I or Ifnα. An agent that when administered to a patient binds and neutralizes IFN type I or Ifnα, is administered to the patient. The agent will neutralize the patient profile the expression of PD markers induced IFN type I or Ifnα.

In another embodiment, the present invention describes a method for the diagnosis of the patient's disorder associated with elevated levels of Ifnα. Under the or absence of the expression profile of PD markers, induced Ifnα, set in a sample taken from a patient.

In another one of the embodiments of the present invention describes a method of monitoring the progression of the disease in the patient treated with a therapeutic agent that binds and modulates the action of Ifnα. First the expression profile of PD markers induced Ifnα, get in the first sample obtained from the patient. therapeutic agent that binds to and modulates the action of Ifnα, is administered to the patient. The second profile of expression of PD markers induced Ifnα, receive a second sample obtained from the patient. Compare the first and second expression profiles of PD markers induced by Ifnα.

In another one of the embodiments of the present invention describes a method for the identification of promising therapeutic agent for the treatment of Ifnα-mediated disorders. Cells, including the expression profile of PD markers induced Ifnα, is brought into contact with the agent. Detected in cells of the presence or absence of changes in the expression profile of PD markers induced by Ifnα.

Another variant of implementation of the present invention includes a set of probes.

Another variant implementation of the present invention includes a set containing the probes.

In another one of the embodiments of the present invention described SPO is about identifying action of IFN in the sample. Cells comprising the polynucleotide sequence representing a reporter gene under the control of the IFN-stimulatory response element, incubated with the sample. Identify the reporter gene expression.

Brief description of figures

Figure 1. Analysis by real-time quantitative PCR TaqMan gene expression IFI44 in whole blood of healthy donors, stimulated Ifnα.

Figure 2. Analysis by real-time quantitative PCR TaqMan gene expression IRF2 in whole blood of healthy donors, stimulated Ifnα.

Figure 3. Analysis by real-time quantitative PCR TaqMan RSAD2 gene expression in whole blood of healthy donors, stimulated Ifnα.

Figure 4. Analysis by real-time quantitative PCR TaqMan gene expression G1P3 in whole blood of healthy donors, stimulated Ifnα.

Figure 5. Analysis by real-time quantitative PCR TaqMan gene expression HERC5 in whole blood of healthy donors, stimulated Ifnα.

6. Neutralization product of MEDI-545 gene expression RAB8B-induced IFN-α in whole blood of healthy donors.

7. Neutralization product of MEDI-545 IRF7 gene expression induced by IFN-α in whole blood of healthy donors.

Fig. Neutralization product of MEDI-545 MARCKS gene expression induced by IFN-α in whole blood of healthy donors.

Fig.9. Neutralization product of MEDI-545 IL6ST gene expression induced by IFN-α in whole blood and healthy donors.

Figure 10. Neutralization product of MEDI-545 Ly6E gene expression induced by IFN-α in whole blood of healthy donors.

11. Neutralization product of MEDI-545 gene expression IFIT3, induced IFN-α in whole blood of healthy donors.

Fig. Neutralization product of MEDI-545 IFIT1 gene expression induced by IFN-α in whole blood of healthy donors.

Fig. Neutralization product of MEDI-545 HERC5 gene expression induced by IFN-α in whole blood of healthy donors.

Fig. Neutralization product of MEDI-545 OAS1 gene expression induced by IFN-α in whole blood of healthy donors.

Fig. Neutralization product of MEDI-545 OAS3 gene expression induced by IFN-α in whole blood of healthy donors.

Fig. Neutralization product of MEDI-545 RSAD2 gene expression induced by IFN-α in whole blood of healthy donors.

Fig. Stimulation of ex vivo whole blood identifies genes induced by IFN type I.

Fig. Neutralization product of MEDI-545 25 genes most induced IFN type I in whole blood of individual patients with lupus.

Fig. Heatmap target modulation scheme and the principal component analysis (AGK) using induced IFN type I probes, abdush the increased regulation in whole blood of the patient 1541 before and after treatment with antibody MEDI-545.

Fig. Heatmap target modulation scheme and the analysis of the main comp the components (ASC), based on 25 genes induced by IFN type I, with the increased regulation in whole blood of the patient 1449 before and after applying the antibody MEDI-545.

Fig. Heatmap target modulation according to the calculations of 165 genes induced by IFN type I, with increased regulation in whole blood of the patient, treated with 0.3 mg/kg of antibody MEDI-545.

Fig. Principal component analysis (AGK) using 169 probe sets that 24/35 patients with SLE induced IFN type I, have statistically significant shape IFN type I in whole blood.

Fig. Antibody MEDI-545 will neutralize 25 induced IFN type I probes with the most advanced regulation in patients with lupus. Target neutralization 25 PD markers induced IFN type I, with the increased regulation of genes measured at 1, 4, 7, 14 and 28 days for each patient. Doses range from 0 (placebo) to 3 mg/kg MEDI-545.

Fig. Antibody MEDI-545 will neutralize 25 induced IFN type I probes with the increased regulation in patients with lupus. Target neutralization top 25 PD markers induced IFN type I, with the increased regulation of genes measured at 1, 4, 7, 14 and 28 days for each patient. Doses range from 0 (placebo) up to 30 mg/kg MEDI-545.

Figa and B. Heatmap (a) and ASC (b), showing the neutralization of the top 25 probes induced IFN type I in whole blood of the patient with the KV, which were administered 30 mg/kg MEDI-545 0, 1, 4, 7 and 14 days after dosing.

Figa and B. ASC timetable patients with lupus before (a) and after (b) dosing control placebo show that there is no tendency to change gene curve induced IFN type I. 25 sets of gene probes induced IFN type I, with the increased regulation of use for analysis of the refinery.

Fig. Increased regulation of Ifnα subtypes (type I) in whole blood of individual patients with lupus.

Fig. The distribution of standardized fold change of the top 25 probes induced IFN type I in whole blood of individual patients with lupus.

Figa-century In test pairwise ranking ratio changes found that the antibody MEDI-545 genes will neutralize IFN type I in a clinical study. The neutralized genes are shown for (a) patients with SLE characteristic gene IFN type I to 14 days after application of antibody MEDI-545; (b) patients with SLE, with no sign of gene IFN type I through 14 days after application of antibody MEDI-545; and (C) patients with SLE to 14 days after application of placebo. Marked in yellow signs genes IFN type I is defined as having.

Fig. Hierarchical clustering 1384 probes shows that they are differently regulated by Ifnα subtypes, β, γ and α in stimulated ex vivo whole blood. Each l is tion corresponds to one set of probes, and each column corresponds to a separate sample. The length of the branches show the correlation with which sets of probes/samples connected, with longer branches show a weaker correlation. The color indicates the relative expression of specific sets of genes compared to the standard expression controls not exposed. Red indicates increased regulation compared to control; green indicates reduced regulation compared to control; black indicates no change.

Figa-31B. (a). Hierarchical clustering of the relative expression 25 sets induced IFN type I genes, which sverkhekspressiya in whole blood ex vivo study with different Ifnα subtypes, β, γ and α. (b). Heatmap of the relative expression of the same 25 sets of genes compared to the control without treatment in keratinocytes ex vivo in the study α2, β, γ and α. Red indicates increased regulation of gene expression relative to control, not treated, the green color means reduced regulation of gene expression relative to control, not treated, the black means the absence of significant changes in gene expression of the test samples relative to control.

Figa-32V. Shorecrest the distribution standard (a) and secondary (b) fold change 25 induced IFN type I probes installed in 26 pairs of samples of damaged skin, compared with samples of undamaged skin. (C) averaging the standard and the average fold change for 25 induced IFN type I probes installed overexpression of 26 pairs of samples of damaged skin and intact skin.

Figa-33g. The relative expression of individual induced IFN type I genes ((a) HPSE, (b) OASL and (C) HERC6) and genes not induced by IFN ((g) SERPINB4), on damaged skin as compared with intact skin intact skin compared with normal skin in patients with psoriasis based on data from the microarrays. Fold changes of these genes in the damaged skin compared with genes paired sample intact skin, although intact skin compared with the standard 21 normal control skin. Value j9 for HPSE, OASL, HERC6 and SERPINB4 is a comparison between normal skin and intact skin between the damaged skin and normal skin (in pairs): 0,468, <0,00001; 0,376, <0,00001; 0,03, <0,00001; is 0.0002, <0,00001.

Figa-34B. (a) Hierarchical clustering of all profiled from psoriasis patients (21 normal (blue line) 26 paired samples intact skin (black lines) and damaged skin (red lines) of 24 patients with psoriasis and 3 samples of damaged skin (red lines) from 3 patients with psoriasis, in which paired samples of intact skin does not give quite the full amount crnc for hybridization or scanned alignment have scaling factors, which are more than three times the standard), using 164 induced IFN type I sets of genes with increased regulation in the damaged skin compared with most intact skin. Each line corresponds to one set of probes, and each column corresponds to one sample. The length of the branches show the degree of correlation, with which the samples are connected, with longer branches show a weaker correlation. The color indicates the relative expression of specific sets of genes compared to the standard expression 21 normal sample. Red indicates increased regulation compared to control; green indicates reduced regulation compared to control, (b) AGK all samples of patients with psoriasis profiled 164 increased regulation of IFN type I-induced probes installed in the damaged skin compared with the majority of paired samples intact skin. (AGK calculate and visualize data in the company's product Spotfire). Each circle represents one sample (blue circles=normal skin; black circles=the skin without damage; red circles=damaged skin).

Fig. Overexpression of selected induced IFN type I genes in 18 pairs damaged are intact and the th skin from 18 patients with psoriasis, based on the analysis of taqMan EOC-PCR using the BioMark™ at 48.48 dynamic system company Fluidigm.

Figa-36B. The correlation coefficient distribution sverhagressivnym genes in skin lesions of patients with psoriasis between the results of the taqMan and the results of the alignment. Genes are grouped based on the correlation coefficient between the results of quantitative RT-PCR and TaqMan measurements on microarrays, (a) the correlation coefficient of the distribution of all 40 genes with increased regulation in skin lesions, which are confirmed by quantitative RT-PCR TaqMan; (b) correlation coefficient distribution 29 induced IFN-gene.

Figa-37g. Comparison of taqMan EOC-PCR analysis using the BioMark™ at 48.48 dynamic system and the results of the Affymetrix gene chip® for the selected genes ISG15 and MH induced IFN type I.

Fig. Confirmation using TaqMan EOC-PCR results overexpression of genes IFI27 and CXCL10 induced IFN type I, obtained using Affymetrix gene chip®.

Figa-39e. Stimulation ex vivo normal keratinocytes leukocyte IFN and α2 and dose-dependent neutralization induced IFN type I genes with Ifnα antibodies, (a) neutralization of overexpression of the gene ISG15 in response to 350 Miu/ml α2, (b) neutralization of the overexpression of the gene ISG15 in response to 150 Miu/ml leukocyte IFN, (b) neutralization of light is expressii gene USP18 in response to 350 Miu/ml α2, (d) neutralization of overexpression of the gene USP18 in response to 150 Miu/ml leukocyte IFN, (d) neutralization of overexpression of the gene IFIT2 in response to 350 Miu/ml α2, and (e) neutralizing the overexpression of the gene IFIT2 in response to 150 Miu/ml leukocyte IFN. The curve of the titration of each dose are derived from the three repetitions. The overexpression of individual genes without Ifnα antibodies normalize to 1.

Figa-40V. Relative expression and RNA, and the average fold changes of IFN type I α subtypes (figa), other representatives of type I interferons (figb), and Ifnα receptors (pigv) in skin damage (KP) or in the skin without damage (KBP) compared to skin a healthy normal control subject (SNC). Standard and relative levels of mRNA of these cytokines and their receptors in normal skin two healthy donors were scaled to 1, based on research taqMan CWR-PCR, using a matrix map TaqMan low density (TaqMan low density - TLDA) from the company Applied Biosciences. Red: relative fold change in mRNA in intact skin compared with normal skin; red: relative fold change in mRNA in the damaged skin compared with intact skin. Values p for overexpression of these individual genes in intact skin or damaged skin compared with healthy normal to the her (listed in pairs) the following: α1, 0,303, <0,001; α2, 0,389, 0,072; α5, <0,001, 0,002; α6, 0,664, 0,093; α7, 0,586, 0,077; α8, 0,430, 0,049; α14, 0,224, 0,049; α17, 0,552, 0,0203; α21, 0,113, 0,003; β, 0,255, 0,022; Ifnc, 0,03, <0,001; ω, 0,516, 0,049; AR1, 0,192, <0,001; AR2, <0,001, <0,001, accordingly.

Fig. Relative expression of mRNA and the average fold change of receptors γ, α and γ in damaged skin (PC) or intact skin (NC) compared with skin from healthy normal controls (SNC). The average magnitude of the relative mRNA levels of cytokines and their receptors in normal skin two healthy donors were scaled to 1, based on research taqMan CWR-PCR using TLDA from the company Applied Biosciences. Black: relative fold change in mRNA in intact skin compared with normal skin; red: relative fold change in mRNA in the damaged skin compared with normal skin. Values of p on the expression of individual genes in intact skin or damaged skin compared with normal healthy skin (presented in pairs) the following: γ, 0,02, <0,001; GR1, <0,001, <0,001; GR2, <0,001, <0,001; α, <0,001, <0,001, respectively.

Fig. Venn diagram illustrating the number of sets of probes that changed under the influence of IFN type I, γ and α during stimulation ex vivo, and sets of probes that changed in the damaged skin compared to not breitenau skin. Red room: the sets of probes, which show increased expression in the processing of a cytokine, or comparison with the initial level of intact skin; the green room: the sets of probes, which show reduced expression in the processing of a cytokine or baseline levels of intact skin. Intersecting areas represent sets of probes that are common to both comparisons.

Figa and 43B. Co-expression of genes induced by IFN type I, type-II IFN and TNF, damaged/intact skin of patients with psoriasis, based on the results of gene chip Affymetrix genechip®. IFN type I, type-II IFN and α induced genes were selected based on experiments on stimulation ex vivo (examples 10 and 16). The set of probes with at least twofold change in the damaged skin relatively intact regarded as sverkhekspressiya. (a) the number of IFN type I Ifnα and α induced genes with increased regulation in the damaged skin shows a strict correlation. (b) the number of IFN type I Ifnα and α induced genes in the damaged skin is significantly different in pairwise comparisons.

Fig. Immunohistochemical analysis of biopsy samples from the skin of psoriasis patients, intact skin and skin healthy donors. BDCA2 is a specific marker for cell who infiltrates pDC, which are contained in larger quantities in the damaged skin compared with intact skin and are completely absent in normal skin. CD83 is a marker for mDC, CD4 is present on T-cells and dendritic cells. Staining of protein STAT1 is observed in the epidermis damaged skin (and in the nucleus and in the cytoplasm) and in the dermal mononuclear inflammatory cells, but not in the skin without damage and not in healthy skin. Increase protein ISG15 see in the skin of psoriasis and to a lesser extent in the skin without damage, but not detected in healthy skin.

Fig. Venn diagram illustrating the number of sets of probes that show altered expression at the mRNA level in the damaged skin compared with intact skin or intact skin compared with normal skin in patients with psoriasis. Values shaded in red indicate the number of sets of probes with significantly increased regulation, although such values are shaded in green indicate the number of sets of probes with significantly reduced regulation. The overlapping area represents the set of probes common to both maps.

Fig. Graphical representation of the signaling pathways of IFN, which is activated in the damaged skin of psoriasis patients. Visualization of metabolic pathways get through integrated programs the CSO ensure GeneGo''s MetaCore. Individual characters mean well described proteins or protein complexes. Arrows, binding proteins, are stimulatory, inhibitory or interactive effect of the protein on the protein target. Thermometers located next to the individual symbols represent the relative levels of expression (red indicates overexpression, green indicates lower expression) transcripts, which include a protein (or protein complex) in a specific metabolic pathway.

Figa and 47b. The table represents the fold change (fold change fc; log2 transformation) and the q-value (calculated by FDR) top 100 sets of genes with increased regulation in the damaged skin compared to neprovedenie skin psoriasis. Also listed are log2 transformed fold change and q values of these genes when comparing intact skin with a healthy normal skin controls. IFN type I-induced genes in bold.

Fig. Specific Department of damaged skin from intact skin and normal skin - hierarchical clustering of all samples using the profiles of transcription of all genes on the matrix of the whole genome (Affymetrix whole genome U133 plus v2.0 matrix).

Fig. The set of probes identified as induced Ifnα, overlapping on Fig.

Fig. On the PRS probes, identified as induced Ifnα, overlapping on Fig.

Fig. The set of probes identified as induced IFN type I, overlapping on Fig.

Fig. Immunohistochemical analysis of biopsy specimens from skin lesions of patients with SLE treated with placebo for detection of pDC, mDC and T-cell infiltrates.

Fig. Immunohistochemical analysis of biopsy specimens from skin lesions of patients with SLE treated with placebo, for the detection of HERC5, ISG15 and IP10 protein, proteins, downregulation induced with IFN type I genes.

Fig. Immunohistochemical analysis of biopsy specimens from skin lesions in patients with SLE treated with 10 mg/kg MEDI-545, to identify pDC, mDC and T-cell infiltrates.

Fig. Immunohistochemical analysis of biopsy specimens from skin lesions of patients with SLE treated with the product of MEDI-545 in the amount of 10 mg/kg, for the detection of HERC5, ISG15 and protein IP10, proteins, downregulation induced with IFN type I genes.

Fig. Immunohistochemical analysis of biopsy specimens from skin lesions of patients with SLE treated with antibody MEDI-545 in the amount of 10 mg/kg, for detection of pDC, mDC and T-cell infiltrates.

Fig. Immunohistochemical analysis of biopsy specimens from skin lesions of patients with SLE treated with the product of the MD MEDI-545 in the amount of 10 mg/kg, for detection of HERC5, ISG15 and protein IP10, proteins, expressed from the induced type I IFN gene type.

Figa and b. Heatmap (a) and ASC (b), showing the neutralization of the top 25 IFN type I induced genes in a biopsy specimen of the skin of the patient with SLE treated with MEDI-545 in the amount of 10 mg/kg at 0 days and 7 days after dosing.

Figa, Detection of activity of IFN type I and II in bioclean IFN.

Figa and 60B. Identification of MEDI-545 (a) and MEDI-546 (b)-mediated neutralization steps Ifnα in bioclean IFN.

Fig. Detection of anti-Ifnα-mediated neutralization steps Ifnα in bioclean IFN.

Fig. Detection of anti-Ifnα-mediated neutralization steps Ifnα in bioclean IFN.

Fig. Detection of anti-Ifnα-mediated neutralization steps Ifnα in bioclean IFN.

Fig. Heatmap modulation of gene expression in whole blood of healthy donors, stimulated ex vivo Ifnα, α or Ifnα/β. The negative control (OK).

Fig. Induced IFN type I genes are among the genes with the most advanced regulation in whole blood of patients with SLE.

Fig. Regulation of mRNA molecules γ, ω, R1 and R2 increased in whole blood of patients with lupus.

Fig. Heatmap shows the modulation of gene expression in MCPC healthy donor ex vivo stimulated serum of patients who erythematosus.

Figa and b. (a) Schedule AGK shows patients with lupus who have strong/moderate induced IFN type I index (about 66% in this sample) are collected together. (b) the table shows the 25 genes used for the analysis of the refinery.

Fig. Confirmation of overexpression of individual induced IFN type I genes in patients with systemic lupus research-based taqMan KPB-PCR (quantitative real-time polymerase chain reaction)using the BioMark™ at 48.48 dynamic array company Fluidigm (array with variable boundaries).

Figa and b. (a) the Ability of four different serum samples of patients with SLE to induce action of IFN type I in the study of the reporter gene. (b) the Number of transcripts induced by at least three times in MCPC healthy person each of four different serum samples of patients with SLE after co-incubation for 4 hours

Figa and 716. The majority of genes that neutralized the influence of anti-Ifnα antibody after 4 h after co-incubation of the serum of a patient with SLE and MCPC healthy person is IFN type I genes, although the majority of genes, neutralized anti-Ifnα antibody after 18 h after co-incubation of the serum of a patient with SLE and MCPC healthy person, not an IFN type I genes that were shown (a) analyze the heatmap and presents (b) in the form of histograms.

Figa and 71, b. Presents (a) IFN type I genes and (b) genes that are not related to IFN type I genes, the regulation of which was raised and neutralized anti-Ifnα antibody 18 h after co-incubation of the serum of a patient with SLE and MCPC healthy person, but a regulation which was not increased after 4 h joint incubation of the serum of a patient with SLE and MCPC healthy person.

Fig. Presents metabolic pathways and cellular processes, neutralized anti-Ifnα antibody 18 h after co-incubation of the serum of a patient with SLE and MCPC healthy person.

Figa and 74B. Identification of (a) high and (b) low levels of specific proteins in the serum of patients with lupus.

Fig. Analysis QuantiGenePlex 1.0 IFN-inducible gene signature in whole blood of 5 healthy donors stimulated 20 U/ml α2b.

Fig. Dose-dependent changes in gene expression in the blood of a healthy donor, after processing multiple concentrations α2b.

Fig. Detection of IFN-inducible transcripts in samples of whole blood of subjects with SLE stored in PAXgene tubes, with detectable and undetectable activity of Ifnα serum.

Fig. Correlation between QuantiGenePlex and Fluidigm technology in samples of whole blood of subjects with SLE stored in PAXgene tubes.

Fig. Longitudinal testing treatment the samples of SLE after the introduction of anti-Ifnα monoclonal antibodies: comparison QuantiGenePlex 2.0 and Fluidigm technology.

Fig. Typical option heatmap visualizing (in descending order) overexpression of genes of the IFN type I; index overexpression of granulocytes; index decreased expression of T-cells, an indicator of reduced expression of NK-cells and the indicator decreased expression of b-cells in whole blood 46 patients with SLE (shown by the red line around heatmap) compared with whole blood from 24 healthy donors (indicated by the blue line around heatmap) IFN = interferon; SLE = systemic lupus erythematosus.

Figa-W. Genes induced by IFN type I in whole blood of patients with SLE can be used to separate patients with SLE with the characteristic genes of IFN type I and healthy normal controls. (a) three-Dimensional chart AGK whole blood 46 samples from patients with SLE using 114 induced IFN type I probes, shows increased regulation in whole blood of patients with SLE compared with the corresponding figure from 24 healthy donors. (b) Chart AGK whole blood from 54 patients with SLE in the upcoming study, using a set of 114 induced IFN type I genes with increased regulation, confirmed the overexpression of genes of IFN type I in patients with SLE. (C) Graph AGK whole blood from 100 samples of SLE in this and subsequent studies using a panel of 21 induced IFN type I gene with increased regulation in p. the patients with SLE compared with 24 healthy donors. Each point represents one sample (blue dots healthy subjects; red dots - patients with SLE). IFN = interferon; ASC = principal component analysis; SLE = systemic lupus erythematosus.

Fig. Relative expression of mRNA molecules and the average fold change (horizontal bar chart) receptors TNF-α, IFN-γ and IFN-γ receptors in whole blood of patients with SLE compared with healthy control subjects (P<0.05 for all). The average magnitude of the relative mRNA levels of these cytokines and their receptors in whole blood 24 healthy donors were scaled to 1, based on research taqMan CWR-PCR. IFN = interferon; EOC-PCR = quantitative real-time transcriptase polymerase chain reaction; SLE = systemic lupus erythematosus; TNF = tumor necrosis factor.

Figa-W. TaqMan EOC-PCR confirmed the overexpression of IFN type I - induced genes in whole blood of patients with SLE. (a) Relative fold change 15 induced IFN type I genes (denoted 1-15) in patients with SLE compared with healthy donors (p<0.05 for all). The average values of the relative mRNA levels of genes in United RNA from 24 healthy donors were scaled to 1, based on research taqMan CWR-PCR. Horizontal lines represent the average fold change. (b and C) Evaluation of TaqMan EOC-HRC the overexpression panel of 21 gene induced by IFN type I genes in whole blood of patients with SLE method of determining, applicable to whole genome alignment. The relative overexpression of 21 gene induced by IFN type I, two patients with SLE, shown using methods of using the microchip (left) and TaqMan (right). The correlation coefficients between the TaqMan QRT-PCR and microchip are 0,9861 and 0,9888 for patients X and Y, respectively. IFN = interferon; EOC-PCR = quantitative real-time reverse transcriptase polymerase chain reaction; SLE = systemic lupus erythematosus.

Fig. The magnitude of overexpression of genes of the IFN type I in whole blood of patients with SLE according to the measurements of the average ratio of change 25 most sverkhekspressiya induced IFN type I genes or assessment genes IFN type I in selected patients with SLE. Horizontal lines represent mean values. Patients in whom the index of the genes of IFN type I ≥10, appreciate as strong indicators genes IFN type I; patients whose assessment of indicator genes IFN-I is 4-10, assessed as having moderate indicators genes IFN type I; patients whose evaluation indicators genes IFN type I ≤4, assessed as having weak indicators of IFN type I. IFN = interferon; SLE = systemic lupus erythematosus.

Figa-85C. Division 35 patients with SLE into groups with low (a; green), moderate (b; gray) and the K (; red) indicator gene IFN type I based on the average ratio of change on the panel of 21 gene induced by IFN type I genes. Density for each patient with SLE calculate, and represent graphically, using the fold change for each of the 21 gene from each patient with SLE in log2scale to represent the distribution of values of fold changes 21 gene. Vertical dotted lines divide the class 3 estimates of gene signatures: 7 patients with low gene expression of IFN type I = the average fold change <1,91 (0,93 on a log2scale), 8 patients with moderate gene expression of IFN type I = the average fold change 1,91-of 5.53 and 20 patients with a strong expression of IFN genes I = average fold change >of 5.53 (2,47 on a log2scale). IFN = interferon; SLE = systemic lupus erythematosus.

Fig. Dose-dependent neutralization by antibody MEDI-545 21 induced IFN-α/β gene with increased regulation in patients with SLE.

Figa and b. Heatmap (a) and ASC (b), showing the neutralization 21 induced IFN-α/β gene with increased regulation in whole blood of patients with SLE treated with MEDI-545 in the amount of 30 mg/kg (0, 1, 4, 7 and 14 days after dosing).

Figa and 88B. Chart AGK, obtained by applying the 21-induced IFN-α/β probe with increased regulation, do not show neutralizing IFN signature in patients, treatment is subjected to a placebo.

Fig. Neutralization 21 induced IFN-α/β gene with increased regulation established in patients after treatment with antibody MEDI-545 in the amount of 0.3, and 1.0 to 3.0, and 10.0 and 30.0 mg/kg

Fig. The methodology of calculating the neutralization targets for Fig.

Detailed description of the invention

The present invention encompasses methods of identifying, diagnosing, treatment and monitoring of disease progression in patients. Patients are treated animals of any kind with IFN type I or Ifnα-induced disease, disorder or condition. The patient may have the disease, disorder or condition as a result of experimental studies, for example, this may be an experimental model developed for the disease, disorder or condition. In another embodiment, the patient may be a disease, disorder or condition in the absence of experimental manipulation. To patients include humans, mice, rats, horses, pigs, cats, dogs and any other animals used for research.

The patient can have the expression profile of PD markers induced IFN type I or Ifnα. The expression profile of PD markers induced IFN type I or Ifnα, can be a strong profile, moderate profile or low profile. The expression profile of PD markers induced IFN type I or Ifnα may be the ü easily identified as strong, moderate or weak by looking at the multiplicity of the dysregulation of the expression profile of PD markers induced IFN type I or Ifnα, the patient (e.g., fold increase in the patient's expression of PD markers induced IFN type I or Ifnα, regulation which increased)relative to the control sample (samples) or control patients (patients) and compare the multiplicity of regulation in patients compared with other patients with the expression profile of PD markers induced IFN type I or Ifnα. The multiplicity of regulation violations can be calculated known in the field of ways. See, for example, example 8.

The expression profile of PD markers induced IFN type I or Ifnα may include increased regulation of any group of genes or groups of genes detected by the probes listed in table 19, 20, 21, 22, 23, 24, 26, 28 or 30. The group of genes or group of genes detected by the probes identified in table 19, 20, 21, 22, 23, 24, 26, 28 or 30 may include any at least 2 or at least 3 or at least 4 or at least 5 or at least 6 or at least 7 or at least 8 or at least 9 or at least 10 or at least 11 or at least 12 or at least 13, any on me is greater as 14, any at least 15 or at least 16 or at least 17, which is either at least 18 or at least 19 or at least 20 or at least 21 or at least 22, any of at least 23 or at least 24, any at least 25 or at least 26, any on at least 27, any of at least 28, any of at least 29, any at least 30 or at least 40, or any at least 50 genes, or genes detected by the probes identified in these tables.

A group of genes that can be included in the expression profile of the patient's PD markers induced IFN type I or Ifnα, the genes can be MG, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RASD2, and IFI44. To the gene or genes detected by the probes may include genes IFI44, IFI27, IFI44L, DNAPTP6, LAMP3, LY6E, RSAD2, HERC5, IFI6, ISG15, OAS3, SIGLEC1, OAS2, USP18, RTP4, IFIT1, MH, OAS1, EPSTI1, PLSCR1 and IFRG28.

To genes may include any at least 2 or at least 3 or at least 4 or at least 5 or at least 6 or at least 7 or at least 8 or at least 9 or at least 10 or at least 11 or at least 12, or any at mere, or any at least 14 or at least 15, or any at least 16 or at least 17, or any at least 18 or at least 19, or at least 20, or any at least 21, or any at least 22, or any of at least 23 or at least 24, or any or at least 25, or any at least 26, or any at least 27, or any at least 28, or any at least 29, or any at least 30 of genes LAMP3, DNAPTP6, FLJ31033, HERC6, SERPING1, EPSTI1, RTP4, OASL, FBXO6, IFIT2, IFI44, OAS3, BATF2, ISG15, IRF7, RSAD2, IFI35, OAS1, LAP3, IFIT1, IFIT5, PLSCR1, IFI44L, MS4A4A, GALM, UBE2L6, TOR1B, SAMD9L, HERC5, TDRD7, TREX1, PARP12 and AXUD1.

The expression profile of PD markers induced IFN type I or Ifnα may include increased regulation of the whole group of genes or groups of genes, detected by probes presented in one table (table 19, or table, or table 21, or table 22, or table, or table, or table, or table, or table), or one or more of the genes represented on Fig, PD markers induced IFN type I or Ifnα. The expression profile of PD marker may include increased regulation of all genes represented in table. The expression profile of PD markers induced IFN type I or Ifnα may include increased regulation of genes identificireba the data on figa or figb, or figa and figb.

The patient has the expression profile of PD markers induced IFN type I or Ifnα may additionally have a PD marker (markers) with reduced regulation of IFN type I or Ifnα. PD markers with low regulation may include any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, maybe 15, maybe 20, maybe 25, maybe 30, maybe 35, maybe 40, maybe 45 or some 50 genes from table or any gene of CYP1B1, TGST1, RRAGD, IRS2, MGST1, TGFBR3 and RGS2.

The patient has the expression profile of PD markers induced by IFN type I or Ifnα can optionally have an increased expression regulation of any number of Ifnα or IFN type I subtypes. Ifnα or IFN type I subtypes may include any or more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine or more than ten Ifnα or IFN type I subtypes. These subtypes may include α1, α2, α4, α5, α6, α7, α8, α10, α14, α17, α21, β or ω. The patient can be increased regulation of expression of IFN subtypes α1, α2, α8 and α14.

Another is ariante the patient, subjected to the treatment described in this invention, can be readily identified as a patient who has a profile of gene expression with increased expression regulation of any number of Ifnα or IFN type I subtypes. Ifnα or IFN type I subtypes may include any or more than one, more than two, more than three, more than four, more than five, more than six, more than seven, more than eight, more than nine or more than ten Ifnα or IFN type I subtypes. These subtypes can be α1, α2, α4, α5, α6, α7, α8, α10, α14, α17, α21, β or ω. These subtypes can be α1, α2, α8 and α14.

The patient with the expression profile of PD markers induced by IFN type I - or Ifnα, may also have increased regulation of expression of Ifnα receptors, or AR1, or AR2, or both, or α, or γ, or γ receptors (or GR1, GR2, or GR1, and GR2). The patient can be easily identified as a patient who observed increased expression of Ifnα receptors, or R1, or R2, or both, or α, or γ, or γ receptors (or GR1, GR2, or GR1, and GR2).

Increased regulation or reduced regulation of the expression profile of PD markers induced by IFN type I - or Ifnα, the patient may be expressed in any of libetpan compared to the same indicator in the sample from control (which can be a sample, which is not diseased tissue of the patient (for example, the skin without damage from a subject with psoriasis) or from a healthy subject not having the disease or disorder). The increased regulation or down regulation may be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, or least 200%or at least 300%, or at least 400%, or at least 500% of the increase in regulation or down regulation control or control sample.

In addition, the patient may occur overexpression or they can be of cloth, which sverkhekspressiya IFN type I subtype in the amount of at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, or at least 200%or at least 300%, or at least 400%, or at least 500% of the number in the control. Subtype IFN type I can be any of the tracks which were: α1, α2, α4, α5, α6, α7, α8, α10, α14, α17, α21, β or ω. The subtypes of IFN type I can relate to all of a number α1, α2, α8 and α14.

Patients may also include, or alternatively include changes in the levels of proteins in serum. The patient may have elevated levels of plasma proteins, for example, adiponectin, alpha-fetoprotein, apolipoprotein CIII, beta-2 microglobulin, cancer antigen 125, cancer antigen 19-9, uoxetine, FABP, factor VII, ferritin, IL-10, IL-R, IL-16, IL-18, IL-1ra, IL-3, MCP-1, MMP-3, myoglobin, SGOT, tissue factor, TIMP-1, TNF RII, TNF-alpha, VCAM-1, or vWF. The patient may have elevated levels in the serum of any of the proteins 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25 or 26. Elevated levels may be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%, at least 100%, at least 125%, at least 150%, or at least 200%or at least 300%, or at least 400%, or at least 500% of the control level, e.g., a healthy subject. The change may be a decrease in serum proteins, for example, BDNK, complement 3, CD40 ligand, EGF, ENA-78, EN-RAGE, IGF-1, MDC, myeloperoxidase, RANTES or trom epoetin. The patient may have decreased levels in the serum of any of 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or 11 of these proteins. Lower level can be at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 90%or at least 100%of the control level, e.g., a healthy subject. Profile PD marker may include one or more of the specified high or low levels of proteins in serum.

The patient can optionally enable auto-antibodies that are associated with any of the following auto-antigens: (a) interferon - induced protein p78 myxoviruses (influenza virus) resistance 1; (b) surfeit 5, transcriptin variant c; (C) proteasome (possamai, multicatalytic protease) activator subunit 3 (RA gamma; Ki) trans c; (d) alpha receptor retinoic acid; (e) protein heat shock 10 kDa 1 (chaperonin 10); (f) tropomyosin 3; (g) the domain related homologue of pleckstrin, family a, 1 representative; (h) cytoskeleton-associated protein 1; (and) antigen A2 Sjogren syndrome (60 kDa, ribonucleoprotein auto-antigen SS-A/Ro); (K) the NADH dehydrogenase (ubiquinone) 1, alpha/beta sub-complex 1, 8 kDa; (l) homolog 1 gene nuclear distribution is (NudE - nuclear distribution gene E) (A. nidulans); (m) the MutL homolog 1, colon cancer, nonpolyposis, type 2 (E. coli); (h) enriched with leucine repeat (in FLII) interacting protein 2; (o) tropomyosin 1 (alpha); (p) spastic lower paraplegia 20, Spartina (Troyer syndrome); (p) preimplantation protein, transcript variant 1; (C) mitochondrial ribosomal protein L45; (t) a homologue of Lin-28 (C. elegans); (u) the heat shock protein 1, weight 90 kDa alpha; (f) dom-3 homolog Z (C. elegans); (x) Geneina, cytoplasmic, light intermediate polypeptide 2; (C) Ras-related substrate 1 C3 toxin botulism (rho family, low molecular weight GTP binding protein); (h) synovial sarcoma, X checkpoint 2, transcript variant 2; (W) Motina; (III) a homologue of the packaging vector {Drosophila), transcript variant 1; (e) GCN5 (type 2 common control amino acid synthesis 5 (yeast); (h) eukaryotic elongation factor broadcast 1, gamma; (I) eukaryotic elongation factor broadcast 1, Delta; (AA) DNA-damage-inducing transcript 3; (BB) SEAT/enhancer binding protein (C/HEB) gamma; and any other autoantigens described in the provisional application entitled "Auto-antibody markers of autoimmune disease"filed may 3, 2007, or in the provisional application entitled "Auto-antibody markers of autoimmune disease", submitted November 6, 2007 (for example, described in tables 2, 4, 5 I, but their list is not limited). The patient may contain auto-antibodies that are associated with any number of these auto-antigens, for example, any of at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 13, at least 14, at least 15, at least 20, at least 25 of auto-antigens.

Other diseases, disorders or conditions that induced IFN type I or Ifnα include any of the diseases, disorders or conditions that show the profile of expression or gene signature IFN type I or Ifnα PD markers. Note that the expression profile of and proylene genes PD markers may be equivalent. To those diseases, disorders or conditions include diseases, disorders or conditions with an autoimmune component, for example, systemic lupus erythematosus (SLE), insulin-dependent diabetes mellitus, inflammatory bowel (including Crohn's disease, ulcerative colitis and celiac disease), multiple sclerosis, psoriasis, autoimmune thyroiditis, rheumatoid arthritis, glomerulonephritis, idiopathic inflammatory myositis, Sjogren Syndrome, vasculitis, dermatomyositis, polyanionic and sarcoidosis. To other sableman the pits, disorders or conditions include disease graft-versus-host and graft rejection.

Patients also may occur any number of symptoms, for example, considered at the time the patent application "Methods of Treating Systemic Lupus Erythematosis" ("treatment of systemic lupus erythematosus"), filed on April 16, 2007, or may be clinical evaluation CKBDAI or BILAG discussed in this application. To these symptoms may include fatigue, organ damage, rash on the cheeks ("skin butterfly") and alopecia. Evaluation of a patient can be produced using known clinical evaluation system, for example, the system CKBDAI, which is an indicator manifestations of SLE, defined and evaluated over the last 10 days (Bombardier C., and others, Arthritis Rheum 35, 1992, SS. 630-640). The degree of manifestation of disease evaluation system CKBDAI may vary 0 to 105. Identify the following categories of manifestations of the disease evaluation system CKBDAI: the disease does not manifest itself (CKBDAI=0); weak manifestation (CKBDAI=1-5); moderate expression (CKBDAI=6-10); high expression (CKBDAI=11-19); very high expression (CKBDAI=20 or more). (Griffiths and others). Another index of evaluation of the disease is the BILAG index - the index of the activity of SLE, which is based on specific clinical manifestations in eight organ systems: overall body, skin and mucous membrane, not the hydrometeorological, musculoskeletal, cardiovascular, respiratory, renal and blood counts. The assessment is based on the alphabetic system, but weighted numerical assessment can also be assigned for each letter, creating the possibility of counting the BILAG assessment in the range 0-72. (Griffiths and others). Other indicators include the assessment of the PGA, complex respondency index (composite responder index - CRI) and test ANAM4™. The methods described in the present invention, for example, the treatment of autoimmune disorders that can be applied to any subject identified as having some level of disease on the measurement of any classification method known in this field, for example, weak, moderate, high or very high. The methods described in the present invention, for example, a method of treating an autoimmune disorder, can lead to a reduction in patient symptoms or can lead to better assessment of the disease, disorder or condition that induced IFN type I or Ifnα.

therapeutic agent can be administered to the patient or the patient can be identified as a candidate for the introduction of the agent or therapeutic agent. A therapeutic agent is any molecule that binds to and modulates the activity of IFN type I or Ifnα. Therapeutic agent m who may be low-molecular compound or biological agent. If therapeutic agent is a low molecular weight compound, it can be synthesized or identified and selected from a natural source.

If therapeutic agent is a biological agent, it can be an antibody specific for a subtype (subtype) of IFN type I or Ifnα. For example, the antibody can be specific for any of the α1, α2, α4, α5, α6, α7, α8, α10, α14, α17, α21, β or ω. In another embodiment, the antibody can be specific for any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, any eleven, any twelve IFN type I Ifnα subtypes. If the antibody is specific for more than one subtype of IFN type I, the antibody may be specific α1, α2, α4, α5, α8, α10 and α21, or it may be specific regarding α1, α2, α4, α5, α8 or α10, or it may be specific regarding α1, α2, α4, α5, α8 and α21, or it may be specific regarding α1, α2, α4, α5, α10 and α21. Antibodies specific IFN type I or include Ifnα antibody MEDI-545, any biologic, or an antibody other than MEDI-545, an antibody described in US 11/009410 and 11/15494, 9F3 and other antibodies described in US 7087726 (example 1 and example 2, the antibodies listed in table 3 and table 4, and/or antibodies described in table., entitled "Deposit of Material in rows 25-54, column 56), NK-2 and YOK5/19 (WO 84/03105), LO-22 (US 4902618), 144 BS (US 4885166), and EBI-1, EBI 2, and EBI-3 (EP 119476). A therapeutic agent that modulates the action of Ifnα, can neutralize the effect of Ifnα. Specialists in this area known for drugs and formulations such biological agents and methods for their introduction.

The antibody may be a synthetic antibody, a monoclonal antibody, polyclonal antibody, recombinante generated antibody, intracellular antibody polyspecific antibody (including bespecifically antibody, human antibody, humanized antibody, chimeric antibody, single-chain (single-chain Fv - scFv) (including bespecifically single-chain antibody scFv)molecule BiTE, single-chain antibody, Fab fragments, fragment F(ab'), disulfide-linked Fv fragment (disulfide-linked Fv - sdFv), or epitope-binding fragment of any of the above antibodies. The antibody may be of any immunoglobulin molecule or immunologically active part of the molecule of the immunoglobulin. In addition, the antibody can refer to any isotype. For example, it can be any of the isotypes IgG1, IgG2, IgG3 or IgG4. The antibody can be an is a full body length, including variable and constant region, or antigennegative fragment, for example, single-chain antibody, or Fab, or Fab'2 fragment. The antibody may also be conjugated or linked to a therapeutic agent, such as a cytotoxin or a radioactive isotope.

In the methods of treatment of a second agent other than the agent that binds to modulate the action of Ifnα, can be administered to the patient. Second agents include, but are not limited to, non-steroidal anti-inflammatory drugs such as ibuprofen, suprofen, sulindac, diclofenac, piroxicam, Ketoprofen, diflunisal, nabumetone, etodolac and oxaprozin, indomethacin; antimalarials such as hydroxylation; corticosteroid hormones such as prednisone, hydrocortisone, methylprednisolone, and dexamethasone; methotrexate; IMMUNOSUPRESSIVE agents, such as azathioprine and cyclophosphamide; and biological agents that target T-cells, such as alefacept and efalizumab, or target α, for example, Enbrel, Remicade and Humira.

The treatment agent may lead to the neutralization profile induced IFN type I or Ifnα. The treatment agent may result in reducing the appearance of one or more symptoms of diseases or disorders mediated IFN type I or Ifnα. Cured the e agent can lead to weaker Ares, associated with a disease or disorder mediated IFN type I or Ifnα. The treatment agent may lead to improved prognosis for a patient that has a disease or disorder mediated IFN type I or Ifnα. The treatment agent may lead to improved patient's quality of life. The treatment agent may alleviate the need for the simultaneous introduction of second agents, or may lower the dose of the introduction of the second agent to the patient. The treatment agent may reduce the number of hospitalizations of patients that are associated with a disease or disorder mediated IFN type I or Ifnα.

An agent that binds to and modulates the activity of IFN type I or Ifnα, can neutralize profile induced IFN type I or Ifnα. Neutralization profile induced IFN type I or Ifnα can be reduced by at least one, at least two, at least three, at least five, at least seven, at least eight, at least ten, at least twelve, at least fifteen, at least twenty, at least twenty five, at least thirty, at least thirty, at least forty, at least forty-five, or at least fifty genes, regulation of which increased IFN type I or Ifnα. Genes that have increased regulation of IFN-I t is a or Ifnα, can be any group of genes from table 19, 20, 21, 22, 23, 24, 26, 28 or 30 according to the above. Neutralization of IFN type I or Ifnα inducible profile is reduced by at least 2%, at least 3%, at least 4%, by at least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%at least 50%, at least 60%, at least 70%, at least 75%, at least 80%or at least 90% of any of lipopo least one, at least two, at least three, at least five, at least seven, at least eight, at least ten, at least twelve, at least fifteen, at least twenty, at least twenty-five at least thirty, at least thirty-five, at least forty, at least juice five, or at least fifty genes, the regulation of which is raised in any of IFN type I or Ifnα-inducible profile. In another embodiment, the neutralization of IFN type I or Ifnα-inducible profile refers to a decrease in the expression of IFN type I or Ifnα-inducible genes with increased regulation, which constitute no more than 50%, not more than 45%not more than 40, not over 35%not over 30%not over 25%not over 20%not more than 15%, no more than 10%, not more than 5%, no more than 4%, no more than 3%, no more than 2%not more than 1% from the levels of expression of the corresponding IFN type I or Ifnα-inducible genes in the control sample. If the agent that binds and modulates the activity of IFN type I or Ifnα is a biological agent, such as antibody, the agent can neutralize IFN type I or Ifnα profile in doses of 0.3-30 mg/kg, 0.3 to 10 mg/kg, 0.3 to 3 mg/kg, 0.3-1 mg/kg, 1-30 mg/kg, 3-30 mg/kg, 5-30 mg/kg, 10-30 mg/kg, 1-10 mg/kg, 3-10 mg/kg or 1-5 mg/kg

Neutralization of IFN type I or Ifnα-inducible profile can be enhanced expression of at least one, at least two, at least three, at least five, at least seven, at least eight, at least ten, at least twelve, at least fifteen, at least twenty, at least twenty five, at least thirty, at least thirty-five, at least forty, at least forty-five, or at least fifty genes, the expression of which decreases under the action of IFN type I or Ifnα. Genes, the expression of which is reduced under the action of IFN type I or Ifnα may be any group of genes from table. Neutralization of genes with reduced regulation in IFN type I or Ifnα-nutirion profile is increased by at least 2%, at least 3%, at least 4%, by at least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%or at least 90%or at least 100%, or at least 125%, or at least 130%, or at least 140%, or at least 150%, or at least 175%, or by at least 200%, or at least 250%, or at least 300%, or at least 500% any at least one, at least two, at least three, at least five, at least seven, at least eight, at least ten, at least twelve, at least fifteen, at least twenty, or at least dvadtsat five genes, regulation of expression of which is reduced in any in IFN type I or Ifnα-inducible profile. In another embodiment, the neutralization of IFN type I or Ifnα-inducible profile refers to the increased expression of IFN type I or Ifnα-inducible genes, which constitute no more than 50%, not more than 45%not more than 40%not over 35%not over 30%not over 25%not over 20%not more than 5%, not more than 10%, not more than 5%, no more than 4%, no more than 3%, no more than 2%not more than 1% from the levels of expression of the corresponding IFN type I or Ifnα-inducible genes (with low regulation) in the sample. If the agent that binds and modulates IFN type I or Ifnα action, is a biological agent, e.g. antibody, the agent can neutralize IFN type I or Ifnα profile in doses of 0.3-30 mg/kg, 0.3 to 10 mg/kg, 0.3 to 3 mg/kg, 0.3-1 mg/kg, 1-30 mg/kg, 3-30 mg/kg, 5-30 mg/kg, 10-30 mg/kg, 1-10 mg/kg, 3-10 mg/kg or 1-5 mg/kg

An agent that binds to and modulates the activity of IFN type I or Ifnα may additionally, or alternatively, to neutralize the expression of one or more of IFN type I or Ifnα subtypes. Subtypes of IFN type I or Ifnα may include more than one, than two, than three, more than four, more than five, more than six, more than seven, more than eight, more than nine or more than ten subtypes of IFN type I or Ifnα. To these subtypes can be α1, α2, α4, α5, α6, α7, α8, α10, α14, α17, α21, β or ω. These subtypes may include all α1, α2, α8 and α14. In another embodiment, all of the subtypes can include α1, α2, α4, α5, α8, α10, α21. Neutralization of IFN type I or Ifnα subtypes may represent a reduction of at least 2%, at least 3%, at least 4%of Maine is our least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%or at least 90% of any at least one, at least two, at least three, at least five, at least seven, at least eight or at least ten subtypes. Neutralization of IFN type I or Ifnα subtypes can be reduced gene expression of IFN type I or Ifnα subtypes that constitute not more than 50%, not more than 45%not more than 40%not over 35%not over 30%not over 25%not over 20%not more than 15%, no more than 10%, not more than 5%, no more than 4%, no more than 3%, no more than 2%, no more than 1% from the levels of expression of the corresponding IFN type I or Ifnα subtypes in the control sample. If the agent that binds and modulates IFN type I or Ifnα action, is a biological agent, e.g. antibody, the agent can neutralize IFN type I or Ifnα subtypes in doses of 0.3-30 mg/kg, 0.3 to 10 mg/kg, 0.3 to 3 mg/kg, 0.3-1 mg/kg, 1-30 mg/kg, 3-30 mg/kg, 5-30 mg/kg, 10-30 mg/kg, 1-10 mg/kg, 3-10 mg/kg or 1-5 mg/kg

An agent that binds to and modulates IFN type I or Ifnα action can additionally or alternatively, naturalisatiedienst Ifnα receptors, or AR1, or AR2, or both, or α, or γ, or γ receptors (any of GR1, GR2, or both GR1 and GR2). Neutralization of expression of Ifnα receptors, or AR1, or AR2, or both, or α, or γ, or γ receptors (GR1 or GR2, or GR1, and GR2) can be reduced by at least 2%, at least 3%, at least 4%, at least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%or at least 90% of any at least one, at least two, at least three, at least five or at least six of these genes. Neutralization of expression of Ifnα receptors, or AR1, or AR2, or α, or γ, or γ receptors (GR1 or GR2, or GR1, and GR2) is a decrease in expression of at least 50%, at least 45%, at least 40%, at least 35%, at least 30%, at least 25%, at least 20%, at least 15%, at least 10%, at least 5%, at least 4%at least 3%, at least 2%or at least 1% of the levels of expression of these genes in the control sample. If the agent is binding and modulating gastiain type I or Ifnα, a biological agent, such as antibody, the agent can neutralize the expression of Ifnα receptors AR1 or AR2, or α, or γ, or γ receptors GR1 or GR2 in doses of 0.3-30 mg/kg, 0.3 to 10 mg/kg, 0.3 to 3 mg/kg, 0.3-1 mg/kg, 1-30 mg/kg, 3-30 mg/kg, 5-30 mg/kg, 10-30 mg/kg, 1-10 mg/kg, 3-10 mg/kg or 1-5 mg/kg

An agent that binds to and modulates the activity of IFN type I or Ifnα may additionally, or alternatively, to neutralize changes in the levels of proteins in serum, such as increases in the levels of those proteins, regulation of levels in serum increased to levels close to the levels of the control subjects. Neutralization protein expression in serum, for example, adiponectin, alpha-fetoprotein, apolipoprotein CIII, beta-2 microglobulin, cancer antigen 125, cancer antigen 19-9, eotaxin, FABP, factor VII, ferritin, IL-10, IL-12p70, IL-16, IL-18, IL-1ra, IL-3, MCP-1, MMP-3, myoglobin, SGOT, tissue factor, TIMP-1, TNF RII, TNF-alpha, VCAM-1, vWF, BDNK, complement 3, CD40 ligand, EGF, ENA-78, EN - RAGE, IGF-1, MDC, myeloperoxidase, RANTES or thrombopoetin, can be done by making at least one, at least two, at least three, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least twelve, at least fifteen, at IU is greater as twenty, or at least 25 of these proteins within at least 2%, at least 3%, at least 4%, at least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%at least 70%, at least 75%, at least 80%or at least 90% of the protein levels in the serum of a healthy subject. If the agent that binds and modulates IFN type I or Ifnα action, is a biological agent, such as antibody, the agent can neutralize the levels of proteins in serum, such as adiponectin, alpha-fetoprotein, apolipoprotein CIII, beta-2 microglobulin, cancer antigen 125, cancer antigen 19-9, eotaxin, FABP, factor VII, ferritin, IL-10, IL-12p70, IL-16, IL-18, IL-1ra, IL-3, MCP-1, MMP-3, myoglobin, SGOT, tissue factor, TIMP-1, TNF RII, TNF-alpha, VCAM-1, vWF, BDNK, complement 3, CD40 ligand, EGF, ENA-78, ENRAGE, IGF-1, MDC, myeloperoxidase, RANTES or thrombopoetin, in doses of 0.3-30 mg/kg, 0.3 to 10 mg/kg, 0.3 to 3 mg/kg, 0.3-1 mg/kg, 1-30 mg/kg, 3-30 mg/kg, 5-30 mg/kg, 10-30 mg/kg, 1-10 mg/kg, 3-10 mg/kg or 1-5 mg/kg

An agent that binds to and modulates IFN type I or Ifnα action, can additionally or alternatively, reduce the number or level of antibodies that bind to any one, any on me is greater as 2, any at least 3, any of at least 4, any of at least 5, any at least 6, any of at least 7, any of at least 8, any of at least 9, any of at least 10, any of at least 15, or any at least 20 of the following proteins: (a) interferon-induced protein p78 myxoviruses (influenza virus) resistance 1; (b) surfeit 5, transcriptin variant c; (C) proteasome (possamai, multicatalytic protease) activator subunit 3 (RA gamma; Ki) TRANS c; (d) alpha receptor retinoic acid; (e) protein heat shock 10 kDa 1 (chaperonin 10); (f) tropomyosin 3; (g) the domain related homologue of pleckstrin, family a, 1 representative; (h) cytoskeleton-associated protein 1; (and) antigen A2 Sjogren syndrome (60 kDa, ribonucleoprotein auto-antigen SS-A/Ro); (K) the NADH dehydrogenase (ubiquinone) 1, alpha/beta sub-complex 1, 8 kDa; (l) homolog 1 gene nuclear distribution (NudE - nuclear distribution gene E) (A. nidulans); (m) the MutL homolog 1, colon cancer, nonpolyposis, type 2 (E. coli); (h) enriched with leucine repeat (in FLII) interacting protein 2; (o) tropomyosin 1 (alpha); (p) spastic lower paraplegia 20, Spartina (syndrome The troyer); (p) preimplantation protein, transcript variant 1; (C) mitochondrial ribosomal protein L5; (t) a homologue of Lin-28 (C. elegans); (I) heat shock protein 1, weight 90 kDa alpha; (f) dom-3 homolog Z (C. elegans); (x) Geneina, cytoplasmic, light intermediate polypeptide 2; (C) Ras-related substrate 1 C3 toxin botulism (rho family, low molecular weight GTP binding protein); (h) synovial sarcoma, X checkpoint 2, transcript variant 2; (W) Motina; (y) a homologue of the packaging vector (Drosophila), transcript variant 1; (e) GCN5 (type 2 General control of amino acid synthesis 5 (yeast); (h) eukaryotic elongation factor broadcast 1, gamma; (I) eukaryotic elongation factor broadcast 1, Delta; (AA) DNA-damage-inducing transcript 3; (BB) SEAT/enhancer binding protein (C/HEB) gamma; and any other autoantigens described in the provisional application entitled "Auto-antibody markers of autoimmune disease"filed may 3, 2007, or in the provisional application entitled "Auto-antibody markers of autoimmune disease"filed November 6, 2007 (for example, described in tables 2, 4, 5 and 9). The decrease in the level of autoantibodies may be at least 2%, at least 3%, at least 4%, at least 5%, at least 7%, at least 8%, at least 10%, at least 15%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, m is Nisha least 75%, at least 80%or at least 90% in the presence of any of the autoantibodies. If the agent that binds to and modulates the activity of IFN type I or Ifnα, is a biological agent, such as antibody, the agent may reduce the number or level of antibodies in doses of 0.3-30 mg/kg, 0.3 to 10 mg/kg, 0.3 to 3 mg/kg, 0.3-1 mg/kg, 1-30 mg/kg, 3-30 mg/kg, 5-30 mg/kg, 10-30 mg/kg, 1-10 mg/kg, 3-10 mg/kg or 1-5 mg/kg

Agent, binding and modulating the activity of IFN type I or Ifnα, cannot neutralize the expression of genes that are not included in the interferon-induced signature or profile FD token.

Samples can also be obtained from patients in the methods of the present invention. The samples include any biological fluid or tissue, such as whole blood, saliva, urine, synovial fluid, bone marrow, cerebrospinal fluid, nasal discharge, sputum, amniotic fluid, bronchoalveolar lavage fluid, mononuclear cells from peripheral blood (MCPC), white blood cells, lymph node cells, spleen cells or skin. Samples can be obtained by any means known in this field.

Expression profiles of PD markers induced by IFN type I - or Ifnα may include the expression or activity with increased regulation of genes in cells, which may be increased levels of Ifnα relative to the source is about level. Increased regulation of expression or activity of genes includes the increased expression of mRNA from the gene increased expression of a protein encoded by the gene, or increase the action of the proteins encoded by the genome. Can be enhanced expression or activity of genes as a direct or indirect response to Ifnα.

Increased regulation of the expression or activity of a gene identified in the sample probes or probe sets in the profile of expression of PD markers induced by Ifnα may be at least 1.2 times, at least 1.25-fold, at least 1.3-fold, at least 1.4, at least 1.5 times, at least 2.0 times, at least 2.25 times, at least 2.5 fold, at least 2.75 times at least 3.0 times, at least 3.5 fold, at least 4.0 times at least 4.5 times at least 5.0 times at least 6.0 times at least 7.0 times, at least 8.0 times, at least 9.0 times at least 10.0 times, at least 15,0 time, at least to 20.0 times at least in 25,0 time, or at least 50,0 times relative to the original levels of control cells, for example cells healthy volunteers, or cells of control animals, or cells not exposed to Ifnα in culture. All the genes in the expression profile of PD markers induced by Ifnα can about what to have increased regulation of expression or activity to the same degree of magnification. In another embodiment, the genes in the expression profile of FD markers can have varying levels of increased regulation of expression or action.

Reduced regulation of the expression or activity of a gene identified in the sample probes or probe sets in the profile of expression of PD markers induced by Ifnα, can be at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%or at least 99% relative to the original levels of control cells, for example cells of healthy volunteers, or cells of control animals, or cells not exposed to Ifnα in culture. All the genes in the expression profile of PD markers induced by Ifnα, may have reduced the regulation of expression or activity to the same degree of reduction. In another embodiment, the genes in the expression profile of PD marker may have varying levels of decreased regulation of expression or action.

The number of genes involved in the expression profile of PD markers induced by Ifnα, morecostly, at least 2, at least 3, at least 4, at least 5, at least 10, at least 20, at least 25, at least 30, at least 50, at least 75, at least 100, at least 150, at least 200, at least 250, at least 300, at least 400, at least 500, at least 750, at least 1000, at least 1500, at least 2000, at least 2,500, at least 5,000, at least 10,000 or at least 15000 genes. These genes may include genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30 and/or 31 and/or any of the genes identified on Fig, 74, 75 or 77. To the genes included in the expression profile of PD markers induced by Ifnα may include genes increased regulation, genes reduced regulation or combination of genes with increased and decreased regulation.

To the genes included in the expression profile of PD markers induced by Ifnα may include genes presented in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30 and/or 31 and/or any of the genes identified on Fig, 74, 75 or 77. Genes included in the expression profile of PD markers induced Ifnα may consist of or include at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, what about at least 50%, at least 60%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, or at least 100% of the genes presented in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30 and/or 31 and/or any genes identified on Fig, 74, 75 or 77.

PD markers induced Ifnα, the expression profile may include any at least 5 genes, for example: MH, LLY6E, IFI27, OAS1, IFIT1; or MH, LLY6E, IFI27, OAS1, IFI6; or MH, LLY6E, IFI27, OAS1, IFI44L; or MH, LLY6E, IFI27, OAS1, ISG15; or MH, LLY6E, IFI27, OAS1, LAMP3; or MH, LLY6E, IFI27, OAS1, OASL; or MH, LLY6E, IFI27, OAS1, RSAD2; or MH, LLY6E, IFI27, OAS1, IFI44; or MH, LLY6E, IFI27, OAS1, IFIT2; or MH, LLY6E, IFI27, OAS1, OAS3; or MH, LLY6E, IFI27, OAS1, USP18; or MH, LLY6E, IFI27, OAS1, SIGLEC1; or MH, LLY6E, IFI27, OAS1, HERC5; or MH, LLY6E, IFI27, OAS1, DNAPTP6; or MH, LLY6E, IFI27, OAS1, LOC129607; or MH, LLY6E, IFI27, OAS1, EPSTI1; or MH, LLY6E, IFI27, OAS1, BIRC4BP; or MH, LLY6E, IFI27, OAS1, SIGLEC1; or MH, LLY6E, IFI27, OAS1, gene detected by probe 229450_at; or MH, LLY6E, IFI27, OAS1, gene detected by probe 235276_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6; or LLY6E, IFI27, OAS1, IFIT1, IFI44L; or LLY6E, IFI27, OAS1, IFIT1, ISG15; or LLY6E, IFI27, OAS1, IFIT1, LAMP3; or LLY6E, IFI27, OAS1, IFIT1, OASL; or LLY6E, IFI27, OAS1, IFIT1, RSAD2; or LLY6E, IFI27, OAS1, IFIT1, IFI44; or LLY6E, IFI27, OAS1, IFIT1, IFIT2; or LLY6E, IFI27, OAS1, IFIT1, OAS3; or LLY6E, IFI27, OAS1, IFIT1, USP18; or LLY6E, IFI27, OAS1, IFIT1, SIGLEC1; or LLY6E, IFI27, OAS1, IFIT1, HERC5; or LLY6E, IFI27, OAS1, IFIT1, DNAPTP6; or LLY6E, IFI27, OAS1, IFIT1, LOC129607; or LLY6E, IFI27, OAS1, IFIT1, EPSTI1; or LLY6E, IFI27, OAS1, IFIT1, BIRC4BP; or LLY6E, IFI27, OAS1, IFIT1, SIGLEC1; or LLY6E, IFI27, OAS1,IFIT1, gene detected by probe 229450_at; or LLY6E, IFI27, OAS1, IFIT1, gene detected by probe 235276_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; or IFI27, OAS1, IFIT1, IFI6, LAMP3; or IFI27, OAS1, IFIT1, IFI6, OASL; or IFI27, OAS1, IFIT1, IFI6, RSAD2; or IFI27, OAS1, IFIT1, IFI6, IFI44; or IFI27, OAS1, IFIT1, IFI6, IFIT2; or IFI27, OAS1, IFIT1, IFI6, OAS3; or IFI27, OAS1, IFIT1, IFI6, USP18; or IFI27, OAS1, IFIT1, IFI6, SIGLEC1; or IFI27, OAS1, IFIT1, IFI6, HERC5; or IFI27, OAS1, IFIT1, IFI6, DNAPTP6; or IFI27, OAS1, IFIT1, IFI6, LOC129607; or IFI27, OAS1, IFIT1, IFI6, EPSTI1; or IFI27, OAS1, IFIT1, IFI6, BIRC4BP; or IFI27, OAS1, IFIT1, IFI6, SIGLEC1; or IFI27, OAS1, IFIT1, IFI6, a gene identified by probe 229450_at; or IFI27, OAS1, IFIT1, IFI6, gene detected by probe 235276_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15; or OAS1, IFIT1, IFI6, IFI44L, LAMP3; or OAS1, IFIT1, IFI6, IFI44L, OASL; or OAS1, IFIT1, IFI6, IFI44L, and RSAD2; or OAS1, IFIT1, IFI6, IFI44L, IFI44; or OAS1, IFIT1, IFI6, IFI44L, IFIT2; or OAS1, IFIT1, IFI6, IFI44L, OAS3; or OAS1, IFIT1, IFI6, IFI44L, USP18; or OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; or OAS1, IFIT1, IFI6, IFI44L, HERC5; or OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; or OAS1, IFIT1, IFI6, IFI44L, LOC129607; or OAS1, IFIT1, IFI6, IFI44L, EPSTI1; or OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; or OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; or OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 229450_at; or OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 235276_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3; or IFIT1, IFI6, IFI44L, ISG15, OASL; or IFIT1, IFI6, IFI44L, ISG15, RSAD2; or IFIT1, IFI6, IFI44L, ISG15, IFI44; or IFIT1, IFI6, IFI44L, ISG15, IFIT2 or IFIT1, IFI6, IFI44L, ISG15, OAS3; or IFIT1, IFI6, IFI44L, ISG15, USP18; or IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; or IFIT1, IFI6, IFI44L, ISG15, HERC5; or IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; or IFIT1, IFI6, IFI44L, ISG15, LOC129607; or IFIT1, IFI6, IFI44L, ISG15, EPSTI1; or IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; or IFIT1, IFI6, IFI44L, ISG15, gene detected by probe 229450_at; or IFIT1, IFI6, IFI44L,ISG15, gene detected by probe 235276_at; or IFI6, IFI44L, ISG15, LAMP3, HERC5; or IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; or IFI6, IFI44L, ISG15, LAMP3, LOC129607; or IFI6, IFI44L, ISG15, LAMP3, EPSTI1; or IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; or IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 229450_at; or IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 235276_at; or IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; or IFI6, IFI44L, ISG15, LAMP3, USP18; or IFI6, IFI44L, ISG15, LAMP3, OAS3; or IFI6, IFI44L, ISG15, LAMP3, IFIT2; or IFI6, IFI44L, ISG15, LAMP3, IFI44; or IFI6, IFI44L, ISG15, LAMP3, RSAD2; or IFI6, IFI44L, ISG15, LAMP3, OASL; or IFI44L, ISG15, LAMP3, OASL, RSAD2; or IFI44L, ISG15, LAMP3, OASL, IFI44; or IFI44L, ISG15, LAMP3, OASL, IFIT2; or IFI44L, ISG15, LAMP3, OASL, OAS3; or IFI44L, ISG15, LAMP3, OASL, USP18; or IFI44L, ISG15, LAMP3, OASL, SIGLEC1; or IFI44L, ISG15, LAMP3, OASL, HERC5; or IFI44L, ISG15, LAMP3, OASL, DNAPTP6; or IFI44L, ISG15, LAMP3, OASL, LOC129607; or IFI44L, ISG15, LAMP3, OASL, EPSTI1; or IFI44L, ISG15, LAMP3, OASL, BIRC4BP; or IFI44L, ISG15, LAMP3, OASL, gene, detected by probe 229450_at; or IFI44L, ISG15, LAMP3, OASL, gene detected by probe 235276_at; or ISG15, LAMP3, OASL, RSAD2, IFI44; or ISG15, LAMP3, OASL, RSAD2, IFIT2; or ISG15, LAMP3, OASL, RSAD2, OAS3; or ISG15, LAMP3, OASL, RSAD2, USP18; or ISG15, LAMP3, OASL, RSAD2, SIGLEC1; or ISG15, LAMP3, OASL, RSAD2, HERC5; or ISG15, LAMP3, OASL, RSAD2, DNAPTP6; or ISG15, LAMP3, OASL, RSAD2, LOC129607; or ISG15, LAMP3, OASL, RSAD2, EPSTI1; or ISG15, LAMP3, OASL, RSAD2, BIRC4BP; or ISG15, LAMP3, OASL, RSAD2, gene detected by probe 229450_at; or ISG15, LAMP3, OASL, RSAD2, gene detected by probe 235276_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2; or LAMP3, OASL, RSAD2, IFI44, OAS3; or LAMP3, OASL, RSAD2, IFI44, USP18; or LAMP3, OASL, RSAD2, IFI44, SIGLEC1; or LAMP3, OASL, RSAD2, IFI44, HERC5; or LAMP3, OASL, RSAD2, IFI44, DNAPTP6; or LAMP3, OASL, RSAD2, IFI44, LOC129607; or LAMP3, OASL, RSAD2, IFI44, EPSTI1; or LAMP3, OASL, RSAD2, IFI44, BIRC4BP; or LAMP3, OASL, RSAD2, IFI44, gene detected by probe 229450_at; or LAMP3, OASL, RSAD2, IFI44, gene detected by probe 235276_at; or OASL, RSAD2, IFI44, IFIT2, OAS3; or OASL, RSAD2, IFI44, IFIT2, USP18; or OASL, RSAD2, IFI44, IFIT2, SIGLEC1; or OASL, RSAD2, IFI44, IFIT2, HERC5; or OASL, RSAD2, IFI44, IFIT2, DNAPTP6; or OASL, RSAD2, IFI44, IFIT2, LOC129607; or OASL, RSAD2, IFI44, IFIT2, EPSTI1; or OASL, RSAD2, IFI44, IFIT2, BIRC4BP; or OASL, RSAD2, IFI44, IFIT2, gene detected by probe 229450_at; or OASL, RSAD2, IFI44, IFIT2, gene detected by probe 235276_at; or RSAD2, IFI44, IFIT2, OAS3, USP18; or RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; or RSAD2, IFI44, IFIT2, OAS3, HERC5; or RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; or RSAD2, IFI44, IFIT2, OAS3, LOC129607; or RSAD2, IFI44, IFIT2, OAS3, EPSTI1; or RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; or RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 229450_at; or RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 235276_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1; or IFI44, IFIT2, OAS3, USP18, HERC5; or IFI44, IFIT2, OAS3, USP18, DNAPTP6; or IFI44, IFIT2, OAS3, USP18, LOC129607; or IFI44, IFIT2, OAS3, USP18, EPSTI1; or IFI44, IFIT2, OAS3, USP18, BIRC4BP; or IFI44, IFIT2, OAS3, USP18, gene detected by probe 229450_at; or IFI44, IFIT2, OAS3, USP18, gene detected by probe 235276_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5; or IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; or IFIT2, OAS3, USP18, SIGLEC1, LOC129607; or IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; or IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; or IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 229450_at; or IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 235276_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; or OAS3, USP18, SIGLEC1, HERC5, LOC129607; or OAS3, USP18, SIGLEC1, HERC5, EPSTI1; or OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; or OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 229450_at; or OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 235276_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; or USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; or USP18, SIGLEC1, HERC5, DNAPTP6, IRC4BP; or USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 229450_at; or USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 235276_at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; or SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; or SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 229450_at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 235276_at; or HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; or HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 229450_at; or HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 235276_at; or DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at; or DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 235276_at; or LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at, gene detected by probe 235276_at. To PD markers induced by Ifnα in this expression profile may include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

Ifnα-inducible PD markers in an expression profile may include any at least 6 genes, for example: MH, LLY6E, IFI27, OAS1, IFIT1, IFI6; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI44L; or MH, LLY6E, IFI27, OAS1, IFIT1, ISG15; or MH, LLY6E, IFI27, OAS1, IFIT1, LAMP3; or MH, LLY6E, IFI27, OAS1, IFIT1, OASL; or MH, LLY6E, IFI27, OAS1, IFIT1, RSAD2; or MH, LLY6E, IPI27, OAS1, IFIT1, IFI44; or MH, LLY6E, IFI27, OAS1, IFIT1, IFIT2; or MH, LLY6E, IFI27, OAS1, IFIT1, OAS3; or MH, LLY6E, IFI27, OAS1, IFIT1, USP18; or MH, LLY6E, IFI27, OAS1, IFIT1, SIGLEC1; or MH, LLY6E, IFI27, OAS1, IFIT1, HERC5; or MH, LLY6E, IFI27, OAS1, IFIT1, DNAPTP6; or MH, LLY6E, IFI27, OAS1, IFIT1, LOC129607; or MH, LLY6E, IFI27, OAS1, IFIT1, EPSTI1; or MH, LLY6E, IFI27, OS1, IFIT1, BIRC4BP; or MH, LLY6E, IFI27, OAS1, IFIT1, gene detected by probe 229450_at; or MH, LLY6E, IFI27, OAS1, IFIT1, gene detected by probe 235276_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L; or LLY6E, IFI27, OAS1, IFIT1, IFI6, ISG15; or LLY6E, IFI27, OAS1, IFIT1, IFI6, LAMP3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, OASL; or LLY6E, IFI27, OAS1, IFIT1, IFI6, RSAD2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFIT2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, OAS3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, USP18; or LLY6E, IFI27, OAS1, IFIT1, IFI6, SIGLEC1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, HERC5; or LLY6E, IFI27, OAS1, IFIT1, IFI6, DNAPTP6; or LLY6E, IFI27, OAS1, IFIT1, IFI6, LOC129607; or LLY6E, IFI27, OAS1, IFIT1, IFI6, EPSTI1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, BIRC4BP; or LLY6E, IFI27, OAS1, IFIT1, IFI6, gene detected by probe 229450_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, gene detected by probe 235276_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; or IFI27, OAS1, IFIT1, IFI6, IFI44L, LAMP3; or IFI27, OAS1, IFIT1, IFI6, IFI44L, OASL; or IFI27, OAS1, IFIT1, IFI6, IFI44L, and RSAD2; or IFI27, OAS1, IFIT1, IFI6, IFI44L, IFI44; or IFI27, OAS1, IFIT1, IFI6, IFI44L, IFIT2; or IFI27, OAS1, IFIT1, IFI6, IFI44L, OAS3; or IFI27, OAS1, IFIT1, IFI6, IFI44L, USP18; or IFI27, OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, HERC5; or IFI27, OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; or IFI27, OAS1, IFIT1, IFI6, IFI44L, LOC129607; or IFI27, OAS1, IFIT1, IFI6, IFI44L, EPSTI1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; or IFI27, OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 229450_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 235276_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3; or OAS1, IFIT1, IFI6, IFI44L, ISG15, OASL; or OAS1, IFIT1, IFI6, IFI44L, ISG15, RSAD2; or OAS1, IFIT1, IFI6, IFI44L, ISG15, IFI44; or OAS1, IFIT1, IFI6, IFI44L, ISG15, IFIT2; or OAS1, IFIT1, IFI6, IFI44L, ISG15, OAS3; or OAS1, IFIT1, IFI6, IFI44L, ISG15, USP18; or OAS1, IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, or HERC5 OAS1, IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LOC129607; or OAS1, IFIT1, IFI6, IFI44L, ISG15, EPSTI1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; or OAS1, IFIT1, IFI6, IFI44L, ISG15, gene detected by probe 229450_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, gene detected by probe 235276_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, RSAD2; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFI44; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFIT2; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OAS3; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, USP18; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, HERC5; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, LOC129607; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, EPSTI1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 229450_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 235276_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2; or IFI6, IFI44L, ISG15, LAMP3, OASL, IFI44; or IFI6, IFI44L, ISG15, LAMP3, OASL, IFIT2; or IFI6, IFI44L, ISG15, LAMP3, OASL, OAS3; or IFI6, IFI44L, ISG15, LAMP3, OASL, USP18; or IFI6, IFI44L, ISG15, LAMP3, OASL, SIGLEC1; or IFI6, IFI44L, ISG15, LAMP3, OASL, HERC5; or IFI6, IFI44L, ISG15, LAMP3, OASL, DNAPTP6; or IFI6, IFI44L, ISG15, LAMP3, OASL, LOC129607; or IFI6, IFI44L, ISG15, LAMP3, OASL, EPSTI1; or IFI6, IFI44L, ISG15, LAMP3, OASL, BIRC4BP; or IFI6, IFI44L, ISG15, LAMP3, OASL, gene detected by probe 229450_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, gene detected by probe 235276_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; or IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; or IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; or IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; or IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; or IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; or IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; or IFI4L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 229450_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 235276_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; or ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; or ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; or ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; or ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; or ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; or ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; or ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; or ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; or ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 229450_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 235276_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3; or LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; or LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; or LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; or LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; or LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; or LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; or LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; or LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 229450_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 235276_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; or OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; or OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; or OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; or OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; or OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; or OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; or OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 229450_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 235276_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; or RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; or RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; or RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; or RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; or RSAD2, IFI44, IFIT2, OAS3, USP18, BIRC4BP; or RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 229450_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 235276_at; what do IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 229450_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 235276_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 229450_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 235276_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 229450_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 235276_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 229450_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 235276_at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 229450_at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 235276_at; or HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at; or HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 235276_at; or DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at, gene detected by probe 235276_at. To PD markers induced by Ifnα in this expression profile may include at least one or more of the genes listed is in table 19, and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include any at least 7 genes, for example: MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, ISG15; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, LAMP3; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, OASL; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, RSAD2; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFIT2; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, OAS3; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, USP18; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, SIGLEC1; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, HERC5; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, DNAPTP6; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, LOC129607; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, EPSTI1; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, BIRC4BP; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, gene detected by probe 229450_at; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, gene detected by probe 235276_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LAMP3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OASL; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, and RSAD2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFI44; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFIT2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OAS3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, USP18; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, HERC5; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LOC129607; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, EPSTI1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, BIRC4BP; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 229450_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 235276_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3; or IFI27, OAS1, IFIT1, FI6, IFI44L, ISG15, OASL; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, RSAD2; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFI44; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFIT2; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OAS3; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, USP18; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, HERC5; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LOCI 29607; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, EPSTI1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, gene detected by probe gene detected by probe 229450_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, gene detected by probe 235276_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, RSAD2; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFI44; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFIT2; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OAS3; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, USP18; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, HERC5; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, LOC129607; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, EPSTI1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 229450_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 235276_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFI44; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFIT2; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, OAS3; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, USP18; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, SIGLEC1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, HERC5; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, DNAPTP6; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, LOC129607; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, EPSTI1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, BIRC4BP; or IFIT1, IFI6, IFI44L, ISG15 LAMP3, OASL, gene detected by probe 229450_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, gene detected by probe 235276_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 229450_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 235276_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 229450_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 235276_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 229450_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 235276_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1 or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 229450_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 235276_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, BIRC4BP; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 229450_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 235276_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 229450_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 235276_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 229450_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 235276_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 229450_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 235276_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1;or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 229450_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 235276_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 229450_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, a gene identified probe 235276 at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 235276_at; or HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at, gene detected by probe 235276_at. To PD markers induced by Ifnα in this expression profile may include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include any at least 8 genes, for example: MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LAMP3; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OASL; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, and RSAD2; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFI44; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IFIT2; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, OAS3; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, USP18; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, SIGLEC1; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, HERC5; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, DNAPTP6; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, LOC129607; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, EPSTI1; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, IRC4BP; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 229450_at; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, gene detected by probe 235276_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OASL; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, RSAD2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFI44; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, IFIT2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, OAS3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, USP18; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, SIGLEC1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, HERC5; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, DNAPTP6; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LOC129607; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, EPSTI1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, BIRC4BP; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, gene detected by probe 229450_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, gene detected by probe 235276_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, RSAD2; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFI44; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, IFIT2; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OAS3; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, USP18; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, SIGLEC1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, HERC5; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, DNAPTP6; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, LOC129607; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, EPSTI1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 229450_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, BIRC4BP; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, gene detected by probe 235276_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFI44; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, IFIT2; Il the OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, OAS3; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, USP18; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, SIGLEC1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, HERC5; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, DNAPTP6; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, LOC129607; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, EPSTI1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, BIRC4BP; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, gene detected by probe 229450_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, gene detected by probe 235276_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; or IFIT1, IFI6, IFI44L, ISG15, LAMPS, OASL, RSAD2, gene detected by probe 229450_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 235276_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 229450_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 235276_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3; or IF44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 229450_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 235276_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 229450_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 235276_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, BIRC4BP; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 229450_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 235276_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, BIRC4BP; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 229450_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene, you is run by probe 235276_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 229450_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 235276_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 229450_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 235276_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 229450_at; or IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 235276_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 229450_at; or OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 235276_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at; or USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 235276_at; or SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at, gene detected by probe 235276_at. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

Dmarker, induced Ifnα, in the expression profile may include any at least 12 genes, for example: MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFIT2; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, OAS3; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, USP18; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, SIGLEC1; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, HERC5; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, DNAPTP6; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, LOC129607; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, EPSTI1; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, BIRC4BP; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 229450_at; or MH, LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, gene detected by probe 235276_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, OAS3; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, USP18; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, SIGLEC1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, HERC5; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, DNAPTP6; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, LOC129607; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, EPSTI1; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, BIRC4BP; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, gene detected by probe 229450_at; or LLY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, gene viewland the th probe 235276_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, USP18; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, SIGLEC1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, HERC5; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, DNAPTP6; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, LOC129607; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, EPSTI1; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, BIRC4BP; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 229450_at; or IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, gene detected by probe 235276_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, SIGLEC1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, HERC5; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, DNAPTP6; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, LOC129607; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, EPSTI1; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, BIRC4BP; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 229450_at; or OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, gene detected by probe 235276_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, HERC5; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, DNAPTP6; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, LOC129607; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, EPSTI1; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI4, IPIT2, OAS3, USP18, BIRC4BP; go IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 229450_at; or IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, gene detected by probe 235276_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, DNAPTP6; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, LOC129607; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, EPSTI1; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1. BIRC4BP; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 229450_at; or IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, gene detected by probe 235276_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, LOC129607; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, EPSTI1; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, BIRC4BP; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 229450_at; or IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, gene detected by probe 235276_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, EPSTI1; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, BIRC4BP; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 229450_at; or ISG15, LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, gene detected by probe 235276_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, UP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, BIRC4BP; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 229450_at; or LAMP3, OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, gene detected by probe 235276_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 229450_at; or OASL, RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, gene detected by probe 235276_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at; or RSAD2, IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at; or IFI44, IFIT2, OAS3, USP18, SIGLEC1, HERC5, DNAPTP6, LOC129607, EPSTI1, BIRC4BP, gene detected by probe 229450_at gene detected by probe 235276_at. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the profile is xpressia may include at least genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1. PD markers induced by Ifnα in the expression profile may include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, EPSTI1, and RSAD2. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes BCL2, VAC, BAD, BAX and BCL2L1. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20, and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2, and ISG15. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes SAMDL, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, SEASON, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, HERC5, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, LY6E, SIGLEC1, and USP18. Ifnα-inducible PD markers in this expression profile may further include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH and IFIT1. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20, is/or 21, and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes IFI6, RSAD2, IFI44, IFI44L, and IFI27. To PD markers induced by Ifnα in this expression profile can also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include at least genes IFI27, IL-121R beta2 and IL-15R alpha, IL-15, suppressor signal transmission cytokine 1 (SOCS1), Janus kinase 2, CXCL11 (T-TAC), OSF13B (BAFF), TRAF-type domain 1 (TRAFD1), SERPING1, CD274 (PD1-L), indolamine-2,3-dioxygenase (INDO), gene 3 activation of lymphocytes (lymphocyte-activation - LAG3) and caspase 5. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the profile is xpressia may include at least genes of factor B complement, insulin-like growth factor (IGF2BP3), cyclina A1, neuropilin 2, the complement IqB, complement IqC, CD80, CD47, MR, bell-like receptor 3 (TLR3), TLR adaptarea molecule 2 (TICAM2), receptor-cleaner-1 macrophages (MSR1), desmoplakin, receptor PDGR, CCL13 (MCP-4), CXCL13 (ICA-1), CCL19 (CCR7), the IL-1 family of 5, purinergic receptor RH, IRS1, caspase 3 and kinase related cyclin-dependent kinase 1 (CDKL1). To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced by Ifnα in the expression profile may include changes in the levels of one or more proteins in serum, namely adiponectin, alpha-fetoprotein, apolipoprotein CIII, beta-2 microglobulin, cancer antigen 125, cancer antigen 19-9, eotaxin, FABP, factor VII, ferritin, IL-10, IL-12p70, IL-16, IL-18, IL-1ra, IL-3, MCP-1, MMP-3, myoglobin, SGOT, tissue factor, TIMP-1, TNF RII, TNF alpha, VCAM-1, vWF, BDNK, complement 3, CD40 ligand, EGF, ENA-78, ENRAGE, IGF-1, MDC, myeloperoxidase, RANTES or thrombopoetin.

PD markers induced Ifnα, the expression profile can include changes in any one or several levels in serum proteins, namely adiponectin, alpha-fetoprotein, apolipoprotein CIII, beta-2 microglobin, RA is a new antigen 125, cancer antigen 19-9, eotaxin, FABP, factor VII, ferritin, IL-10, IL-12p70, IL-16, IL-18, IL-1ra, IL-3, MCP-1, MMP-3, myoglobin, SGOT, tissue factor, TIMP-1, TNF RII, TNF-alpha, VCAM-1, or vWF. To PD markers induced by Ifnα in this expression profile can also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

PD markers induced Ifnα, the expression profile can include changes in any one or several levels in the serum proteins BDNK, complement 3, CD40 ligand, EGF, ENA-78, EN-RAGE, IGF-1, MDC, myeloperoxidase, RANTES or thrombopoetin. To PD markers induced by Ifnα in this expression profile may also include at least one or more genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30.

The expression profile of PD markers induced Ifnα may additionally include genes, regulation of expression or activity which is reduced in cells that are open to levels not corresponding to the original levels of Ifnα. Genes have reduced expression regulation, or action, can be any of the genes presented in tabl. Genes may include any one or more genes from a number of SLC4A1, PRSS33, FCER1A, WASN, KLRB1, D4S234E, T-cell receptor alpha locus/T-cell receptore what about the Delta locus, FEZ1, AFF3, CD160, AWSW, RTSN, OR2W3, IGHD, NOG, NR3C2, TNS1, PDZK1IP1, SH2D1B, STRBP, ZMYND11, TMOD1, FCRLA, DKFZp761P0423, EPB42, NR6A1, LOC341333, MS4A1, IGHM, SIGLECP3, KIR2DS2, PKIA, BLR1, C5 or f4, MYLK, LOC283663, MAD1L1, CXCL5, D4S234E, FCRLA, KRT1, cl6 or f74, ABCB4 or GPRASP1. A number of these genes may act as PD markers in an expression profile PD markers induced by Ifnα. For example, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 11, at least 12, at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, or at least 50 genes with low regulation may be included in the expression profile of PD markers induced by Ifnα. To profile the expression of PD markers induced Ifnα, may also include the genes listed in table 19 and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28.

The expression profile of PD markers induced Ifnα may include FEZ1 gene, or may include genes FEZ1 and NOG, or may include NOG gene, or may include genes FEZ1, NOG and SLC4A1, or may include gene SLC4A1, or may include genes NOG and SLC4A1, or may include genes FEZ1, NOG, SLC4A1 and D4S234E, or may include genes FEZ1, NOG, SLC4A1, D4S234E and PRSS33. The expression profile of PD marker induced Ifnα may also include genes listed the s in table 19, and/or 20 and/or 21 and/or 22 and/or 23 and/or 24 and/or 26 and/or 28 and/or 30 and/or 31.

Genes with decreased regulation can have the expression or activity with reduced regulation, which constitutes at least 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%or at least 99% of the expression or activity of control cells, for example cells of healthy volunteers, or cells of control animals, or cells not exposed to Ifnα in culture.

Increased or decreased regulation of gene expression or activity of PD markers induced by Ifnα may be determined by any means known in this field. For example, increased or decreased regulation of gene expression may be detected for determining levels of mRNA. Expression of mRNA can be determined norsen-blotting, slot blotting, quantitative polymerase chain reaction or hybridization methods with gene chip. Cm. US 5744305 and 5143854, for example, obtaining the sequence is nucleic acid methods for hybridization with the gene chip.

Increased or decreased gene expression or activity of PD markers induced Ifnα, can be determined by detecting the levels of protein. Gene with increased or decreased regulation, whose protein level detected may be any one, any two, any three, any four, any five, any six, any seven, any eight, any nine, any ten, any of the twelve, some fifteen, some twenty, some five and twenty, some thirty, some thirty-five or more of the genes adiponectin, alpha-fetoprotein, apolipoprotein CIII, beta-2 microglobulin, tumor antigen 125, a tumor antigen 19-9, eotaxin, FABP, factor VII, ferritin, IL-10, IL-R, IL-16, IL-18, IL-1ra, IL-3, MCP-1, MMP-3, mioglobin, SGOT, tissue factor, TIMP-1, TNF RII, TNF-alpha, VCAM-1, vWF, BDNK, complement 3, CD40 ligand, EGF, ENA-78, EN-RAGE, IGF-1, MDC, myeloperoxidase, RANTES or thrombopoetin. Methods for detecting levels of expression of protein include immunological methods, for example fermentownia immunosorbent studies, Western blotting, protein matrix and staining with silver.

The expression profile of PD markers induced Ifnα may include the profile of the activity of the proteins. Increased or decreased regulation of gene expression is whether the activity of PD markers, induced Ifnα, can be determined by detecting the activity of proteins, including, but not limited to, detectable activity on the phosphorylation activity dephosphorylating or activity splitting. In addition, increased or decreased regulation of gene expression or activity of PD markers induced Ifnα may be determined to identify any combination of expression levels or activity of these genes.

Therapeutic product candidate for the treatment of Ifnα-mediated disorders may be detected by the methods described in the present invention. A therapeutic agent candidates can be any types of molecules, including low molecular weight compounds or biological agents. A therapeutic agent candidates identified by the methods described in this invention, can be immediately identified as applicable therapeutic agents for the treatment of disease, disorder or condition. In another embodiment, may require a therapeutic agent candidates identified by the methods described in this invention were further investigated and/or modified prior to their selection for the treatment of patients. In another embodiment, a therapeutic agent candidates identified by the methods described in this invention can have the following further study to be rejected as molecules for the treatment of patients.

In ways that identify a therapeutic agent candidate cells representing the expression profile of PD markers induced Ifnα, in contact with the agent. Cells can be cells of any type, for example, cells commercially available lines of immortal cells, which represent the expression profile of PD markers induced Ifnα, cells commercially available lines of immortal cells treated with PD marker induced Ifnα, for the induction of the expression profile of PD markers induced Ifnα, cells isolated from the patient with the expression profile of PD markers induced Ifnα, or cells isolated from a healthy patient and Ifnα treated for the induction of the expression profile of PD markers induced by Ifnα.

The presence or absence of changes in the expression profile of PD markers induced Ifnα, cells detected after exposure of the cells with the agent. The occurrence of a change can be any change in the expression profile of PD markers induced Ifnα, including at least 10% reduction of increased regulation or activity of at least 1 gene with increased regulation in the expression profile of PD markers induced Ifnα, at least 20% decrease of at least 1 gene with increased regulation, at least 30% decrease of at least 1 g is on increased regulation, at least 40% decrease of at least 1 gene with increased regulation, at least 50% decrease of at least 1 gene with increased regulation, at least 60% decrease of at least 1 gene with increased regulation, at least 70% decrease of at least 1 gene with increased regulation, at least 75% decrease of at least 1 gene with increased regulation, at least 80% decrease of at least 1 gene with increased regulation, at least 85% decrease of at least 1 gene with increased regulation, at least 90% decrease of at least 1 gene with increased regulation, at least 95% decrease of at least 1 gene with increased regulation, at least 96% decrease of at least 1 gene with increased regulation, at least 97% reduction at least 1 gene with increased regulation, at least 98% decrease of at least 1 gene with increased regulation, at least 99% decrease of at least 1 gene with increased regulation, or 100% decrease in at least 1 gene with increased regulation. Alternatively, or additionally, the occurrence of a change can be any change in the profile of expression of Ifnα-inducible PD markers, including at least 10% increase of expression or activity of at least 1 gene with reduced regulation in the expression profile of FD mA is Kerov, induced Ifnα, at least 20% improvement in at least 1 gene with reduced regulation, at least 30% improvement in at least 1 gene with reduced regulation, at least 40% improvement in at least 1 gene with reduced regulation, at least 50% improvement in at least 1 gene with reduced regulation, at least 60% improvement in at least 1 gene with reduced regulation, at least 70% improvement in at least 1 gene with reduced regulation, at least 75% increase in at least 1 gene with reduced regulation, at least 80% of the increase at least 1 gene with reduced regulation, at least 85% improvement in at least 1 gene with reduced regulation, at least 90% improvement in at least 1 gene with reduced regulation, at least 95% of the increase at least 1 gene with reduced regulation, at least 96% improvement in at least 1 gene with reduced regulation, at least 97% improvement in at least 1 gene with reduced regulation, at least 98% improvement in at least 1 gene with reduced regulation, at least 99% improvement in at least 1 gene with reduced regulation, or 100% decrease of at least 1 gene with reduced regulation.

In the monitoring of disease progression of the patient samples can be taken from PAC is enta before or after introduction of the agent, for example, an agent that binds to and modulates the activity of IFN type I or Ifnα, or an agent that binds and doesn't modulate the actions of IFN type I or Ifnα, or a combination of an agent that binds to and modulates the activity of IFN type I or Ifnα. Expression profiles of PD markers induced IFN type I or Ifnα, set in the samples (before and after the introduction of the agent). Compare the expression profiles of PD markers induced by IFN type I or Ifnα, in samples. The comparison may be by the number of PD markers induced by IFN type I or Ifnα present in the samples, or can be counted the number of PD markers induced by IFN type I or Ifnα contained in the samples or in any combination thereof. Change, indicating the effectiveness of a therapeutic agent, may be set if the number or level (or a combination) PD markers induced by IFN type I or Ifnα, with increased regulation is reduced in the sample obtained after administration of therapeutic agent relative to the sample obtained before administration of therapeutic agent. The number of PD markers induced by IFN type I or Ifnα, with increased regulation may decrease by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, m is Nisha least 9, or at least 10. The level of any given PD marker induced IFN type I or Ifnα can be reduced by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%. The number of PD markers induced by IFN type I or Ifnα, with reduced regulation with lower levels may be at least 1 at least 2 at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, or at least 35. Any combination of the low number and low FD Makarov induced IFN type I or Ifnα, with increased regulation can be effective. Option, revealing the effectiveness of therapeutic agent can be installed, if the number or level (or any combination thereof) PD markers induced by IFN type I or Ifnα, with reduced regulation reduced in the sample obtained after administration of therapeutic agent, compared to the sample obtained before administration of therapeutic agent. The number of PD markers in tirovannyh IFN type I or Ifnα, with reduced regulation may decrease by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10. The level of any given PD marker induced IFN type I or Ifnα, with reduced regulation may increase by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, or at least 95%. The number of IFN type I - or Ifnα-inducible PD markers with low regulation and high levels can be equal to at least 1 at least 2 at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, or at least 35. Any combination of the low number and high level of PD markers induced by IFN type I or Ifnα, with reduced regulation can be effective.

The sample obtained from the patient, can be obtained before the first introduction of the agent, i.e. earlier this agent the patient did not enter. In others the d version of the sample, obtained from the patient, can be selected after the introduction of the agent throughout the course of treatment. For example, the agent may be introduced before the initiation of the monitoring Protocol. After the introduction of the agent additional samples can be obtained from the patient and to compare PD markers induced IFN type I or Ifnα, in samples. Samples can be the same or different type, for example, each received sample can be a blood sample, or each received sample may be serum sample. IFN type I - or Ifnα inducible PD markers identified in each sample, can be the same, may significantly overlap, or may be close.

Samples can be obtained at any time before or after administration of therapeutic agent. The sample obtained after administration of a therapeutic agent, can be obtained by at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, or at least 14 days after the administration of a therapeutic agent. The sample obtained after administration of a therapeutic agent, can be obtained at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, less the th least 8 weeks after administration of therapeutic agent. The sample obtained after administration of a therapeutic agent, can be obtained at least 2, at least 3, at least 4, at least 5, at least 6 months after administration of therapeutic agent.

Additional samples can be obtained from the patient after administration of therapeutic agent. At least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 12, at least 15, at least 20, at least 25 samples can be obtained from the patient for monitoring the progression or regression of the disease or disorder over time. Disease progression may be subject to monitoring for a period of at least 1 week at least 2 weeks at least 3 weeks at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 1 year at least 2 years at least 3 years at least 4 years at least 5 years at least 10 years, or for life. For more about the specimens can be obtained from the patient at regular intervals, for example, monthly, bimonthly, quarterly, held twice a year or yearly. Samples can be obtained from the patient after administration of the agent at regular intervals. For example, samples can be obtained from the patient one week after each injection of the agent, or two weeks after each injection of the agent, or three weeks after each injection of the agent, or one month after each injection of the agent, or two months after each injection of the agent. In another embodiment, multiple samples can be obtained from the patient after each injection of the agent.

The progression of the disease, the patient may be subjected to monitoring in a similar manner in the absence of the introduction of the agent. Samples may be periodically sampled in a patient with a disease or disorder. Can be identified progression of the disease, if the number of PD markers induced IFN type I or Ifnα increases in the samples obtained later in comparison with the previous sample. The number of PD markers induced IFN type I or Ifnα may increase by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, or at least 10. The progression of the disease may be you shall go, if the level of any data PD markers induced IFN type I or Ifnα, with increased regulation increased by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. The progression of the disease can be detected, if the level of any data PD markers induced IFN type I or Ifnα, with reduced regulation is reduced by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. The number of PD markers induced IFN type I or Ifnα, with increased regulation with elevated levels may be equal to at least 1 at least 2 at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, or at least 35. The number of PD markers induced IFN type I or Ifnα, with reduced regulation with lower levels may be set at mere, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, or at least 35. Any combination of the increased number of high-level PD marker induced IFN type I or Ifnα, with increased regulation may indicate the progression of the disease. In another embodiment, or in combination, any combination of the low number and low PD marker induced IFN type I or Ifnα, with reduced regulation may indicate the progression of the disease. Regression of the disease can also be installed in a patient with a disease or disorder, untreated agent. In this case, the regression can be identified, if the number of PD markers induced IFN type I or Ifnα, decreases in the later sample relative to a previously obtained sample. The number of PD markers induced IFN type I or Ifnα may be reduced by at least 1, at least 2, at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9 or at least 10. Regression of the disease can be identified, if kako is any data PD markers, induced IFN type I or Ifnα, with increased regulation is reduced by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. Regression of the disease can be detected, if the level of any data PD markers induced IFN type I or Ifnα, with reduced regulation increases by at least 10%, at least 20%, at least 25%, at least 30%, at least 35%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90% or at least 95%. The number of PD markers induced IFN type I or Ifnα, with lower levels may be at least 1 at least 2 at least 3, at least 4, at least 5, at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, or at least 35. The number of PD markers induced IFN type I or Ifnα, with reduced regulation with elevated levels may be equal to at least 1 at least 2 at least 3, at least 4, at least 5,at least 6, at least 7, at least 8, at least 9, at least 10, at least 15, at least 20, at least 25, at least 30, or at least 35. The progress or regression of the disease are subjected to monitoring by obtaining samples during any period when any interval. The progress or regression of the disease can be subjected to monitoring by obtaining samples throughout the course, lasting at least 1 week at least 2 weeks at least 3 weeks at least 4 weeks, at least 5 weeks, at least 6 weeks, at least 7 weeks, at least 2 months, at least 3 months, at least 4 months, at least 5 months, at least 6 months, at least 1 year at least 2 years, at least 3 years at least 4 years at least 5 years at least 10 years or over the life of the patient. The progress or regression of the disease are subjected to monitoring by obtaining samples at least monthly, every two months, quarterly, twice a year or annually. Samples should be obtained with well-defined intervals.

The present invention also includes kits and probes. The probes can be any molecules that detect any expression or action of any kind whether what about the gene, which may be included in the expression profile of PD marker induced by Ifnα.

The present invention also relates to methods of detecting the action of IFN. These methods can use a cell comprising a polynucleotide sequence containing a reporter gene under the control of the element response is stimulated by interferon. Cells comprising the polynucleotide sequence can be any cell capable of transfection or transformation of the polynucleotide sequence and which can be maintained in culture. Such cells include animal cells, bacteria, yeast, insect or plant. These cells can be attached or can grow in suspension. If the cells are animal cells, they can be cells known cell lines, such as HeLa, COS, NIH3T3, AGS, 293, CHO, Huh-7, HUVEC, MCF-7, C6, BHK-21, BNL CL 2, C2C12, HepG2 and ATDC5. Countless other cell lines are known and can be obtained by specialists in this field. Cells in another embodiment, may be primary cells that were or were not immortal.

Cells can include a polynucleotide sequence comprising a reporter gene under the control of the element response is stimulated by interferon. The polynucleotide sequence can be stably integrated into the DNA of cells which can be necrovalley element, permanent or temporary for cells. Polynucleotide can be introduced into cells as an open polynucleotide molecules, combined with a lipid-polynucleotide molecules or other molecules, or polynucleotide in the virus particle.

If polynucleotide was introduced as an open polynucleotide molecules, polynucleotide can be linear or circular molecule. Examples of the ring polynucleotide molecules are plasmids, artificial chromosomes, but they are not alone. These vectors can be broken down by enzymes, for example, to generate a linear polynucleotide molecules.

In addition, if polynucleotide introduced as an open polynucleotide, it can be introduced into cells by any of many well known in the field of methods. These methods include, but are not limited to, electroporation, microinjection, ballistic delivery particles. See, also, e.g., Loeffler and Behr, Meth. Enzymol. 217, 1993, SS. 599-618; Cohen and others, Meth. Enzymol. 217, 1993, SS. 618-644; Clin. Pharma. Ther. 29, 1985, SS. 69-92, kN.: Sambrook and other "Molecular Cloning: A Laboratory Manual", 1989, 2nd ed., published by Cold Spring Harbor Laboratory Press, Cold Spring Harbor, new York; kN.: "Current Protocols in Molecular Biology", 1987-2001, Ed. by Ausubel and others, published by John Wiley & Sons, Inc., New York.

Although polynucleotide being introduced in the form of a complex with lipids or liposomes, it also may be the introduced one of many known in the art methods. Lipids and liposomes represent a mixture of particles of fats or lipids that bind DNA or RNA to form a bubble with a hydrophobic coating for delivery. The corresponding liposomes can include any of the conventional synthetic or natural phospholipid liposomal materials including phospholipids from natural sources such as eggs, plants or animals, for example phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, sphingomyelin, phosphatidylserine or phosphatidylinositol. Can also be used synthetic phospholipids, such as dimyristoylphosphatidylcholine, dioleoylphosphatidylcholine and the corresponding synthetic phosphatidylethanolamine and phosphatidylglycerol. Lipids or liposomes, which can be conjugated with vector commercially available. Examples of commercially available reagents lipid or liposomal transfection are known to the experts in this field, including product LIPOFECTAMINE™ (firm Invitrogen), product GENEJUICE® (firm Novagen), product GENEJAMMER® (the company Stratagene), product FUGENE® HD (firm Roche), product MEGAFECTIN™ (firm Qbiogene), product SUPERFECT® (firm Qiagen) and the product EFFECTENE® (firm Qiagen).

If polynucleotide was introduced as a complex with other molecules, it can be compact or in the form of nanospheres. Compact polynucleotide complexes described in the patent is US 5972901, 6008336 and 6077835. Nanospheres described in patents US 5718905 and 6207195. Such compact polynucleotide complexes and nanospheres, which bind the nucleic acids, the use of polymeric cations. Typical polymeric cations include gelatin, poly-L-lysine and chitosan. In another embodiment, polynucleotide can be combined with DEAE-dextran or transfected, using methods such as coprecipitation with calcium phosphate or coprecipitation with calcium chloride.

If polynucleotide was introduced in Association with the virus, the virus may be any known relevant virus for release polynucleotide. Examples of viruses that can be used as vectors include adenoviruses, adeno-associated virus, lentivirus, retrovirus, herpes virus (e.g., virus herpes simplex), smallpox virus, papovirus, Sendai virus, SV40 virus, respiratory syncytial virus and other

The polynucleotide sequence may include a reporter gene and the item response is stimulated by interferon. Reporter gene can be any gene among the genes luciferase, chloramphenicol-acetyl-transferase, β-galactosidase, green fluorescent protein, β-glucuronidase or secreted placental alkaline phosphatase. Variations of many of these reporter genes such as green fluorescent who CSOs protein and luciferase, known and can be easily identified and/or obtained by the experts in this field. Other reporter genes in addition to those listed, may also be known to specialists in this field and available. The elements of the response that is stimulated by interferon, also known specialists in this field. They can be obtained from commercial sources, such as firms Stratagene, Clonetech and Biomyx. They are also described, for example, in the works of Alcantara and others, Nuc. Acid. Res. 30, 2002, SS. 2068-2075, and Kirchhoff and others, Oncogene 18, 1999, SS. 3725-3736.

Cells used in the study, can be incubated with the sample. The sample can be obtained from the patient is transferred to the attending physician of the patient or may be a control sample used for calibration or quality control. If the sample obtained from the patient, it can be any biological fluid or tissue, such as blood, saliva, urine, synovial fluid, bone marrow, cerebrospinal fluid, allocation from a nose, sputum, amniotic fluid, bronchoalveolar washing fluid mononuclear cells of peripheral blood total leukocytes, lymph node cells, spleen cells, cells of the tonsils or skin.

Expression of reporter gene reveal any known in the field method. Expression, even if it is "no load) is I", shows the effect of IFN in the sample. Specialist in this field can also be calculated for any level of expression of a reporter gene, which can be correlated with the level of action of IFN in the sample.

Applicants present a number of embodiments of the present invention to describe some of the objects of the present invention, and these options do not limit the present invention.

Embodiments of the present invention

Embodiments of the present invention 1. A method of treating a patient with a disease or disorder mediated IFN type I or Ifnα, which includes:

the introduction of an agent that binds to and modulates the activity of IFN type I or Ifnα;

moreover, the patient has the profile of expression of PD markers induced IFN type I or Ifnα;

and the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, patient.

Embodiments of the present invention 2. Method variant implementation of the present invention 1, further comprising identifying the neutralization profile of expression of PD markers induced IFN type I or Ifnα, patient.

Embodiments of the present invention 3. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN I tipari Ifnα, includes enhanced regulation of the expression or activity of genes MH, LY6E, IFI27, OAS1 IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Embodiments of the present invention 4. Method variant implementation of the present invention 1, in which the agent is a biological agent.

Embodiments of the present invention 5. Method variant implementation of the present invention 4, in which the agent is an antibody.

Embodiments of the present invention 6. Method variant implementation of the present invention 5, in which the antibody is the antibody MEDI-545.

Embodiments of the present invention 7. Method variant implementation of the present invention 5, in which the antibody is specific for one or more of IFN type I or Ifnα subtypes, but not an antibody MEDI-545.

Embodiments of the present invention 8. Method variant implementation of the present invention 1, in which the introduction of the agent alleviates one or more symptoms of diseases or disorders.

Embodiments of the present invention 9. The method according to the variant of implementation of the present invention 5, in which the antibody is administered at a dose of approximately component of 0.03-30 mg/kg

Embodiments of the present invention 10. The method according to the variant of implementation of the present invention 9, in which the om antibody is administered at a dose about component of 0.3-3 mg/kg

Embodiments of the present invention 11. The method according to the variant of implementation of the present invention 10, in which the antibody is administered at a dose of 0.03-1 mg/kg

Embodiments of the present invention 12. The method according to one of the embodiments of the present invention 9-11, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 10%.

Embodiments of the present invention 13. Method variant implementation of the present invention 12, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 20%.

Embodiments of the present invention 14. Method variant implementation of the present invention 13, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 30%.

Embodiments of the present invention 15. Method variant implementation of the present invention 14, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 40%.

Embodiments of the present invention 16. Method variant implementation of the present invention 15 in which the agent will neutralize the profile ek is pressie PD markers, induced IFN type I or Ifnα, the patient is at least 50%.

Embodiments of the present invention 17. Method variant implementation of the present invention 1, in which IFN type I - or Ifnα-mediated disease or disorder is systemic lupus, psoriasis, vasculitis, sarcoidosis, Sjogren syndrome, or idiopathic inflammatory myositis.

Embodiments of the present invention 18. Method variant implementation of the present invention 17, in which IFN type I - or Ifnα-mediated disease or disorder is systemic lupus.

Embodiments of the present invention 19. Method variant implementation of the present invention 17, in which IFN type I - or Ifnα-mediated disease or disorder is psoriasis.

Embodiments of the present invention 20. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of at least Ifnα subtypes 1, 2, 8 and 14.

Embodiments of the present invention 21. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes transcripts of genes FD token.

Options Khujand is the implementation of the present invention 22. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes polypeptides expressed from genes FD token.

Embodiments of the present invention 23. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα is increased regulation of expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1.

Embodiments of the present invention 24. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Embodiments of the present invention 25. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Embodiments of the present invention 26. Method variant implementation of the present invention , in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Embodiments of the present invention 27. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Embodiments of the present invention 28. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 29. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, SEASON, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 30. Way case for us is Otsego invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 31. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 32. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, and IFI27.

Variant implementation of the present invention 33. The method according to the variant of implementation of the present invention 32, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes MH and IFIT1.

Variant implementation of the present invention 34. The method according to the variant of implementation of the present invention 33, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes OAS2 and OAS1.

Option implemented is tvline of the present invention 35. The method according to any one of the embodiments of the present invention 3 or 23-33, in which the expression profile of PD markers induced IFN type I or Ifnα, further includes a reduced regulation of expression or activity of genes NOG, SLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 36. Method variant implementation of the present invention 1, in which the expression profile of PD markers induced IFN type I or Ifnα includes reduced regulation of expression or activity of genes NOG, SLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 37. Method variant implementation of the present invention 22, which revealed elevated levels of the polypeptide in the serum.

Variant implementation of the present invention 38. Method variant implementation of the present invention 37, in which the polypeptides are cancer antigen 125, ferritin, tissue factor, and MMP-3.

Variant implementation of the present invention 39. Method variant implementation of the present invention 22, which reveal decreased levels of the polypeptide in the serum.

Variant implementation of the present invention 40. Method variant implementation of the present invention 39, in which the polypeptides are EGF, thrombopoetin and CD40 ligand.

Variant implementation of the present invention 41. The method of treatment p is the consistent with a person with an autoimmune disease, including moderate or marked profile of IFN type I or Ifnα PD markers containing:

the introduction of an agent that binds to and modulates the activity of IFN type I or Ifnα;

in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, patient.

Variant implementation of the present invention 42. Method variant implementation of the present invention 41, further comprising detecting the expression profile of PD markers induced IFN type I or Ifnα, patient.

Variant implementation of the present invention 43. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes MH, LY6E, IFI27, OAS1 IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Variant implementation of the present invention 44. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1.

Variant implementation of the present invention 45. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN-I is IPA or Ifnα, includes enhanced regulation of the expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Variant implementation of the present invention 46. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Variant implementation of the present invention 47. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Variant implementation of the present invention 48. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Variant implementation of the present invention 49. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced And The N type I or Ifnα, includes enhanced regulation of the expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 50. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 51. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 52. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 53. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα includes increased regulate the expression or activity of genes IFI6, RSAD2, IFI44, and IFI27.

Variant implementation of the present invention 54. Method variant implementation of the present invention 53, in which the expression profile of PD markers induced IFN type I or Ifnα, includes in addition to the increased regulation of expression or activity of genes MH and IFIT1.

Variant implementation of the present invention 55. Method variant implementation of the present invention 41, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of at least Ifnα subtypes 1, 2, 8 and 14.

Variant implementation of the present invention 56. Method variant implementation of the present invention 41, in which the agent is a biological agent.

Variant implementation of the present invention 57. Method variant implementation of the present invention 41, in which the agent is an antibody.

Variant implementation of the present invention 58. Method variant implementation of the present invention 57, in which the antibody is the antibody MEDI-545.

Variant implementation of the present invention 59. Method variant implementation of the present invention 57, in which the antibody is specific for one or more of IFN type I or Ifnα subtypes, but not an antibody MEDI-545.

Variant implementation of the present invention 60. the manual variant implementation of the present invention 41, in which the introduction of the agent alleviates one or more symptoms of diseases or disorders.

Variant implementation of the present invention 61. Method variant implementation of the present invention 57, in which the antibody is administered at a dose of approximately component of 0.03-30 mg/kg

Variant implementation of the present invention 62. Method variant implementation of the present invention 57, in which the antibody is administered at a dose of approximately component of 0.3-3 mg/kg

Variant implementation of the present invention 63. Method variant implementation of the present invention 57, in which the antibody is administered at a dose of approximately component of 0.03-1 mg/kg

Variant implementation of the present invention 64. Method variant implementation of the present invention 41, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, at least 10%.

Variant implementation of the present invention 65. Method variant implementation of the present invention 64, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, at least 20%.

Variant implementation of the present invention 66. Method variant implementation of the present invention 65, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, at least 30%.

Variant implementation of the present invention 68. Method variant implementation of the present invention 67, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, at least 50%.

Variant implementation of the present invention 69. Method variant implementation of the present invention 41, in which an autoimmune disease in humans is lupus, psoriasis, vasculitis, sarcoidosis, Sjogren syndrome, or idiopathic inflammatory myositis.

Variant implementation of the present invention 70. Method variant implementation of the present invention 69, in which a patient has lupus.

Variant implementation of the present invention 71. Method variant implementation of the present invention 69, in which the patient is a patient with psoriasis.

Variant implementation of the present invention 72. Method for neutralizing the PD markers induced IFN type I or Ifnα, in a patient in need thereof, including:

the introduction of an agent that binds and modulates IFN type I or Ifnα activity of the patient;

in which the agent will neutralize the expression profile of PD markers, indutsiruemyi type I or Ifnα, patient.

Variant implementation of the present invention 73. Method variant implementation of the present invention 72, further comprising neutralizing the profile of expression of PD markers induced IFN type I or Ifnα, patient.

Variant implementation of the present invention 74. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of the expression or activity of genes MH, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Variant implementation of the present invention 75. Method variant implementation of the present invention 72, in which the agent is a biological agent.

Variant implementation of the present invention 76. Method variant implementation of the present invention 75, in which the agent is an antibody.

Variant implementation of the present invention 77. Method variant implementation of the present invention 76, in which the antibody is an antibody MEDI-545.

Variant implementation of the present invention 78. Method variant implementation of the present invention 76, in which the antibody is specific for one or more of IFN type I or Ifnα subtypes, but not an antibody MEDI-545.

Variant implementation of the present invention 79. Method options implemented the I present invention 72, in which the introduction of the agent alleviates one or more symptoms of diseases or disorders.

Variant implementation of the present invention 80. Method variant implementation of the present invention 76, in which the antibody is administered at a dose of about 0.03 to 30 mg/kg

Variant implementation of the present invention 81. Method variant implementation of the present invention 80, in which the antibody is administered at a dose of 0.3-3 mg/kg

An implementation option 82 of the present invention. Method variant implementation of the present invention 81, in which the antibody is administered at a dose of 0.03-1 mg/kg

Variant implementation of the present invention 83. The method according to one of the embodiments of the present invention 80-82, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, at least 10%.

Variant implementation of the present invention 84. Method variant implementation of the present invention 83, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 20%.

Variant implementation of the present invention 85. Method variant implementation of the present invention 84, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 30%.

An implementation option is altoadige inventions 86. Method variant implementation of the present invention 85, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, in a patient by at least 40%.

Variant implementation of the present invention 87. Method variant implementation of the present invention 86, in which the agent will neutralize the expression profile of PD markers induced IFN type I or Ifnα, the patient is at least 50%.

Variant implementation of the present invention 88. Method variant implementation of the present invention 72, in which a patient has lupus, psoriasis, vasculitis, sarcoidosis, Sjogren syndrome, or idiopathic inflammatory myositis.

Variant implementation of the present invention 89. Method variant implementation of the present invention 88, in which a patient has lupus.

Variant implementation of the present invention 90. Method variant implementation of the present invention 88, in which the patient is suffering from psoriasis.

Variant implementation of the present invention 91. Method variant implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers is increased regulation of expression or activity of at least Ifnα subtypes 1, 2, 8 and 14.

Variant implementation of the present invention 92. The method option is the implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers includes transcripts of genes FD token.

Variant implementation of the present invention 93. Method variant implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers includes polypeptides expressed from genes FD token.

Variant implementation of the present invention 94. Method variant implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers include increased regulation of expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1.

Variant implementation of the present invention 95. Method variant implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers include increased regulation of expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Variant implementation of the present invention 96. Method variant implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers include increased regulation of expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH,OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Variant implementation of the present invention 97. Method variant implementation of the present invention 72, in which the expression profile of IFN type I - or Ifnα-inducible PD markers include increased regulation of expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Variant implementation of the present invention 98. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Variant implementation of the present invention to 99. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 100. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes SAMD9, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 101. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 102. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 103. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, and IFI27.

Variant implementation of the present invention 104. Method variant implementation of the present invention, 103 in which the expression profile of PD markers induced IFN type I or Ifnα, includes enhanced regulation of expression or activity of genes MH and IFIT1.

Variant implementation of the present invention 105. The method according to one of the in the of options for the implementation of the present invention 74 or 94-104, in which the expression profile of PD markers induced IFN type I or Ifnα, further includes a reduced regulation of expression or activity of genes NOG, SLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 106. Method variant implementation of the present invention 72, in which the expression profile of PD markers induced IFN type I or Ifnα, further includes a reduced regulation of expression or activity of genes NOG, SLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 107. Method variant implementation of the present invention 93, which detect lower levels of polypeptides in serum.

Variant implementation of the present invention 108. Method variant implementation of the present invention 107, in which the polypeptides are cancer antigen 125, ferritin, tissue factor, and MMP-3.

Variant implementation of the present invention 109. Method variant implementation of the present invention 93, which detect lower levels of polypeptides in serum.

Variant implementation of the present invention 110. Method variant implementation of the present invention 109, in which the polypeptides are EGF, thrombopoetin and CD40 ligand.

Variant implementation of the present invention 111. The method of monitoring or predicting progression autoimmune the disease in a patient, including:

obtaining a first expression profile of markers induced by Ifnα in the first patient sample.

Variant implementation of the present invention 112. Method variant implementation of the present invention 111, in which the profile of expression of PD markers induced by Ifnα is pronounced profile and prognosis for the patient is the progression of the disease.

Variant implementation of the present invention 113. Method variant implementation of the present invention 112, in which the autoimmune disease is SLE, and progression is the exacerbation of SLE.

Variant implementation of the present invention 114. Method variant implementation of the present invention 111, in which the profile of expression of PD markers induced Ifnα, is a weak profile and prognosis for the patient is the regression of the disease.

Variant implementation of the present invention 115. Method variant implementation of the present invention 111, further including:

obtaining a second profile of expression of PD markers induced Ifnα, the second sample obtained from the patient;

moreover, the increase in the number or levels of PD markers induced IFN type I - or Ifnα, in the second expression profile relative to the first expression profile predicts the progression of Soboleva is I; or

in which the decrease in the number or level of PD markers induced IFN type I - or Ifnα, in the second expression profile relative to the first expression profile predicts regression of the disease.

Variant implementation of the present invention 116. Method of monitoring the progression of disease in a patient receiving treatment with a therapeutic agent that binds to and modulates the action of Ifnα, including:

obtaining a first expression profile of markers PD markers induced by Ifnα in the first patient sample

the introduction of a therapeutic agent which binds to and modulates the action of Ifnα,

obtaining a second expression profile of markers induced by Ifnα in the second patient sample, and

the comparison of the first and second profiles the expression of markers induced Ifnα,

in which the change in the first and second profiles the expression of markers induced Ifnα, shows the level of effectiveness of therapeutic agent that binds to and modulates the action of Ifnα.

Variant implementation of the present invention 117. Method variant implementation of the present invention 116, in which the profile of expression of markers induced by Ifnα is increased regulation of expression or activity of genes MH, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Option osushestvlyaetsya inventions 118. Method variant implementation of the present invention 116, in which the expression profile of markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1.

Variant implementation of the present invention 119. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Variant implementation of the present invention 120. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Variant implementation of the present invention 121. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNATP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Variant implementation of the present invention 122. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Variant implementation of the present invention 123. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 124. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 125. Method variant implementation of the present invention 116, in which the first type of the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of the expression is AI or actions SAMD9L genes, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 126. Method variant implementation of the present invention 116, in which the profile of expression of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 127. Method variant implementation of the present invention 116, in which the profile of expression of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, and IFI27.

Variant implementation of the present invention to 128. Method variant implementation of the present invention 116, in which the change is to reduce the levels of increased regulation of expression or activity of genes.

Variant implementation of the present invention 129. Method variant implementation of the present invention 116, in which the disease is lupus erythematosus, idiopathic inflammatory myositis, Sjogren syndrome, vasculitis, sarcoidosis, and psoriasis.

Variant implementation of the present invention 130. Method variant implementation of the present invention 131, in which the disease is lupus.

Option assests the of the present invention 131. Method variant implementation of the present invention 116, in which therapeutic agent is a low molecular weight compound or biological agent.

Variant implementation of the present invention 132. Method variant implementation of the present invention 131, in which the biological agent is an antibody.

Variant implementation of the present invention 133. Method variant implementation of the present invention 132, in which the antibody is the antibody MEDI-545.

Variant implementation of the present invention 134. Method variant implementation of the present invention 116, in which the profile of expression of PD markers induced Ifnα, get up to the introduction of therapeutic agent.

Variant implementation of the present invention 135. Method variant implementation of the present invention 116, in which the profile of expression of PD markers induced Ifnα receive during the administration of therapeutic agent.

Variant implementation of the present invention 136. Method variant implementation of the present invention 116, in which the first and the second sample is whole blood or serum.

Variant implementation of the present invention 137. Method variant implementation of the present invention 116, further comprising receiving a third profile of expression of PD marker is in, induced Ifnα, in the third sample taken from a patient.

Variant implementation of the present invention 138. Method variant implementation of the present invention 137, further comprising receiving a fourth profile of expression of PD markers induced by Ifnα in the fourth sample taken from a patient.

Variant implementation of the present invention 139. Method variant implementation of the present invention 138, further comprising receiving a fifth of the expression profile of PD markers induced Ifnα, in the fifth sample taken from a patient.

Variant implementation of the present invention 140. Method variant implementation of the present invention 139, further comprising receiving the sixth of the expression profile of PD markers induced Ifnα, in the sixth sample taken from a patient.

Variant implementation of the present invention 141. Method variant implementation of the present invention 116, in which the second sample receive at least one week, at least 2 weeks, at least three weeks, at least one month or at least two months after the introduction of therapeutic agent.

Variant implementation of the present invention 142. Method variant implementation of the present invention 137, in which the third sample get at least 2 days is to, at least 5 days, at least one week, at least two weeks, at least three weeks, at least one month or at least two months after receiving the second sample.

Variant implementation of the present invention 143. Method variant implementation of the present invention 138, in which the fourth sample get at least 2 days, at least 5 days, at least one week, at least two weeks, at least three weeks, at least one month or at least two months after receiving the third sample.

Variant implementation of the present invention 144. Method variant implementation of the present invention 139, in which the fifth sample get at least 2 days, at least 5 days, at least one week, at least two weeks, at least three weeks, at least one month or at least two months after receipt of the fourth sample.

Variant implementation of the present invention 145. Method variant implementation of the present invention 116, in which the change is to reduce the increased regulation of expression or activity of a gene.

Variant implementation of the present invention 146. How variationbetween of the present invention 145, in which the reduction is at least 10%, at least 20%, at least 25%, at least 30%, at least 40%, at least 45%, at least 50%, at least 60%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100%.

Variant implementation of the present invention 147. The method of identifying the patient as a candidate for treatment with a therapeutic agent that binds to and modulates the action of Ifnα, comprising: detecting the presence or absence of the expression profile of PD markers induced by Ifnα in the patient sample,

moreover, identification of the expression profile of PD markers induced Ifnα, describes a patient as a candidate for treatment with a therapeutic agent that binds to and modulates the action of Ifnα.

Variant implementation of the present invention 148. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes MH, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Variant implementation of the present invention 149. Method variant implementation of the present invention 147, in which the profile PD Mar is', induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1.

Variant implementation of the present invention 150. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Variant implementation of the present invention 151. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Variant implementation of the present invention 152. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MX1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Variant implementation of the present invention 153. The way the implementation of this option the image is placed 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MX1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Variant implementation of the present invention 154. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MX1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 155. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MX1.

Variant implementation of the present invention 156. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MX1.

Variant implementation of the present invention 157. The way the implementation of this option from the Britania 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MX1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 158. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is increased regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, and IFI27.

Variant implementation of the present invention 159. Method variant implementation of the present invention 147, in which the patient is diagnosed as having a disorder selected from the group including lupus, idiopathic inflammatory myositis syndrome Shogren, vasculitis, sarcoidosis, and psoriasis.

Variant implementation of the present invention 160. Method variant implementation of the present invention 159, in which disorder is lupus.

Variant implementation of the present invention 161. Method variant implementation of the present invention 147, in which therapeutic agent is a small molecule compound or biological agent.

Variant implementation of the present invention 162. Method variant implementation of the present invention 161, in which the biological agent is antic the scrap.

Variant implementation of the present invention 163. Method variant implementation of the present invention 162, in which the antibody is an antibody MEDI-545.

Variant implementation of the present invention 164. The method according to one of the embodiments of the present invention 148-158, which increased regulation of expression or activity is at least twofold increase in the expression of one or more genes.

Variant implementation of the present invention 165. The method according to one of the embodiments of the present invention 148-158, in which increased expression regulation or action is at least a threefold increase in expression of one or more genes.

Variant implementation of the present invention 166. The method according to one of the embodiments of the present invention 148-158, which increased regulation of expression or activity is increased levels of mRNA of one or more genes.

Variant implementation of the present invention 167. The method according to one of the embodiments of the present invention 148-158, which increased regulation of expression or activity is increased levels of proteins of one or more genes.

Variant implementation of the present invention 168. The method according to one of the variants domestic the present invention 148-158, where increased regulation of expression or activity is increased enzymatic activities of the protein expressed from one or more genes.

Variant implementation of the present invention 169. Method variant implementation of the present invention 147, in which the sample is whole blood.

Variant implementation of the present invention 170. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is reduced regulation of expression or activity of genes NOG, SLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 171. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα, is elevated in serum polypeptides cancer antigen 125, ferritin, tissue factor, and MMP-3.

Variant implementation of the present invention 172. Method variant implementation of the present invention 147, in which the expression profile of PD markers induced IFN type I - or Ifnα is depressed levels of serum EGF polypeptides, thrombopoetin and CD40 ligand.

Variant implementation of the present invention 173. A method for diagnosing a patient as a patient having a disorder associated with increasing the n levels of Ifnα, including:

detecting the presence or absence of the expression profile of PD markers induced by Ifnα in the patient sample,

moreover, identification of the expression profile of PD markers induced Ifnα, describes a patient as having a disorder associated with elevated levels of Ifnα.

Variant implementation of the present invention 174. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes MH, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Variant implementation of the present invention 175. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1.

Variant implementation of the present invention 176. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Variant implementation of the present invention 177. The way the variants of implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Variant implementation of the present invention 178. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Variant implementation of the present invention 179. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MX1, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Variant implementation of the present invention 180. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MX1, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 181. Method variant implementation of the present invention 173, in which the profile e is cpressey PD markers, induced Ifnα is increased regulation of expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MX1.

Variant implementation of the present invention 182. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MX1.

Variant implementation of the present invention 183. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MX1, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 184. Method variant implementation of the present invention 173, in which the expression profile of PD markers induced by Ifnα is increased regulation of expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, and IFI27.

Variant implementation of the present invention 185. Method variant implementation of the present invention 173, in which disorder is lupus, idiopathic inflammatory myositis, Sjogren syndrome, vasculitis, sarcoidosis, or psoriasis.

An implementation option infusion is his invention 186. Method variant implementation of the present invention 185, in which disorder is lupus.

Variant implementation of the present invention 187. The method according to one of the embodiments of the present invention 174-184, which increased regulation of expression or activity is at least twofold increase in the expression or activity of one or more genes.

Variant implementation of the present invention 188. Method variant implementation of the present invention 187, in which increased expression regulation or action is at least a threefold increase in expression or activity of one or more genes.

Variant implementation of the present invention 189. The method according to one of the embodiments of the present invention 174-184, which increased regulation of expression or activity is increased levels of mRNA of one or more genes.

Variant implementation of the present invention 190. The method according to one of the embodiments of the present invention 174-184, which increased regulation of expression or activity is increased levels of proteins of one or more genes.

Variant implementation of the present invention 191. The method according to one of the embodiments of the present invention 174-184, in which asenna regulation of expression or activity is increased enzymatic activity of the protein, downregulation of one or more genes.

Variant implementation of the present invention 192. The method according to one of the embodiments of the present invention 174-184, in which the expression profile of PD markers induced IFN type I - or Ifnα, further includes a reduced regulation of expression or activity of genes NOGSLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 193. The method according to one of the embodiments of the present invention 174-184, in which the expression profile of PD markers induced IFN type I - or Ifnα additionally include elevated levels of serum polypeptides cancer antigen 125, ferritin, tissue factor, and MMP-3.

Variant implementation of the present invention 194. The method according to one of the embodiments of the present invention 174-184, in which the expression profile of PD markers induced IFN type I - or Ifnα, additionally includes decreased levels of serum EGF polypeptides, thrombopoetin and CD40 ligand.

Variant implementation of the present invention 195. The method of identification studied therapeutic agent for the treatment of Ifnα-mediated disorders, including:

contact of cells, including the expression profile of PD markers induced Ifnα, agent, and

detecting the presence or absence of changes in the profile of expr the hurt FD markers, induced IFN type I - or Ifnα, in cells

moreover, the detection of the occurrence of a change involves reducing the reduced gene regulation of the expression profile of PD markers induced Ifnα, confirms that the agent is a therapeutic agent candidate.

Variant implementation of the present invention 196. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes MH, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44.

Variant implementation of the present invention 197. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5 and OAS1.

Variant implementation of the present invention 198. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

Variant implementation of the present invention 199. Method variant implementation of the present invention 195, in which profile the expression of PD markers, induced Ifnα, includes enhanced regulation of the expression or activity of genes SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1.

Variant implementation of the present invention 200. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

Variant implementation of the present invention 201. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27.

Variant implementation of the present invention 202. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18.

Variant implementation of the present invention 203. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes the higher the percent regulation of the expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, CEACAM1, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 204. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

Variant implementation of the present invention 205. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18.

Variant implementation of the present invention 206. Method variant implementation of the present invention 195, in which the expression profile of PD markers induced Ifnα, includes enhanced regulation of the expression or activity of genes IFI6, RSAD2, IFI44, IFI44L, and IFI27.

Variant implementation of the present invention 207. Method variant implementation of the present invention 195, in which cells derived from the patient, are the disorder associated with elevated levels of Ifnα.

Variant implementation of the present invention 208. Method variant implementation of the present invention 195, in which cells are cells, the processing is subjected to Ifnα for the induction of the expression profile of PD markers, induced by Ifnα.

Variant implementation of the present invention 209. Method variant implementation of the present invention 195, which increased regulation of genes of the expression profile of PD markers induced by Ifnα is at least two-fold increase in expression of one or more genes of the profile.

Variant implementation of the present invention 210. Method variant implementation of the present invention 195, which increased regulation of genes of the expression profile of PD markers induced by Ifnα is at least a threefold increase in expression of one or more genes of the expression profile of PD markers induced by Ifnα.

Variant implementation of the present invention 211. Method variant implementation of the present invention 195, which increased regulation of genes of the expression profile of PD markers induced by Ifnα is increased levels of mRNA of one or more genes of the expression profile of PD markers induced by Ifnα.

Variant implementation of the present invention 212. Method variant implementation of the present invention 195, which increased regulation of genes of the expression profile of PD markers induced Ifnα, represents an increase of protein levels of one or more genes of the expression profile of PD markers induced by Ifnα.

Option about what westline of the present invention 213. Method variant implementation of the present invention 195, which increased regulation of genes of the expression profile of PD markers induced Ifnα, represents the increase of the enzymatic action of a protein expressed from one or more genes of the expression profile of PD markers induced by Ifnα.

Variant implementation of the present invention 214. The method according to one of the embodiments of the present invention 196-206, in which the expression profile of PD markers induced IFN type I - or Ifnα, further includes a reduced regulation of expression or activity of genes NOGSLC4A1, PRSS33 and FEZ1,

moreover, the presence of change, representing the increased expression or activity of genes with reduced regulation, suggests that the agent is a therapeutic agent candidate.

Variant implementation of the present invention 215. The method according to one of the embodiments of the present invention 196-206, in which the expression profile of PD markers induced IFN type I - or Ifnα additionally include elevated levels of serum polypeptides cancer antigen 125, ferritin, tissue factor, and MMP-3,

moreover, the presence of change, representing the lower levels in the serum polypeptide, indicates that the agent is a therapeutic agent candidate.

Option Khujand is the implementation of the present invention 216. The method according to one of the embodiments of the present invention 196-206, in which the expression profile of PD markers induced IFN type I - or Ifnα, additionally includes decreased levels of serum EGF polypeptides, thrombopoetin and CD40 ligand,

moreover, the presence of change, representing increasing levels of serum polypeptide, indicates that the agent is a therapeutic agent candidate.

Variant implementation of the present invention 217. The set of probes, including:

polynucleotide, which specifically detect expression of any of the sets of genes:

(a) MH, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, IFI44; or

(b) IFI27, SIGLEC1, RSAD2, IFI6, IFI44L, IFI44, USP18, IFIT2, SAMD9L, BIRC4BP, DNAPTP6, OAS3, LY6E, IFIT1, LIPA, LOC129607, ISG15, PARP14, MH, OAS2, OASL, CCL2, HERC5, OAS1; or

(C) IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2; or

(g) SERPING1, IFIT2, IFIT3, IFI6, LY6E, MH, OAS1, ISG15, IFI27, OAS3, IFI44, LAMP3, DNAPTP6, ETV7, HERC5, OAS2, USP18, XAF1, RTP4, SIGLEC1, and EPSTI1; or

(d) RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, MH, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15; or

(e) LAMP3, SIGLEC1, DNAPTP6, IFIT2, ETV7, RTP4, SERPING1, HERC5, XAF1, MH, EPSTI1, OAS2, OAS1, OAS3, IFIT3, IFI6, USP18, RSAD2, IFI44, LY6E, ISG15 and IFI27; or

(W) DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, RSAD2, RTP4, SIGLEC1, and USP18; or

(C) SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, 1RN, SEASON, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPIG1, OASL, GBP 1 and MH; or

(and) SAMD9L, IFI6, IFI44, IFIT2, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH; or

(K) IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1, and USP18; or

(l) IFI6, RSAD2, IFI44, IFI44L, and IFI27; or

(m) NOGSLC4A1, PRSS33 and FEZ1.

Variant implementation of the present invention 218. The set includes any of the sets of probes indicated in the embodiment of the present invention 217.

Variant implementation of the present invention 219. The method of detecting the action of IFN in the sample, including:

incubation of cells comprising a polynucleotide sequence containing a reporter gene under the control of the element response is stimulated by interferon, with the sample; and

detection of the reporter gene expression,

and the reporter gene expression indicates IFN in the sample.

Variant implementation of the present invention 220. Method variant implementation of the present invention 219, in which cells are cells NECN.

Variant implementation of the present invention 221. Method variant implementation of the present invention 219, in which the reporter gene is a luciferase gene, a chloramphenicol-acyl transferase, β-galactosidase, green fluorescent protein, β-glucuronidase or secreted placental alkaline phosphatase.

An implementation option this is about inventions 222. Method variant implementation of the present invention 221, in which the reporter gene is a luciferase gene.

Variant implementation of the present invention 223. Method variant implementation of the present invention 222, in which the luciferase is luciferase Gaussia princeps.

Variant implementation of the present invention 224. Method variant implementation of the present invention 219 also includes the calculation of the expression level of the reporter gene.

Variant implementation of the present invention 225. Method variant implementation of the present invention 224, further comprising a correlation of the expression level of the reporter gene with the level of action of IFN in the sample.

All publications, patents and patent applications cited in the present description, included in the present invention by reference to their description in the same extent that each individual publication, patent or patent application was specifically and specifically shown for inclusion in the present invention by reference.

This application claims priority based on provisional application for U.S. patent US 60/873008, filed December 6, 2006, provisional application for U.S. patent 60/907762 filed April 16, 2007, provisional application for U.S. patent 60/924219, filed may 3, 2007, provisional application for U.S. patent 60/924584, filed 21 may 2007 the., the provisional patent application U.S. 60/960187, filed September 19, 2007, and provisional patent application U.S. 60/996176, filed November 5, 2007, the essence of which is included in the present invention for all purposes. In this application also claims the priority based on provisional application for U.S. patent US 924220, filed may 3, 2007, provisional application entitled "Auto-Antibody Markers of Autoimmune Disease" and filed November 6, 2007 (attorney IA201P2), of the provisional application US, entitled "Auto-Antibody Markers of Autoimmune Disease"filed November 6, 2007 (attorney AR) and the provisional application US, entitled "Auto-Antibody Markers of Autoimmune Disease"filed December 6, 2007 (attorney AR)included in the present invention in the form of links. In this application also claims the priority based on provisional application for U.S. patent US 60/907767 filed April 16, 2007, on the basis of the provisional patent application 60/996174, filed November 5, 2007, and PCT patent application entitled "Methods of Treating Systemic Lupus Lupus", filed December 6, 2007 (attorney ART)included in the present invention by reference.

The following examples are provided only as an illustration and in no way limit the scope of the present invention.

Examples

Example 1A. Initial identification of genes with increased regulation in patients with in what chunks

Determine the profile of gene expression in whole blood of five patients with lupus erythematosus (two with skin form and three with severe) and five healthy volunteers, using the methodology developed by Affymetrix for whole genome alignment and confirmation method qPCR. The multiplicity values of gene expression is determined by calculating the difference values log2signal intensity between samples of individual patients with lupus and average value of log2signal intensity for 5 samples of healthy donors. 118 genes identified as genes with increased regulation at least twice, in the whole blood of all 5 patients with lupus relative to healthy volunteers.

Table. 1 presents summary information for 71 of 118 annotated genes that have been identified as genes increased regulation at least twice, all five patients with lupus. Table. 2 represents the fold increase in expression of a subset of 118 genes for each of the five patients with SLE compared with healthy volunteers. Table. 2 also presents a comparison between the values of fold change is defined by two unique platforms (ff GeneChip and TaqMan (i.e. KCR)).

Table. 1.
Genes, your identify is consistent with the increased regulation at least twice, in whole blood of patients with lupus.
Table 2.
Increased regulation of gene expression of genes for each of the five patients with lupus.
Probe IDThe designation of the gene129KHR. SLE (Tag Man)129KHR. SLE (Affy)RH33XR. SLE (Tag Man)RH33XR. SLE (Affy)OJ9S SR (Tag Man)OJ9S SR (Affy)4499R (Tag Man)4499R (Affy)MI26CR (Tag Man)MI26CR (Affy)
228220_atFCHO23,2439,863,3076,1533,0584,8622,3635,0717,7710,61
205483_s_atG1P386,13146,74 80,5592,15of 4.457,832,90the 5.45of 5.0612,71
212195_atIL6STa 3.879,183,6327,526,609,734,9510,702,356,14
203275_atIRF28,106,465,004,805,076,544,124,322,44of 4.66
1555643_s_atLILRA516,4312,0027,2514,6411,226,666,827,44 4,86of 6.49
205170_atSTAT211,558,679,742,258,082,166,372,924,122,62

Example 1A. Identification of genes identified as genes with increased regulation, in patients with lupus

For further identification of PD marker candidates for clinical trials using monoclonal antibodies anti-Ifnα in patients with SLE, use the platform alignment Affymetrix Human Genome U133 Plus 2.0 GeneChip®to obtain a profile of whole blood 46 patients with SLE and whole blood 24 older and are of childbearing age in healthy donors. It was found that the sets of 245 and 77 probes have shown an increased regulation and down regulation, respectively, in the whole blood of patients with SLE, which was compared with control healthy donors.

Set 245 probes with increased regulation in whole blood of SLE patients 114 are IFN type I-induced. Table. 30 lists the 50 sets of probes with the most advanced regulation in whole blood t the fir of SLE patients; of these, 76% are IFN type I-induced. Table. 30 is also the prevalence of overexpression of these genes in whole blood of SLE patients. Most of these genes sverkhekspressiya at least twice, at 65-80% profiled patients. Strong and dominant overexpression of a large number of IFN type I-induced genes in patients with SLE means that they can be relevant PD markers for clinical studies study treatment using monoclonal antibodies anti-Ifnα for patients with SLE.

Table 30
50 probes with the greatest increased regulation in whole blood of patients with SLE
ID probesGene productThe designation of the genelog2fcThe value of q (FDR)Prevalence
202411_atInterferon alpha-inducible protein 27IFI274,608,41E-0773,91
219519_s_atSialic Ki the lot, binding Ig-like lectin 1, sialoadhesinSIGLEC13,527,28E-0765.22 per
214059_atInterferon-induced protein 44IFI443,518,04E-0773,91
213797_atProtein 2, containing the domain of the radical S-adenosylmethionineRSAD23,299,86E-0671,74
204415_atInterferon alpha-induced protein 6IFI63,212.25e-0982,61

212768_s_at
ID probesGene productThe designation of the genelog2fcThe value of q (FDR)Prevalence
242625_atProtein 2, containing the domain of the radical S-adenosylmethionineRSAD2 3,191,55E-0669,57
204439_atProtein similar to interferon-induced protein 44IFI44L3,144,99E-0671,74
219211_atUbiquitin-specific peptidase 18USP182,842,23E-0667,39
214453_s_atinterferon-induced protein 44IFI442,721,07E-0571,74
202145_atComplex lymphocyte antigen 6, locus ELY6E2,537,28E-0763,04
207329_atMatrix metallopeptidase 8 (neutrophil collagenase)MRof 2.510,00111in comparison with 60.87
202869_at2',5'-oligoadenylate synthetases is 1, 40/46 kDaOAS12,331,66E-0669,57
222154_s_atDecolorata-transactionally protein 6DNAPTP62,321,14E-0565.22 per
44673_atSialic acid binding Ig-like lectin 1, sialoadhesinSIGLEC12,312,23E-0658,70
242234_atXIAP associated factor-1BIRC4BP2,318,41E-0765.22 per
203153_atInterferon-induced protein with tetratricopeptide repeats 1IFIT12,259,53E-0567,39
218400_at2'-5'-oligoadenylate synthetase 3, 100 kDaOAS32,241,23E-0567,39
Olfactometer 4OLFM42,230,00608in comparison with 60.87
241869_atApolipoprotein L, 6APOL62,220,0004580,43
235643_atProtein related protein domain, a sterile alpha motif 9SAMD9L2,221,E-0684,78
231688_atTranscribed locus-2,220,0024863,04
208470_s_atThe haptoglobin /// haptoglobin-related proteinHP /// HPR2,202,48TH-0580,43
239979_atEpithelial stromal interaction 1 (breast)EPSTI12,205,44TH-0665.22 per
206697_s_atThe haptoglobinHP2,192,E-0573,91
205552_s_at2',5'-oligoadenylate synthetase 1, 40/46 kDaOAS12,184,E-0765.22 per
205483_s_atUbiquitin-like modifier ISG15ISG152,162,E-0665.22 per
227609_atEpithelial stromal interaction 1 (breast)EPSTI12,154,E-0667,39
1555643_s_atLeukocyte-type immunoglobulin receptor, subfamily ALILRA52,148,E-0776,09
222816_s_atZinc finger, SSNS domain containing 2ZCCHC22,095,43TH-05 80,43
205569_atLysosomal-associated membrane protein 3LAMP32,082,74A-0665.22 per
226702_atHypothetical protein LOC129607LOC1296072,075,E-0567,39

ID probesGene productThe designation of the genelog2fcThe value of q (FDR)Prevalence
215838_atLeukocyte-type immunoglobulin receptor, subfamily ALILRA52,071,87E-0571,74
219863_athect domain and RLD 5HERC52,031,53E-0567,39
204747_atInterferon-induced protein with Tetra is ecopatent repeats 3 IFIT32,011,55E-0667,39
200986_atinhibitor Sarbinowo peptidases, taxon G (C1 inhibitor), member 1SERPING11,980,0001367,39
224225_s_atVariant ets gene 7 (TEL2 oncogene)ETV71,982,48E-0558,70
219684_atReceptor (dynamics) transport protein 4RTP41,962,74E-0663,04
206133_atXIAP associated factor-1BIRC4BP1,967,28E-07
206871_atElastase 2, neutrophilELA21,950,0031654,35
217502_atAnd terferon-induced protein with tetratricopeptide repetitions 2 IFIT21,954,86E-0671,74
237340_atThe family of soluble carriers 26, the representative 8SLC26A81,936,68E-06in comparison with 60.87
235276_at--1,936,44E-0665.22 per
203757_s_atThe adhesion molecule cell 6, related carcinoembryonic antigenSEASON1,910,0012447,83
202086_atResistance to myxovirus (influenza a) 1, interferon-inducible protein R (mouse)MH1,902,66E-0567,39
241916_atScramblase-1 phospholipidsPLSCR11,894,86E-0673,91
203595_s_atinterferon-induced protein with tetratricopeptide repeats 5IFIT51,892,81E-0869,57
205660_atType 2'-5'-oligoadenylate synthetaseOASL1,891,94E-0565.22 per
219352_athect domain and RLD 6HERC61,879,79E-0663,04
211657_atThe adhesion molecule cell 6, related carcinoembryonic antigenSEASONto 1.860,00667in comparison with 60.87
228439_atbasic Lazenby zipper transcription factor that is similar to ATF 2BATF2to 1.862,63E-0563,04

Data were obtained from 46 patients with SLE and 24 healthy control subjects, using SAM and FDR in R (see methods). IFN type I-induced genes compartment which are in bold. FDR = degree of false assessments (false discovery rate); SAM = significance of the research microarray (significance analysis of microarrays); SLE = systemic lupus erythematosus.

Fig (top panel) shows a heatmap of the expression sets 114 with increased regulation of IFN type I-induced probes in patients with SLE and healthy subjects (control). Of the 46 patients profiled SLE 32 show significant overexpression of signature of IFN type I genes. To confirm the observation, namely, that of IFN type I-induced genes sverkhekspressiya in whole blood of SLE patients, selected whole blood 54 of SLE patients in prognostic research. Figa shows a scheme AGK 46 of SLE patients in the first study, using 114 sverhagressivnym IFN type I-induced probes. See a clear distinction between SLE patients whose overexpression signature of IFN type I genes differs from the corresponding index in healthy donors and patients with SLE who have weak or undetectable signature of IFN type I genes in whole blood. Figb shows a scheme AGK from 54 patients with SLE in a subsequent study, using the same sets identified 114 IFN type I-induced probes. A similar separation of patients with SLE see, based on the signature of IFN type I genes, like presented on figa. The distribution of ratings signature of IFN type I gene is a prognostic study also resembles the distribution in the first study (data not shown). The ability to use sverhagressivny IFN type I-induced genes have been identified for the separation of SLE patients into 2 different groups of patients - with or without a signature genes IFN type I - confirms the accuracy of the identification of overexpression signature of IFN type I genes in whole blood of SLE patients.

In addition to overexpression signature of IFN type I genes observed the overexpression of the gene signature, which is an indicator of activation of granulocytes in whole blood of SLE patients. Gene signature of granulocytes includes (but not limited to) the following genes: AZU, DEFA1, DEFA4, ELA2, MMR, MR, PHKS2, lros, CAMP, FCAR and CYBB (Fig, second panel). Gene signature of granulocytes present in approximately 50% of profiled patients with SLE.

The 50 sets of probes with the most reduced regulation, which is observed in whole blood of SLE patients are shown in table. Reduced regulation of gene signatures in T cells, NK and B observed in whole blood of patients with SLE (Fig, panel three, four and five, respectively); this is consistent with the observation lymphopenia in patients with SLE, which was previously reported in the literature (Bennett L., and others, J Exp Med, 197(6), 2003, SS. 711-723; Rivero S.J., and others, Arthritis Rheum., 21(3), 1978, SS. 295-305).

45,65
Table 31
Top 50 transcripts with the most is its reduced regulation in whole blood of SLE patients
ID probesThe name of the geneThe designation of the genelog2fcThe value of q (FDR)Distribution
1552713_a_atSoluble carrier family 4, aminoalkenes, representative 1 (erythrocyte membrane protein band 3, Diego blood)SLC4A1- 1,820,0002169,57
1552348_atSerine protease 33PRSS33- 1,710,0004663,04
211734_s_atFc fragment of IgE, high affinity I, receptor for; alpha polypeptide /// Fc fragment of IgE, high affinity I, receptor for; alpha polypeptideFCER1A- 1,590,0008354,35
236307_atBTB and CNC homology 1, basic Lazenby zipper transcription factor 2WASN- 1,510,00012 54,35
214470_atLectin-like receptors, natural killer cell, subfamily B, representative 1 /// Lectin-like receptors, natural killer cell, subfamily B, representative 1KLRB1- 1,500,0000058,70
209570_s_atDNA segment on chromosome 4 (unique) 234 expressed sequenceD4S234E- 1,460,0000065.22 per
217143_s_atAlpha locus receptor T cells /// Delta locus receptor T cellsTRA@ /// TRD@- 1,380,0000158,70
203562_atProtein fasciculation and elongation Zeta 1 (zygin I)FEZ1- 1,360,0002889,13
227198_atAF4/FMR2 family, the representative 3AFF3- 1,350,00046
207840_atCD160 moleculeCD160is 1.340,0007947,83
232286_atAF4/FMR2 family, the representative 3AFF3is 1.340,0000356,52

ID probesThe name of the geneThe designation of the genelog2fcThe value of q (FDR)Distribution
209993_atATP-binding cassette, subfamily B (MDR/TAP), member 1ASV- 1,320,0000263,04
209815_atOchagavia homolog 1 (Drosophila)RTSN- 1,290,0000354,35
241881_atOlfactory receptor, family 2, subfamily W, will present the eh 3 OR2W3- 1,290,0173650,00
213674_x_atThe constant region of the heavy chain of immunoglobulin DeltaIGHD- 1,290,0180150,00
231798_atFactor NogginNOG- 1,280,0023473,91
239673_atNuclear receptor subfamily 3, group C, representative 2NR3C2- 1,270,0000456,52
221748_s_atTenzin 1 /// Tenzin 1TNS1- 1,230,0095350,00
218864_atTenzin 1TNS1- 1,220,0071850,00
219630_atPDZK1 interacting protein 1 PDZK1IP1- 1,200,0052856,52
1553177_atSH2 domain containing 1BSH2D1B- 1,200,0018747,83
229513_atEcoLeaders RNA-binding protein is presentedSTRBP- 1,200,0001758,70
243054_atZinc finger, MYND domain containing 11ZMYND11- 1,200,00101in comparison with 60.87
236796_atBTB and CNC homology 1, basic Lazenby zipper transcription factor 2BACH2- 1,200,0000456,52
203661_s_atTropaeolin 1TMOD1- 1,190,0067550,00
239278_atThe cDNA clone IG:5301129 -- 1,170,0000265.22 per
235400_atProtein cognate Fc receptor-AFCRLA- 1,170,0009952,17
240690_atHomolog of rat pragma of protein Rnd2DKFZp761P0423- 1,170,0001252,17
210746_s_atstrip membrane protein of erythrocytes 4.2 /// stripe membrane protein of erythrocytes 4.2EPB42- 1,160,0055245,65
232478_atNuclear receptor subfamily 6, group A, representative 1NR6A1- 1,150,0000447,83

ID probesThe name of the geneThe designation of the genelog2fcThe value of q (FDR) Distribution
243810_atProtein, similar to heterogeneous nuclear ribonucleoprotein A1 (helix-destabilizing protein) (protein that binds single-stranded RNA) (crustal protein heterogeneous nuclear ribonucleoprotein (GARP) A1)LOC341333- 1,150,0001447,83
228599_atLongest in the membrane 4 domains, subfamily A, representative 1MS4A1- 1,140,0045445,65
212827_atConstant plot heavy chain immunoglobulin mu /// Const plot heavy chain immunoglobulin muIGHM- 1,140,0032445,65
1552349_a_atSerine protease 33PRSS33- 1,130,0235747,83
216191_s_atThe locus of T-cell receptor alpha /// Locus T-cell receptor Delta /// B-cel CLL/lymphoma 11B (protein zinc finger) TRA@ /// TRD@ /// BCL11B- 1,120,0107350,00
232686_atLectin-type Ig that binds sialic acid, pseudogene 3SIGLECP3- 1,120,0000358,70
211532_x_atSimilar to immunoglobulin receptor killer cell, two domains, short cytoplasmic tail, 2KIR2DS2- 1,100,0401154,35
1563217_atInhibitor alpha of camp-dependent protein kinasePKIA- 1,100,0002458,70
243798_atLymphoma, Burkitt's lymphoma receptor 1, GTP binding protein (a receptor of the chemokine (C-X-C motif) 5)BLR1- 1,100,0004454,35
22075l_s_atChromosome 5 open reading frame 4C5 or f4 - 1,090,0053150,00
202555_s_atLight chain myosin kinase /// myosin Light chain kinaseMYLK- 1,090,0014952,17
230245_s_atHypothetical protein LOC283663LOC283663- 1,090,0097747,83
233921_s_atProtein type of low protein MAD1 the arrest of meiosis 1 (yeast)MAD1L1- 1,080,0000141,30

ID probesThe name of the geneThe designation of the genelog2fcThe value of q (FDR)Distribution
214974_x_atThe ligand of the chemokine (C-X-C motif) 5CXCL5- 1,080,0071754,35
209569_x_atDNA segment on chromosome 4 (unique) 234 expressed sequenceD4S234E- 1,080,0000558,70
235401_s_atProtein cognate Fc receptor-AFCRLA- 1,080,0017350,00
205900_atKeratin 1 (epidermolizei hyperkeratosis)KRT1- 1,080,0451843,48
242509_atChromosome 16 open reading frame 74C16 or f74- 1,080,0001647,83
209994_s_atATP-binding cassette, subfamily B (MDR/TAP), member 1 /// ATP-binding cassette, subfamily B (MDR/TAP), member 4AVSV /// AVSV- 1,080,0000056,52
204793_atProtein 1, is ortherwise receptors, associated with G-proteinsGPRASP1- 1,080,0002645,65

Data were obtained from 46 patients with SLE and 24 healthy control subjects, using SAM and FDR in R (see methods). FDR = degree of false assessments (false discovery rate); SAM = significance of the research microarray (significance analysis of microarrays); SLE = systemic lupus erythematosus.

To further confirm the observations about the overexpression of IFN type I and granulocytic signatures and to identify other signaling pathways that may be altered in patients with SLE, analyze metabolic pathways and networks software GeneGo (see methods). Total for SLE analysis of these metabolic pathways confirms the activation of the IFN type I-metabolic pathway along with the activation signature of granulocytes and reduced expression of T-cell signaling pathways. In addition, we profiled patients activating IL-10 signaling pathway occurs along with other known metabolic pathways that are altered. It may also include the activation of B cells and may manifest as altered apoptosis of T-cell subsets in patients with SLE (Diaz-Alderete A, Crispin JC, Vargas-Rojas MI and Alcocer-Varela J., J Autoimmun. 23(4), 2004, SS. 379-383, Wang H, Xu J, Ji X, etc., Cell Immunol. 235(2), 200, SS. 117-121).

Confirmation of overexpression of IFN type I-induced genes. To confirm the overexpression of IFN type I-induced genes in patients with SLE, which is observed in the analysis using microarrays, use an array with a variable number of elements BioMarkTMAt 48.48 for the implementation of high throughput reaction (high throughput - NTR) TaqMan EOC-PCR for IFN type I-induced genes (selected based on their length and the prevalence of overexpression in whole blood of SLE patients). Research TaqMan EOC-PCR confirmed the overexpression of all 40 genes in whole blood 35 initially profiled 46 patients with SLE. The overexpression of 15 out of 40 IFN type I-induced genes using the TaqMan analysis, show figa. Regulation of these genes increased on average by 8-92 times and all of them essentially sverkhekspressiya (P<0,05). These observations demonstrate that IFN type I-induced genes significantly sverkhekspressiya in patients with SLE. Accordance with results of microarrays and TaqMan and a strong correlation (correlation coefficient >0,98) between research microarrays and TaqMan for the 21st IFN-induced gene in example 2 in patients with SLE (figb and 4B) indicate their potential as FD and diagnostic markers in clinical studies of anti-IFN-α approaches to the treatment of SLE.

Example 2. Potential PD markers selected from the genes povyshennoi regulation in patients with lupus

Using data profiling, whole genome described in example 1A, selected group PD marker candidates. These markers are candidates lead in table 3.

Table 3
PD markers-candidates
ID probeThe designation of the geneGroup
204415_atHERC51
202411_atIFI271
214453_s_atIFI441
229450_atIFIT31
1555643_s_atLILRA51
205483_s_atG1P21
204439_atIFI44L1
203153_atIFIT11
202145_atLY6E
ID probeThe designation of the geneGroup
202869_atOAS11
218400_atOAS31
242625_atRSAD21
228220_atFCHO22
205483_s_atG1P32
212195_atIL6ST2
203275_atIRF22
1555643_s_atLILRA52
205170_atSTAT22
208436_s_atIRF73
211967_atPORIMIN3
226312_atAVO3201669_s_atMARCKS3
222846_atRAB8B3

Example 3. PD markers candidates show minimal variation from healthy donors

Performed By RT-PCR on selected group PD marker candidates to determine whether they are a variation of the original level in whole blood of healthy volunteers. For RT-PCR shows that the variation of the baseline minimum. Cm. table 4, which presents the data To the RT-PCR baseline (healthy volunteers are shown in shaded columns).

Table 4
Variation of the initial data PD markers-candidates
Gene102-PAX129-PAX129KHR-SLERH33XR-SLE
CDC42SE10,5891,0002,6221,996
FCHO20,8721,0003,2353,298
G1P32,0591,00086,13080,545
HERC53,6381,000638,073159,621
IFI270,2461,000508,34614,012
IFI445,1941,000636,965338,921
IFIT31,4131,000104,16659,344
IL6STof 0.3371,0003,8733,628
IRF21,4861,0008,0964,998
LILRA51,481771,00016,43318227,248745
BAFF 0,4331,0002,4784,679
GIP20,5711,00022,16813,634
IFI44L2,5811,000407,035259,517
IFIT14,0181,000128,164151,301
LY6E0,4421,00010,0955,181
OAS10,8171,00016,65010,379
OAS32,5171,00075,54232,355
RSAD22,4251,000310,575217,885
STAT21,5261,000 11,5519,735

Example 4. Ifnα stimulates increased expression regulation FD marker candidates in whole blood of healthy volunteers

The study was conducted to determine whether Ifnα to stimulate the expression of PD marker candidates in whole blood of healthy volunteers. Whole blood from healthy volunteers were taken in heparinized tubes are transferred into corresponding wells of 6-well plates, incubated with leukocyte IFN doses of 3, 30, 100 and 300 Honey and then incubated for 4 h at 37°C in an atmosphere of 5% CO2. Fold change PD markers of candidate genes FI44, IRF2, RSAD2, G1P3 and HERC5 determined using RNA isolated from MKK (mononuclear cells in peripheral blood) with a set PHKeasy kit company Qiagen. In table 5 (IFI44 and IRF2), table 6 (RSAD2) and table 7 (G1P3 and HERC5) have shown that IFN enhances regulation of expression of each of these PD marker candidates. Cm. a graphical analysis of these results in the expression of PD marker candidates in figure 1 (IFI44), 2 (IRF2), 3 (RSAD2), 4 (G1P3) and figure 5 (HERC5).

Summary of hierarchical clustering of all samples using 1384 genes differently regulated IFN type I, type-II IFN or α obtained in a separate experiment, shown in Fig. Heatmap with a total hierarchical clustering also receive DL is 689 IFN type I-induced sets of probes, applied to samples of whole blood from healthy donors ex vivo, which were stimulated IFN type I, type-II IFN or α. Cm. Fig.

Table 5
Induced expression of genes IFI44 and IRF2 after stimulation of leukocyte interferon whole blood of healthy volunteers.
SampleGeneAverageThe standard deviation
63A EnvironmentIFI441,00
63A IFNIFI448,580,16
63A IFNIFI448,270,07
63A IFNIFI4415,120,50
63A IFNIFI4412,420,04
SampleGeneAverageThe standard deviation
63A EnvironmentIRF21,00

SampleGeneAverageThe standard deviation
63A IFNIRF22,250,08
63A IFNIRF21,960,06
63A IFNIRF22,190,06
63A IFNIRF23,750,10
Table 6
Induced gene expression RSAD2 after which simulatie leukocyte interferon whole blood of healthy volunteers
SampleGeneAverageThe standard deviation
63A EnvironmentRSAD21,00
63A IFNRSAD210,850,11
63A IFNRSAD211,140,21
63A IFNRSAD214,960,12
63A IFNRSAD2is 25.500,50
Table 7
Induced expression of genes G1P3 and HERC5 after stimulation of leukocyte interferon whole blood of healthy volunteers
SampleGene AverageThe standard deviation
63A EnvironmentG1P31,00
63A IFNG1P342,881,03
63A IFNG1P325,760,10
63A IFNG1P321,720,48
63A IFNG1P316,020,06
SampleGeneAverageThe standard deviation
63A EnvironmentHERC5 1,00
63A IFNHERC514,170,12
63A IFNHERC513,740,12
63A IFNHERC518,510,58
63A IFNHERC523,550,54

Example 5. Antibody against Ifnα will neutralize the expression of Ifnα-induced PD marker candidates in whole blood of healthy volunteers

Source interferon = α2

Because the processing of whole blood of healthy volunteers Ifnα leads to the induction of the expression of PD - marker candidates, investigate whether antibody against Ifnα, MEDI-545, to neutralize the induction of expression of these markers.

Blood is collected from each of three donors in heparinized tubes. Aliquots of selected blood volume 2.5 ml contribute to each of 4 wells of a 6 - or 24-well plates for processing blood. The processing circuit 4 holes as follows: (a) blood + dissolve the ü, (b) blood + 100 Honey. α2, (C) blood + 100 Honey. α2 + MEDI-545 (antibody against Ifnα) and (g) blood + 100 Honey. α2 + R347 (control antibody).

Wells containing subjected to treatment with antibody blood first or incubated with the antibody MEDI-545 (antibody against Ifnα, hole (in)), or R347 antibody (control antibody, the hole (g)), 30 min After treatment with antibody add solvent (the hole (a)) or α2 (holes (b), (C) and (d)) into the appropriate wells and then incubated for an additional 4 h at 37°C in an atmosphere of 5% CO2. Then the samples are transferred into PAXgene tubes and incubated at room temperature for 2 h After 2 h incubation the tubes stored at -80°C.

Then when incubating at least over night at -80°C get the total RNA of the cells according to the Protocol of the firm PAXgene. The first and second chain cDNA prepared by methods Affy fiberglass and TaqMan sample cDNA.

The expression of at least 11 PD marker candidates previously identified as PD markers with increased regulation in patients with lupus, can be neutralized by the antibody MEDI-545 in whole blood stimulated α2. Cm. table 8 (RAB8B), tabl (IRF7), table 10 (MARCKS), tabl (IL6ST), tabl (LY6E), table 13 (IFIT3), table 14 (IFIT1), tabl (HERC5), table 16 (OAS1), table 17 (OAS3) and table (RSAD2), which presents a quantitative analysis of gene expression for each of the specified the 11 genes in whole blood of each of 3 healthy volunteers.

Table 8
α2-induced gene expression RAB8B neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTRAB8B1,00
107 IFNRAB8B3,450,31
107 IFN + 545RAB8B1,300,04
107 IFN + R347RAB8B3,150,03

SampleGeneAverageThe standard deviation
163 SOLVENTRAB8B0,70 0,01
163 IFNRAB8B2,200,04
107 IFN + 545RAB8B1,180,01
107 IFN + R3437RAB8B3,710,02
175 SOLVENTRAB8B0,640,01
175 IFNRAB8B2,630,04
107 IFN + 545RAB8B1,150,02
107 IFN + R347RAB8Bof 2.510,05
Tables is 9
α2-induced IRF7 gene expression is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTIRF71,00
107 IFNIRF718,533,32
107 IFN + 545IRF73,420,33
107 IFN + R347IRF719,481,67
163 SOLVENTIRF70,910,02
163 IFN IRF717,161,39
107 IFN + 545IRF72,920,22
107 IFN + R3437IRF723,281,46
175 SOLVENTIRF71,250,10
175 IFNIRF724,650,80
107 IFN + 545IRF72,430,08
107 IFN + R347IRF726,348,61
Table 10
α2-induzirovanna the expression of MARCKS is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTMARCKS1,00
107 IFNMARCKS3,970,09
107 IFN + 545MARCKS1,300,08
107 IFN + R347MARCKS2,990,10
163 SOLVENTMARCKS0,560,01

SampleGeneSredneetazhnye The standard deviation
163 IFNMARCKS2,590,12
107 IFN + 545MARCKS1,550,05
107 IFN + R3437MARCKS4,420,07
175 SOLVENTMARCKS0,410,01
175 IFNMARCKS2,590,06
107 IFN + 545MARCKS0,550,02
107 IFN + R347MARCKS3,380,05
Table 11
α2-ind is carovana the IL6ST gene expression is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTIL6ST1,00
107 IFNIL6ST3,540,60
107 IFN + 545IL6ST2,620,16
107 IFN + R347IL6ST8,190,54
163 SOLVENTIL6ST2,500,58
163 IFNIL6STof 7.690,47
107 IFN + 545IL6ST4,18 0,44
107 IFN + R3437IL6ST13,240,12
175 SOLVENTIL6ST1,370,09
175 IFNIL6STa 7.620,56
107 IFN + 545IL6ST2,950,38
107 IFN + R347IL6ST23,912,77
Table 12
α2-induced gene expression LY6E neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTLY6E 1,00
107 IFNLY6EKZT 19.090,03
107 IFN + 545LY6E3,500,15
107 IFN + R347LY6E12,540,20
107 SOLVENTLY6E1,020,04
107 IFNLY6E13,520,35
107 IFN + 545LY6E4,800,18

SampleGeneAverageThe standard deviation
107 IFN + R347LY6E22,560,35
107 SOLVENTLY6E1,610,15
107 IFNLY6E19,320,68
107 IFN + 545LY6E3,740,00
107 IFN + R347LY6E15,570,44
Table 13
α2-induced gene expression IFIT3 is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTIFIT31,00
107 IFNIFIT338,430,78
107 IFN + 545IFIT3of 6.780,14
107 IFN + R347IFIT342,590,75
163 SOLVENTIFIT30,620,01
163 IFNIFIT325,940,57
163 IFN + 545IFIT34,580,08
163 IFN + R347IFIT344,830,44
175 SOLVENTIFIT31,320,02
175 IFNIFIT335,020,48
175 IFN + 545IFIT35,280,05
175 IFN + R347IFIT329,710,79
Table 14
α2-induced expression of IFIT1 is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTIFIT11,00
107 IFNIFIT180,213,44
107 IFN + 545IFIT113,14 0,02
107 IFN + R347IFIT186,440,57
163 SOLVENTIFIT10,920,03
163 IFNIFIT151,651,21
163 IFN + 545IFIT17,600,05
163 IFN + R347IFIT186,63to 2.67

SampleGeneAverageThe standard deviation
175 SOLVENT IFIT11,470,17
175 IFNIFIT182,982,94
175 IFN + 545IFIT18,400,24
175 IFN + R347IFIT158,501,47
Table 15
α2-induced gene expression HERC5 is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTHERC51,00
107 IFNHERC541,122,87
107 IFN + 545HERC56,290,49
107 IFN + R347HERC555,040,69
163 SOLVENTHERC51,050,07
163 IFNHERC575,810,50
163 IFN + 545HERC57,830,00
163 IFN + R347HERC595,447,79
175 SOLVENTHERC51,190,06
175 IFNHERC574,585,79
175 IFN + 545 HERC56,890,13
175 IFN + R347HERC598,1519,40
Table 16
α2-induced expression of OAS1 gene is neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTOAS11,00
107 IFNOAS115,114,27
107 IFN + 545OAS13,451,03
107 IFN + R347OAS117,823,93
163 SOLVENTOAS10,770,22
163 IFNOAS114,193,14
163 IFN + 545OAS13,050,75
163 IFN + R347OAS1of 22.443,49
175 SOLVENTOAS11,620,38

SampleGeneAverageThe standard deviation
175 IFNOAS122,090,97
175 IFN + 545OAS1 4,040,45
175 IFN + R347OAS115,224,48
Table 17
α2-induced gene expression OAS3 neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTOAS31,00
107 IFNOAS349,0413,74
107 IFN + 545OAS37,030,84
107 IFN + R347OAS376,8817,8213,69
163 SOLVENTOAS30,490,06
163 IFNOAS342,0110,01
163 IFN + 545OAS314,604,53
163 IFN + R3437OAS352,60? 7.04 baby mortality
175 SOLVENTOAS31,270,14
175 IFNOAS337,873,57
175 IFN + 545OAS33,920,06
175 IFN + R347OAS334,912,07
Table 18
α2-induced gene expression RSAD2 neutralized by antibody MEDI-545
SampleGeneAverageThe standard deviation
107 SOLVENTRSAD21,00
107 IFNRSAD2109,6436,65
107 IFN + 545RSAD29,880,32
107 IFN + R347RSAD2107,3235,38
RSAD20,560,11
163 IFNRSAD271,4721,17
163 IFN + 545RSAD24,390,60
163 IFN + R347RSAD2114,5128,63
175 SOLVENTRSAD21,880,43
175 IFNRSAD2126,2722, 95mm

SampleGeneAverageThe standard deviation
175 IFN + 545 RSAD28,430,36
175 IFN + R347RSAD290,977,42

Cm. also 6 (RAB8B), 7 (IRF7), Fig (MARCKS), Fig.9 (IL6ST), figure 10 (LY6E), 11 (IFIT3), Fig (IFIT1), Fig, (HERC5), Fig (OAS1), Fig (OAS3) and Fig (RSAD2) for graphical representations of data on gene expression for each of the 11 genes.

Source interferon = serum of patients with SLE

(a) Neutralization of IFN type I-induced genes antibody MEDI-545 also found in whole blood of healthy volunteers, which was stimulated by serum obtained from patients with lupus. Serum samples receive from patients with SLE, which was analyzed in IFN-bioanalysis. Whole blood taken from healthy donors in heparinized vacuum tubes and MCPC allocate, using a gradient Ficoll centrifugation. Cells MCPC resuspending in quantities of 1×107cells/ml in RPMI medium with 10% fetal calf serum (FCS) and 125 μl of cell suspension contribute to each well of a 24-hole flat-bottomed tablet (1,25×106cells/well). The serum of SLE patients pre-incubated for one hour with the antibody MEDI-545 (0,1, 1, 10 μg/ml), anti-IFN-γ antibody (1 μg/ml) or control antibody (10 μg/ml). The serum of SLE patients who are to MKK to a final concentration of 25% (of 62.5 μl/well). Additional volume of RPMI medium+10% FTS contribute to the wells to obtain a final volume of 250 µl/well. Tablets incubated at 37°C for 4 or 18 hours After incubation of the RNA is collected by the introduction of the 750 ál of Trizol LS in each well. Samples frozen at -70°C prior to RNA extraction. Table 21 presents the blockade antibody MEDI-545 74 IFN type I genes in whole blood of healthy volunteers after stimulation ex vivo serum of SLE patients.

Table 21
Antibody MEDI-545 blocks the overexpression of IFN type I genes in whole blood of healthy volunteers after stimulation ex vivo serum of patients with lupus
ID probeD1 002 545.10D1 004 545.10D1 17021 545.10UniGene IDThe designation of the gene
219211_at-3,1949-4,9995-4,0543Hs.38260USP18
217502_at-3,1886-4,2648-3,0247Hs.437609FIT2
218400_at-3,1235-4,3204-3,9594Hs.528634OAS3
213797_at-3,0752-3,3250-2,5795Hs.17518RSAD2
203153_at-2,8862-4,6545-4,7890Hs.20315IFIT1
242625_at-2,8104-2,9506-2,2214Hs.17518RSAD2
204747_at-2,7900-3,6590-2,9676Hs.47338IFIT3
205483_s_at-2,5237-2,9955-3,1566Hs.458458ISG15
204439_at-2,5133-3,5887-3,5926H.389724 IFI44L
202145_at-2,4809-3,0198-3,5950Hs.521903LY6E
202869_at-2,4582-3,5402-3,2304Hs.524760OAS1
235643_at-2,4535-3,3586-2,9115Hs.489118SAMD9L
219352_at-2,4496-3,5983-3,8692Hs.529317HERC6
204415_at-2,4417-2,5228-2,3149Hs.523847IFI6
219684_at-2,4167-2,8965-2,1421Hs.43388RTP4
236156_at-2,4160-2,5440-2,885 Hs.127445LIPA
205552_s_at-2,3880-3,3679-2,7561Hs.524760OAS1
206133_at-2,3139-3,0772-2,4787Hs.441975BIRC4BP
214453_s_at-2,2965-3,1707-3,3204Hs.82316IFI44
1556643_at-2,2666-2,0429-1,7120Hs.515243LOC93343
228607_at-2,2597-2,1659-2,3234Hs.414332OAS2
218943_s_at-2,2563-2,4118-2,6600Hs.190622DDX58
242020_s_at-2,2542 -2,6436-1,7975Hs.302123ZBP1
204959_at-2,2501-1,3731-1,5559Hs.153837MNDA
226757_at-2,2481-2,9288-2,3984Hs.437609IFIT2
219863_at-2,2465-3,0980-3,8114Hs.26663HERC5
229450_at-2,2281-3,2200-2,2151--
214059_at-3,2929-3,5281Hs.82316IFI44
232517_s_at-2,1925-2,2750-2,4569Hs.517180PRIC285
232666_at-2,125 -1,9206-1,4938Hs.528634OAS3
230036_at-2,1654-3,0256-2,4879Hs.489118SAMD9L
227609_at-2,1548-2,5608-1,1577Hs.546467EPSTI1
226702_at-2,1420-3,0150-3,0155Hs.7155LOC129607
226603_at-2,1183-2,8672-2,4103Hs.489118SAMD9L
210397_at-2,1095-0,5687-2,0322Hs.32949DEFB1
204994_at-2,0685-3,2727-3,6132Hs.926MX2
20086_at -2,0661-3,2741-3,6406Hs.517307MX1
228617_at-2,0596-2,5832-2,3139Hs.441975BIRC4BP
219364_at-2,0583-2,3774-2,4651Hs.55918LGP2
209417_s_at-2,0364-2,5262-2,4132Hs.632258IFI35
222154_s_at-2,0330-2,4542-2,6425Hs.120323DNAPTP6
228230_at-2,0323-2,9621-3,0255Hs.517180PRIC285
242234_at-2,0161-3,0047-3,1633Hs.441975BRC4BP
219519_s_at-2,0077-2,2596-3,1621Hs.31869SIGLEC1
207713_s_at-1,9940-1,0134-1,6345Hs.247280C20 or fl8
218974_at-1,8904-2,5122-2,5244Hs.445244FLJ10159
1552309_a_at-1,8820-2,4284-2,7221Hs.632387NEXN
210873_x_at-1,8424-1,2891-1,2710Hs.348983APOBEC3A

ID probeD1 002 545.10D1 004 545.10D1 17021 545.10UniGene IDThe designation of the gene
243271_at-18388 -2,2657-2,0595Hs.489118SAMD9L
202411_at-1,8385-0,1345-2,4757Hs.532634IFI27
222793_at-1,8137-2,4540-2,6576Hs.190622DDX58
235276_at-1,8007-2,6121-1,4780--
203236_s_at-1,7926-1,9069-2,6425Hs.81337LGALS9
225291_at-1,7801-2,0167-2,4613Hs.388733PNPT1
44673_at-1,7547-0,1337-2,3913Hs.31869SIGLEC1
213294_at/td> -1,7361-2,4393-2,5907Hs.546523-
211122_s_at-1,7296-3,0816-1,5743Hs.632592CXCL11
224701_at-1,6827-1,7880-1,2356Hs.583792PARP14
230314_at-1,6795-2,2159-2,3476Hs.112420-
218986_s_at-1,6648-2,1615-2,0204Hs.591710FLJ20035
205569_at-1,6647-2,5741-2,6878Hs.518448LAMP3
219691_at-1,6420-1,8434-1,8310Hs.65641SAMD9
20421l_x_at-1,6244-2,0612-2,3379Hs.131431EIF2AK2
220146_at-1,6033-2,7419-1,7471Hs.443036TLR7
241916_at-1,6026-1,5906-1,3802Hs.130759PLSCR1
229350_x_at-1,5906-1,7395-1,3577Hs.348609PARP10
1555464_at-1,5866-1,7397-1,3101Hs.163173IFIH1
204972_at-1,5822-2,8402-2,8355Hs.414332OAS2
204698_at-1,5277-1,5978-1,6553 Hs.459265ISG20
203595_s_at-1,4853-1,8724-1,5442Hs.252839IFIT5
220576_at-1,4834-1,7834-1,0040Hs.229988PGAP1
1555491_a_at-1,4739-1,0165-1,4991-FLJ11286
1565752_at-1,4418-0,0040-1,0835Hs.509664FGD2
203596_s_at-1,4389-2,0356-1,9284Hs.252839IFIT5

Analysis of genes uniquely activated after 18 h, reveals increased regulation of genes involved in innate immune is the answer (TLR NFB), adaptive immune response (NFAT, IL-1/IL-6), activation of complement, as well as chemotaxis and leukocyte adhesion. It is possible that the neutralization of type IFN metabolic pathway has the ability to modify downstream metabolic pathways, which can significantly affect the pathogenesis of SLE.

Also analyze Heatmap for studying induction of IFN type I signature in MCPC healthy donor under the influence of the serum of the patient of SLE and neutralization of IFN type I signature antibody MEDI-545. Cm. Fig. Treatment with anti-IFN-α monoclonal antibody (lines 4-6) shows the simple neutralization of a large number of genes stimulated by serum of the patient of SLE. In addition, neutralizing anti-IFN-α monoclonal antibody is dose-dependent, which means that these genes may be good candidates for PD. The control monoclonal antibody itself inhibits the overexpression of certain genes, the regulation of which increases when processing the serum of the patient of SLE; some of them identified as IFN type I-induced genes. However, the effect of anti-IFN-α monoclonal antibodies is much wider and has a strong neutralization observed on a large number of genes for which no control monoclonal antibody or anti-IFN-γ monoclonal antibody, did not show any significant who is Astia (line 2, lines 4-6). It should be noted that the treatment with anti-IFN-αR monoclonal antibody (lane 7) causes a large reduction in comparison with the anti-Ifnα monoclonal antibody, which indicates the presence of other representatives of IFN type I family in the serum of SLE patients in addition to IFN-α.

(b) Conduct additional research to identify early and late responses in the form of transcription in cells MCPC healthy donors after stimulation with serum of the patient of SLE. In this study, four serum samples of SLE patients with different levels of actions Ifnα used to stimulate MCPC isolated from a healthy donor. Varying levels of action of Ifnα in four serum samples of patients with SLE define a method with the use of reporter gene luciferase as described in example 20. Briefly, cells NECN stable transferout design luciferase (Gaussia princeps) under the control of interferon-stimulated element response (IFN-stimulated response element - ISRE). Transfected cells incubated with 50% patient serum, and the luciferase activity detected in supernatant cultures after 24 hours the Samples, generating a signal higher than 1.5x in the wells of negative control (normal sivorda person)is estimated as positive. To determine what class of IFN type I is responsible for a positive response, the cell is treated with monoclonal antibodies against IFN type I and type II IFN. Figa shows the range of activity levels of IFN type I in each of the four serum samples of patients with SLE.

Each of the serum samples of four patients with SLE incubated together with mononuclear cells of peripheral blood (MCPC)isolated from healthy volunteers. MCPC from healthy volunteers (previously defined as having a negative IFN-signature) was isolated using centrifugation in Ficoll density gradient. Selected MCPC incubated with 25% serum of a patient with SLE or 25% autologous patient serum (as a negative control). After incubation, the cells are harvested using Trizol LS and stored at -70°C for RNA extraction. Total RNA is extracted, and the purity and concentration of RNA is determined spectrophotometrically (260/280>1,9). Production and hybridization of the labeled Biotin amplified complementary RNA (crnc) is performed according to the manufacturer's instructions (firm Affymetrix, Santa Clara, Calif.). Data obtained by separation by a factor of three (high regulation) expression upon stimulation with serum of SLE patients compared with the autologous control serum samples (q-value≤0,05). Figb shows the number of probes detected by increased regulation 3 times or more in MCPC healthy volunteers under the influence of each of the four exemplary the serum of SLE patients. The number of probes detected as increased three times or more regulation under the influence of the serum of the patient of SLE, respectively, increases the level of action of IFN type I found in the serum sample of a patient with SLE.

Then examined the role of type I interferons in the induction of increased regulation (three times or more) probes using serum samples of patients with SLE. Cells MCPC isolated from healthy volunteers as described above, were incubated with 25% serum of patients with SLE in the presence or absence of neutralizing antibodies against IFN-α, or irrelevant monoclonal antibodies for 4 or 18 hours as a negative control MCPC incubated with 25% autologous patient serum. After incubation, the cells are harvested using Trizol LS and stored at -70°C for RNA extraction. Total RNA is extracted, and the purity and concentration of RNA is determined spectrophotometrically (260/280>1,9). Production and hybridization of the labeled Biotin amplified complementary RNA (crnc) is performed according to the manufacturer's instructions (firm Affymetrix, Santa Clara, Calif.). Software ArrayAssist® Lite is used to calculate the aggregate-level data probes received the files of intensity matrices and R packages used to identify otherwise regulated genes (three times or more higher re is ulacia expression after stimulation with serum of the patient of SLE compared with control samples autologous serum (q-value≤0,05); firm R Development Core Team, New Zealand). Then determine the percent neutralization of the calculation of the percentage change for each probe increased regulation, after treatment with anti-Ifnα antibody without such processing. Figa is heatmap showing the percent neutralization of the probes that have been identified for increased regulation after treatment with anti-Ifnα for IFN type I genes (689 probes) and non-IFN type I genes (probes, induced by the serum of the patient of SLE and are not included in the list of the IFN type I genes) after 4 and 18 h of incubation. Figb shows for each of the four sera of SLE patients, the percentage of probes with IFN type I gene signature or not-IFN type I gene signature, neutralized by treatment with anti-Ifnα, after 4 and 18 h of incubation. It was found that most genes neutralized by treatment with anti-Ifnα in cells MCPC healthy volunteers treated with serum of the patient of SLE, 4 h after incubation belong to IFN type I genes, although the majority of genes neutralized by obrabotki anti-Ifnα in cells MCPC healthy volunteers treated with serum of the patient of SLE through 18 h after incubation does not belong to the IFN type I genes.

Genes, whether IFN type I genes or not IFN type I genes, the regulation of which was raised and neutralized by treatment with anti-Ifnα after 18 h, but was not increased regulation after 4 h (i.e. "unique who's genes"), identify for each sample of serum from patients with SLE. Fig is (a) IFN type I genes and (b) not-IFN type I genes, which were identified as unique genes. The shaded areas show more than 50% neutralization of anti-Ifnα in this patient sample.

Metabolic pathways and processes in the cell, neutralized by treatment with anti-Ifnα after 18 h, involved in signaling pathways of cytokines and chemokines, immune regulation, cell adhesion and survival of cells. Cm. Fig, which is a table showing the analysis of metabolic pathways altered genes and proteins through 18 including Metabolic pathways, marked in yellow, also significantly altered in the serum samples of patients with SLE. Metabolic pathways and processes in the cell, neutralized by treatment with anti-Ifnα after 18 h, analyzed by integrated software MetaCore company GeneGo, Inc., using the identified unique genes. Only pathways with p values≤0.05 is assessed as significant. Shows the metabolic pathways were altered in at least 2 of 4 serum samples of patients with SLE.

Example 6. Product introduction MEDI-545 patients with lupus will neutralize the pattern of expression of Ifnα-induced PD marker candidates

Whole blood of patients with lupus who received placebo ,3 mg/kg, 1.0 mg/kg and 3.0 mg/kg MEDI-545, analyze the expression of Ifnα-inducible PD markers over the course of 28 days. Whole blood (~2.5 ml) taken in PAXgene tubes for RNA and processed, as described above. With increasing doses of the antibody MEDI-545 is neutralized increased expression regulation 25 of the top PD markers. Cm. Fig, Fig and Fig, which represent graphically the neutralization of these top 25 PD markers after administration of varying concentrations of MEDI-545 Ifnα antibodies for different time. Top 25 PD markers measured in this study are presented in table 19.

Table 19
25 top IFN-induced PD marker in patients with lupus
ID probeUniGene IDGene productThe designation of the gene
202086_atHs.517307Resistance to myxovirus (influenza a) 1, interferon-inducible protein p78 (mouse)MH
202145_atHs.521903Complex lymphocyte antigen 6, lo the condition E LY6E
202411_atHs.532634Interferon alpha-inducible protein 27IFI27
202869_atHs.5247602',5'-oligoadenylate synthetase 1, 40/46 kDaOAS1
203153_atHs.20315Interferon-induced protein with tetratricopeptide repeats 1IFIT1
204415_atHs.523847Interferon alpha-induced protein 6IFI6
204439_atHs.389724Protein similar to interferon-induced protein 44
205483_s_atHs.458485ISG15 ubiquitin-like modifierISG15
205569_atHs.518448Lysosomal-associated membrane protein 3LAMP3
205660_atHs.118633 Protein similar to 2'-5'-oligoadenylate synthetaseOASL
213797_atHs.17518Protein 2, containing the domain of the radical S-adenosylmethionineRSAD2
214059_atHs.82316Interferon-induced protein 44IFI44

ID probeUniGene IDGene productThe designation of the gene
217502_atHs.437609Interferon-induced protein with tetratricopeptide repetitions 2IFIT2
218400_atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS3
219211_atHs.38260Ubiquinone-specific peptidase 18USP18
219519_s_atHs.31869Binding of sialic acid Ig-like lectin 1, sialoadhesin/td> SIGLEC1
219863_atHs.26663hect domain and RLD 5HERC5
222154_s_atHs.120323Decolorata-transactionally protein 6DNAPTP6
226702_atHs.7155Hypothetical protein LOC129607LOC129607
227609_atHs.546467Epithelial-stromal interaction 1 (breast)EPSTI1
229450_at---
235276_at---
239979_atHs.546467Epithelial-stromal interaction 1 (breast)EPSTI1
242234_atHs.441975XIAP associated factor-1BIRC4BP
44673_at Hs.31869Binding of sialic acid Ig-like lectin 1, sialoadhesinSIGLEC1

Neutralization of IFN-induced PD marker antibody MEDI-545 in several patients with lupus research and present findings on Fig-21. Fig and 20 are heatmap on the neutralization of the top 25 PD markers (see table 19) for two specific patients lupus erythematosus (Fig patient 1541 and Fig patient 1449). Each of these patients with lupus have received 3 mg/kg MEDI-545. Each shows the neutralization of the 25 top-inducible PD markers 7 and 14 days after treatment with antibody MEDI-545.

They also examine the neutralization of the top 25 IFN type I-induced genes in whole blood of SLE patients treated by high dose (30 mg/kg) of antibody is MEDI-545. Heatmap neutralization top 25 IFN-type I induced genes 1, 4, 7 and 14 days after the injection of antibody MEDI-545 presented on Fig(a). Neutralization of all genes can be observed after the introduction of MEDI-545. Fig(b) represents AGK target modulation based on the top 25 of IFN type I-induced genes. Chart AGK shows the progression of SLE patient after treatment from the state opposite to the state of normal healthy donors before the introduction of the antibody MEDI-545, to the state in which he concentrates from healthy donors pic the e introduction of MEDI-545.

Neutralization 165 PD markers using antibodies MEDI-545 exploring the additional patients with lupus, which impose a lower dose of antibody (0.3 mg/kg). Cm. Fig. Antibody MEDI-545 will neutralize most of 165 PD marker candidates in patients with lupus. 165 PD marker candidates are shown as the first 165 in tabl.

Neutralization of IFN type I-induced sets of probes not been established in patients with SLE who were treated with placebo as control. Comparison of charts AGK of SLE patients before (a) and after (b) dosing with placebo Fig. Thus, neutralization of IFN type I PD marker is an antibody MEDI-545.

Table. 22 is a list of 63 IFN type I-induced probes, the regulation of which is increased in whole blood of patients with lupus and neutralized by MEDI-545 or placebo by at least 30% on 7 day, 14 day or 28 days after injection. In each set of columns presents data on the neutralization of each of these genes on 7, 14 and 28 days after injection. The first set of columns represents the percentage of neutralization of each of the indicator gene in patients with lupus with IFN type I signature, and those who were treated with antibody MEDI-545. It may be noted that each of these genes neutralization varies from 30% to 68% on day 7 after injection. At the same time on day 7 in group applications Platz is Bo neutralization of the same genes varies from 0% to 27%.

0,3352 0,1569
Table 22
Neutralization 63 IFN type I-induced probes in whole blood of patients with lupus with antibody MEDI-545
The designation of the Gene (IFN type I-induced)ID probeSamples of patients with lupus with IFNAll samples of patients with lupusSamples of patients with lupus without IFNSamples treated with placebo
day 714 day28 daysday 714 day28 daysday 714 day28 daysday 714 day28 days
IFI44214059_at0,68710,62760,50470,34330,2657 0,2357-0,0799-0,2278-0,0088-0,1325-1,91-0,4185
IFI44L204439_at0,66210,61930,55150,66620,55610,4920,67130,46980,43790,007-2,18160,0035
RSAD2213797_at0,65470,6310,52130,60230,46110,44640,53770,22940,3783-0,2332-5,0172-0,9617
G1P2205483_s_at0,63950,59540,57030,54040,47810,148 0,41850,31810,27340,0423-0,9440,1706
RSAD2242625_at0,63590,61230,49460,56070,5410,34430,46810,44370,2077-0,3537-2,7176-0,2632
USP18219211_at0,63050,62690,55770,43220,44230,40820,18820,19070,2723-0,4424-2,4219-0,4972
IFI44214453_s_at0,6260,58750,42230,49560,27410,2298-0,15320,0547-0,2833-1,0524-2,4005
IFIT1203153_at0,62240,60930,53760,54420,45860,41820,4480,25320,3097-0,1604-1,1565-0,436
IFIT3204747_at0,62130,56760,56380,52120,41740,38540,3980,21240,2232-5,9101-9,7543-7,4011
SERPING1200986_at0,6170,62140,59740,46170,42940,3673,2706 0,16760,1582-0,5973-2,7824-0,4193
HERC6219352_at0,5996mean HDI of 0.5310,53520,35810,36780,43350,06090,14520,341-0,9901-4,4468-1,6832
DNAPTP6222154_s_at0,59730,62230,50160,3450,38190,22440,03450,0543-0,02760,028-1,9470,007
OASL210797_s_at0,59680,55290,58150,47150,38530,42080,31740,2748-0,1014-1,6808-0,1344
HERC5219863_at0,59480,55520,49970,46510,45210,38160,30540,31150,2742-0,0955-0,9446-0,1306

td align="center"> 28 days
The designation of the Gene (IFN type I-induced)ID probeSamples of patients with lupus with IFNAll samples of patients with lupusSamples of patients with lupus without IFNSamples treated with placebo
day 714 day28 daysday 714 day28 daysday 714 dayday 714 day28 days
OAS3218400_at0,5890,57920,50620,48460,40390,35620,30650,311-0,0945-1,1786-0,1744
IFRG28219684_at0,5810,52180,49550,30140,30350,2441-0,04270,00580,0155-2,1401-2,8445-3,3644
MH202086_at0,58070,53290,50730,5120,48310,40010,42730,4152 0,3026-0,0951-0,77890,01
OAS1202869_at0,57610,51480,56520,43450,4290,43730,26030,31190,32110,0389-0,62460,0692
OASL205660_at0,56810,55490,54940,48140,44150,40460,37460.28680,2729-0,0675-0,97650,0773
OAS1205552_s_at0,56780,51930,560,47960,41150,41960,37110,26440,292 -0,1562-1,7918-0,395
LAMP3205569_at0,55310,67960,48710,34270,41820,28540,08380,06180,10210,007-1,43320,045
MGC20410228439_at0,5350,50850,50930,3590,2949of 0.3320,14240,00360,1709-1,1629-2,0558-0,5523
SN219519_s_at0,53210,56390,53070,3070,37110,2120,030,1081-0,0778-0,1736 -4,82970,1133
HSXIAPAF1228617_at0,53170,5030,47070,39420,36040,2660,22490,16590,0799-0,2206-0,7607-0,1053
IFIT5203596_s_at0,52570,49220,33140,30040,19970,07230,023-0,1991-0,16330,0791-0,2048-0,1939
IRF7208436_s_at0,51830,4940,47170,43180,35090,3010,32530,15570,14590,1162 -0,27910,2159
EPST11227609_at0,5170,52980,49990,31420,26620,27980,0646-0,09320,07970,0161-1,0185-0,1578
EPST11239979_at0,50740,48030,5530,37380,35270,36740,20930,17860,1987-0,6502-1,8449-0,4975
ETV7224225_s_at0,50570,51010,35960,29650,23890,09850,039-0,1308-0,1389-0,5808-1,3814 -0,6834

-0,1084
The designation of the Gene (IFN type I-induced)ID probeSamples of patients with lupus with IFNAll samples of patients with lupusSamples of patients with lupus without IFNSamples treated with placebo
day 714 day28 daysday 714 day28 daysday 714 day28 daysday 714 day28 days
IFIT5203595_s_at0,50560,47310,29020,24820,22630,028-0,0685-0,1102-0,2105-0,1956 -0,4059-0,6195
HES4227347_x_at0,49980,47460,42660,33770,31410,27030,13830,09530,12830,0775-0,36880,2619
ZC3HDC1218543_s_at0,48120,42740,40760,30580,29350,21090,08980,11090,03210,055-0,17260,1826
C7orf6230036_at0,46360,46650,40250,31140,28480,22990,12410,0370,0730,0287-04023 -0,002
C7orf6226603_at0,45780,42420,34250,2640,15550,17940,0253-0,2110,0312-0,2153-0,8023-0,4988
OAS3232666_at0,45570,36280,48280,31650,24570,33560,14520,0860,2018-0,3754-1,0637-0,0014
OAS2204972_at0,45320,45030,38890,29630,31060,20840,10320,12020,0444-0,1067-0,9025
IFIT2217502_at0,45140,45190,18990,0857-0,039-0,4306-0,3643-0,7083-0,9948-0,7316-0,9653-4,4123
CXCL10204533_at0,44760,46470,2620,18340,19110,1282-0,1418-0,18190,0066-0,1664-0,9562-0,1939
LY6E202145_at0,44630,45820,41130,34040,32940,26120,210,15360,1247-0,4715-1,729
HERC6239988_at0,44490,37260,35960,29510,24020,24330,11080,05960,13760,2771-0,0980,0584
G1P3204415_at0,44210,39140,10180,1520,3129-0,3045-0,2050,2058-0,6738-0,3862-0,3826-0,4763
C7orf624327l_at0,44190,42790,4010,26630,24450,21650,0501-0,00550,04881,E-04-0,24870,116
OAS2206553_at0,43770,37210,29650,30080,23790,18820,13230,05480,0897-0,0861-1,1845-0,2322
APOL6241869_at0,42640,0630,4352-0,0787-0,5482-0,2042-0,7003-1,3816-0,7855-1,0548-2,2250,0949
ZBP1242020_s_at0,42320,4060,37290,07610,12810,2718--0,17990,0954--

The designation of the Gene (IFN type I-induced)ID probeSamples of patients with lupus with IFNAll samples of patients with lupusSamples of patients with lupus without IFNSamples treated with placebo
day 714 day28 daysday 714 day28 daysday 714 day28 daysday 714 day28 days
0,35120,25080,68790,0275
PLSCR1202446_s_at 0,40220,39480,29960,19190,19730,1063-0,0668-0,0719-0,06940,0049-0,5041-0,1826
OAS2228607_at0,39890,36550,33740,27120,21740,16390,1140,01550,0061-0,026-0,5978-0,0611
TRIM6223599_at0,38960,34640,26690,22850,19870,11190,0303-0,0027-0,0289-0,4333-1,2181-0,76
ZCCHC2233425_at,3891 0,42490,39250,25410,29650,28220,0880,1213of 0.182-0,1376-0,4844-0,075
PLSCR1202430_s_at0,38470,38580,2706-0,2032-0,0283-0,1714-0,9268-0,5931-0,5733-0,091-0,5114-0,3841
CLEC4D1552773_at0,37820,20120,1293-0,5127-0,9029-0,5568-1,6091-2,4085-1,1806-0,0151-0,298-0,9965
ECGF1204858_s_at0,24030,29710,31780,16990,00190,2440,0741-0,26650,0637-0,27110,1519
C7orf27233880_at0,36580,35080,28040,29130,2599to 0.1080,19960,136-0,0488-0,4266-0,7606-0,4247
SN44673_at0,36420,33730,37360,23440,25220.14050,07470,1362-0,0714-0,321-1,21050,1766
PRIC285228230_at0,366 0,41310,33630,27010,27310,10740,1550,0822-0,1008-0,5711-0,6313-0,1671
PARP1422470l_at0,36110,37650,37180,27370,28550,22670,16620,16140,0947-0,0715-0,32470,0835
DNAPTP6241812_at0,34480,36720,28960,20480,2134to 0.1080,03250,0037-0,0571-0,134-0,51470,0613
HSXIAPAF1242234_at0,3371 0,37930,10840,15860,1796-0,2285-0,0612-0,0927-0,5347-0,4102-0,73590,0295
TNFAIP6206025_s_at0,3360,35590,32690,19130,19090,11640,0133-0,034-0,0751-0,3457-0,7114-0,2343
LGALS3BP200923_at0,3310,270,2644-0,17640,1032-0,5120,0487-0,111-0,3187

The designation of the Gene(IFN type I-induced) ID probeSamples of patients with lupus with IFNAll samples of patients with lupusSamples of patients with lupus without IFNSamples treated with placebo
day 714 day28 daysday 714 day28 daysday 714 day28 daysday 714 day28 days
0,04570,04340,2857
CKS2204170_s_at0,32150,06040,0634 -0,2323-0,5787-1,1884-0,914-1,4502-2,3265-0,36970.1034-1,5141
STAT2205170_at0,31760,17810,18520,1643-0,0318-0,051-0,0245-0,318-0,26570,0708-0,6738-0,8915
EIF2AK2204211_x_at0,30940,36210,25770,21650,2860,14410,10210,18220,0408-0,2044-0,3038-0,2554

Table. 33 presents the results of a separate study that shows the top 50 genes, neutralized in whole blood of the patient of SLE h is cut to 7 days after treatment with antibody MEDI-545. Only three genes 50 genes, ZCCHC2, REC8L1 and GCLM, not related to IFN-α/β-inducible genes.

Table 33
Tone 50 probes, neutralized in 7 days after dosing in patients with SLE who were treated with MEDI-545
ID probeUniGene IDThe name of the geneThe designation of the geneStandard probes (% neutralization)The final location of the probes
219352_atHs.529317hect domain and RLD 6HERC62277,01
208436's atHs.166120Factor activity regulation of interferon 7IRF72497,52
210797's atHs.118633Protein similar to 2'-5'-oligoadenylate synthetaseOASL2708,23
205483's atHs.458485ISG15 ubiquitin-like modifierISG152735,74
204439_atHs.389724Protein similar to interferon-induced protein 44IFI44L3194,95
219211 atHs.38260Ubiquinone-specific peptidase 18USP183458,66
218543 satHs.12646The family of poly (ADP-ribose) polymerase, a representative 12PARP123472,37
205241_atHs.567405SCO cytochrome oxidase insufficient homolog 2 (yeast)SCO23825,78
204747 atHs.47338Interferon-induced protein with tetratricopeptide repeats 33987,29
219519's atHs.31869Binding of sialic acid Ig-like lectin 1, sialoadhesinSIGLEC14207,210
228230_atHs.517180Receptor-a, activated proliferation peroxisome interacting complex 285PRIC2854373,111
235276 at--4438,712
214059_atHs.82316Interferon-induced protein 44IFI444477,413
222154's atHs.120323Decolorata-transactionally protein 6DNAPTP64531,314

ID probe UniGene IDThe name of the geneThe designation of the geneStandard probes (% neutralization)The final location of the probes
202145 atHs.521903Complex lymphocyte antigen 6, locus ELY6E4618,615
223849_s_atHs.514941Mov10, leukosis virus, Malone 10, homolog (mouse)MOV104691,016
219364 atHs.55918Presumably the ortholog gene D111gp2 mouseLGP24717,417
224503's atHs.114191Zinc finger, SSNS containing domain 2ZCCHC24926,518
228617_atHs.441975XIAP associated factor-1 BIRC4BP4942,019
53720 at-Hypothetical protein FLJ11286FLJ112865046,220
218400 atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS35136,721
235508_atHs.526464Promyelocytic leukemiaPLM5328,722
232155_atHs.514554KIAA1618KIAA16185344,523
202086_atHs.517307Resistance to myxovirus (influenza a) 1, interferon-inducible protein p78 (mouse)MH5484,424
242625 atHs.17518Protein 2, containing the domain of the radical S-adenosyl the Jonas RSAD25522,425
209417's atHs.632258Interferon-induced protein 35IFI355529,426
228439_atHs.124840basic Lazenby zipper transcription factor that is similar to ATF 2BATF25563,027
221766's atHs.10784Family with sequence, close 46, A representativeFAM46A5607,128
202446's atHs.130759Scramblase phospholipids 1PLSCR15911,329
205660_atHs.118633Protein similar to 2'-5'-oligoadenylate synthetaseOASL6001,330
205875's at Hs.344812Repairwoman the exonuclease 3'-end 1TREX16062,031
34689 atHs.344812Repairwoman the exonuclease 3'-end 1TREX16097,032
202869 atHs.5247602',5'- oligoadenylate synthetase 1, 40/46 kDaOAS16101,533

ID probeUniGene IDThe name of the geneThe designation of the geneStandard probes (% neutralization)The final location of the probes
214453's atHs.82316Interferon-induced protein 44IFI446210,434
1555491_s_at-Hypothetical protein FLJ11286 FLJ112866235,735
230036 atHs.489118Protein related protein domain, a sterile alpha motif 9SAMD9L6254,136
222217's atHs.438723The family of 27-soluble carriers (carriers of fatty acids), representative of 3SLC27A36257,937
201641_atHs.118110Antigen stromal bone marrow cells 2BST26371,438
218599 atHs.419259REC8-like (yeast)REC8L16423,339
238327 atHs.531314Glutamate-cysteine ligase, modifier subunitGCLM6500,440
225291_atPolyribonucleotide nucleotidyltransferase 1PNPT16537,641
208581 at xHs.374950Metallothionein 1XMTH6541,442
212380_atHs.520102KIAA0082KIAA00826547,143
227347 at xHs.154029Protein class hairy/enhancer of split 4 (Drosophila)HES46557,344
1557116 atHs.257352Apolipoprotein L, 6APOL66571,145
231769_atHs.464419F-box protein 6FBXO66683,046
200986 atHs.384598Inhibitor serpin PEP is easy, taxon G (C1 inhibitor), member 1, (angioedema, hereditary)SERPING16688,747
33304 atHs.459265Stimulated by interferon gene ectonucleoside 20 kDaISG206853,848
209593_s_atHs.252682Family torsina 1, representative B (torsin B)TOR1B6866,449
202307's atHs.352018A Transporter 1, ATP-binding cassette, subfamily B (MDR/TAP)TAR6909,050

Example 7. The majority of patients with systemic lupus manifests IFN type I-induced variant expression of PD markers

Using sets 169 probes for detecting expression of a number of PD markers analyze gene expression in whole blood specimens 35 patients with lupus, using principal component analysis (AGK). A principal component analysis refers to statistical methods simplify the data set PU is eaten reduce multidimensional databases to lower dimensions for analysis. Spend AGK on the filtered data sets 169 probes), using the statistical analysis in Spotfire. The result of the analysis AGK shows that 24 of the 35 patients with lupus have a statistically significant signature of the PD marker. Cm. the results of the analysis on AGK Fig. Sets 169 probes used in the above analysis AGK, lead in tabl.

Table 20
Gene expression detected using sets 169 probes in 35 patients with SLE
ID probeUniGene IDThe name of the geneThe designation of the gene
1552772_atHs.351811C-type lectin domain family 4, representative DCLEC4D
1554343_a_atHs.435579BCR below in chain the transmitting signal 1BRDG1
1555464_atHs.163173interferon-induced with domain C1 of helicaseIFIH1
1555728_a_atHs.325960 Anchored in the membrane 4-domains, subfamily A, representative 4MS4A4A
1556643_atHs.515243Hypothetical protein VSLOC93343
1557236_atHs.257352Apolipoprotein L, 6APOL6
1559585_atHs.535011Hypothetical protein FLJ31033FLJ31033
200887_s_atHs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT1
200923_atHs.514535Lectin, galactoside-binding, soluble, 3 binding proteinLGALS3BP
200986_atHs.384598Inhibitor serpin peptidases, taxon G (C1 inhibitor), member 1, (angioedema, hereditary)SERPING1
201015_s_atHs.514174associated plakoglobin is n JUP
201324_atHs.436298Protein epithelial membrane 1EMR
201641_atHs.118110Antigen stromal bone marrow cells 2BST2
201646_atHs.349656Receptors-"scavengers" class B, representative 2SCARB2
201761_atHs.469030Methylenetetrahydrofolate dehydrogenase (NADP + dependent) 2, maternityrelated cyclohydrolaseMTHFD2
202086_atHs.517307Resistance to myxovirus (influenza a) 1, interferon-inducible protein p78 (mouse)MH
202145_atHs.521903Complex lymphocyte antigen 6, locus ELY6E

205241_at
ID probeUniGene IDThe name of the gene The designation of the gene
202270_atHs.62661Guanylate binding protein 1, interferon-inducible, 67 kDaGBP 1
202411_atHs.532634Interferon alpha-inducible protein 27IFI27
202430_s_atHs.130759Scramblase-1 phospholipidsPLSCR1
202446_s_atHs.130759Scramblase-1 phospholipidsPLSCR1
202759_s_atHs.591908Protein 2 anchor kinase PRKA protein PALM2-ACARACER PALM2-AKAP2
202863_atHs.369056Nuclear antigen SP100SP100
202869_atHs.5247602',5'-oligoadenylate synthetase 1, weight 40/46 kDaOAS1
203153_atHs.20315Interferon-induced protein with t tetracaine repeats 1 IFIT1
203595_s_atHs.252839Interferon-induced protein with tetratricopeptide repeats 5IFIT5
203596_s_atHs.252839Interferon-induced protein with tetratricopeptide repeats 5IFIT5
203771_s_atHs.488143Biliverdin reductase-ABLVRA
204211_x_atHs.131431The eukaryotic initiation factor 2 broadcast-alpha kinase 2EIF2AK2
204224_s_atHs.86724GTP cyclohydrolase 1 (DOPA-responsive dystonia)GCH1
204326_x_atHs.374950metallothionein 1XMTH
204415_atHs.523847Interferon alpha-induced protein 6IFI6
204439_at Hs.389724Protein similar to interferon-induced protein 44IFI44L
204533_atHs.632586The ligand of the chemokine (motif C-X-C) 10CXCL10
204747_atHs.47338Interferon-induced protein with tetratricopeptide repeats 3IFIT3
204972_atHs.4143322'-5'-oligoadenylate synthetase 2, 69/71 kDaOAS2
204994_atHs.926Resistance to myxovirus (influenza virus) 2 (mouse)MH
205098_atHs.301921Receptor 1 chemokine (C-C motif)CCR1
205099_s_atHs.301921Receptor 1 chemokine (C-C motif)CCR1
205170_atHs.530595Carrier signal and activator of transcription 2, 113 kDaSTAT2
Hs.567405SCO cytochrome oxidase insufficient homolog 2 (yeast)SCO2
205483_s_atHs-458485ISG15 ubiquitin-like modifierISG15
205552_s_atHs.5247602',5'-oligoadenylates 1, 40/46 kDaOAS1
205569_atHs.518448Lysosomal-associated membrane protein 3LAMP3
205660_atHs.118633Protein similar to 2'-5'-oligoadenylate synthetaseOASL
206025_s_atHs.437322The tumor necrosis factor, alpha-induced protein 6TNFAIP6
206026_s_atHs.437322The tumor necrosis factor, alpha-induced protein 6TNFAIP6
206133_atHs.441975XIAP associated the actor-1 BIRC4BP
206332_s_at--interferon gamma-inducible protein 16IFI16
206513_atHs.281898Absent in melanoma 2AIM2
206553_atHs.4143322',5'-oligoadenylate synthetase 2, 69/71 kDaOAS2
206576_s_atHs.512682Molecule adhesion of cells, related carcinoembryonic antigen 1 (glycoprotein bile)SEASON

tr> PGAP1
ID probeUniGene IDThe name of the geneThe designation of the gene
206715_atHs.125962The transcription factor ECTFEC
208087_s_atHs.302123Z-DNA binding protein 1ZBP1
208436_s_atFactor activity regulation of interferon 7IRF7
208581_x_atHs.374950metallothionein 1XMTH
208653_s_atHs.591335CD164 molecule, sialomucinsCD164
208966_x_at-Interferon gamma-inducible protein 16IFI16
209417_s_atHs.632258interferon-induced protein 35IFI35
209498_atHs.512682Molecule adhesion of cells, related carcinoembryonic antigen 1 (glycoprotein bile)SEASON
209593_s_atHs.252682Family torsina 1, representative B (torsin B)TOR1B
210001_s_atHs.50640Suppressor 1 intracellular signal transductionSOCS1
210705_s_atHs.370515Protein 5, containing tripartite motifTRIM5
210797_s_atHs.118633Protein similar to 2'-5'-oligoadenylate synthetaseOASL
210873_x_atHs.348983Enzyme-catalytic polypeptide, corrective mRNA of apoprotein B, related catalytic polypeptide 3AAROUSSA
210985_s_atHs.369056SP100 nuclear antigenSP100
211012_s_atHs.498345Promyelocytic leukemia /// Hypothetical protein LOC161527 /// Related protein-isoform 9 promyelocytes the isoforms of the protein 9PML /// LOC161527/// LOC652671
211456_x_at-Hypothetical protein LOC650610LOC650610
211889_x_atHs.512682Molecule adhesion of cells, related carcinoembryonic ant the gene 1 (glycoprotein bile) SEASON
212185_x_atHs.534330Metallothionein 2AMT2A
212657_s_atHs.81134Receptor antagonist interleukin 1IL1RN
212659_s_atHs.81134Receptor antagonist interleukin 1IL1RN
212845_atHs.98259Protein domain, a sterile alpha motif 4ASAMD4A
213293_s_atHs.501778Protein 22 containing tripartite motifTRIM22
213294_atHs.546523Full length cDNA clone CS0DK002YF13 of HeLa cells Cot 25-normalized of Homo sapiens (human)-
213361_atHs.193842TUDOR domain containing 7TDRD7
213469_atHs.229988GPI deacylase
213797_atHs.17518Protein 2, containing the domain of the radical S-adenosylmethionineRSAD2
214059_atHs.82316Interferon-induced protein 44IFI44
214329_x_atHs.478275The superfamily of tumor necrosis factor (ligand)representative 10SF10
214453_s_atHs.82316Interferon-induced protein 44IFI44
214511_x_atHs.534956Fc fragment of IgG, high affinity Ia, receptor (CD64) /// Fc-gamma receptor I B2 /// close Fc-gamma receptor I, B2, isoform bFCGR1A /// LOC440607 /// LOC652758
216243_s_atHs.81134Receptor antagonist interleukin 1IL1RN
216598_s_atHs.303649The ligand of the chemokine 2 (motif C-C)CCL2
217165__at Hs.513626Metallothionein 1F (functional)MT1F
217502_atHs.437609Interferon-induced protein with tetratricopeptide repetitions 2IFIT2

FLJ20035
ID probeUniGene IDThe name of the geneThe designation of the gene
217933_s_atHs.570791Leucine aminopeptidase 3LAP3
218400_atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS3
218543_s_atHs.12646The family of poly(ADP-ribose)polymerase, a representative 12PARP12
218943_s_atHs.190622DEAD (Asp-Glu-Ala-Asp) box polypeptide 58DDX58
218986_s_atHs.591710Hypothetical protein FLJ20035
219062_s_atHs.631682Zinc finger, SSNS domain containing 2ZCCHC2
219209_atHs.163173interferon-induced with domain 1 of helicaseIFIH1
219211_atHs.38260Ubiquitin-specific peptidase 18USP18
219352_atHs.529317hect domain and RLD 6HERC6
219364_atHs.55918Presumably ortholog D11lgp2 mouseLGP2
219519_s_atHs.31869Binding of sialic acid Ig-like lectin 1, sialoadhesin /// Bind sialic acid Ig-like lectin 1, sialoadhesinSIGLEC1
219607_s_atHs.325960Longest in the membrane 4 domains, subfamily A, representative 4MS4A4A
219684_at Hs.43388Receptor transport protein 4RTP4
219691_atHs.65641Protein domain, a sterile alpha motif 9SAMD9
219863_atHs.26663hect domain and RLD 5HERC5
219885_at-The family of Slaven, representative 12SLFN12
220059_atHs.435579BCR below in chain the transmitting signal 1BRDG1
220576_atHs.229988GPI deacylasePGAP1
221680_s_atHs.272398Variant ets gene 7 (TEL2 oncogene)ETV7-
221816_s_atHs.369039PHD fingernail protein 11PHF11
222154_s_atHs.120323Decolorata-transactivate the p protein 6 DNAPTP6
222631_atHs.443733Phosphatidylinositol 4-kinase type 2 betaPI4K2B
222793_atHs.190622DEAD (Asp-Glu-Ala-Asp) box polypeptide 58DDX58
222816_s_atHs.631682Zinc finger, SSNS domain containing 2ZCCHC2
223167_s_atHs.473370Ubiquitin-specific peptidase 25USP25
223220_s_atHs.518200The family of poly(ADP-ribose)polymerase, representative 9PARP9
223434_at-Guanylate binding protein 3GBP3
223501_at----
223849_s_atHs.514941Mov10, leukosis virus, Malone 10, homolog (mouse)MOV10
224225_s_atHs.272398Variant ets gene 7 (TEL2 oncogene)ETV7
224701_atHs.583792The family of poly(ADP-ribose)polymerase, representative 14PARP14
225291_atHs.388733Polyribonucleotide nucleotidyltransferase 1PNPT1
225415_atHs.518201deltex 3-like (Drosophila)DTX3L
225636_atHs.530595Carrier signal and activator of transcription 2, 113 kDaSTAT2
225834_atHs.599880Hypothetical protein LOC652689 /// Family with sequence, close 72, representative of A /// Proximity to family with sequence, close 72, representative of A /// Proximity to family with sequence, close 72, representative of ALOC652689 /// FAM72A /// LOC653594 /// LOC653820

td align="center"> Domain 22 anchirinah redo
ID probe UniGene IDThe name of the geneThe designation of the gene
225869_s_atHs.502989unc-93 homolog Bl (C. elegans)UNC93B1
226103_atHs.632387Nexion (F actin binding protein)NEXN
226603_atHs.489118Protein domain, a sterile alpha motif 9SAMD9L
226702_atHs.7155Hypothetical protein LOC129607LOC129607
226757_atHs.437609Interferon-induced protein with tetratricopeptide repetitions 2IFIT2
227458_at----
227609_atHs.546467Epithelial-stromal interaction 1 (breast)EPSTI1
227697_atHs.527973 Suppressor signal transmission cytokine 3SOCS3
228152_s_atHs.535011Hypothetical protein FLJ31033FLJ31033
228230_atHs.517180Receptor-a, activated proliferation peroxisome interacting complex 285PRIC285
228439_atHs.124840Basic Lazenby zipper transcription factor that is similar to ATF 2BATF2
228531_atHs.65641Protein domain, a sterile alpha motif 9SAMD9
228607_atHs.4143322',5'-oligoadenylate synthetase 2, 69/71 kDaOAS2
228617_atHs-441975XIAP-associated factor-1BIRC4BP
229450_at---
230036_atHs.489118/td> Protein domain, a sterile alpha motif 9SAMD9L
230314_atHs.112420Transcribed locus, closely related HR Presumably hypothetical protein HR [common chimpanzee - Pan troglodytes]-
231769_atHs.464419F-box protein 6FBXO6
232034_atHs.599821Hypothetical protein LOC203274LOC203274
232155_atHs.514554KIAA1618KIAA1618
232375_atHs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT1
232666_atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS3
233425_atHs.631682Zinc finger, SSNS domain containing 2ZCCHC2
233880_atHs.195642Chromosome 17 open reading frame 27C17orf27
235061_atHs.291000Proteinopathy 1K (containing the domain RRS)RRMC
235112_atHs.533491KIAA1958KIAA1958
235157_atHs.583792The family of poly(ADP-ribose)polymerase, representative 14PARP14
235276_at---
235643_atHs.489118Protein domain, a sterile alpha motif 9SAMD9L
236156_atHs.127445Lipase A, lysosomal acid, cholesterylester disease Wolman)LIPA
236692_at---
238439_atHs.217484ANKRD22
238581_atHs.513726Guanylate-binding protein 5GBP5
238743_atHs.546523Full length cDNA clone CS0DK002YF13 of HeLa cells Cot 25-normalized of Homo sapiens (human)-
239196_atHs.217484Domain 22 anchirinah redoANKRD22
239277_at---
239979_atHs.546467Epithelial-stromal interaction 1 (breast)EPSTI1

ID probeUniGene IDThe name of the geneThe designation of the gene
241812_atHs.120323Decolorata-transactionally protein 6DNAPTP6
241916_at Hs.130759Scramblase phospholipids 1PLSCR1
242020_s_atHs.302123Z-DNA binding protein 1ZBP1
242234_atHs.441975XIAP-associated factor 1BIRC4BP
242625_atHs.17518Protein 2, containing the domain of the radical S-adenosylmethionineRSAD2
242898_at---
243271_atHs.489118Protein domain, a sterile alpha motif 9SAMD9L
44673_atHs.31869Binding of sialic acid Ig-like lectin 1, sialoadhesinSIGLEC1
AFFX-HUMISGF3A/ M97935_3_atHs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT1
AFFX-HUMISGF3A/ M97935_5_at Hs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT1
AFFX-HUMISGF3A/ M97935_MB_atHs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT1

Similarly, using 25 high increase regulation of IFN-induced gene expression in samples of whole blood of patients with lupus and normal healthy donors examined using AGK (principal component analysis). Using AGK has installed approximately 66% of patients with lupus with strong/moderate IFN type I-induced signature. Cm. on figa the results of the analysis of AGK and figb for 25 genes used in the refinery.

Overexpression of genes of IFN type I in whole blood of larger numbers of patients with SLE identified using a set of Affymetrix genome, shown in tabl. Table and Fig provide additional evidence that a high percentage of patients with SLE shows at least twice the overexpression of each gene IFN type I.

Table 23
Overexpression of IFN type I genes in whole blood of patients with lupus.
ID probeThe name of the geneThe designation of the geneThe number of samples, the change in which ≥2% samplesAverage log2 value of the ratio changes
222816_s_atZinc finger, SSNS domain containing 2ZCCHC27079,552,124
204415_atInterferon alpha induced protein 6IFI66776,143,007
217502_atInterferon-induced protein with tetratricopeptide repetitions 2IFIT26573,861,913
235643_atProtein domain, a sterile alpha motif 9SAMD9L6573,862,020
213797_atProtein 2, containing the domain Radik the l S-adenosylmethionine RSAD26270,452,978
214059_atInterferon-induced protein 44IFI446169,323,050
202411_atInterferon alpha-inducible protein 27IFI276068,183,937
204439_atProtein similar to interferon-induced protein 44IFI44L6068,182,847
242625_atProtein 2, containing the domain of the radical S-adenosylmethionineRSAD25967,052,861
214453_s_atInterferon-induced protein 44IFI445967,052,463
203153_at Interferon-induced protein with tetratricopeptide repeats 1IFIT15967,052,034
242234_atXIAP associated factor-1BIRC4BP5967,052,066
203595_s_atinterferon-induced protein with tetratricopeptide repeats 5IFIT55967,051,603
202086_atResistance to myxovirus (influenza a) 1,interferon-inducible protein p78 (mouse)MH5865,911,777
206133_atXIAP associated factor-1BIRC4BP5865,911,803
216243_s_atReceptor antagonist interleukin 1IL1RN58 65,911,278
219863_athect domain and RLD 5HERC55764,711,795
202869_at2',5'- oligoadenylate synthetase 1, 40/46 kDaOAS15663,642,057

Epithelial-stromal interaction 1 (breast)
ID probeThe name of the geneThe designation of the geneThe number of samples, the change in which ≥2% samplesAverage log2 value of the ratio changes
226702_atHypothetical protein LOC129607LOC1296075663,641,797
205483_s_atISG15 ubiquitin-like modifierISG155663,641,979
204747_atInterferon-is induzirovanny protein with tetratricopeptide repeats 3 IFIT35663,641,675
1555464_atInterferon induced with domain 1 of helicase CIFIH15663,641,532
218400_at2'-5'-oligoadenylate synthetase 3, 100 kDaOAS35562,501,932
227609_atEpithelial-stromal interaction 1 (breast)EPSTI15562,501,788
200986_atinhibitor Sarbinowo peptidases, taxon G (C1 inhibitor),SERPING15562,501,503
202145_atComplex lymphocyte antigen 6, locus ELY6E5461,362,242
239979_atEPSTI15461,361,895
205552_s_at2',5'-oligoadenylate synthetase 1, 40/46 kDaOAS15461,361,945
225929_s_atChromosome 17 open reading frame 27C17orf275461,361,054
222l54_s_atDecolorata-transactionally protein 6DNAPTP65360,232,030
205569_atLysosomal-associated membrane protein 3LAMP35360,231,813
205660_atType 2'-5'-oligoadenylate synthetaseOASL5360,231,677
219352_athect domain and RLD 6HERC65259,091,663
210797_s_atType 2'-5'-oligoadenylate synthetaseOASL5259,091,548
241916_atScramblase phospholipids 1PLSCR15259,091,396
208087_s_atZ-DNA binding protein 1ZBP15259,091,438
243271_atProtein related protein domain, a sterile alpha motif 9SAMD9L5259,091,126
219519_s_atSialic acid binding Ig-like lectin 1, sialoadhesinSIGLEC15157,953,019
228617_atXIAP associated factor-1BIRC4BP5157,951,473
202446_s_atScramblase phospholipids 1PLSCR15157,951,307

ID probeThe name of the geneThe designation of the geneThe number of samples, the change in which ≥2% samplesAverage log2 value of the ratio changes
232095_atSPLIT-ROBO Rho GTPase activating protein 2SRGAP25056,821,155
232666_at2'-5'-oligoadenylate synthetase 3, 100 kDaOAS34955,68UAH 1,862
204972_at2',5'-oligoadenylate synthetase 2, 69/71 kDaAS2 4955,681,642
202430_s_atScramblase phospholipids 1PLSCR14955,681,209
224701_atThe family of poly(ADP-ribose) polymerases, representative 14PARP144955,681,098
219211_atUbiquitin-specific peptidase 18USP184854,552,365
206553_at2',5'-oligoadenylate synthetase 2, 69/71 kDaOAS24854,551,582
219684_atReceptor (dynamics) transport protein 4RTP44854,551,534
230000_atChromosome 17 open frame autom what I'm 27 C17orf274753,410,936
44673_atSialic acid binding Ig-like lectin 1, sialoadhesinSIGLEC14753,411,975
203596_s_atInterferon-induced protein with tetratricopeptide repeats 5IFIT54753,411,327
218986_s_atHypothetical protein FLJ20035FLJ200354753,411,091
242020_s_atZ-DNA binding protein 1ZBP14753,411,195
212659_s_atReceptor antagonist interleukin 1IL1RN4753,411,196
228439_at Basic Lazenby zipper transcription factor, such ATF2BATF24652,271,180
226757_atInterferon-induced protein with tetratricopeptide repetitions 2IFIT24652,270,882
225291_atPolyribonucleotide nucleotidyltransferase 1PNPT14652,270,957
206026_s_atThe tumor necrosis factor, alpha-induced protein 6TNFAIP64652,270,942
222858_s_atDouble adapter phosphotyrosine and 3-phosphoinositidesDAPP14652,271,055
208436_s_atFactor activity regulation of interferon 7IRF745 51,141,146

ID probeThe name of the geneThe designation of the geneThe number of samples, the change in which ≥2% samplesAverage log2 value of the ratio changes
217933_s_atLacinova aminopeptidase 3LAP34551,140,807
228152_s_atHypothetical protein FLJ31033FLJ310334551,140,834
230036_atProtein related protein domain, a sterile alpha motif 9SAMD9L4450,001,097
228607_at2',5'-oligoadenylate synthetase 2, 69/71 kDaOAS24450,001,113
218543__at The family of poly(ADP-ribose)polymerase, a representative 12PARP124450,001,111
226603_atProtein related protein domain, a sterile alpha motif 9SAMD9L4450,001,033
204211_x_atThe eukaryotic initiation factor 2 broadcast-alpha kinase 2EIF2AK24450,001,050
235157_atThe family of poly(ADP-ribose)polymerases, representative 14PARP144450,000,940
209417_s_atInterferon-induced protein 35IFI354450,000,957

Based on the observations of different sverkhekspressiya IFN type I genes in patients with SLE, as described above, 21 of IFN type I gene in whole blood patient is with lupus are defined as potentially applicable. Cm. table.

Table 24
Twenty-one potentially sverkhekspressiya IFN type I gene, applicable as FD token.
SampleIFI44IFI27IFI44LONAPTP6LAMP3LY6ERSAD2HERC5IF16ISG15OAS3S1GLEC1OAS2USP18RTP4IFIT1MX1OAS1EPSTMPLSCR1IFRG28
A A1323,673,3423,457,636,757,2528,218,12of 5.537,474,82 5,165,227,143,9415,26to 4.98of 7.75to 6.573,693,71
A A135,314,336,282,804,23the 1.448,14was 2.762,393,443,48of 2.262,632,121,82a 4.832,77to 2.062,48the 3.652,17
A A1310,701,4110,31of 2.512,232,9411,762,521,251.972,63 0,962,382,852,737,392,823,782,972,122,89
A A1637,5530,7128,865,283,944,3035,611,881,85to 3.73of 2.260,923,032,543,7021,922,664,5110,062,483,92
AB A13of 10.72to 4.62of 7.362,42of 1.343,3814,352,073,342,462,55 2,812,172,011,1213,792,322,303,511,401,29
A A134,190,835,32of 2.514,131,277,01of 3.644,67is 3.084,166,382,972,431,464,552,402,022,402,431,41
A A1324,798,2526,4515,7618,1111,3354,5113,72shed 15.3716,0210,79cent to 8.85to 9.577,0723,56by 8.22to 11.5616,51to 5.937,49
A A130,880,960,530,630,650,850,270,390,480,700,250,260,500,961,350,310,770,680,591,451,48
A All0,850,170,670,890,140,360,360,320,180,270,42 0,120,730,430,690,320,230,920,502,970,82
AA1,254,200,832,712,192,820,951,970,701,780,930,452,152,944,700,491,761,541,01a 7.924,96
A All0,7817,780,540,370,40of 2.260,110,280,651,990,280,351,183,440,230,961,650,512,053,50
A A141,535,560,981,902,241,890,821,650,712,890,501,001,64to 1.864,200,391,732,401,238,184,51
S8,93162,6716,2941,434,1335,4914,75there is a 10.035,3431,985,95 13,146,3515,8113,080,6518,8410,759,428,1614,58
S30,64136,3853,1115,25of 6.787,3320,984,886,528,786,28of 6.495,5823,176,5615,64of 6.73which 9.227,103,62of 6.68
S25,99220,8171,1818,138,489,9451,748,774,3212,047,00 6,607,8732.60 high.11,2121,06RS 9.698,0711,63a 7.6210,31
Sis 11.39324,7863,1244,63of 6.7114,9350,6811,587,4622,3711,0323,0511,9063,5610,70to 19.7417,4314,429,625.599,02
_006b0,480,570,470,550,250,730,270,331,200,700,21 0,310,340,380,810,330,380,520,600,370,67
S63,08498,8671,4731,259,75to 25.15124,4317,2612,0130,68to 4.98to 4.6811,9237,9414,2132,7313,9212,20of 14.2814,3611,18
S30,12209,7546,2915,456,6311,0732,358,074,7110,176,77 8,67to 9.5721,008,07of 14.259,04at 9.538,017,837,49
S24,3185,8342,2221,6110,7815,1449,9812,947,2919,2910,907,3410,34MT 18 : 347,8012,478,3211,5812,307,217,03
S26,17160,5330,3457,4132,4529,5845,3635,182,6614,9344,32 25,2827,1051,7426,859,1915,6317,9615,0019,2928,84
S48,84131,9085,6315,28the 7.8510,1757,958,19to 5.218,717,764,5510,1731,2710,4627,358,327,6612,356,33the remaining 9.08
S3,14of 2.21equal to 4.971,841,790,736,652,66of 1.341,021,85 0,741,412,452,693,552,141,323,192,302,31
S21,09256,3048,34be 18.495,749,1835,387,794,9113,136,544,77to 6.6716,584,9118,665,6910,378,295,625,43

td align="center"> 42,37
SampleIFI44IFI27IFI44LONAPTP6LAMP3LY6ERSAD2HERC5IF16 ISG15OAS3S1GLEC1OAS2USP18RTP4IFIT1MX1OAS1EPSTMPLSCR1IFRG28
S71,14177,6097,1741,7211,9528,8298,7616,7510,9727,3318,719,8416,4875,0218,4144,0923,4112,6618,71to 12.5215,63
S75,89362,67158,9630,4716,3317,58113,4417,7016,63 29,097,39of 5.2915,1361,5021,0022,61each holding 21.2519,0618,9312,4619,78
S49,27149,0096,5040,2913,8923,4177,4816,52of 10.2130,406,26of 5.9211,5748,5913,5734,7613,9911,7613,898,6313,38
S100,31153,10123,2146,6925,19quintiles these figures were 19.6395,1217,618,083,388,4514,2158,1512,6020,8014,95203223,7213,2213,85
_10722b7,053,094.152,50of 3.071,822,621,750,611,290,400,581,55and 5.301,563,311,981,874,223,401,54
S49,92189,3647,5632,6311,8424,4550,6215,9815,1912,146,2713.9826,9412,8033,1710,4717,4116,858,4313,63
S32,068,2426,4613,549,786,6341,1412,405,2310,87the 7.658,53by 8.2212,465,3525,7411,90of 5.688,136,335,56
S77,48163,4390,25236,52162,6730,0573,4726,4025,86 193,4535,73130.3128,2371,6323,96of 33.2613,1420.7125,6212,2927,39
S5,390,812,191,360,541,081,150,791,051,420,170,300,881,082,501,431,292,192,022,202,80
S16,15at 7.55of 19.037,333,596,3514,393,881,82 4,883,853,764,75of 7.643,437,764,153,106,322,903,76
S86,5751,9589,4296,0618,3728,43110,3424,7512,0945,5424,2912,4625,6254,2917,1051,0013,8621,6425,98of 14.2817,42
Average23,6730,7126,4615,256,637,3332,358,074,71 8,78to 4.985,166,3512,165,35of 14.25of 6.73of 7.758,13to 5.935,56
Standard28,22101,1040,0025,0212,1411,3738,039,195,9418,76a 7.629,398,0722,108,1715.62 wide7,958,329,276,558,16

The overexpression of these genes identified initially using matrices Affymetrix, confirm with the matrix Fluidigm dynamic. Cm. Fig.

Example 8. Antibody MEDI-545 substantially neutralizes IFN type I gene signature in patients with SLE with severe to moderate IFN type I gene signature

In CL the clinical study of patients identified as having a strong/moderate IFN type I gene signature, weak IFN type I gene signature, or without IFN type I gene signature. These patients are allocated to these groups, based on 149 genes. Table shows the number of patients with lupus enrolled in the clinical study, which were identified in each of these three groups, and shows the treatment Protocol, in which they were received.

Table 25
The distribution of patients on IFN type I gene signature before treatment.
GroupStrong and moderate signatureWeak signatureNo title
RVO1052
0.3 mg/kg501
1 mg/kg222
3 mg/kg321
10 mg/kg4 30
30 mg/kg321
Only27147

Patients with SLE who have established the existence of strong and moderate IFN type I gene signatures, all have an average of 4-fold increased expression of the top 25 most increased regulation of IFN type I genes; average 2-fold increase in the expression of the top 50 IFN type I genes with the highest increased regulation and the percentage of the total genes examined disease, which IFN type I induced, and 3.8. The average fold increase in the top 25 of IFN type I-induced genes for each patient, with a strong/moderate IFN type I signature or weak signature in the research, presented at Fig.

Treatment of patients with SLE of these different groups has allowed to establish that neutralization of IFN type I gene signatures antibody MEDI-545 is specific. Fig(a) shows that the group of patients with SLE with IFN type I gene signature, almost all of the top 39 genes, neutralized to 14 days after treatment with antibody MEDI-545, are the genes of the IFN type I signature (see genes highlighted in yellow; the percentage of inhibition is the s genes of IFN type I signature varies in the range of 30.5-64,7). In contrast, none of the top 39 neutralized genes in patients with SLE receiving placebo, is not the genome of IFN type I signature. Cm. Fig(in). Patients with SLE who have lost IFN type I signature and were treated with antibody MEDI-545, show an intermediate version of neutralization, in which some genes IFN type I signature neutralized. (See Fig(b); yellow color indicates genes IFN type I signature that has been neutralized by 19%-44,9%).

Conduct further division of SLE patients for strong, moderate and weak IFN type I gene signature. Briefly, examine the 25 most highly sverkhekspressiya genes induced by IFN type I, in selected patients with SLE, obtained from ex vivo whole blood of a healthy donor, stimulated serum of the patient of SLE, and the average cratloe change these 25 genes used to construct estimates of IFN type I gene signature for each patient with SLE. Fig shows the distribution of estimates of IFN type I gene signatures 46 profiled patients with SLE. Patients with SLE are divided into 3 groups, based on an assessment of their IFN type I gene signatures: high IFN type I gene signature (score >10), moderate IFN type I gene signature (score 4-10) and weak IFN type I gene signature (score <4).

The selection panel 21 of IFN type I-induced genes in whole blood of patients with SLE

For selection of small Usto the Chiva panel of genes induced IFN type I, which can be used for analysis of the str, the gene panel is cut to 21 gene. For the identification of 21 potential FD and diagnostic marker 807 IFN-α/β-inducible probes identified by stimulation of ex vivo whole blood of healthy donors using ten subtypes of IFN-α (2a, 4B, 5, 6, 7, 8, 10, 14, 16 and 17) and IFN-β, is used as the starting point marker candidates. Whole blood specimens a total of 46 patients with SLE, obtained from a commercial source, and 24 from healthy normal control subjects are used to determine IFN type I-induced probes, the regulation of which is increased in whole blood of patients of SLE patients. 114 sverhagressivnym probes (q≤0.05; ratio of change ≥2) be detected in whole blood of SLE patients are IFN type I-induced, using SAM and FDR.

In order to determine whether sverkhekspressiya IFN type I-induced genes in whole blood of patients with SLE can be neutralized by anti-Ifnα monoclonal antibody mononuclear cells of peripheral blood (MCPC) of healthy donors stimulated ex vivo serum from six individual patients with SLE. Healthy donors previously examined to exclude those donors, who may be a viral infection. Regulation 161 IFN type I-inducer is controlled probes was increased in 2 times or more in MCPC healthy donor after stimulation ≥1 patient serum, the patient of SLE, in which overexpression of these genes supression ≥50% and ≥70% of anti-Ifnα monoclonal antibody and anti-αR monoclonal antibodies, respectively.

The intersection between the specified list of 161 probe and the previously described list of probes 114 is 80 probes. Each of these 80 probes rank and largest multiple of the average change in all SLE patients, and percentage of patients showing change in 2 or more times. Overall, 21 the most common sverkhekspressiya IFN type I-induced gene (these genes are unique in using NetAffx annotation file for the analysis of Affymetrix U133 plus 2,0 array; EST exclude) from the specified ranking leave for the statistical list of probes used to measure PD. Evaluation of IFN type I signature then produce on the average value of these genes (21 genes).

At the specified 21 gene needs to recalculate the threshold values that have been previously established for the classification of SLE patients by response of IFN type I gene signatures (strong, moderate or weak, based on Affymetrix) for lower density platform (analysis based on TaqMan). Method of assessment required for the conversion of the evaluation of IFN type I signature based on the top 25 differently expressed genes (separately for each patient SLE) on the Affymetrix platform for assessment of the IFN type I signature based on 21 gene selected for TaqMan analysis. This method is used to compensate for the 3 major differences between the two platforms: (1) the number of probes used for IFN type I signature (25 genes that are dynamically defined for each patient on the Affymetrix platform, against a list of 21 statistical gene in the study based on TaqMan), (2) differences in sensitivity between the 2 platforms, and (3) scales dynamic ranking for each platform. First, calculate the magnitude of the frequency change (on a scale of log2for 155 type I-induced probes between 35 randomly selected patients with SLE and standard size set to normal healthy controls. The genes with the top 25 times larger values are determined for each patient on the Affymetrix platform (this set of genes can vary from patient to patient, depending on what kind of IFN type I-induced genes is expressed at the highest level). Then the average fold change calculated from the top 25 genes for each patient with SLE. The same calculation is carried out with the same patients, using statistical 21 gene research, based on TaqMan-based. This set of genes identified for each patient, and the average fold change is calculated, preferably based on 21 gene, but not at 25 dynamic genes on platforms the Affymetrix. Then create a simple regression model using these two vectors of equal length (35 value fold change), and the coefficients of this model are used to calculate the conversion factor (from platformy Affymetrix for research-based TaqMan) for values of threshold response, on the basis of SLE patients are divided into categories of IFN type I gene signatures: strong (>10 by Affymetrix; >of 5.53 on TaqMan), moderate (between 4 and 10 by Affymetrix; between 1,91 of 5.53 and by TaqMan) or low (<4 Affymetrix; <1,91 by TaqMan). Using the separating threshold value to stratify patients signature (i.e. the average fold changes), which were counted at 21 gene by a method based on TaqMan, compare with the same value from the top 25 with increased regulation of IFN type I-induced genes.

The prevalence and fold change (expressed in log2) 21 IFN-α/β-inducible gene in whole blood from 111 patients with SLE presented below in table.

The name of the gene 66,40
Table 32
The distribution and frequency changes in the expression of 21 gene induced by Ifnα/β in whole blood of patients with SLE
ProbeThe value of QRatioDistributionThe designation of the gene
204415_atqv<1e-169,3878,20Interferon alpha induced protein 6IFI6
213797_at2.67E-128,2771,80Protein 2, containing the domain of the radical S-adenosylmethionineRSAD2
214059_at7.18E-14to 7.9370,90Interferon-induced protein 44IFI44
204439_at5.85E-126,4569,10Protein, similar interferon-induced protein 44IFI44L
20241l_at6.35E-1214,4267,30Interferon alpha-inducible protein 27IFI27
202086_at1.09E-093,26Resistance 1 myxovirus (influenza virus), interferon-inducible protein p78 (mouse)MH
203153_at3.90E-073,5265,50Interferon-induced protein with tetratricopeptide. repetitions 1IFIT1
219863_at8.05E-11with 3.2764,50hect domain and RLD 5HERC5
205483_s_at1.23E-133,7163,60ISG15 ubiquitin-like modifierISG15
205569_atqv<le-163,9162,70Lysosomal-associated membrane protein 3LAMP3
218400_at1.01E-10the 3.6562,702'-5'-oligoadenylate synthetase 3, 100 kDaOAS3
202869_at4.95E-11of 3.7761,802',5'-oligoadenylate synthetase 1, 40/CDOAS1
227609_at7.41E-103,1660,90Epithelial-stromal interaction 1 (breast)EPSTI1
204747_at9.78E-113.04 from60,90Interferon-induced protein with tetratricopeptide repeats 3IFIT3
202145_atqv<le-164,6560,90Complex lymphocyte antigen 6, locus ELY6E
204972_atqv<le-163,0658,202',5'-oligoadenylate synthetase 2, 69/71 kDaOAS2
241916_at6.29E-072,4656,40Phospholipid is scramblase 1 PLSCR1
44673_atqv<le-163,9155,50Binding of sialic acid Ig-like lectin 1, sialoadhesinSIGLEC1

ProbeThe value of QRatioDistributionThe name of the geneThe designation of the gene
219211_at2.54E-13a 4.8355,50Ubiquitin-specific peptidase 18USP18
219684_at2.75E-072,4750,00Receptor (dynamics) transport protein 4RTP4
241812_at5.25E-071,8438,20Decolorata-transactionally protein 6DNAPTP6

Specified 21 gene neutralize dose of C is independent way using antibody MEDI-545. Cm. Fig and 89. Heatmap (figa) and ASC payments (figb) using the specified 21 gene show neutralization of increased regulation of IFN α/β gene signature in patients with SLE after application of MEDI-545 in the amount of 30 mg/kg, but not in patients with SLE after application of placebo (Fig). Thus, it is proved that these genes can be used as a set of FD token.

The separation of the 35 patients in the intensity of IFN type I gene signature using the 21-gene

Fig shows the separation of the 35 patients with SLE into groups with high (20 patients), moderate (8 patients) and weak (7 patients) IFN type I gene signatures based on the distribution of values of the ratio of change scale (log2all 21 of IFN type I-induced genes and divided into each group by the average fold change of the specified distribution 21 gene in each patient (vertical dotted line), from measurements of the dynamic analysis of Fluidigm. From Fig follows that the distribution of each patient manifests a slight difference in the slope line and in the main form that reflects the diversity of different levels of severity of SLE patients, based on selected 21 type IFN-induced gene. In the graph AGK for all patients with SLE, profiled in this study (n=100)and 24 control samples from healthy individuals using 21 IFN type I-inducere the th gene, see a clear distinction between SLE patients with sverkhekspressiya IFN type I gene signature and with weak or undetectable IFN type I gene signature (pigv). In addition, patients with SLE with weak and undetectable IFN type I gene signatures combine together with healthy donors. It is important that the separation between these groups, using a panel of 21 gene IFN type I-induced genes, similar to the separation obtained with the larger set, consisting of 114 genes (figa and 81B).

Example 9. Multiple IFN type I subtypes have increased regulation in whole blood of SLE patients

To identify subtypes of IFN type I, responsible for the induction of IFN type I signature of SLE patients, measure the mRNA levels of IFN type I genes in whole blood of the patient of SLE.

Analysis of gene expression performed using TaqMan Low Density Array (TLDA) the company Applied Biosystems. The expression of subtypes of IFN type I α 1, 2, 5, 6, 7, 8, 14, 17 and 21 are subjected to monitoring and comparing whole blood in patients with SLE relative to healthy volunteers.

Double-strand cDNA of each sample of the patient's pre-amplified using a set of TaqMan PreAmp Master Mix kit (firm Applied Biosystems). Pre-amplified cDNA, spending 10 cycles of PCR in each of the samples obtained from patients using a combined solution of the primer pair for each gene studied on h is ne. Pre-amplified cDNA diluted 1:5 in THOSE. Volume 50 μl of the diluted pre-amplified cDNA bring in 50 μl of a mixture of 2× TaqMan Universal PCR Master Mix, Applied Biosystems) and stirred. Chip load mixture using standard techniques, and loaded the chip is passed through a fast real-time PCR NT (firm Applied Biosystems). Data analysis the obtained Ct values is carried out with the use of the software product SDSv2.2.2 (firm Applied Biosystems).

Fig shows the relative overexpression of mRNA nine subtypes of Ifnα in whole blood of patients with systemic lupus relative to healthy volunteers. Regulation many of the subtypes of Ifnα raised at the level of mRNA in whole blood of patients with SLE.

Fig shows that genes β, ω and AR1 and AR2 also sverkhekspressiya in whole blood of patients with systemic lupus relative to healthy volunteers.

Fig shows that regulation of transcripts of TNF-α, IFN-γ, IFN-γR1 and IFN-γR2 also increased in whole blood of patients with SLE (Fig). However, the relative importance of overexpression of these transcripts is less than the value of the representatives of the IFN type I family, especially subtypes of IFN-α.

Example 10. Ex vivo IFN-stimulated whole blood and keratinocytes of healthy individuals identify a panel of IFN type I-induced genes important for psoriasis.

For ID manually the requirements of IFN type I-induced genes sverhagressivnym in keratinocytes from damage in patients with psoriasis, whole blood and keratinocytes of healthy donors stimulated ex vivo with a panel of Ifnα subtypes, as well as β, γ and α.

Whole blood

Whole blood collected from healthy donors in heparinized tubes. The total volume of blood obtained from each donor, placed in one culture flask and 3 ml of total bring in a separate well of a 6-hole tablet for cultivation. Individual wells with blood then subjected to various processing, including: solvent (1x FSB), the panel of Ifnα subtypes (α2a, -4b, -5, -6, -7, -8, -10, -16, -17), β, ω, λ, γ, leukocyte IFN, or α. After processing the blood gently mixed with a pipette and incubated at 37°C in an atmosphere of 5% CO2within 4 h (processing α performed within 2 h, and 4 h). After a period of incubation of 2.5 ml of whole blood is transferred into a test tube PAXgene RNA and overturn 8-10 times. The PAXgene tubes incubated at room temperature for two hours and then frozen (-20°C during the night, -70°C for prolonged storage period) until the next use. Induction of gene expression by the conditions of the processing is carried out using the chip Affymetrix GeneChip®human genome U133 plus v2.0.

Different Ifnα subtypes and β 900-1200 probes installed for increased regulation of at least 2 times. Of these, 689 zones is s (approximately 1.3% of all sets of probes on the chip Affymetrix human genome U133 plus v2.0) uniformly increased regulation at least 2 times all donors all ten Ifnα subtypes and β. Using the same approach, 336 sets of probes reveal reduced regulation of Ifnα/β in the stimulated ex vivo whole blood.

Changes in gene expression in whole blood of healthy individuals, stimulated α also see and after 2 h and after 4 h of All regulation, all 234 and 72 sets of probes is increased and decreased, respectively, at least two times in all donors. In addition, γ sample of whole blood for 4 h induces increased regulation 304 sets of probes and reduced regulation 52 sets of probes at least 2 times. A small overlap is observed in the sets of probes, regulation which increased Ifnα/β and α (40 probes). On the contrary, the increased overlap observed in sets of probes, regulation which increased Ifnα/β and γ. Regulation 198 probes is increased at least 2 times under the influence and Ifnα/β, and γ. 198 probes, the regulation of which is increased at least 2 times under the influence and Ifnα/β, and γ, the value of increased regulation under the action of Ifnα/β above approximately 2/3 of these probes (p-value less than 0.05) compared with γ.

Fig shows a hierarchical clustering 1384 sets of probes, different regulirovaniya or Ifnα/β, or γ, or α in stimulated ex vivo whole blood. Such a hierarchical clustering similar response of whole blood to the introduction of a confirmation Ifnα the surface and β can be easily installed, as can be close, but very different effect γ from Ifnα/β and dramatically excellent effect α from Ifnα/β.

Figa shows a hierarchical clustering of the relative expression of only the top 25 of IFN type I-induced sets of probes detected in whole blood stimulated ex vivo.

Keratinocytes

Normal human keratinocytes (EpiDerm system, the firm MatTek, Inc.) grown in the absence of serum according to the manufacturer's instructions. Briefly, keratinocytes supported in the tissue culture inserts on the surface of the air-liquid to maintain a multi-layered, fully differentiated epithelial phenotype. Keratinocytes stimulate leukocyte IFN person (15, 50, 150, Honey/ml, the firm PBL Biomedical Labs), α2 person (15-350 Miu/ml, the firm PBL Biomedical Labs), recombinant α man (0.1 ng/ml, company R+D Systems) or recombinant γ man (3 ng/ml, company R+D Systems). Epidermal cultures harvested after 2, 4 or 18 h after treatment for analysis of the transcripts. More than 100 sets of probes identified as sverhagressivnym in cultures of keratinocytes stimulated α2 and leukocyte IFN person.

Figb shows a hierarchical clustering of the relative expression 25 IFN type I-induced genes in stimulated ex vivo keratinocytes. 25 IFN type I-induced sets of probes used DL is receiving a hierarchical clustering of the top 25 IFN type I-induced probes, detected in stimulated ex vivo whole blood (see figa). Many of the top 25 IFN type I-induced sets of probes in ex vivo stimulated whole blood is also induced in stimulated ex vivo keratinocytes. See, for example, MH, IFI27, OAS1, IFI6, IF144L, etc.

In addition, many of these genes are among the most sverhagressivnym genes in the affected skin of patients with psoriasis. Cm. discussion in example 11 below.

Example 11. Profiling matrices whole genome reveals Ifnα/β signaling metabolic pathway as the most significantly activated metabolic pathways in the affected skin of patients with psoriasis.

Conduct a comparison of the profiles of gene expression in skin samples from healthy donors and paired undamaged/damaged skin samples of patients with psoriasis to identify signatures of gene expression induced by a type-1 interferon associated with skin lesions of psoriasis. In short, get skin samples from 21 normal healthy control donor (5 samples obtained from the company Biochain, 14 received from the company ILSbio, and 2 from the laboratory of Dr. James Krueger) and 26 paired undamaged/damaged skin samples from 24 patients with psoriasis (21 pairs obtained from the company Asterand, and 5 from the laboratory of Dr. James Krueger). Get three additional the additional sample of damaged skin from three patients with psoriasis. These 3 additional sample of damaged skin has lost undamaged pair sample of the skin, because the sample intact skin or do not give sufficient crnc for hybridization, or scanning the matrix for sample intact skin has a high conversion rate that exceeds the standard in more than three times.

Total RNA extracted from samples using a set of Qiagen RNAeasy Mini (Hilden, Germany). The purity and concentration of the extracted RNA determined spectrophotometrically (260/280>1,9). The quality of RNA is evaluated on the analyzer Agilent 2100 Bioanalyzer using the RNA 6000 Nano LabChip®. Getting labeled Biotin amplified crnc from 2 µg total RNA is performed using the set for synthesis of cDNA Affymetrix GeneChip®One-Cycle and set for applying labels the Affymetrix GeneChip®IVT. The concentration and purity of the product crnc determined spectrophotometrically.

20 μg of each labeled with Biotin crnc segments for hybridization on arrays Affymetrix GeneChip®human genome U133 plus v2.0. Fragmented crnc prepared for hybridization according to the instructions in the manual Affymetrix GeneChip®. The hybridization is carried out overnight in the model 320 rotary furnace for hybridization installed on a temperature of 45°C. All GeneChip®washed and stained on the installation Affymetrix Model 450 Fluidics station. Matrix to scan the t in the scanner, Affymetrix GeneChip ®Scanner 3000. Data collection and initial assessment of the condition of the matrix is performed using software GeneChip Operating Software (GCOS).

Software ArrayAssist®Lite company Stratagene (La Jolla, Calif.) is used to calculate the total level probes (algorithm normalization GC-RMA) files matrices CEL. The package R (R development) samr & qvalue is used for producing differently regulated genes. AGK and hierarchical clustering performed using and SpotFire and R (R development). SAM & FDR use to select different regulated genes (pair-wise comparison between damaged and undamaged damaged skin and normal skin, and intact and normal skin). Sets of probes with a fold change of at least two times, and the value of q is less than or equal to 0.05 are considered as differently regulated. AGK and hierarchical clustering performed in SpotFire, and in bioconductor R.

In General, the regulation 1408 sets of probes is increased and 1465 sets of probes lowered into the damaged skin compared with skin without ulcers. Although genes with reduced regulation exceeds the number of genes with increased regulation in the damaged skin, the magnitude of the differential regulation of genes with increased regulation is much higher in General. For example, regulation 318 sets of probes is increased at least four times the damage is given to the skin, although the regulation only 84 sets of probes lowered at least 4 times in the damaged skin. Among them regulation 96 sets of probes is increased at least eight times in the damaged skin, although the regulation only six sets of probes lowered at least eight times.

463 sets of probes with increased regulation and 489 sets of probes with reduced regulation in intact skin compared with normal skin. Fig shows a Venn diagram of the sets of probes with increased (or decreased) regulation in the damaged skin and intact skin compared with normal skin of healthy people. Only 70 of 1408 sets of probes with increased regulation in the damaged skin also have increased regulation in intact skin. However, only 43 of 1465 sets of probes with reduced regulation in the damaged skin also possess reduced regulation in intact skin. These data indicate that molecular processes and biological changes in povrejdeniy skin compared with intact skin, significantly different from molecular processes and biological changes which are normal skin relatively intact skin.

To identify the most statistically significant metabolic pathways altered in psoriasis, the list of different adjustable lighting angle is the most genes are subjected to GeneGo for the analysis of metabolic pathways and networks. In short, the analysis of metabolic pathways and networks is performed with integrated software MetaCore™ from the company GeneGo, Inc. (St. Joseph, Michigan). Significance obtained for a specific metabolic pathways and networks, almost corresponds to the hypergeometric distribution, and the p-value substantially corresponds to the probability of a random mapping of a particular set of genes, receiving the number of genes in the set of all genes on the maps of metabolic pathways, gene map of a specific metabolic pathways and genes in the experiment.

Fifty-seven signaling pathways significantly altered in skin lesions compared with intact skin, most of whom are involved in immune response and cell cycle. Signal the metabolic pathway of Ifnα/β greatest way changed in the damaged skin with p-value=3,8×10-13. Representatives of signaling pathways Ifnα/β, for example, Ifnα, β, AR1, AR2, STAT1, IRF1, MPL, ISG15, IFI6, all were largely sverkhekspressiya in damaged skin compared with unaffected skin.

Overall, 22 of the signaling pathways activated and 37 signaling pathways ingibirovany (p<0.05) in damaged skin compared with intact skin. All activated estimated signal metabolizes the e path are or cytokine-, or chemokine-mediated signaling and metabolic pathways or involved in immune responses. For example, signaling pathways γ, α and oncostatin M are activated in the damaged skin of patients with psoriasis. Of all the signaling pathways that are changed in the damaged skin and intact skin, signaling the metabolic pathway of Ifnα/β tops the list with a value of p=6,6×10-26(Fig). Components of the metabolic pathway, for example, Ifnα subtypes, as well as β, AR1, AR2, STAT1, IRF1, MPL, ISG15, IFI6 substantially sverkhekspressiya in damaged skin compared to the intact skin of patients with psoriasis.

Using the list of sets of probes, for which it is established that they IFN type I-induced in whole blood and in keratinocytes in research on stimulation ex vivo (example 10), 164 from 1408 (approximately 11.7%) sets of probes with increased regulation in the damaged skin relatively intact skin identified as IFN type I-induced. Fisher's exact test calculates the p-value (one-sided criterion t-test), constituting less than 0,0001, hence the observed overexpression of IFN type I genes in the affected skin of patients with psoriasis is statistically significant. IFN type I-induced genes are also many of the genes with the most advanced controllers what s in the damaged skin relatively intact skin psoriasis. 19% of the top 100 and 200 sets of probes with the increased regulation in the damaged skin relatively intact skin are the genes of the IFN type I. Cm. figa and b for the top 100 genes with increased regulation in the damaged skin. These genes include STAT1, a key component in the formation of the ISGF3 complex; IRF7, the main controller Ifnα/β mediated immune response; MYD88 gene that directs the induction of CD8+T-cell responses with IRF7; IRF1, activator of gene transcription of IFN type I; representatives of the OAS1, OAS2, OAS3 family OAS, mediators of resistance to viral infection; ISG15, a ubiquitin-like protein that becomes conjugated to many cellular proteins upon activation under the action of Ifnα/β; and representatives of signaling pathways ISG15, for example, USP18, UBE2L6 and HERC5. This expansion of IFN type I genes represents them as the most sverhagressivnym genes in the affected skin of patients with psoriasis.

Table lists in descending order of 50 top 50 IFN-induced probes in the damaged skin compared with intact skin in patients with psoriasis. Table not only compares the fold change based on log2 (log2 fc) and the q-value for each of the 50 greatest increased regulation of IFN type I-induced genes in the damaged skin relative to the intact skin of patients with psoriasis, but also compares based on log2 fold change and q-value for these 50 genes in intact skin of patients with psoriasis relatively healthy control patients.

Table 26
The frequency of increased regulation of the top 50 IFN type I-induced probes in the damaged skin compared to the intact skin of patients with psoriasis
ID probeUnigen IDThe name of the geneThe designation of the geneComparison of damaged skin with intactComparison of intact skin with normal
Log2 fcThe value of qLog2 fcThe value of q

Hs.l 18633
ID probeUnigen IDThe name of the geneThe designation of the geneComparison of damaged skin with intact Comparison of intact skin with normal
Log2 fcThe value of qLog2 fcThe value of q
219403_s_atHs.44227HeparanaseHPSE4,5984.46E-220,2260,23589
204972_atHs.4143322',5'-oligoadenylate synthetase 2, 69/71 kDaOAS24,0988.57E-140,0960,28896
205660_atHs. 118633Type 2'-5'-oligoadenylate synthetaseOASL4,0301.34E-120,0290,20341
227609_atHs.546467Epithelial stromal interaction 1 (breast)EPSTI14,0021.14E-14-0,254 0,10796
227458_at---3,8599,31E-14-0,5910,05449
219352_atHs.529317hect domain and RLD 6HERC63,8429,49E-16-0,4600,04810
216834_atHs.75256Control signal G protein 1RGS13,8092,47E-17-5,2690,00000
204533_atHs.632586The ligand of the chemokine (motif C-X-C) 10CXCL103,6972,97E-120,3380,13024
226702_atHs.7155Hypothetical protein LOC129607LOC1296073,5722,37E-16 -0,1560,26500
242625_atHs.17518Protein 2, containing the domain of the radical S-adenosylmethionineRSAD23,4031,65E-12-0,0700,31309
213797_atHs.17518Protein 2, containing the domain of the radical S-adenosylmethionineRSAD2amounting to 3.2433,36E-100,0040,36209
202086_atHs.517307Resistance to myxovirus (influenza a) 1, interferon-inducible protein p78 (mouse)MH3,2355,28E-140,0500,33453
205552_s_atHs.5247602',5'-oligoadenylate synthetase 1, weight 40/46 kDaOAS13,2222,41E-140,3280,13669
210797_s_atType 2'-5'-oligoadenylate synthetaseOASL3,2161,63E-090,0050,34940
204439_atHs.389724Protein similar to interferon-induced protein 44IFI44L3,2054,73E-130,1200,30073
202411_atHs.532634Interferon alpha-inducible protein 27IFI273,1654,81E-12-0,1540,26878
202869_atHs.5247602',5'-oligoadenylate synthetase 1, weight 40/46 kDaOAS13,1502,47E-140,2480,21403
205483_s_atHs.458485ISG15 ubiquitin-like modifierISG153,088 4,37E-13-0,2730,11013
209969_s_atHs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT12,9937,95E-170,1990,20072
22853l_atHs.65641Protein domain, a sterile alpha motif 9SAMD92,8465,24E-14-0,0330,35359
204415_atHs.523847Interferon alpha-induced protein 6IFI62,7697,23E-09-0,0450,29074

ID probeUnigen IDThe name of the geneThe designation of the geneComparison of damaged skin with intactWith Auntie intact skin with normal
Log2 fcThe value of qLog2 fcThe value of q
214453_s_atHs.82316Interferon-induced protein 44IFI442,6791,94E-120,0860,32618
222838_atHs.517265Representative 7 family SLAMSLAMF72,6591.60e-16-0,0460,31222
219684_atHs.43388Receptor (dynamics) transport protein 4RTP42,6493,73E-110,4970,04912
203127_s_atHs.435661Serine palmitoyltransferase, subunit of long chain bases 2SPTLC22,6281,04E-20 -1,0160,00017
205569_atHs.518448Lysosomal-associated membrane protein 3LAMP32,5692,64X-090,2930,22865
219691_atHs.65641Protein domain, a sterile alpha motif 9SAMD92,5591,30E-130,0110,37349
223220_s_atHs.518200The family of poly(ADP-ribose)polymerase, representative 9PARP92,5531,08E-150,0690,31416
AFFX-HUMISGHs.565365Carrier signal and activator of transcription 1, CDSTAT12,5251.64e-100,7060,03338
212268_atHs.381167 Inhibitor Sarbinowo peptidases, taxon B (ovalbumin), member 1SERPINB12,5103,02E-15-0,6050,07749
216202_s_atHs.435661Serine palmitoyltransferase, subunit of long chain bases 2SPTLC22,5071,17E-13-0,6820,01693
229450_at---2,4921,50E-140,2240,20674
208436_s_atHs.166120Factor activity regulation of interferon 7IRF72,4486,90E-15-0,5780,01612
AFFX-HUMISGHs.565365Carrier signal and activator of transcription 1, 91 kDaSTAT12,444 3,03E-100,5160,05854
204747_atHs.47338Interferon-induced protein with tetratricopeptide repeats 3IFIT32,4242,15E-140,3650,07219
229390_atHs.381220Hypothetical protein LOC441168RP1-93H18.52,4002,59E-12-0,3690,11426
218400_atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS32,3973,83E-140,1790,11631
235276_at---2,3863,61E-150,0570,32771
203153_atHs.20315Interferon-ind the new protein with tetratricopeptide repeats 1 IFIT12,3511,17E-100,0540,34454
210873_x_atHs.348983Enzyme-catalyticAROUSA2,3481,35E-07-0,0480,30119

204698_at 2,205
ID probeUnigen IDThe name of the geneThe designation of the geneComparison of damaged skin with intactComparison of intact skin with normal
Log2 fcThe value of qLog2 fcThe value of q
polypeptide, corrective mRNA of apoprotein B, related catalytic polypeptide 3A
Hs.459265Stimulated by interferon gene ectonucleoside 20 kDaISG202,3371,50E-12-0,6440,05052
232666_atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS32,2364,50E-100,0770,04816
222881_atHs.44227HeparanaseHPSE2,2303,47E-150,2210,17127
205241_atHs-567405SCO cytochrome oxidase insufficient homolog 2 (yeast)SCO22,2081,90E-17-0,2850,08517
AFFX-HUMISGHs.5653675Carrier signal and activator of transcription 1, 91 kDaSTAT15,29E-100,3970,10218
206553_atHs.4143322',5'-oligoadenylate synthetase 2, 69/71 kDaOAS22,1831,34E-090,0430,14755
207387_s_atHs.1466GlycerokinaseGK2,1609,38E-140,0140,37488
219716_atHs.257352Apolipoprotein L, 6APOL62,1233,03E-11-0,1260,19251
202270_atHs.62661Guanylate binding protein 1, interferon-inducible, 67 kDaGBP 12,1134,67E-14-0,0530,31367

Removing EST, hypothetical proteins and gene duplications in the result is the identification of sets of multiple probes presented in tabl. Table is in descending order of the top 50 genes with the highest increased regulation of IFN type I in the damaged skin compared with intact skin. For genes identified by more than one set of probes, lead probe set identified as having the highest regulation.

Table 27
Top 50 IFN type I-induced genes in the damaged skin compared to the intact skin of patients with psoriasis
ID probeUnigen IDThe name of the geneThe designation of the geneLog2 fcThe value of q (fdr)% prevalence
219403_s_atHs.44227HeparanaseHPSE4,604.46E-22100
204972_atHs.4143322',5'-oligoadenylate synthetase 2, 69/71 kDaOAS24,108,57E-14 96,15
205660_atHs.118633The enzyme related 2'-5'-oligoadenylate synthetaseOASL4,031.34E-1296,15

ID probeUnigen IDThe name of the geneThe designation of the geneLog2 fcThe value of q (fdr)% prevalence
2276099_atHs.546467Epithelial stromal interaction 1 (breast)EPSTI14,001.14E-1492,31
219352_atHs.529317hect domain and RLD 6HERC63,849,49E-1696,15
216834_atHs.75256Control signal G protein 1RGS13,81100,00
204533_atHs.632586The ligand of the chemokine (motif C-X-C) 10CXCL103,702,97E-12100,00
242625_atHs.17518Protein 2, containing the domain of the radical S-adenosylmethionineRSAD23,401,65E-1288,46
202086_atHs.517307Resistance to myxovirus (influenza a) 1, interferon-inducible protein p78 (mouse)MH3,245,28E-1492,31
205552_s_atHs.5247602',5'-oligoadenylate synthetase 1, weight 40/46 kDaOAS13,222,41E-1496,15
204439_atHs.389724Protein similar to interferon-induced protein 44IFI44L 3,214,73E-1388,46
202411_atHs.532634interferon alpha-inducible protein 27IFI273,174,81E-1292,31
205483_s_atHs.458485ISG15 ubiquitin-like modifierISG153,094,73E-1392,31
209969_s_atHs.565365Carrier signal and activator of transcription 1, CDSTAT12,997,95E-1796,15
228531_atHs.65641Protein domain, a sterile alpha motif 9SAMD92,855,42E-1492,31
204415_atHs.523847interferon alpha-induced protein 6IFI62,77 7,23E-0984,62
214453_s_atHs.82316Interferon-induced protein 44IFI442,681,94E-1292,31
222838_atHs.517265Representative 7 family SLAMSLAMF72,661.60e-1692,31
219684_atHs.43388Receptor transport protein 4RTP42,653,73E-1188,46
203127_s_atHs.435661Serine palmitoyltransferase, subunit of long chain bases 2SPTLC22,631,04E-20100,00
205569_atHs.518448Lysosomal-associated membrane protein 3LAMP3to 2.5796,15
223220_s_atHs.518200The family of poly(ADP-ribose) polymerase, representative 9PARP92,551,08E-1588,46

ID probeUnigen IDThe name of the geneThe designation of the geneLog2 fcThe value of q (fdr)% prevalence
212268_atHs.381167Inhibitor Sarbinowo peptidases, taxon B (ovalbumin), member 1SERPINB1of 2.513,02E-1588,46
208436_s+atHs.166120Factor activity regulation of interferon 7IRF72,456,90E-1596,15
204747_atHs.47338Interferon-induced b the Lok with tetratricopeptide repeats 3 IFIT32,422,15E-1492,31
218400_atHs.5286342'-5'-oligoadenylate synthetase 3, 100 kDaOAS32,403,83E-14100,00
203153_atHs.20315Interferon-induced protein with tetratricopeptide repeats 1IFIT12,351,17E-1084,62
210873_x_atHs.348983Enzyme-catalytic polypeptide, corrective mRNA of apoprotein B, related catalytic polypeptide 3AAPOBEC3A2,351,35E-0780,77
204698_atHs.459265Stimulated by interferon gene ectonucleoside 20 kDaISG202,341,50E-1292,31
205241_at Hs.567405Homolog, lack of synthesis of cytochrome oxidase 2 (yeast)SCD2of 2.211,90E-1796,15
207387_s_atHs.1466GlycerokinaseGK2,169,38E-1492,31
219716_atHs.257352Apolipoprotein L, 6APOL62,123,03E-1192,31
202270_atHs.62661Guanylate binding protein 1, interferon-inducible, 67 kDaGBP 12,114,67E-1492,31
229625_atHs.513726Guanylate-binding protein 5GBP52,077,52E-1088,46
228617_atHs.441975 XIAP associated factor-1BIRC4BP2,053,41E-1284,62
206513_atHs.281898Absent in melanoma 2AIM22,042,32E-0876,92
218943_s_atHs.190622DEAD (Asp-Glu-Ala-Asp) box polypeptide 58DDX582,001,39E-1088,46
203148_s_atHs.575631Protein 14 containing tripartite motifTRIM141,942,17E-1796,15
213293_s_atHs.501778Protein 22 containing tripartite motifTRIM221,891,36E-1288,46
214838_at-SFT2 domain-containing protein 21,885,30E-1792,31
231769_atHs.464419F-box protein 6FBXO6to 1.866,34E-1488,46
227697_atHs.527973Suppressor signal transmission cytokine 3SOCS31,824,55E-1088,46

Ubiquitin-conjugating enzyme E2L 6
ID probeUnigen IDThe name of the geneThe designation of the geneLog2 fcThe value of q (fdr)% prevalence
206632_s_atHs.226307Enzyme-catalytic polypeptide, corrective mRNA of apoprotein B, related catalytic polypeptide 3AAPOBEC3B1,819,42E-1092,31
201649_atHs.425777UBE2L61,812,15E-1384,62
204702_s_atHs.404741Similar to nuclear factor (erythroid derivative 2) 3NFE2L31,801,71E-1696,15
202531_atHs.436061Factor activity regulation of interferon 1IRF11,792,13E-1380,77
204994_atHs.926Resistance to myxovirus (influenza virus) 2 (mouse)MH1,757,99E-0969,23
215966_x_at'Pseudogene glycerokinase 3GKP31,733,33E-1180,77
207655_s_atHs.444049B-cell is inter BLNK1,712,28E-1496,15
216598_s_atHs.303649The ligand of the chemokine 2 (motif C-C)CCL21,714,80E-07compared with 65.38

The multiplicity of changes (fold changes - log2 fc) calculated based on the relative levels of transcription between the paired samples of damaged and undamaged skin. The value of q calculated based on the degree of false assessments (false discovery rate - FDR). Dominance is represented in percentages, 26 paired samples of damaged and undamaged skin at least twice the overexpression of the genes listed in the table.

These top 50 IFN type I-induced genes in the damaged skin relative to the intact skin of patients with psoriasis sverkhekspressiya, on average, more than 3.2 times (CCL2 and BLNK) up to 24 times (HPSE) in the damaged skin. Furthermore, all genes represented in the table, except for CCL2 and AIM2 was increased regulation of at least 84% of paired biopsy samples of damaged/undamaged skin (23 of 26 pairs) from patients with psoriasis. Such a strong increased regulation major panel IFN type I the genes in samples of damaged skin samples relative to the intact skin of psoriasis patients provide a good argument for their use as PD markers.

Above briefly stated that the increased regulation of type-I interferon-inducible genes consistently observed in patients with psoriasis. Table is standard and the average fold change of the top 25 most increased regulation of IFN type I sets of probes for each pair of samples of damaged/undamaged skin. Top 25 most increased regulation of IFN type I sets of probes constantly see in the detection of increased gene expression in the damaged skin relative to the intact skin of each individual patient with psoriasis.

3,96
Table 28
Standard and average fold change value of the top 25 most increased regulation of IFN type I-induced genes in 26 pairs of damaged skin compared to damaged skin
ID probeUniGene IDThe designation of the geneNon steam
12345678 91011121314151617181920212223242526
219403_s_atHs.44227HPSE67,7824,3135,28of 27.9437,3128,56236,24128,7710,297,1219,6225,7830,2124,0156,8010,7035,2011,425,86of 12.7325,7830,8132.26 24,5848,50105,13
204972_atHs.414332OAS212,6021,221,192,4449,3348,0333,2243,9613,9271,3628,174,0424,6379,3415,8496,9910,2730,289,2630,1116,3824,2760,4325,32132,099,07
205660_atHs.118633OASL7,1913,484,519,0362,1950,2331,1254,059,72 9,941,102,3124,7544,7011,9145,9817,4614,6633,6017,2784,9724.22 to92,1246,4454,9639,66
2276099_atHs.546467EPSTI1at 11.2520,34-1,431,3857,0132,1414,4023,4210,5355,8032,878,8659,5447,7133,8478,1214,3425,8633,4112,0619,2417,8628,12 22,4378,0310,90
227458_at--16,6910,9419,353,1154,3123,3030,7610,593,2540,4341,376,7026,8323,1937,8870,7875,9819,0426,1949,505,4324,8924,13of 11.4526,059,87
219352_atHs.529317HERC67,8615,702,381,4649,2551:0111,64quintiles these figures were 19.6320,95 21,7215,84of 5.82of 10.5823,0630,42113,4711,0326,949,9016,4619,0633,3227,9819,0826,568,66
216834_atHs.75256PGS127,928,5017,90for 6.8158,4216,25equal to 4.97to 20.5210,0224,3219,50to 9.9194,4114,8323,0015,6413,9531.90 beef100,038,022,4413,4915,8322,64 29,1514,83
204533_atHs.632586CXCL103,923,018,723,91249,6013,1213,3715,144,7569,8656,3122,30was 12.758,3016,6128,1112,9530,7966,1017,7211,8912,1241,2710,9030,145,86
226702_atHs.7155LOC1296073,595,773,101,2760,0012,7614,7222,00at 9.5358,99/td> 27,552,995,9939,7525,66225,9919,7930,964,8845,3014,42to $ 7.9132,8714,5019,853,13
242625_atHs.17518RSAD24,57to 6.191,791,2466,1351,9119,2823,36as 4.0232,048,801,765,6416,3615,9794,85for 9.4714,58with 4.6433,6716,2610,6768,9620,21 40,575,99
213797_atHs.17518RSAD28,337,371,161,0078,6433,0811,9825,13to 1.8621,738,432,733,2331,9112,0449,528,1112,6111,92to 24.0225,0010,0475,0417,3628,336,29
202086_atHs.517307MX15,039,171,251,0820,9739,0814,6323,5411,3318,56 11,71is 3.088,9320,038,6886,7211,0419,607,244,0012,0510,6328,8011,0827,74of 5.68
205552_s_atHs.524760OAS1to 5.9311,051,19was 2.7621,0329,0011,7627,377,7119,2320,143,492,8237,85to 21.9139,436,1324,105,862,634,1813,4621,42of 9.3032,15 16,09
210797_s_atHs.118633OASL2,046,901,32of 1.3445,9431,0616,8666,61a 9.251,691,731,2019,0023,731,6243,8811,7110,3026,362,2778,5115,8865,78represented 33.47 per35.32 per18,92
204439_atHs.389724IFI44Lto 4.52of 6.71-3,59-1,0614,4958,16a 9.2532,21of 6.6837,4931,8219,4316,6623,81253,56for 6.8120,343,1817,9012,167,6018,42to 4.5225,931,12
202411_atHs.532634IFI2710,9715,521,942,6612,0238,8714,8327,6317,0217,2217,69of 5.819,3626.0015,85up 38.942,0130,694,59-4,73of 3.4610,5922,177,0050,187,37
202S69_atHs.524760OAS15,347,992,042,0916,2332,48to 13.2930,47was 12.7549,0010,155,522,3118,9419,5236,574,5816,194,818,964,7311,0511,677,1318,207,39
205483_s_atHs.458485ISG155,644,371,651,10received 19.8240,248,3013,897,0012,1814,494,47 of 6.7819,2410,6557,01to 3.6712,652,96to 2.5711,305,7134,4118,0630,485,07
209969_s_atHs.565365STAT16,146,122852,0038,3916,5010,357,1012,9017,3212,41of 3.7714,317,4925,0018,73the 5.459,639,1817,307,109,2711,0310,9112,914,37
228531_at Hs.65641SAMD95,075,242,521,7912,5612,675,7615,639,8812,9420,851,974,7024,2415,2220,1210,49accounted for 10.39the ceiling of 5.6014,30to 6.806,3816,2412,4613,496,75
204415_atHs.523847IFI61,626,53-2,011,0013,9025,745,5916.88 inof 4.6611,656,453,305,43 30,763,2938,934,0820,012,081,0049,45of 16.0558,4317,9552,576,86
214453_s_atHs.82316IFI442,606,23-2,891,22of 14.7610,554,439,99to 2.6712,3225,673,66compared to 8.2618,22to 2.5761,65of 6.4920,838,3210,76is 4.935,66of 13.278,0226,712,03
222838_atHs.517265 SLAMF75,26of 7.361,701,9710,558,755,56becomes 9.97of 6.78to 10.6215,915,44KZT 19.095,3914,936,8610,108,8915,427,994,69of 5.06of 5.925,6111,229,01
219684_atHs.43388RTP43,1113,02-3,07-1,1113,9518,006,50to 10.093,4830,2523,698,836,6616,4718,653,4017,365,961,925,908,904,554,9228.753,91
203127_s_atHs.435661SPTLC2the 6.065,074,113,508,185,5011,498,252,734,536,24to 5.575,6111,38compared to 8.267,7310,92to 7.324,82of 3.649,245,35to 9.3213,1111,0012,89
Standard fold change0,04 9,924,123,2043,4029,0822,4127,458,5526,7319.14 per6,1317,2525,18be 18.4963,1613,02KZT 19.0916,4914,3018,2113,6532,8215,9435,6113,07
The average fold changeto 5.937,371,791,7937,3129,0011,9822,00a 9.2519,2317,694,049,3623,0615,8543,8810,27 19,047,2412,0611,8910,6727,9813,1128,757,37

Fig represents a graph of the distribution of standard and average multiple changes among different pairs of damaged and undamaged skin. A common and homogeneous increased regulation of most sverhagressivnym IFN type I genes in the affected skin of patients with psoriasis confirms their use as PD markers.

Seventeen sets of probes were also noted as insufficiently expressed in damaged skin and their regulation was lowered under the action of Ifnα/β in research on stimulation ex vivo as described in example 10. These genes include genes CYP1B1, TGST1, RRAGD, IRS2, MGST1, TGFBR3 and RGS2.

Example 12. The expression of IFN type I genes significantly changed in normal skin compared to the intact skin of patients with psoriasis.

Although the data array obtained in example 11, shows the overexpression of various genes induced by IFN type I in the damaged skin compared with intact skin, reveal only 5 sets of probes, sverhagressivnym in intact skin compared with normal control skin is. P-value Fisher's exact test (bi-directional t-test) is 0,581 that confirms that the overexpression of IFN type I genes is not statistically significant in intact skin of psoriasis patients relative to healthy skin.

In table (example 11) shows that most of the genes identified as the top 50 of IFN type I-induced genes in the damaged skin compared with intact skin, comparable expressed in intact skin relative to normal control skin (several genes, for example, RGS1 and SPTLC2, possess reduced regulation in intact skin compared to normal skin). Fig graphically represents the relative expression of three genes induced by IFN type I (HPSE, OASL and HERC6; induced as a top 50 IFN type I-induced sets of probes in the damaged skin compared with intact skin), and 1 gene is not related to IFN type I-induced gene (SERPINB4), and (a) damaged skin compared with intact skin, and (b) in intact skin compared with normal skin. Overexpression of genes HPSE, OASL and HERC6 in damaged skin compared with intact skin statistically significant (which proves a very small p-value) and scale (standard overexpression has multiplicity 12-250). Overexpression of the gene SERPINB4 in nemouridae the Noi skin approximately 3-4 times higher compared to normal skin, but roughly 200 times greater in damaged skin compared with intact skin.

Analysis of samples from a normal, healthy, damaged with psoriasis and undamaged psoriasis skin using 164 sets of probes identified in example 11 as IFN type I inducible shows the accumulation of damaged samples for psoriasis of the skin and the accumulation of samples intact for psoriasis of the skin and normal healthy skin. Figa heatmap represents unsupervised hierarchical clusters all damaged, undamaged and normal skin samples profiled using 164 IFN type I-induced sets of probes in the damaged skin compared to the intact skin of patients with psoriasis. It is shown that almost all (except three) samples of damaged skin klastirovannye together, and also about all the samples intact and normal skin klastirovannye together. Figb is a plan AGK skin samples, using the same 164 with increased regulation of IFN type I-induced sets of probes. In addition, normal skin samples and intact skin samples mainly klastirovannye together, showing similar levels of expression of 164 genes. In addition, most samples of damaged skin is separated from the sample normal and intact skin, showing that the samples of the damage is given to the skin are distinctive overexpression of IFN type I-induced genes which were separated from the levels of gene expression of normal and intact skin samples.

These observations are additionally confirmed by the analysis of metabolic pathway gene. The GeneGo analysis shows that changes in Ifnα/β signaling pathways intact skin of psoriasis patients relative to normal skin has a p-value close to 1. Distinctive separation of samples of damaged skin samples from intact skin samples and normal skin see even if the clustering of the samples based on the transcription profile of the whole genome sequences. Cm. Fig.

Example 13. Confirmation of increased regulation of IFN type I-induced gene in the affected skin of patients with psoriasis methods taqMan-based

Dynamic combination of BioMark48,48 (method based on taqMan) company Fluidigm used to confirm the results of studies of the chips of the human genome Affymetrix GeneChip®human genome U133 plus v2.0, the results show that increased regulation of genes IFN type I in the damaged skin psoriasis relatively intact skin psoriasis or normal skin samples.

Eighteen pairs of damaged and undamaged skin samples from 18 patients with psoriasis, is used for the analysis of gene expression. Twenty-nine of the number pointed to by the x genes are IFN type I induced genes, although 11 genes were highly increased regulation in the damaged skin, but they are not of IFN-induced genes, for example, S100A9, S100A12, SERPINGB4 and KLK13. Each gene are selected based on the prevalence and significant overexpression in the damaged skin. The overexpression of all genes in the damaged skin is confirmed by taqMan method EOC-PCR, the majority of these genes show a very good correlation between micrometrical and taqMan analyses. Fig shows taqMan data for overexpression of each of the ten (OAS2, OASL, EPSTI1, MH, IFI44L, IFI44, HERC6, HPSE, ISG15 and STAT1) IFN type I-induced genes in the damaged skin in 18 paired samples of damaged/undamaged skin.

In General, the results of the analysis based on taqMan and analysis matrix Affymetrix well correlated, confirming that the genes selected as sverhagressivnym IFN type I-induced genes in the affected skin of patients with psoriasis. The distribution of correlation coefficients between the analysis and taqMan analysis matrix for Affymetrix 40 sverhagressivnym genes represented on figa. At nineteen sverhagressivnym genes correlation coefficients exceeding 0,85, confirming the correlation between micrometrical and analysis based on taqMan. Other 17 genes have high correlation coefficients between micrometrical and analysis based on taqMan 0.5-0,85. Figb p which shows the distribution of correlation coefficients between the analysis and taqMan analysis matrix for Affymetrix 29 IFN type I-induced genes in 18 patients with psoriasis. In addition, many of the genes have a high correlation coefficients exceeding the value of 0.90. Along with other these genes include genes IFI27, CXCL10, ISG15 and MH.

Figa-37g and 38 show detailed data on gene expression, derived from studies based on microarray and taqMan for several IFN type I-induced genes in paired samples of damaged/undamaged skin. These findings indicate that similar levels of overexpression of IFN type I-induced genes in the affected skin of patients with psoriasis reveal between research method based on taqMan and method using microarray and, therefore, high correlation coefficients discussed above. Figa and b show a similar overexpression of ISG15 in each of the 18 paired samples of skin damage/no damage by definition method based on taqMan (37A) and using the microarray (b). Figv and 37g show the overexpression of MCH in each of the 18 paired samples of skin damage/no damage, by definition, the taqMan method (37V) and using the microarray (37g). The correlation coefficient between the method based on taqMan and method of using the microchip is 0,9735 for ISG15 and 0,9836 for MH. Fig shows the measurement is close overexpression of IFN type I-induced genes IFI27 and CXCL10 method based on taqMan method with the use of microchips in each of the 18 pairs of samples of damaged/undamaged skin.

The correlation coefficient between the results obtained by the method based on taqMan method with the use of microchips for IFI27 and CXCL10 is 0,9456 and 0,9455, respectively.

Example 14. Ifnα antibody will neutralize gene expression induced Ifnα I type, in ex vivo stimulated the keratinocytes of healthy volunteers.

Isolated keratinocytes from healthy volunteers and stimulated ex vivo increasing doses α2 and leukocyte interferon for induction option of increasing IFN I α-induced gene expression. Anti-Ifnα antibody can neutralize the variant IFN I α-induced gene expression in a dose-dependent manner.

Normal human keratinocytes (EpiDerm system, MatTek, Inc.) grown without serum according to the manufacturer's instructions. Briefly, keratinocytes supported in the insets of tissue culture on the surface of the air-liquid to maintain a multi-layered fully differentiated epithelial phenotype. Keratinocytes stimulate leukocyte IFN person (15-150 Miu/ml, the firm PBL Biomedical Labs) and α2 person (15-350 Miu/ml, the firm PBL Biomedical Labs). In some wells add humanitariannet anti-human Ifnα monoclonal antibody (0.01 to 100 μg/ml; product of MEDI-545, firm MedImmune, Inc) or izotopicheskie matched control antibody of irrelevant specificity (product R34, the firm MedImmune, Inc.) along with stimulating effects of the cytokine. Epidermal cultures harvested after 2, 4 or 18 h after treatment for analysis of transcription. Gene expression induced by IFN type I, measured using the BioMark™ at 48.48 dynamic array.

Regulation of expression of the majority of the IFN type I-induced genes increase in α2 - and leukocyte interferon-stimulated keratinocytes in a dose-dependent manner. This increased regulation of IFN type I-induced genes, or α2, or leukocyte interferon, similarly inhibited in a dose-dependent manner with Ifnα monoclonal antibody (MEDI-545). Control R347 antibody has no significant effect on the neutralization of IFN type I-induced genes.

Dose-dependent neutralization of the three genes induced by IFN type I (ISG15, USP18 and IFIT2), antibody MEDI-545 in keratinocytes stimulated α2 or leukocyte IFN presented on Fig. Fig (a), (b) and (d) show that MEDI-545 neutralizes the overexpression of genes ISG15, USP18 and IFIT2 induced IFN type I, respectively, in keratinocytes stimulated 350 Miu/ml α2. Each of these genes neutralized 100% with MEDI-545. Fig (b), (d) and (e) shows that MEDI-545 neutralizes the overexpression of genes ISG15, USP18 and IFIT2, induced IFN type I, respectively, in keratinocytes, Prostamol is aligned with 150 Med./ml leukocyte IFN. Neutralization of these genes using MEDI-545 is 70-100%, which is not surprising, since which leukocyte IFN and contains Ifnα, and β. MEDI-545 effectively neutralizes most of Ifnα subtypes, but not β. These data neutralize provide additional evidence that IFN type I-induced genes in whole blood and keratinocytes stimulated ex vivo (example 10)are IFN type I-induced genes. They also confirm the increased regulation of expression of these genes in the damaged skin of psoriatic relatively intact skin due to induction of IFN type I.

Example 15. Increased regulation of various IFN type I subtypes in the affected skin of patients with psoriasis.

To identify subtypes of IFN type I, responsible for the induction of signature of IFN type I in skin lesions of patients with psoriasis, measure the mRNA levels of genes of IFN type I in psoriatic skin lesions.

Analysis of gene expression performed using a TaqMan Low Density Array (TLDA) the company Applied Biosystems. The expression of 23 genes, including subtypes 1, 2, 5, 6, 7, 8, 14, 17 and 21 type I Ifnα; interferon - type I β, K and ω; γ; Ifnα receptors AR1 and AR2; γ receptors GR1 and GR2; type I Ifnα inducible genes RSAD2, OAS3, IFI44, MH and CXCL10; and α subjected to monitoring and comparing in pairs the damaged and undamaged skin 18 patients with psoriasis./p>

Double-strand cDNA sample each patient pre-amplified using a set of TaqMan PreAmp Master Mix kit (firm Applied Biosystems). Pre-amplified in 10 cycles of PCR cDNA in the sample of each patient, using a combined solution of the primer pair for each gene analyzed by matrix. Pre-amplified cDNA diluted 1:5 in THOSE. 50 µl of the diluted pre-amplified cDNA is added to 50 ál of 2x mix TaqMan Universal PCR Master Mix, Applied Biosystems) and stirred. Matrix saturate the mixture using standard procedures, and loaded matrix are examined in the rapid real-time PCR NT (firm Applied Biosystems). Data analysis the obtained Ct values is carried out with software SDSv2.2.2 (firm Applied Biosystems).

Figa shows the relative overexpression of mRNA nine subtypes of Ifnα in the damaged skin compared either with intact skin, or normal skin. Except α5 (regulation increased by approximately 4.6 times the average rate of change, p<0,001), none of the subtypes of Ifnα was not significantly changed the level of mRNA in intact skin in comparison with the same indicator in normal skin (p<0,05). However, increased regulation of all subtypes of Ifnα on the level of mRNA in the damaged skin compared to mRNA in normal skin (or intact skin) in statistics, the key significant overexpression α1, α5, α8, α14, α17, α21 (p<0,05). Figb shows the overexpression of other representatives of the IFN type I family, β-and-ω mRNA in the damaged skin compared either with intact skin, or normal skin. Changes in mRNA β and ω in intact skin is negligible. However, increased regulation of these mRNA significant in the damaged skin compared with normal skin (p value of 0.022 and 0,049 respectively). Increased regulation Ifnc mRNA is approximately 1.6 times (average fold change, p=0.03) in intact skin, and regulation increased sharply in 62,6 times (average fold change) in the damaged skin compared with normal skin (p<0,001). In addition, the receptors for IFN type I, AR1 and AR2 also significantly sverkhekspressiya in the affected skin of patients with psoriasis at the level of transcription (value, p<0,001; figv). Although increased regulation AR2 significant in intact skin, for AR1 this is not the case (pigv). Collectively, the data presented strong evidence that the levels of mRNA representatives of the family of IFN type I comparable between intact healthy skin and normal skin (except α5 and Ifnc) and uniformly sverkhekspressiya in the affected skin of patients with psoriasis.

Table lists the correlation coefficients overexpression of molecules of the RNA representative of IFN type I family (IFN I α subtypes 1, 2, 5, 6, 7, 8, 14, 17 and 21; and β, Ifnc and ω) in the damaged skin compared to the intact skin of patients with psoriasis. Of the 12 measured representatives of the family of IFN type I overexpression α1, 2, 8 and 14 in the damaged skin correlates most consistently with overexpression of other members of the family of IFN type I except α5, which shows the weakest correlation with the other members of the family of IFN type I.

0,77 W1
Tabl
The correlation coefficient overexpression of members of the family of IFN type I in skin ulcers in patients with psoriasis
IFNAIFNAIFNAIFNAIFNAIFNAIFNAIFNAIFNAIPNVIFNCW1
IFNA1
IFNA0,661
IFNA0,110,201
IFNA0,450,47-0,011
IFNA0,790,090,681
IFNA0,640,990,190,490,841
IFNA0,840,940,280,440,720,941
IFNA1,000,960,150,070,770,97 0,941
IFNA0,710,490,500,420,810,490,610,751
IPNV0,540,860,280,330,690,960,800,930,541
IFNC0,780,730,090,590,270,730,770,030,220,541
0,730,720,440,220,750,700,770,930,900,730,261

Example 16. Joint overexpression of IFN type I, type-II IFN and α and their genetic signatures in the damaged skin or in patients with psoriasis

Part γ and α mRNA signaling pathways also assessed in paired samples of damaged/undamaged skin of psoriasis patients and healthy people. Above in example 15 was discussed that the TLDA company Applied Biosciences used to measure γ, RG1, GR2 and α mRNA in the damaged and intact skin of patients with psoriasis and normal skin of healthy people.

In contrast to the observations of the levels of expression of IFN type I mRNA, γ levels GR1, GR2 and α mRNA significantly sverkhekspressiya in intact skin compared with normal skin of healthy people (Fig; p value of 0.02, <0,001, <0.001 and <0,001, respectively). Increased regulation α mRNA is approximately 5.7 times, and regulation of mRNA molecules γ, GR1 and GR2 increased by approximately 1.5, 2.2 and 2.8 times compared to the regulation in normal skin (average crtn the industry changes; Fig). However, like interferons of the first type (IFN type I), increased regulation of these genes in the damaged skin compared with either intact skin (p value of 0.04, 0.01, 0.001 and to 0.007, respectively), or with normal skin (p value<0.001 for all these genes; Fig). The mRNA molecules α, γ, GR1 and GR2 increased regulation of approximately 33.5, of 116.7, 11.6 and 8.4 times in the damaged skin compared with the specified index in the normal skin. Such observations suggest that variations in the expression of mRNA for γ and α different from the expression of members of the family of IFN type I that is comparable in healthy, undamaged skin (except α5 and Ifnc), the regulation of which is increased in damaged skin compared to the intact skin of patients with psoriasis.

Example 17. Identification of genes induced by type II IFN and α, stimulated ex vivo whole blood, which are induced in skin lesions of patients with psoriasis

Similar to the description in example 10 whole blood of healthy donors stimulated ex vivo by a panel of Ifnα subtypes, as well as β, γ and α. Stimulation of whole blood ex vivo with γ or α identify sets of probes associated with potential γ or α-induced genes. Sets of three hundred and four probes identified based on minicamera 2-fold increase regulation under the action of γ four hours after stimulation. Sets two hundred thirty-four probes identify, based at least 2-fold increase regulation under the action of α and two hours, and four hours after stimulation.

Sets of probes detected ex vivo as associated with induction γ or α, compared with the total set 1408 probes (example 11), which was established increased regulation in the damaged skin relative to the intact skin of patients with psoriasis. Using the specified method sets 106 and 35 probes included in the total number 1408 probes increased regulation in the damaged skin, identified as γ or α-induced, respectively (Fig). Sets 106 probes identified as induced γ shown in Fig. The 35 sets of probes identified as induced α shown in Fig. Sets 164 probes shown in Fig as identified IFN type I is displayed, shown in Fig. Fisher's exact test shows that the two values p (one-sided criterion t - test) overexpression γ or α induced genes in the damaged skin is less than 0,0001. Overexpression of γ and α induced genes is essential.

Using the list of sets of probes, which became known in studies of ex vivo that they are induced IFN type I, γ and α, establish that IFN type I-, γ and α-induce the genes has been created, regulation which is increased at least 2 times in each of the samples of damaged skin samples relative to intact skin. Fig shows the number of IFN type I-, γ and α-induced genes with increased regulation in each of the 26 paired samples of damaged and undamaged skin. The increased number of IFN type I-induced genes with increased regulation in a biopsy sample of damaged skin usually leads to increased overexpression of a larger number γ and α-induced genes in the same biopsy specimen damaged skin. This observation is confirmed by the strong correlation in the joint activation of these three sets of genes with correlation coefficients 0,9811, 0,9179 and 0,9372 using two-sided paired criterion - t-test for comparison of increased regulation of IFN type I and γ-, IFN type I and α-and γ and α-induced genes in the damaged skin compared with intact skin (figa).

A similar analysis is performed for genes with low regulation in the damaged skin compared to the intact skin of patients with psoriasis (Fig). From a total of 1465 probes, the regulation of which is reduced in damaged skin relatively intact skin, only 17, 5 and 5 induced IFN type I, γ and α. Although it is established that increased regulation of molecules γ and α mRNA in the skin without the damage is calling patients psoriasis patients when compared with normal skin of healthy people, γ and α-induced genes do not show significant overexpression in intact skin (Fig). The lack of genetic signatures of IFN type I, γ and α-induced genes in intact skin compared with normal skin, even if the molecules of mRNA γ and α sverkhekspressiya in intact skin, mean and γ, and α proteins have not been established in intact skin, or other signaling molecules may exert a suppressive effect on the metabolic pathway γ and α in intact skin of patients with psoriasis.

Example 18. Immunohistochemical analysis of biopsy samples of damaged skin of psoriasis patients, intact skin of patients with psoriasis and skin healthy donors shows elevated protein levels of genes induced by IFN type I.

To install, does high overexpression of IFN type I-induced genes in psoriatic skin to similar changes in protein expression, immunohistochemical tests conducted to assess the presence of proteins STAT1 and ISG15 in the skin. In addition, the analysis of cellular infiltrates (pDC, mDC and CD4-positive cells) is performed to compare the number of types of IFN-produced cells and inflammatory cells in biopsy samples of damaged skin compared to povrejdeniy and healthy skin.

Instantly frozen biopsy samples damaged by psoriasis, undamaged psoriasis and normal skin is divided into two parts. Half of each sample is immersed in OCT, cut into pieces with a size of 5 μm, placed on the "plus" glass and fixed in cold acetone. Chopped samples incubated with primary antibodies (specific BDCA2, CD83, CD4, STAT1 and ISG15) for 4 h and washed FSB. The slices are then incubated with the polymer labeled with peroxidase conjugated goat anti-mouse immunoglobulin antibody system (Envision+; firm Dakocytomation, Carpenteria, CA) for 30 min and washed with Tris-buffered saline buffer, pH to 7.2. Detection is carried out with the use of 3,3'-diaminobenzanilide (drug DAB+; firm DakoCytomation) as Chromogen. The slices are washed dH2O, re-stained with hematoxylin, dehydrated and covered with a cover glass.

All patients with psoriasis, which can be evaluated pairs of samples of damaged/undamaged skin, damaged skin contains increased amount of cellular infiltrates pDC and/or mDC, increased the number of CD4+ cells and proteins STAT-1 and ISG15 with a significant increase in regulation in the epidermis and in fact the skin (the dermis) compared with the intact biopsy samples. In contrast, biopsy skin samples from a healthy donor is s do not contain significant amounts of pDC, mDC or not show staining for STAT-1 and ISG15. Cm. Fig, for example, immunohistochemical sections.

Example 19. Immunohistochemical analyses of gene expression biopsy specimens from skin lesions of patients with SLE show reduced expression of genes induced by IFN type I, at the level of proteins and transcripts after treatment with the product MEDI-545

To determine whether the transcripts of the top 25 IFN type I-induced genes in skin lesions of a patient with SLE to be neutralized by MEDI-545, were examined biopsy specimens from patients after treatment of MEDI-545 in the amount of 10 mg/kg Heatmap neutralization top 25 IFN type I-induced genes in skin lesions at 0 and 14 days after treatment are given in Fig(a). All of the top 25 genes neutralized through 14 days after the administration of MEDI-545. Chart AGK target modulation, based on the specified top 25 IFN type I-induced genes shown in Fig(b). Chart AGK shows the progression of a patient with SLE undergoing treatment, the condition opposite to the condition of a normal healthy donors before the introduction of antibody MEDI-545, to a state close to a state of healthy donors through 14 days after the administration of MEDI-545.

To determine whether the levels of certain proteins expressed from these high shorecrest the dummy 1 IFN type I-induced genes also be reduced by treating the product of MEDI-545 in the amount of 10 mg/kg, immunohistochemical analyses carried out to identify HERC5, ISG15 and protein IP10 in skin lesions of SLE patients, which were treated with MEDI-545 and placebo. In addition, the analysis of cellular infiltrates (pDC, mDC and CD4-positive cells) is conducted to compare several types of IFN-producing cells and inflammatory cells in biopsy specimens of skin lesions of SLE patients in the treatment of MEDI-545 in control samples from people treated with placebo.

Instantly frozen biopsy samples of damaged skin of SLE patients subjected to treatment with antibody MEDI-545, and patients with SLE treated with placebo, divided in half. Half of each sample is immersed in OCT, cut into layers with a thickness of 5 μm, placed on the "plus" glass and fixed in cold acetone. Chopped samples incubated with primary antibodies (specific BDCA2, CD83, CD4, STAT1 and ISG15) for 4 h and washed FSB. The slices are then incubated with the polymer labeled with peroxidase conjugated goat artemisinin immunoglobulin antibody system (Envision+; firm Dakocytomation, Carpenteria, CA) for 30 min and washed with Tris-buffered saline buffer, pH to 7.2. Detection is carried out with the use of 3,3'-diaminobenzanilide (drug DAB+; firm DakoCytomation) as x is of homogene. The slices are washed dH2O, re-stained with hematoxylin, dehydrated and covered with a cover glass.

In patients with SLE treated with placebo, and cellular infiltrates, and the levels of proteins expressed from sverhagressivnym IFN type I-induced genes, improved (or worsened) over the course of 14 days. Cm. Fig, which shows the improvement (deterioration) mDC (CD83 staining) and T-cell (CD4 staining) infiltration in skin damage. Fig also shows no change in pDC (staining BDCA2) infiltration into the damaged skin of a patient with SLE who were treated with placebo for 14 days. Cm. also Fig, which shows increased staining for proteins expressed from sverhagressivnym IFN type I-induced genes HERC and IP10. There are no changes in staining for ISG15.

On the contrary, patients treated with the product of MEDI-545 in the amount of 10 mg/kg, the levels of infiltrates and proteins, expressed from sverhagressivnym IFN type I-induced genes are reduced in varying degrees. Cm. Fig and 55, which provide immunohistochemical data of the first patient with SLE treated with the product of MEDI-545, and Fig and 57, which provide immunohistochemical data of the second patient with SLE treated product MEDI-545.

Example 20. Analysis coustical the particular detection of type-I and type-II IFN

For the development of the study of the sensitivity of detection of IFN type I and type II IFN, clone constructs containing the gene of the enzyme luciferase isolated from a marine organism Gaussia princeps (firm Targeting Systems; Santee, California) under the control of the element response is stimulated by interferon (interferone-stimulated response element - ISRE) (TAGTTTCACTTTCCC)5; firm Biomyx; San Diego, California). Cells NECN stable transferout design and the resulting cells are used for methods for detecting IFN.

25000 stably transfected cells NECN sown in well in 50 μl of cell culture medium and placed in an incubator in an atmosphere of CO2on the night. The next day, the serum samples of the patient (or normal pooled human serum, injected with different subtypes of IFN-alpha or IFN-beta, IFN-omega, IFN-gamma) were screened to identify different subtypes of IFN by adding 50 ál of undiluted serum of a patient or injected serum in the test wells containing the seeded cells (final concentration 50% of patients ' sera in the wells for 24 h). IFN-induced luciferase activity detected on the next day by observing chemiluminescence in the supernatant of cultures. Chemiluminescence see by transferring 5 μl of the supernatant from the wells in the B&W Isoplate, to whom avlee 50 ál chemiluminescence substrate and exposing chemiluminescence in 6 minutes Sample generating a signal that is more than 1.5 times the signal in the negative control wells on each pad is classified as a positive activity of IFN. Cm. Fig a-d, which provide the identified levels of type-I and type-II IFN activity in IFN-bioanalysis for different inoculated cells treated with patient serum and injected with control serum. Each of panels a-d shows that high dose IFN in the study leads to increased identification of action of IFN.

In the samples, which revealed the activity of IFN, antibodies that specifically neutralize various type-I and type-II IFN, can then be used to determine IFN responsible for a positive response. Anti-IFN-type-specific antibodies pre-incubated with either positive samples (sample) serum (if antibody MEDI 545, anti-IFN-beta, anti-IFN-gamma and anti-IFN-omega, which are themselves associated with IFN ligand)or cells (in the case of MEDI 546, which binds to a receptor interferon type I cells NECN) followed by the addition of samples to the cells and determining the intensity of fluorescence as described above. Injected samples, which show reduced chemiluminescence after processing specific antibody appreciate as gender is positive for the presence of specific interferon (interferon), which is neutralized IFN-specific antibodies.

Fig(a) shows that increasing doses of MEDI-545 in a processed hole value neutralizes IFN increasing doses of antibody MEDI-546 (figb). Fig-63 shows that γ, ω and β, respectively, are neutralized by antibodies specific against γ, ω and ββ, which corresponds to the assumption.

Example 21. Changes in the levels of soluble proteins in the serum of patients with lupus

Serum taken from patients with SLE (n=40) and CLE (n=5), whose history includes at least 4 of the 11 positive ACR classification criteria, and the degree to which show signs of disease at the time of selection of the sample. Ninety-five percent are women, whose average age is equal to 41±15 years ± standard deviation. Seventy-six percent currently receive oral corticosteriod in doses ranging from 1 mg/day to 30 mg/day of prednisone, and 2 patients with SLE also receive intravenous pulse administration of steroids. 59% receive at least 1 active disease modifying drug agent other than corticosteroids. Luminex xMAP technology is used to detect changes in 89 the samples and rules Based Medicine (see the Internet for domain "rulesbasedmedicine. com"). The results for each analysis the dummy connection compared with the average value of the panel of normal human serum (n=17) and determine the significance, using the paired student's criterion. Fig shows the agents, the levels are sufficient (a) increased or (b) reduced relative mean values in normal serum (p value ≥0,05). Significant changes in the levels of cytokines, chemokines, metabolic proteins and other soluble mediators detected in the serum of patients with lupus.

Example 22. Another option analysis Panomics OuantiGenePlex, verifies the results of the study of IFN-induced gene expression

Analysis QuantiGenePlex primarily conducted to assess the ability of QuantiGenePlex discover 22 IFN-inducible transcripts in whole blood after stimulation with α2b. 22 IFN-inducible transcript detected using the specified initial analysis QuantiGenePlex are selected based on their sustainable increased regulation in patients with SLE, and is shown on the x-axis of the graphs shown in Fig and 76.

Stimulation of whole blood is carried out by incubation of fresh selected Na-EDTA whole blood from 5 healthy donors and 20 Miu/ml α2b within 4 hours After incubation with 2.5 ml of stimulated whole blood add in PAXgene tubes, mixed and incubated overnight at room temperature. After overnight incubation the samples frozen at -80°C. These manual methods choose to follow those used in clinical studies.

PAXgene blood analyze to determine the expression levels of IFN-inducible transcripts. Blood in PAXgene tubes (500 ál) precipitated by centrifugation and then are lysed and 139 μl buffer Protocol lysis of blood QuantiGenePlex PAXgene. Protestirovanny blood of each donor in repeats inserted in wells and hybridizing during the night with multiple set of probes for 22 IFN-induced genes. Gene expression assessed on the following day, using the device Luminex 100 is software BioRad BioPlex. Estimate the rate of change for each individual, based on the increased signal observed between wells, which was the stimulation of IFN, and holes, which was the stimulation of the FSB. Fig shows the rate of change of expression of each of the 22 IFN-induced genes after stimulation with each of the 5 samples of whole blood from healthy volunteers. The dashed line shows the two-fold change relative to control samples, which stimulated the FSB.

Whole blood per volunteer additionally stimulate higher dose range of 0.2-200 Miu/ml α2b to determine whether increased regulation of IFN-induced genes using α2b dose-dependent and can it be detected by the method QuantiGenePlex. For each of the 22 transcripts installed in a dose-dependent induction. Cm. Fig that p is ecstasy fold change in expression for each of the 22 transcripts for each dose α2b. The maximum induction of the transcript is about 100 times set for genes RSAD2, IFIT3 and MH. Using twice the excess of the initial level as the edge magnitude 19/22 genes identified in the samples treated with 2 Honey/ml IFN, and 5/22 detected in samples treated with 0.2 Miu/ml IFN. Expression of SIGLEC1, LY6E, SERPING1, OAS3 and IFI27 transcripts weakly induced stimulation α2b. Such low levels of induction may indicate a loss of sensitivity analysis to specified targets or about the differences in gene expression between the real disease SLE (from the patient with the disease specified panel transcripts was selected) and stimulation ex vivo with one subtype of Ifnα - α2b. The dotted line indicates the two-fold change relative to control samples, stimulated the FSB.

Then the analysis QuantiGenePlex used to identify levels of IFN-inducible transcripts in whole blood of patients with SLE. 20 of 22 probes from the original set QuantiGenePlex presented on Fig and 76, are retained in the analysis QuantiGenePlex used to evaluate these data.

Two probes, HSXIAPAF1 and GIP3, replace the other probes, XAF1 and IFI6. Using this panel of 22 probes, set the source base signature, based on samples of whole blood from ten healthy donors (blue line in each panel). The original gene signature, the basis of the ing on samples of whole blood of healthy donors, compare with (1) genetic signature of patient of SLE, which detected the activity of IFN in the serum, and (2) genetic signature of patient of SLE, which has no detectable activity of IFN in the serum. The action of IFN serum determined in serum samples of patients with SLE, using the analysis described in example 20. Figa shows the comparison of gene signatures SLE patient (red), which has no detectable activity in the serum Ifnα (i.e. the activity of serum IFN<2.5 Miu/ml), with a baseline level of gene signatures (blue color). Except gene LAMP3, the levels of all transcripts install as elevated in the blood of the patient of SLE, which is not in the serum activity of IFN. Figb shows the comparison of gene signatures SLE patient with high levels of activity in the serum Ifnα (red) relative to the original gene signature (in blue). All transcripts increased at least 2 times in the blood of a patient with high activity of IFN in the serum, with maximum induction at approximately 80 times for IFI27.

Data obtained by the method of QuantiGenePlex, then evaluate the comparability of data obtained by the method of Fluidigm Real-Time PCR. Each of the methods QuantiGenePlex and Fluidigm, is used for the analysis and comparison of the levels of transcription in stored in PAXgene tubes the whole blood specimens from 16 patients, SLE patients, participating in the first phase, the wedge is ical research (monoclonal antibody against Ifnα) relative to the median of the mixed genetic evaluation 10 healthy donors. Analyses Fluidigm carried out using a mixture of methods TaqMan gene expression, including 4 reference control gene, prepared with a set of TaqMan PreAmp Master Mix Kit (firm Applied Biosystems). Dynamic load matrix, using the controller NanoFlex 4-IFC (company Fluidigm Corp), and the reaction Poland real time, using real-time PCR BioMark. The results analyzed using the software BioMark Real-Time PCR Analysis. The magnitude of the Delta - Delta Ct (DDCt) calculated using the average of 4 reference genes (GAPDH, TFRC, b2 and 18S) and the calibrated value of the sample. The results obtained using samples of whole blood from patients with SLE show a high degree of correlation between the methods QuantiGenePlex and real-time PCR to identify profiles of gene expression associated with disease. Fig shows (a) a compound of the median and (b) the average fold changes of all genes in the panels, which were calculated and compared using correlation analysis Pearson. A significant correlation observed between the results QuantiGenePlex and Fluidigm at the median (p=0.0002) and secondary (p<0,0001) multiple changes when compared with a panel of genes.

Data obtained by QuantiGenePlex and real-time PCR Fluidigm, then compare the ability to detect changes in levels of transcription in samples from patients with SLE ove the terms of the course of treatment in a clinical study. For this comparison samples from patients with SLE collected directly into PAXgene tubes at "0" days (before dosing) and repeatedly at different times after administration of a single dose of anti-Ifnα monoclonal antibody or placebo. For each sample calculate the total average fold change on the panel of 22 genes and compared with a sample from the same patient taken before dosing. Figa shows changes in gene signatures for patients who were treated with placebo or antibody using the Fluidigm technology. Figb shows changes in gene signatures for patients who were treated with placebo or antibody, using methods QuantiGenePlex. Each subject not treated with placebo, reduced the IFN gene signature watch within 24 hours after the administration of medicines, and it is consistent between data Fluidigm and QuantiGenePlex. Changes in levels of transcription after the introduction of the identified methods QuantiGenePlex and Fluidigm, also highly similar.

1. Application of a set of genes with increased expression regulation or action MX1, LY6E, IFI27, OAS1, IFIT1, IFI6, IFI44L, ISG15, LAMP3, OASL, RSAD2, and IFI44 to identify SLE patients to receive MEDI 545.

2. The use according to claim 1, where the increased regulation of expression or activity includes
(a) increased at least 2 times the expression of one or more genes;
(b) increased at least 3 times e is cpressey one or more genes;
(d) elevated levels of mRNA of one or more genes or
(d) elevated levels of the protein of one or more genes.

3. The way to identify SLE patients to receive MEDI 545, comprising: detecting the presence or absence of the expression profile of Ifnα-inducible PD markers pharmacodynamic markers (PD markers in the patient sample,
wherein detection of the presence profile of expression of Ifnα-inducible PD markers allows the identification of the patient as a candidate for MEDI 545, and wherein the expression profile of IFN type I - or Ifnα-inducible PD markers includes a set of genes with increased expression regulation or action IFIT1, IFIT3, IRF7, IFI6, IL6ST, IRF2, LY6E, MARCKS, MH, MH, OAS1, EIF2AK2, ISG15, STAT2, OAS3, IFI44, IFI44L, HERC5, RAB8B, LILRA5, RSAD2 and FCHO2.

4. The way to identify SLE patients to receive MEDI 545, comprising: detecting the presence or absence of the expression profile of Ifnα-inducible PD markers pharmacodynamic markers (PD markers in the patient sample,
wherein detection of the presence profile of expression of Ifnα-inducible PD markers allows the identification of the patient as a candidate for MEDI 545, and wherein the expression profile of IFN type I - or Ifnα-inducible PD markers includes a set of genes with increased expression regulation or action RTP4, RSAD2, HERC5, SIGLEC1, and USP18, LY6E, ETV7, SERPING1, IFIT3, OAS1, HSXIAPAF1, G1P3, M is 1, OAS3, IFI27, DNAPTP6, LAMP3, EPSTI1, IFI44, OAS2, IFIT2 and ISG15.

5. The way to identify SLE patients to receive MEDI 545, comprising: detecting the presence or absence of the expression profile of Ifnα-inducible PD markers pharmacodynamic markers (PD markers in the patient sample,
wherein detection of the presence profile of expression of Ifnα-inducible PD markers allows the identification of the patient as a candidate for MEDI 545, and wherein the expression profile of IFN type I - or Ifnα-inducible PD markers includes a set of genes with increased expression regulation or action DNAPTP6, EPSTI1, HERC5, IFI27, IFI44, IFI44L, IFI6, IFIT1, IFIT3, ISG15, LAMP3, LY6E, MH, OAS1, OAS2, OAS3, PLSCR1, PSAD2, RTP4, SIGLEC1, and USP18.

6. The way to identify SLE patients to receive MEDI 545, comprising: detecting the presence or absence of the expression profile of Ifnα-inducible PD markers pharmacodynamic markers (PD markers in the patient sample,
wherein detection of the presence profile of expression of Ifnα-inducible PD markers allows the identification of the patient as a candidate for MEDI 545, and wherein the expression profile of IFN type I - or Ifnα-inducible PD markers includes a set of genes with increased expression regulation or action SAMD9L, IFI6, IFI44, IFIT2, ZC3HAV1, ETV6, DAPP1, IL1RN, SEASON, OAS1, IFI27, OAS3, IFI44L, HERC5, IFIT1, EPSTI1, ISG15, SERPING1, OASL, GBP 1 and MH.

7. The method according to any of PP-6, where the higher the Naya regulation of expression or activity includes
(a) increased at least 2 times the expression of one or more genes;
(b) increased at least 3 times the expression of one or more genes;
(d) elevated levels of mRNA of one or more genes or
(d) elevated levels of the protein of one or more genes.

8. Application of a set of genes with increased expression regulation or action IFI6, RSAD2, IFI44, IFI44L, IFI27, MH, IFIT1, ISG15, LAMP3, OAS3, OAS1, EPSTI1, IFIT3, OAS2, SIGLEC1 USP18 to identify SLE patients to receive MEDI 545.

9. Application of a set of genes with increased expression regulation or action IFI6, RSAD2, IFI44, IFI44L, and IFI27 to identify SLE patients to receive MEDI 545.

10. The use of claim 8 or 9, where the increased regulation of expression or activity includes
(a) increased at least 2 times the expression of one or more genes;
(b) increased at least 3 times the expression of one or more genes;
(d) elevated levels of mRNA of one or more genes or
(d) elevated levels of the protein of one or more genes.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns a method for identifying lactic acid bacilli. The presented method is based on a combination and a polymorphism of toxin-antitoxin RelBE and MazEF gene superfamilies and characterised by the fact that identifying is ensured by genome DNA amplification with using a set of oligonucleotides of certain structure; PCR products are analysed in agarose gel, while a size of the produced fragment is determined by means of a DNA marker. The analysed strain is referred to a specific group, species or strain in case of producing fragments when using certain oligonucleotides.

EFFECT: presented invention can be used for identifying the lactic acid bacilli strains in human microbiota, food stuff, as well as for detecting the analysed strain in clinical samples, or molecular targeting in commercial preparations.

3 tbl, 3 ex

FIELD: biotechnology.

SUBSTANCE: invention is a set of synthetic oligonucleotides for species identification of roseroot (Rhodiola quadrifida (Pall.) Fisch. et Mey). The set comprises species-specific areas to create a forward, reverse primers and a destructible probe, namely forward primer - CGGCAACGGATATCTCGGCT-3', the reverse primer - 5'-GGCCTCGCAACCACCACTTGTC-3', the destructible probe - (fluorescent label)-5'-CCGTGAACCATCGAGTTTTT-3'-(quencher).

EFFECT: invention enables to identify reliably, fast and with high sensitivity the species of medicinal plant in the course of screening of plant raw material.

1 dwg, 1 ex

FIELD: medicine.

SUBSTANCE: invention concerns a method for Staphylococcus aureus genotyping. The presented method involves preparing a pure culture on a solid nutrient medium with DNA purification and amplification by multiplex polymerase chain reaction (PCR) and result detection by agarose gel electrophoresis. The multiplex PCR involves using four pairs of primers complementary to extracellular thermonuclease (nuc) gene, Panton-Valentine leukocidin (pvl) gene, toxic shock protein (tst) gene and methicillin resistance (mecA) gene sites. Staphylococcus aureus is genotyped by the presence or absence of pvl and tst virulence genes and mecA methicillin resistance genes or combinations thereof.

EFFECT: invention enables Stafylococcus aureus genotyping in a combination with the multiplex reaction, as well as provides eliminating the preliminary stage of microorganism identification.

1 dwg, 2 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention deals with a set of oligonucleotide primers and a fluorescently labelled probe for species-specific express-identification of RNA of the Junin virus by a method of a polymerase chain reaction in real time. The claimed set includes sequences of oligonucleotides, species-specific for the Junin virus and having the following structure: external: 5'→3' 5' TCTTCTTCCCCCYTTTTAGTCTTTCT 3' internal: 5'→3' 5' CGCACAGTGGATCCTAGGCA 3' probe: FAM - TGAGTCCATCTAAAGCTTGGNACCTCCTT - BHQ1.

EFFECT: possibility of the application in medicine and epidemiology for determination of a genetic material of the Junin virus in clinical or sectional samples.

2 dwg, 1 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention deals with a set of oligonucleotide primers and a fluorescently labelled probe for species-specific express-identification of RNA of the Machupo virus by a method of polymerase chain reaction in real time. The claimed set includes sequences of oligonucleotides, species-specific for the Machupo virus and having the following structure: external: 5'→3' 5' TCCTCYTCACCCCTTTTGTTCTTTCT 3' internal: 5'→3' 5' CGCACAGTGGATCCTAGGCA 3' probe: R6G - TGAGTCCACCGRAAGCTGGGRATYTCYTT - BHQ1.

EFFECT: possibility of the application in medical practice for determination of a genetic material of the Machupo virus in clinical or sectional samples.

2 dwg, 1 tbl, 2 ex

FIELD: biotechnology.

SUBSTANCE: granule of biocatalyst with the cells contained in it of one or more species of Rhodococcus is placed in a well of a 96-well plate, a colorant iodine-nitro-tetrazolium (INT) is added. After the appearance of specific purple staining formazan the optical density of granule is measured using a tablet photometer. In the case of a stained substrate or preliminary presence of the immobilised biocatalyst in the soil the extraction of formazan is carried out with 96% ethanol and the optical density of the extract is measured. The amount of viable Rhodococcus in the granule of the gel is determined using the calibration dependency diagram of the optical density on the number of living cells in suspension as determined by traditional method of plating on solid growth medium. Then, from the granule stained by the colorant of the biocatalyst or from the granule after extraction of the colorant the DNA is isolated and PCR is performed using sets of species-specific primers. The specific position of the immobilised Rhodococcus is determined.

EFFECT: invention enables to reduce the time differentiation of Rhodococcus and to improve the accuracy of the method.

2 cl, 3 tbl, 4 dwg, 4 ex

FIELD: biotechnology.

SUBSTANCE: method comprises obtaining samples of highly purified DNA, fragmentation of the isolated DNA with restriction endonuclease having no recognition site in the amplified region, hydrolysis of fragmented DNA by methyl-dependent site-specific DNA-endonuclease GlaI or its isoschizomer, ligation of the universal oligonucleotide adapter to the hydrolysed DNA followed by amplification in real time using a primer and a probe complementary to the test DNA and the hybrid primer, which 3'end is complementary to at least 3 nucleotides of the 3' terminus of DNA in the test area of hydrolysis GlaI, and the remaining part is complementary to an adapter sequence, and making conclusion on the basis of a fluorescent signal on the presence of the sequence Pu(5mC)GPy.

EFFECT: improved method.

4 cl, 4 dwg, 5 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology, more specifically to a response test to the hospital infection in a patient suffering from a septic shock, and can be used in medicine. A biological sample specified in the patient's blood, serum, saliva, tissue or circulating cells is prepared, and a biological material: nucleic acid or protein is extracted from the biological sample. A reagent specific to the S100A9 target gene expression product specified in an amplification primer, a hybridisation probe and/or antibody is used to determine the S100A9 target gene expression.

EFFECT: invention enables stating the response to the hospital infection in the patient suffering from the septic shock as shown by the S100A9 target gene overexpression to a certain threshold.

11 cl, 2 dwg, 3 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to biotechnology and concerns a kit for detecting Q fever by RT PCR. The characterised kit contains synthetic oligonucleotides limiting a fragment of groEL gene: GroEL F 5' CTTCTACTGTTATGACGCCTTCTTTGC 3'; GroEL R 5' CGCAAGTAGGCACCATTTCTGC 3', and a fluorescent probe: GroEL Probe 5' FAM-CACTTTCTCCATCGCTTCCGCAATAATA-TAMRA 3'.

EFFECT: invention can be used in medicine, veterinary science, clinical laboratory diagnostics for the recovery of the bacteria Coxiella burnetii DNA in test samples, as well as for solving scientific problems aiming at examining the given microorganism.

2 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: claimed group of inventions relates to the field of medicine. Claimed are a method and a set for determination of the presence in a patient of a higher risk of possessing cardiovascular disease or disorder by polymorphic variants of genes. Claimed is a method of identifying the patient, requiring early and/or aggressive or preventive therapy of cardiovascular disease and a method of treating such patient.

EFFECT: claimed group of inventions provides effective methods and sets for determining a risk of possessing cardiovascular disease, which makes it possible to identify the patient requiring therapy of cardiovascular disease.

10 cl, 4 dwg, 18 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology and biotechnology. What is presented is an IL-1β-binding antibody or its IL-1β-binding fragment containing V heavy and light chain regions. The above antibody binds to human IL-1β with dissociation constant less than 1pM. Versions of the antibody are described. There are disclosed corresponding coding nucleic acids (NA), as well as: a NA passage vector to a host cell, the host cell producing a coded polypeptide. What is described is using the antibody for preparing the other format of the above antibody: "camel-like", VHH antibody, nanobody. What is disclosed is a pharmaceutical composition for treating or preventing an IL-1β-related disease in a mammal on the basis of the antibody, as well as a method of treating or preventing the IL-1β-related disease in a mammal.

EFFECT: using the invention provides the novel IL-1β-specific antibodies with high IL-1β affinity that can find application in medicine for preventing, treating the diseases mediated by IL-1β activity.

39 cl, 20 dwg, 6 tbl, 14 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to immunology and biotechnology. Claimed are versions of an isolated monoclonal antibody, specific to hGM-CSF, where each version is characterised by a heavy and light chain. Each of the versions is characterised by the fact that it contains six appropriate CDR. Described are: a pharmaceutical composition, and a set, representing medication, based on the antibody application. Disclosed are: a coding isolated nucleic acid, an expression vector, containing it, and a vector-carrying host cell, used for the antibody obtaining. Described is a method of obtaining the antibody with the cell application.

EFFECT: claimed inventions can be applied for treating disease or disorder, associated with superexpression of hGM-CSF.

25 cl, 9 dwg, 14 tbl, 15 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions relates to methods of obtaining preparation of antibody against IL-18 or its antigen-binding part with reduced content of host cell protein (HCP) from sample of mixture, containing antibody against IL-18 or its antigen-binding part, and, at least, one HCP. Method includes reduction of mixture sample pH from 3.0 to approximately 4.0, bringing pH from 4.5 to approximately 5.5 and conductivity to 9±0.5 mS/cm, application of sample on cation-exchange resin, carrying out chromatography of hydrophobic interaction and sample collection. Version of method includes realisation of anion-exchange chromatography before the stage of cation-exchange chromatography. Version of method also includes sample filtration before anion-exchange chromatography.

EFFECT: group of inventions makes it possible to obtain preparation of antibody with increased output and purity Output constitutes 96±4%, purity 99,51±0,26%.

28 cl, 2 dwg, 9 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to biotechnology, gene and protein engineering and specifically to recombinant plasmid DNA pG1-Rm7, which facilitates synthesis of hybrid protein G1-Rm7 in Escherichia coli cells, which is capable of biding the tumour necrosis factor and has bioluminescence of luciferase Renilla muelleri, where said plasmid DNA includes the nucleotide sequence SEQ ID NO: 1 and can be in medicine. The invention also relates to the protein pG1-Rm7 having molecular weight of 65.4 kDa, consisting of a single-strand anti tumour necrosis factor antibody, a GGSGGS peptide and modified luciferase Renalla muelleri and characterised by SEQ ID NO: 2.

EFFECT: invention enables to obtain a highly sensitive reporter for detecting a tumour necrosis factor via bioluminescent analysis.

2 cl, 4 dwg, 3 ex

Anti-mif antibodies // 2509777

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and immunology. Invention discloses a monoclonal antibody and its antigen-binding parts which specifically bind the C-end or central part of the macrophage migration inhibitory factor (MIF). The anti-MIF antibody and its antigen-binding part further inhibit biological function of the human MIF. The invention also describes an isolated heavy and light chain of immunoglobulins obtained from anti-MIF antibodies, and molecules of nucleic acids which encode such immunoglobulins.

EFFECT: disclosed is a method of identifying anti-MIF antibodies, pharmaceutical compositions containing said antibodies and a method of using said antibodies and compositions for treating diseases associated with MIF.

22 cl, 14 dwg, 16 ex

FIELD: biotechnologies.

SUBSTANCE: two antibodies against IL-21 of a human being are presented. The first antibody includes a variable region of a heavy chain, which includes SEQ ID NO: 31, 33 and 35, and a variable region of a light chain, which includes SEQ ID NO: 39, 41 and 43. The second antibody includes a variable region of heavy chain, which includes SEQ ID NO: 47, 49 and 51, and variable region of light chain, which includes SEQ ID NO: 55, 57 and 59. Besides, the invention describes hybridomes producing the first and the second antibodies against IL-21 of a human being and deposited in the collection of cultures "American Type Culture Collection" and have numbers "ATCC Patent Deposit Designation PTA-8790" and "ATCC Patent Deposit Designation PTA-8786" respectively.

EFFECT: invention allows obtaining antibodies to IL-21 of a human being.

48 cl, 4 dwg, 16 tbl, 23 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes variable domains of heavy (VH) and light (VL) chains of murine antibody against tumour necrosis factor alpha (TNF-α) of a human being, as well as antigen-binding fragment Fab, which are selectively bound to TNF-α of the human being and neutralise it.

EFFECT: invention can be further used in development of medicines for therapy of TNF-α-mediated diseases and for diagnostics of such diseases.

3 cl, 5 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: antibody includes a heavy chain covalently connected to a light chain, for which amino-acid sequences have been determined. Antigen-binding variable region demonstrates very high affineness of binding with IL-1α, and contact region is effective both in activation of the complement system by means of C1q binding, and in binding with several different Fc-receptors. Also, a set of allocated nucleic acids (NA) is described, which contains the first NA coding the heavy chain of human IgG mab, and the second NA coding the light chain IgG mab. A set of allocated NA can be contained in the expressing vector or the host cell, in particular, a cell of a mammal, which expresses light and heavy chains of the antibody.

EFFECT: use of the invention allows successful application of such Abs for therapy, prevention or detection of a pathology associated with aberrant expression IL-1α.

7 cl, 13 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers biotechnology and medicine. What is described is an immunogen for inducing the IgE immune response. The immunogen contains at least one IgE antigen peptide bound to an immunogenic carrier. The immunogenic carriers may be presented by virus-like particles specified in a group consisting of HBcAg, HBsAg and Qbeta VLP There are also disclosed compositions and method for preventing, relieving or treating an IgE-associated disorder in an individual with using the above immunogen.

EFFECT: group of inventions may be used in medicine for treating the allergic diseases.

20 cl, 2 dwg, 13 tbl, 14 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology. What is presented is a method of treating a mammal suffering an inflammatory disease wherein the inflammatory disease is atopic dermatitis, eczema, or itch. The method comprises administering to a mammal a recovered monoclonal antibody or antigen-binding fragment thereof which is prepared by inoculating a non-human animal an adjuvant and a polypeptide (zcytor17lig) containing amino acid residues 27-164 SEQ ID NO: 2, followed by recovering said antibodies from said animal.

EFFECT: using the invention can find application in medicine for treating atopic dermatitis, eczema, or itch.

2 cl, 7 dwg, 21 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to pharmaceutical industry, namely to an immunomodulatory composition for injection into a mammal. The immunomodulatory composition for injection into a mammal containing a hydrolysate prepared by acid and/or enzymatic hydrolysis of one or more bioresources specified in a group consisting of bivalve molluscs, annelids, leeches, and water taken in certain proportions. A method for preparing the immunomodulatory composition for injection into a mammal. A method of treating a pathological condition in a mammal in need thereof involving the injections of the immunomodulatory composition into the above mammal. Using the composition for normalising metabolism into the mammal in need thereof.

EFFECT: composition enables extending the range of products with immunomodulatory activity for injections.

19 cl, 7 tbl, 7 ex

Up!