Single-chain antibody to carcinoembryonic antigen, chimeric monomolecular t-cell receptor, vector and host cell for provision of such receptor and method of diagnostics or treatment

FIELD: medicine.

SUBSTANCE: inventions relate to the field of immunology. Claimed are a single-chain antibody, specific to a carcinoembryonic antigen, a chimeric mononuclear T-cell receptor, a vector, a host cell and a method of diagnostics or treatment of diseases, characterised by the presence of antigens, capable of binding with the chimeric receptor. Described is a genetic construction, coding chimeric monomolecular T-cell receptors, in which an effector fragment of the T-cell receptor is combined with an antigen-recognising part, which represents variable fragments of two different antibodies to the carcinoembryonic antigen (CEA).

EFFECT: claimed inventions can be used in T-cell cancer therapy.

7 cl, 4 dwg, 3 ex, 1 tbl

 

The invention relates to the field of passive immunotherapy of cancer, in particular to a method adoptive transfer of cells, which use genetically modified autologous or allogeneic cytotoxic T-lymphocytes, has acquired immunogenicity against tumor cells. And can be used in T-cell therapy of cancer.

Currently identified a large number of tumor-associated antigens, which individually or in combination can be used for the induction of an immune response against the tumor tissue. Developed approaches of immunotherapy, such as vaccination and adoptive transfer of immune cells demonstrated efficacy in several preclinical and clinical studies [1, 2]. However, despite the great interest of researchers to immunotherapeutical approaches and the great potential of immunotherapy, the cases of complete cure of cancer through such approaches are rare events.

A special place in immunotherapy is a method of adoptive transfer of cells, which use genetically modified autologous or allogeneic cytotoxic T lymphocytes with receptors specific to antigens of tumor cells [2]. Studies have shown that the most perspective the major problem is getting the lymphocytes, expressing chimeric immunoglobulin monomolecular T-cell receptors, in which the antigen-recognizing portion representing a variable fragment antibodies, combined with effector fragment of T-cell receptor (usually with ζ-chain) [3]. Recognition of antigen such chimeric receptor due to the immunoglobulin part is independent from the presentation of antigen by cells major histocompatibility complex (MHC), binding to antigen leads to the secretion of the modified T-lymphocyte interleukin-2 (IL-2) and other cytokines and expression of cytotoxic action and join in chimeric receptor complex variety of co-stimulating domains allows to improve the survival of lymphocytes and enhance the cytotoxic effect[4, 5, 6].

To date, designed the set of chimeric immunoreceptor to different tumor antigens, such as antigens from neuroblastoma cell [7], prostatespecific membrane antigen (PSMA) [8, 9], cancer-embryonic antigen (CEA) [10] and others

CEA is a glycoprotein, with a molecular mass of 180 kDa, expressed in all adenocarcinomas of the gastrointestinal tract, in 50% of breast cancer cases and in 70% of cases of non-small cell lung cancer and in the cells of some other types of cancer [11]. Normal CEA is expressed in the tissue, the Yah of the embryo during prenatal development, and after the birth of his products destruida in cells of the gastric pits, the epithelium of the colon and in other areas of the gastrointestinal tract, mainly on the surface of the microvilli. However, the level of expression of CEA in tumor cells far exceeds its expression level in normal tissue (35 and above) [12]. Despite the success of preclinical experimental studies described in the literature chimeric T-cell receptors to CEA have their drawbacks, not allowing you to move on to the stage of clinical application [13, 14]. In this regard remains relevant to the creation of new structures of chimeric immunoglobulin T-cell receptor to other epitopes of CEA. In addition, the expression of the cytotoxic effect of modified cells containing the chimeric receptors, remains high death lymphocytes after antigen binding, caused by the activation of lymphocytes, there is no universal approaches to reduce the cytotoxicity due to the introduction of structures, just not installed a set of signal sequences that enhance cytotoxic effect, it's necessary to increase the affinity of chimeric receptors to the antigen.

The objective of the invention has been based on unique sites encoding amino acid sequence having a high level of contact is of the CEA, including in the solution, the genetic constructs encoding monomolecular chimeric T-cell receptors that recognize different epitopes of CEA, transfection of which activated human lymphocytes leads to expression of these receptors on the surface of lymphocytes.

The technical result of the invention is the recognition by immunoreceptor antigen on the surface of CEA-expressing cells, which leads to the development of a cytotoxic response that causes the death of more than 45% of the target cells.

The result of the invention was that the marked objects biotechnology.

1. Chimeric monomolecular T-cell receptor, including

discriminating fragment of antibodies to cancer-embryonic antigen (SEQ ID NO 1 or SEQ ID NO 2.

2. Chimeric monomolecular T-cell receptor according to claim 1, whose amino acid sequence represented by SEQ ID NO 3.

3. Chimeric monomolecular T-cell receptor according to claim 1, whose amino acid sequence represented by SEQ ID NO 4.

4. Expression vector that encodes a discriminating fragment of antibodies to cancer-embryonic antigen of claim 1.

5. A host cell transformed by the expression vector according to claim 4 and producing discriminating fragment of antibodies to cancer-embryonic antigen of claim 1.

6. A host cell, transformera the fair expression vector according to claim 4 and producing discriminating fragment of antibodies to cancer-embryonic antigen according to claim 1, characterized in that the transfection performed using electroporation.

7. The method of binding expressed chimeric monomolecular T-cell receptor with cancer-embryonic antigen, comprising using at least a host cell according to claim 5, having a receptor according to claim 1.

8. The method of binding expressed chimeric monomolecular T-cell receptor with cancer-embryonic antigen according to claim 7, where a host cell were subjected to preliminary activation.

The essence of the invention is the creation of an original genetic structure that encodes a chimeric monomolecular T-cell receptors, in which the effector fragment of T-cell receptor combined with the antigen-recognizing part, representing the variable fragments of two different antibodies to cancer-embryonic antigen (CEA). It was shown that after transfection with these receptors expressionlist on the surface of cells and was associated with CEA. Also showed high cytotoxic activity of transfected described structures of peripheral blood lymphocytes in relation to CEA-expressing cells.

When carrying out the invention cell line human NST (carcinoma of the colon), NT (adenocarcinoma of the colon), A (carcinoma l is Gogo) and NEC (embryo kidney) were cultured in DMEM. Mononuclear cells of peripheral blood were isolated from heparinized peripheral blood of patients Federal state institution "Russian scientific center of radiology and nuclear medicine" by centrifugation in a gradient of ficoll. Lymphocytes were cultured in RPMI medium. Lymphocytes stimulated to proliferation by addition of 1 μg/ml of phytohemagglutinin (PHA) and activated 50 Units/ml IL-2 (BIOTECH) within 72-120 hours

Table 1
Oligonucleotide primers. Underlined sites recognition restricts XbaI, SmaI, EcoRI. Italicized sequence encoding the linker peptide (G4S)3
The name of the oligonucleotideThe sequence 5'-3'
CD8-FATATTCTAGAGCGAAGCCCACCACGACG
CD8-RGCAGAGTTTGGGATCATCACAGGCGAAGTC
CD247-Fp-GACTTCGCCTGTGATGATCCCAAACTCTGC
CD247-RATATCCCGGGATACTTCAGTGGCTGAGAAG
1C6K-FGCGCGCGAATTCGCCACCATGGAGACAGACACACTCCTGT
1C6K-RAGAGCCACCTCCGCCTGAACCGCCTCCACCCCGTTTCAGCTCCAGCTT
1C6G-FGGCGGAGGTGGCTCTGGCGGTGGCGGATCGGATGTGCAGCTTCAGGAGT
1C6G-RGCATTCTAGATGAGGAGACGGTGACCGTGG
3C1G-FGCGCGCGAATTCGCCACCATGAAGTTGTGGCTGAACTGG
3C1G-RAGAGCCACCTCCGCCTGAACCGCCTCCACCTGAGGAGACGGTGAC
3C1K-FGGCGGAGGTGGCTCTGGCGGTGGCGGATCGCAAATTGTTCTCTCC
3C1K-RGCGCGCTCTAGACCGTTTTATTTCCAGCTTGG

Obtaining genetic structures. Total RNA from the cells and hybrid cultures was isolated using the RNeasy kit Mini Kit. The synthesis of the first chain cDNA was performed using primer oligo-dT and revertase RevertAid H(Fermentas). PCR was performed using polymerase TaqSE (SibEnzyme) and oligonucleotide primers listed in table 1.

The cDNA fragments of light and heavy chains, encoding the variable domains VL and VH immunoglobulin IgG1, were amplified from RNA preparations hybrid S and S using a set of degenerate primers and methods described previously [15]. Obtained PCR products were cloned in the plasmid vector pAL-TA (Evrogen) using standard methods [16] and sequenced.

To obtain constructs encoding the chimeric immunoreceptor, fragments of cDNA CD8 and CD247 amplified in the matrix cDNA from human lymphocytes using primers CD8-F, CD8-R, CD247-F, CD247-R. the Obtained products were the leaders among themselves, were reamplification using primers CD8-F, CD247-R and cloned into the vector pCI (GE-Amersham) according to the restriction sites XbaI and SmaI. Variable fragments of cDNA lung (κ) and heavy (γ) chains of antibodies C and S amplified by using the primers of Table 1. PCR products were mixed in pairs for annealing overlapping terminal areas and reamplification using pairs of primers 1C6K-F/1C6G-R and 3C1G-F/3C1K-R, respectively. The resulting fragments cloned in plasmid pCI/CD8-CD247 sites EcoRI and XbaI. Designed in the end, the plasmid pCI/1C6-CD8-CD247 and pCI/3C1-CD8-CD247 abbreviated called rsea-1 and rsea-2. Sequencing of recombinant plasmids was performed using an automatic sequencing machine CEQ8000 (Beckman-Coulter).

Transfection of cells NECK was performed using PolyFect reagent (QIAGEN) according to the manufacturer's Protocol. After treatment, cells were incubated under standard conditions for 24 to 48 hours as a positive control was used a plasmid encoding green fluorescent protein (GFP).

Transfection of lymphocytes of peripheral blood was performed by the method of electroporation on the device Amaxa Nucleofector using a set of Human T Cell Nucleofector Kit (Lonza) according to manufacturer's instructions. For transfection of one sample used 4-5 million cells and 2 μg of plasmid DNA. The directly the public after the pulse, cells were cultured in complete RPMI medium under standard conditions for 4-5 h, then the cells were added IL-2 to a concentration of 100 Units/ml 24 h after electroporation culture medium containing IL-2 was replaced by a new one without adding interleukin. Cells were cultured for another day, and then were subjected to analysis. Expression constructs encoding chimeric T-cell receptors was confirmed by polymerase chain reaction, coupled with reverse transcription (RT-PCR) after 48 h after transfection.

Cytofluorometric studies were performed on a flow cytometer DAKO Galaxy (Dako). Fixation and permeability of cell labeling with antibodies was performed using a corresponding set of firms DakoCytomation. In this work, we used antibodies to the ζ-chain of the T-cell receptor human, mouse antibodies to IgG (Dako), biotinylated antibody 1C11 and S (Beckman Coulter) polyclonal antibodies to CEA AS229 (Beckman Coulter).

To assess the ability of the study of monomolecular chimeric T-cell receptors expressed by cells NECK, associate REA cells after 24 after transfection were incubated 30 min with a solution REA labeled with a fluorescent dye FITZ (REA-FITZ, at a final concentration of 0.06 μg/μl), and analyzed on a flow cytometer.

Assessment of ability to bind to surface-expressed CEA biotinylating monoclonal antibodies to the ranks epitopes of CEA, as well as the ability of the constructed monomolecular chimeric T-cell receptors to bind CEA after transfection of lymphocytes was performed by indirect immunocytochemical staining. To do this, expressing CEA cells or lymphocytes expressing monomolecular chimeric receptors, 48 h after electroporation was washed with a solution of the FSB and stained biotinylating antibodies (about 3 µl per 106 cells) for 20 min at room temperature. For detection of bound peroxidase antibodies washed cells were stained with streptavidin labeled with phycoerythrin (PE), in accordance with the manufacturer's recommendations (Beckman Coulter). Stained cells were analyzed on a flow cytometer. As a negative control used cells, to which was added only streptavidin conjugated with PE.

Analysis of cytotoxic activity of lymphocytes by double staining CFDA-SE:PI. 48 h before the setting of the experiment, cells NST was removed from the substrate by a standard method, were counted and stained operations ether carboxyfluorescein-diacetate (CFDA-SE) in the FSB at a concentration of 0.625 mg/ml for 7-8 min in the incubator. The reaction was stopped by adding equal volume of serum. Cells were washed from neuklyuzhego dye and placed in Petri dishes at a concentration of 2-3 is 10 5cells/ml. Portion of unstained cells were placed in the same concentration as the control. On the day of the performances of the experiment, cells NST unpainted and painted (HCT116/CFDA-SE) was removed from the substrate in a standard way and mixed with lymphocytes in the required proportions. The cytotoxicity experiments were performed in RPMI medium with addition of 10% ETS. Mixed cultures were incubated under standard conditions for the necessary time. After the incubation time environment with the lymphocytes were collected and preserved, and attached cells NST washed and removed from the substrate a minimum quantity of a solution of trypsin: EDTA standard way. Then the separated cells were combined with the previously selected by the suspension of the lymphocytes were stained with iodide of propecia (PI, 2.5 μg/ml) and analyzed on a flow cytometer.

Results

A series of mouse monoclonal biotinylated antibody (isotype IgG1), able to connect with REA in the solution was provided by LLC "xema-Medica" (Russia, Moscow). The series includes the following antibodies: S, S, S, S, S, S, S, S, S, S, S, S, S [17]. For analysis of the ability of antibodies available series to bind CEA on the surface of expressing his cells were selected three cell lines man: NT, A and NCT. Antibody S were selected as having a high level of binding of CEA with all the research which has been created cell lines. Antibody S was chosen because the highest affinity of all antibodies series for binding to CEA in solution. The cDNA fragments of immunoglobulin genes coding for variable sites of antibody domains (VL and VH1) of the hybrid S and S, were PCR-amplified and cloned to determine the complete nucleotide sequence.

Design rsea-1 and rsea-2 were established on the basis of the recognition sites of the antibody S and S respectively by cloning in plasmid pCI plots encoding i) variable fragments of κ- (lungs) and γ (heavy) chains selected monoclonal antibodies to CEA, separated by linker peptide (648)3 (single-stranded mini-antibodies in scFv format), (ii) the "hinge" part of the protein CD8 and (iii) protein site CD247 (ζ-chain T-cell receptor), including the transmembrane and cytoplasmic domains (figure 1).

To confirm the proper functioning of chimeric immunoreceptor encoded created structures was performed transfection of cells NC. 24 h after transfection by flow cytometry was investigated binding to cells antibodies to the ζ-chain of the T-cell receptor. It was shown that a positive signal was detected in transfected with both plasmids cells, whereas the signal in the control group of cells stained izotopicheskii control antibodies, tsotsitaal (figa, b). In addition transfetsirovannyh both structures HEK293 cells connected REE in solution, which was shown after incubation for 30 min the cells with a solution REA labeled FITZ (FIGU, g).

Next was held transfection of established genetic structures of human lymphocytes. Used the mononuclear blood cells are stimulated to proliferation using PHA and activated recombinant IL-2 (50 U./ml) for 3 days. After this time the number of CD3+T-lymphocytes among the entire population was about 60%. After 24 h after transfection in the course of carrying out RT-PCR in the cells was detected the expression of the genes encoding the chimeric immunoreceptor with both plasmids.

The ability of transfected lymphocytes to bind CEA after 24 h after electroporation was confirmed by indirect immunocytochemical staining (figure 3). The number of modified cells, contacting REA, was about 4 times higher for pre-activated IL-2 lymphocytes compared with restimulating cells.

The study of cytotoxicity of lymphocytes transfected investigated plasmids was performed using the dual-color CFDA-SE/PI cells NST expressing surface REA. It was shown that when it is time to relax the Institute to cells NST, stained with CFDA-SE, transfected cells in a ratio of 1:10 maximum cytotoxic effect was achieved after 5 h joint incubation. The percentage of living cells NST after exposure of lymphocytes transfected with the plasmid Rea-1 amounted to 47.9%, and in the case of lymphocytes, transfitsirovannykh rsea-2, - 56.9% (figure 4). The average percentage of living cells NST, inkubiruemykh in the presence of control lymphocytes, amounted to 86.7%when incubated with lymphocytes exposed to an electric pulse, but without the addition of DNA, the percentage of live NST amounted to 70.9%.

Brief description of drawings

Figure 1. The scheme of the plasmid that encodes the chimeric immunoreceptor (a), and the detailed structure of the gene of chimeric immunoreceptor (b), sp - signal peptide, κ, γ - variable fragments of cDNA light and heavy antibody chains, respectively; CD8 - "hinge" region of the antigen CD8; CD247 - ζ-chain T-cell receptor; TM, transmembrane domain; PCMV - CMV promoter; SV40 polyA signal of the SV40 polyadenylation; Ampr - gene resistance to ampicillin; BglII, HinDIII EcoR1, Xbal, Smal sites of appropriate restriction endonucleases.

Figure 2. Data cytofluorometric analysis of cells NEC 24 hours after transfection monomolecular chimeric T-cell receptors, and 6 - binding to cells antibodies to the ζ-chain of the T-cell receptor on the use of the f plasmid, rsea-2: a - cells adding antibodies to the ζ-chain, b - cells adding izotopicheskii control antibodies. R1 - area cells, contacting antibodies to ζ-chain. in, g - binding cells modified with the plasmid Rea-1 with REE in solution in transfetsirovannyh cells; g - nitrostilbene cells (negative control). The axes represent the values of the fluorescence channels: on the x-axis FL2, y-axis FL1.

Figure 3. Data cytofluorometric analysis of human lymphocytes, activated IL-2 and transfected monomolecular chimeric T-cell receptors by binding to CEA in solution after 24 hours after transfection. a, b - lymphocytes, transfetsirovannyh plasmide rsea-1 and rsea-2, respectively; nitrostilbene lymphocytes (negative control). RN1 - area cells with fluorescence above the threshold. On x-axis values of fluorescence in the FL2 channel, y-axis the number of fluorescent particles.

Figure 4. Cytotoxicity of lymphocytes transfected with the plasmids of rsea-1 (CNT:P1-1), rsea-2 (CNT:P1-2), in relation to expressing CEA cells NST (after 5 h after adding the ratio of effector cells and target cells 10:1). The average interest literami cells from the total number of target cells and standard deviations. HCT:K-pulse - cytotoxicity of lymphocytes exposed to e is tricesimo pulse without added DNA. Nst - cells NST without adding lymphocytes. * - p<0.05 compared to control nitrostilbene lymphocytes (HCT:K-lymph).

Example 1. Cell line

We used cell lines NEC (kidney cells of a human embryo), Jurkat (CD4(+) cell line T-cell leukemia), courtesy of the Institute of epidemiology and Microbiology named Nofamily.

All work with cell cultures were performed under sterile conditions in a laminar box in a specially equipped to work with the cells of the room.

Cultivation NC

Media for cultivation of NEC had the following composition: DMEM (Paneco, Russia), 10% fetal bovine serum (Paneco) and the antibiotics penicillin and streptomycin in a standard concentration. Cells were cultured under conditions of high humidity at 37°C and 5% CO2. When reaching 80-90% of confluently cells were passively. For this, cells 2 times washed with a solution of sterile phosphate-saline buffer (FBS, Invitrogen), and treated with 0.25% solution of trypsin-EDTA. To improve the efficiency of the enzymes at this stage vials of cells were placed at 37°C for 4-5 minutes. After removing all cells from the substrate trypsin iactiveaware the addition of medium with serum, and then the cells were broken to obtain a homogeneous suspension, selected the required number of cells, and to ostalim the I cells was added the appropriate number of complete culture medium and continued cultivation.

Freezing and thawing NEC

Environment for frost had the following composition: 90% complete environment for the cultivation and 10% DMSO (Paneco).

From the cultivated cells were selected Wednesday, washed 2 times with PBS, was added 0.25% solution of trypsin-EDTA. Incubated at 37°C for 5 minutes, pietravalle to obtain a unicellular suspension neutralized trypsin complete culture medium containing serum. The resulting suspension was centrifuged for 5 minutes at 1000 rpm the Supernatant was removed, the residue is suspended in an appropriate amount of protection for freezing, transferred in cryoprobe at a concentration of 106cells in 1 ml of medium and immediately placed at -70°C for 24 hours. After 24 hours of cryoprobes transferred to liquid nitrogen for long term storage. In one cryoprobe froze 1.0-2.0 million cells.

Cryoprobes thawed in a water bath at 37°C, were sterilized by 70% ethanol, then their contents transferred into a test tube containing medium for cultivation warmed to 37°C, centrifuged for 5 minutes at 1000 rpm, the supernatant was removed, the residue is suspended in an appropriate amount of medium and transferred into a vial with the environment. Cells are evenly distributed on the culture surface and placed in an incubator at 37°C, 5% CO2. After 24 h, when cells were attached to the substrate and to racialprofiling, replaced the environment to eliminate dead in the freezing process of the cells.

Cultivation of lymphocytes

Media for cultivation of lymphocytes had a composition identical to the composition of the medium for culturing Jurkat.

The selection of lymphocytes from the peripheral blood of man

Human lymphocytes were obtained as follows. Fresh human blood was collected in a 5 ml sterile tube, and treated with an anticoagulant (sodium citrate). Whole blood or defended at room temperature for one hour to precipitate the cells, and then selected the plasma containing white blood cells, or took the blood directly after extraction and were diluted in PBS at a ratio of 1:2, the resulting solution was layered on a solution of ficoll-urografin (Paneco) in the ratio 2:1. Separation of the cells was performed by centrifugation for 30 min at 1500 rpm, and then took a ring of lymphocytes. Washed cells from ficoll in 5 ml PBS 2 times, the cells were besieged by centrifugation for 10 min at 1000 rpm Precipitate suspended in an appropriate amount of medium for culturing lymphocytes. The purity of the selection of lymphocyte population and the calculation of the concentrations was carried out on the device Micros. Usually among the selected cells, the percentage of lymphocytes was about 80-90%. Lymphocytes are either directly used for experience, or placed in culturalresource and incubated under standard conditions (37°C, 5% CO2).

Example 2. The introduction of exogenous DNA into the cells

Transfection of NECK

Liposomal transfection

PolyFect (Quagene). PolyFect transfection (Quagene) was carried out according to the enclosed Protocol of the manufacturer. The cells were passively 1 day before transfection, transplanting about 1.0-1.2 x 105cells per well of a 24-hole tablet in 500 μl of culture medium, and incubated at 37°C, 5% CO2. The percentage of confluently on the day of transfection was about 60-80%. Always used 2 control sample: the first cell, transfetsirovannyh plasmid DNA encoding green fluorescent protein (pmaxGFP (Amaxa)), the second - nitrostilbene cells. Transfection of a single sample according to the Protocol was carried out as follows. In serum-free medium containing no antibiotics (DMEM), was dissolved 0.4 µ g plasmid to a total volume of 15 µl. To the DNA solution was added 4 μl agent PolyFect, carefully suspended, incubated for 5-10 min at room temperature. The cells were replaced with medium with fresh complete culture medium to a total volume of 400 ál. After 5-10 minutes to complexes of DNA-PolyFect was added 100 μl of complete medium was pietravalle and immediately added to the cells. Was stirring his, shaking the tablet, and placed in the incubator for 24-48 hours.

Lipofectin (Invitrogene). Transfection using lipofectin was performed according to the supplied Protocol PR the manufacturer. The cells were placed for 24 hours before transfection in an amount of about 1.0 to 1.2 x 105cells per well of a 24-hole tablet in 500 μl culture medium and incubated under standard conditions. The percentage of confluently on the day of transfection was about 60-80%. Always used 2 control sample: the first cell, transfetsirovannyh plasmid DNA encoding green fluorescent protein (pmaxGFP), the second - nitrostilbene cells. For one transfection 0.4 μg of plasmid DNA was dissolved in 20 μl of serum-free medium in the absence of antibiotics. 4 μl of Lipofectin was dissolved in 20 μl of medium without serum and antibiotics, leaving the solution at room temperature for 30-45 minutes then connected the solution of DNA and Lipofectin, they were carefully mixed and incubated at room temperature for 10-15 minutes drive From cells selected Wednesday, washed with 400 μl of medium without serum and antibiotics. After a time of incubation of the complexes with DNA-lipofectin was added 160 μl (per well) in serum-free medium, gently mixed, and added to cells. Cells were incubated under standard conditions for 24 hours, then was replaced with medium full medium for the cultivation and incubated another 24 hours. Then the cells were removed from the substrate in a standard way and analyzed the expression of plasmid DNA.

Lipofectamine (Invitrogene). Transfection using lipofectamine is remodels according to the Protocol of the manufacturer. The cells were placed for 24 hours before transfection in an amount of about 1.0 to 1.2 x 105cells per well of a 24-hole tablet in 500 μl culture medium and incubated at 37°C, 5% CO2. The percentage of confluently on the day of transfection was about 60-80%. Always used 2 control sample: the first cell, transfetsirovannyh plasmid DNA encoding green fluorescent protein (pmaxGFP (Amaxa), the second - nitrostilbene cells. For one transfection 0.4 μg of plasmid DNA was dissolved in 25 µl of serum-free medium in the absence of antibiotics. Lipofectamine was carefully mixed, per transfection took 4 μl of Lipofectamine, was dissolved in 25 μl of medium without serum and antibiotics, gently stirred. Then connected the solution of DNA and Lipofectamine, gently mixed and incubated at room temperature for 15-45 minutes After that to complexes of DNA-Lipofectamine was added 150 μl of serum-free medium. The environment of the cells was replaced with 200 μl of medium without serum and antibiotics was added to the complexes of DNA-Lipofectamine and was stirring his, shaking the tablet. Cells were incubated under standard conditions for about 5 hours, then added protection and appropriate amount of serum to 10% and the total medium volume of 500-600 ml. Analysis of expression of plasmid DNA was performed next 24 hours later.

Electroporation

Electroporation NECK was conducted on the instrument the Amaxa Nucleofector (Lonzabio), using a set of "Human T Cell Nucleofector Kit (Amaxa)according to the supplied Protocol. The cells were passively 24 hours before transfection in a standard way in a sufficient concentration to ensure that on the day of transfection was achieved 80-90% of confluently. Always used 2 control sample: the first cell, transfetsirovannyh plasmid DNA encoding green fluorescent protein (pmaxGFP), the second - nitrostilbene cells. Pre-cooked and warmed up to room temperature Nucleofection Solution (for drasticly one sample was added to 18 μl Supplement to 82 μl of Human T Cell Nucleofector Solution from a set of Human T Cell Nucleofector Kit). The cells were removed from the substrate in a standard way, counted their number, put the desired number of cells in a separate test tube and precipitated by centrifugation at 1000 rpm for 5 minutes per transfection took about 1-2 million cells. After centrifugation of sludge cells were selected dry environment, was added 100 μl of a solution of Nucleofection Solution and suspended cells to obtain a homogeneous suspension. Then the cell suspension was added to 2 μg of plasmid DNA and transferred into a cuvette (Human T Cell Nucleofector Kit), avoiding bubbles. The cuvette was placed in the holder device Amaxa Nucleofector. For transfection used the Q-001. Immediately after the pulse in the cuvette was added 500 μl of pre-warmed to whom atoi temperature of culture medium, transferred in Petri dishes with a diameter of 3 cm, containing 1.5 ml of culture medium, pre-warmed to 37°C. Then the cells were placed in an incubator at 37°C, 5% CO324-48 hours.

Transfection of human lymphocytes

Transfection was performed using the program V-024, providing high efficiency transfection of T-lymphocytes on the device Amaxa Nucleofector. For transfection of one sample used 2-3 million cells. Other terms and procedure of transfection of human lymphocytes were identical to the conditions for NEC.

Cytofluorometric analysis

Cytofluorometric analysis was performed on a flow cytometer DAKO Galaxy (Denmark), in which the radiation source is used argon laser (λ=488 nm). The obtained data were processed using the program FloMax, version 3.0. Cells were besieged by centrifugation at 1000 rpm for 5-10 minutes the Precipitate was washed in 1 ml PBS twice. To the precipitate obtained was added 2 ml of PBS and carefully pietravalle. The resulting preparation of cells either immediately analyzed on a flow cytometer, or the cells were then subjected to fixation and permeabilization and colouring using antibodies (see below).

Tagging antibodies With-chain T-cell receptor

Fixation and permeability of cell labeling with antibodies was performed using a set of "Fixation and permeailization kit for flow cytometry" (DakoCytomation) according to the attached instructions. The dry residue of the analyzed cells, containing not more than 2 million cells suspended in 100 μl of PBS solution was divided into 2 equal parts (prototype and izotopicheskii control) and to each part was added 100 μl of fixative reagent A. the Cells thoroughly suspended and incubated at room temperature for 15 minutes, the Samples were washed in 2 ml PBS, the cells were besieged by centrifugation at 1000 rpm for 5 minutes, removing the supernatant to a liquid residue in 50 ál. The cells are then suspended to obtain a homogeneous suspension was added 100 μl permeabilizing solution to each sample and then the sample was added to the antibody on the ζ-chain of the mouse antibody to IgG (Dako) as the isotopic control, respectively, thoroughly suspended. Samples were incubated for 15 min in the dark, then washed in 2 ml PBS, besieged cells by centrifugation at 1000 rpm for 5 minutes. To the precipitate obtained was added 2 ml of PBS and carefully pietravalle. After this, preparations were immediately analyzed on a flow cytometer as described above.

Example 3. The binding of the expressed receptors with CEA-FITZ

To assess the ability of expressing chimeric T-cell receptors to bind CEA cells after 24 and 48 hours after transfection were incubated with a solution of cancer-embryonic Antiga is a, labeled with a fluorescent dye FITZ (REA-FITZ), for 30 minutes. After that the cells were analyzed on a flow cytometer.

References

1. Murphy, A., Westwood J.A., Teng M.W., M. Moeller, Darcy P.K., Kershaw M.H. Gene modification strategies to induce tumor immunity // Immunity. - 2005. - V.22. - N.4. - P.403-414.

2. Yee .Adoptive therapy using antigen-specific T-cell clones // J. Cancer - 2010. - V.6. - N.4. - P.367-373.

3. Chhabra A. TCR-engineered, customized, antitumor T cells for cancer immunotherapy: advantages and limitations // Scientific World Joumal. - 2011. - V.11. - P.121-129.

4. Altenschmidt, U., Moritz, D., Groner B. Specific cytotoxic T lymphocytes in gene therapy // J. Mol. Med. - 1997. - V.75. - N.4. - P.259-266.

5. Chen J., Dave S.K., Simmons A. Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide // J. Virol - 2004. - V.1. - P.11.

6. Ma Q.Z., Gonzalo-Daganzo R., Junghans R.P. Genetically engineered T cells as adoptive immunotherapy of cancer // In: Giaccone, R.; Schlinsky, R.; Sondel, P., editors. Cancer Chemotherapy &Biological Response Modifiers, Annual 20. Oxford: Elsevier Science. - 2002. - P.319-345.

7. Rossig C., Bollard C.M., Nuchtem J.D., Merchant D.A., M.K. Brenner Targeting of GD2-positive tumor cells by human T lymphocytes engineered to express chimeric T-cell receptor genes // Int J Cancer. - 2001. - V.94. - N.2. - P.228-236.

8. Gade T.P., W. Hassen, E. Santos, Gunset G., Saudemont, A., M.C. Gong, Brentjens R., Zhong X.S., Stephan M., J. Stefanski, Lyddane C., Osbome J.R., Buchanan I.M., Hall, S.J., W.D. Heston, Riviere I., Larson S.M., J.A. Koutcher, Sadelain M. Targeted elimination of prostate cancer by genetically directed human T lymphocytes // Cancer Res. - 2005. - V.65. - N.19.- P.9080-9088.

9. Ma Q., Safar M., Holmes, E., Wang Y., A.L. Boynton, Junghans R.P. Anti-prostate specific membrane antigen designer T cells for prostate cancer therapy // Prostate. - 2004. - V.61. - N.1. - P.12-25.

10. Ma Q., DeMarte L., Wang Y., C.P. Stanners, Junghans R.P. Carcinoembryonic antigen-immunoglobulin Fc fusion protein (CEA-Fc) fo identification and activation of anti-CEA immunoglobulin-T-cell receptor-modified T cells, representative of a new class of Ig fusion proteins // Cancer Gene Ther. - 2004. - V.11. - N.4. - P.297-306.

11. Schwartz M.K. Cancer markers // In: DeVita, VT.; Hellman, S.; Rosenberg, SA., editors. Cancer: Principles and Practice of Oncology. Lippincott. - 1993. - P.531-542.

12. World s The Carcinoembryonic antigen (CEA) family: structures, suggested functions and expression in normal and malignant tissues // Seminars in Cancer Biology. - 1999. - V.9. - N.2. - Page 67-81.

13. Emtage P.C., Lo A.S. Gomes E.M., D.L. Liu, Gonzalo-Daganzo R., Junghans R.P. Second-generation anti-carcinoembryonic antigen designer T cells resist activation-induced cell death, proliferate on tumor contact, secrete cytokines, and exhibit superior antitumor activity in vivo: a preclinical evaluation // Clin Cancer Res. - 2008. - V.14. - N.24. - P.8112-8122.

14. Ma Q., DeMarte L, Wang Y., C.P. Stanners, Junghans R.P. Carcinoembryonic antigen-immunoglobulin Fc fusion protein (CEA-Fc) for identification and activation of anti-CEA immunoglobulin-T-cell receptor-modified T cells, representative of a new class of Ig fusion proteins // Cancer Gene Ther. - 2004. - V.11. - N.4. - P.297-306.

15. Chen J., Dave S.K., Simmons A. Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide // J. Virol - 2004. - V.1. - P.11.

16. Sambrook J., Russell D.W. Molecular cloning: a laboratory manual // Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. - 2001.

17. Bjemer J., Lebedin Y., L. Bellanger, Kuroki M., Shively J.E., Varaas So, Nustad K., World S., Bormer O.P. Protein epitopes in carcinoembryonic antigen. Report of the ISOBM TD8 workshop // Tumour Biol. - 2002. - V.23 supported. - N.4. - P.249-262.

1. Single-chain antibody to a cancer-embryonic antigen that is encoded by the nucleotide sequence of SEQ ID NO: 1 or SEQ ID NO: 2.

2. Chimeric monomolecular T-cell receptor specific to cancer-embryonic antigen, including single-chain antibody encoded by the nucleotide placenta is the sequence SEQ ID NO: 1 or SEQ ID NO: 2, according to claim 1.

3. Chimeric monomolecular T-cell receptor according to claim 2, encoded by the nucleotide sequence of SEQ ID NO: 3.

4. Chimeric monomolecular T-cell receptor according to claim 2, encoded by the nucleotide sequence of SEQ ID NO: 4.

5. Vector to ensure the expression of a chimeric monomolecular T-cell receptor specific to cancer-embryonic antigen according to claim 2 to 4, comprising the nucleotide sequence represented by SEQ ID NO: 1 or SEQ ID NO: 2.

6. A host cell producing chimeric monomolecular T-cell receptor specific to cancer-embryonic antigen according to claim 2 to 4, containing the vector according to claim 5.

7. A method for the diagnosis or treatment of diseases characterized by the presence of antigens which are capable of contacting the chimeric monomolecular T-cell receptor according to claim 2 or 3, or 4.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to chemical-pharmaceutical industry and represents a preparation for involving a mesenchymal stem cell of the bone marrow into peripheral blood from the bone marrow, which is introduced into the blood vessel or muscle and which contains any of components: (a) protein HMGB1; (b) HMGB1 protein-secreting cell; (c) a vector, into which HMGB1 protein-coding DNA is inserted; (d) protein HMGB2; (e) HMGB2 protein-secreting cell; (f) a vector, into which HMGB2 protein-coding DNA is inserted; (g) protein HMGB3; (h) HMGB3 protein-secreting cell; and (i) a vector, into which HMGB3 protein-coding DNA is inserted.

EFFECT: elaboration of the preparation for involving the mesenchymal stem cell of the bone marrow into peripheral blood from the bone marrow.

3 cl, 6 ex, 1 tbl, 14 dwg

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology. Method includes introduction of RNA molecule into a bird egg. Introduced RNA molecule contains double-stranded region and results in reduction of the level of molecule of RNA and/or protein, included into determination of sex in birds, in the egg. Invention can be used in poultry breeding.

EFFECT: claimed is method of changing sex characteristics in birds.

7 cl, 3 dwg, 6 tbl, 2 ex

FIELD: food industry.

SUBSTANCE: invention refers to the field of biotechnology and food industry. Presented is a barley plant that yields grain and is homozygotic in at least two loci for the genetic variations having been bred, representing: a) allele wherein most of or all the genes coding B-hordein in Locus Hor2 are removed, and b) mutant allele in the barley Locus Lys3 so that the grain contains neither B-, nor C- hordeins, the said genetic variations present in Lines Riso 56 and Riso 1508 barley accordingly; absence of B-hordeins is to be revealed by absence of amplified DNA using primers: 5'B1hor: 5'-CAACAATGAAGACCTTCCTC-3', 3'B1hor: 5'-TCGCAGGATCCTGTACAACG-3', while absence of C-hordeins is to be revealed by absence of the 70 kDa strip during study of the grain alcohol-soluble extract by means of SDS-PAGE. Additionally presented are: barley grain cropped from the said plant; B- and C-hordein-free products produced from the said grain such as flour, malt and beer. Additionally described are methods for production of food products barley (flour, whole-grain flour, starch, malt) and beverages using grain cropped from the barley plant having the above characteristics. Proposed is a method for identification of barley grain suitable for production of a malt-based food product and/or beverage suitable for consumption by a person suffering from gluten-sensitive enteropathy which method includes: a) production of one or more materials: i) sample of a plant capable to yield the said grain, ii) grain, iii) malt produced from the grain, and/or iv) extract of the said grain; b) analysis of Stage a) material for presence of at least one hordein and/or at least one hordein-coding gene with selection of grain having the gene pattern of the above plant.

EFFECT: invention allows to manufacture B- and C-hordein-free malt-based food products or beverages.

27 cl, 14 dwg, 10 tbl, 10 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of immunology. Claimed is a version of Fc polypeptide of human IgG with substitutions 2591 and 308F, where numeration of positions is given in accordance with EU Kabat index. Described is a version of the said polypeptide, including one or several substitutions of the following: 428L, 434S, 307Q, 319L, 250I in addition to the said ones. Disclosed are: a nucleic acid, coding the said versions, a host cell for production of the said versions of polypeptide, which contains the coding nucleic acid, a method of obtaining the said versions of polypeptide, including application of the cell expressing the said polypeptide and containing the nucleic acid, which codes the said polypeptide.

EFFECT: application of the invention provides polypeptide, demonstrating higher affinity with human FcRn, which can be applied in therapy of different diseases.

11 cl, 32 dwg, 14 ex

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biology and chemistry and deals with isolated nucleic acid, coding fluorescent protein with biosensor properties, expression cassettes, providing expression of said fluorescent protein, cells, producing said protein, and peculiarly fluorescent protein with biosensor properties. Obtained fluorescent protein has amino acid sequence, given in SEQ ID NO:4, and intended for changing NAD+/NADH ratio inside cells by increasing signal with displacement of NAD+/NADH ratio towards decrease of NADH concentration.

EFFECT: claimed invention makes it possible to carry out analysis of processes in cell in real time mode.

4 cl, 6 dwg, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology. Described is molecule of chimeric nucleic acid of porcine circovirus (PCV2Gen-1Rep), which includes molecule of nucleic acid, coding porcine circovirus of type II (PCV2), which contains sequence of nucleic acid, coding protein Rep of porcine circovirus of type 1 (PCV1). Chimeric molecule of nucleic acid is constructed by replacement of gene Rep ORF1 PCV2 with gene Rep ORF1 PCV1. Invention also includes biologically functional plasmid or viral vector, which contain unique molecules of chimeric nucleic acids, suitable host cells, transformed by plasmid or vector, infectious chimeric porcine circoviruses, which produce suitable host cells, method of obtaining immunogenic polypeptide product with application of novel chimera, viral vaccines, protecting pig against viral infection or syndrome of postweaning multisystem wasting syndrome (PMWS), caused by PCV2, methods of protecting pigs against viral infection or postweaning multisystem wasting syndrome (PMWS), caused by PCV2, methods of obtaining unique chimera PCV2Gen-1Rep and the like. Invention can be applied in veterinary.

EFFECT: invention additionally includes novel method of increasing level of replication and PCV2 titre in cell culture.

21 cl, 2 dwg, 6 ex

Fused rage proteins // 2513695

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biochemistry. Claimed is fused protein for treating diseases, mediated by advanced glycation end products (AGE), consisting of a fragment of a version of human receptor of advanced glycation end products (RAGE), which has two point mutations H217R and R221H, and a fragment of constant domain of human immunoglobulin IgG4, joined with linker if necessary. In addition, considered are: nucleic acid and recombinant host cell for obtaining fused protein, as well as pharmaceutical composition for treatment of AGE-mediated diseases, which contain fused protein.

EFFECT: invention ensures lower aggregation of fused protein.

13 cl, 19 dwg, 3 ex, 9 tbl

FIELD: chemistry.

SUBSTANCE: claimed invention relates to field of biotechnology, in particular to novel peptide analogue of insulin-like growth factor-1 (IGF-1), which contains amino acid substitution of methionine in position 59 on Asn, Leu, Nle, Ile, Arg, A6c, Glu, Trp or Tyr, as well as other additional substitutions, inserts and deletions. Said peptide or its pharmaceutically acceptable salt is used in composition of pharmaceutical composition for treatment of IGF-1-mediated diseases, as well as in method of treating dwarfism.

EFFECT: invention makes it possible to obtain IGF-1 analogue-agonist, possessing higher biological activity with respect to native IGF-1.

17 cl, 2 tbl

FIELD: medicine.

SUBSTANCE: present group of inventions relates to biotechnology. What is presented is a humanised anti-CD79b antibody and its antigen-binding fragment produced of murine antibody MA79b and CD79b having a substantially analogous binding affinity thereto. A polynucleotide, a vector, a host cell and a method for producing the anti-CD79b antibody according to the invention; immunoconjugates, compositions and methods for cell growth inhibition, a method of treating an individual suffering cancer, a method of treating a proliferative disease and tumour in a mammal, a method for B-cell proliferation inhibition; a method for detecting the presence of CD79b in a sample and method for binding the antibody to the CD79b expressing cell are also disclosed.

EFFECT: given invention can find further application in therapy of the CD79b associated diseases.

86 cl, 20 tbl, 9 ex, 51 dwg

Anti-mif antibodies // 2509777

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and immunology. Invention discloses a monoclonal antibody and its antigen-binding parts which specifically bind the C-end or central part of the macrophage migration inhibitory factor (MIF). The anti-MIF antibody and its antigen-binding part further inhibit biological function of the human MIF. The invention also describes an isolated heavy and light chain of immunoglobulins obtained from anti-MIF antibodies, and molecules of nucleic acids which encode such immunoglobulins.

EFFECT: disclosed is a method of identifying anti-MIF antibodies, pharmaceutical compositions containing said antibodies and a method of using said antibodies and compositions for treating diseases associated with MIF.

22 cl, 14 dwg, 16 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to the field of biotechnology and genetic engineering and can be used in veterinary for creation of vaccines regulating the sexual function in animals. A gene of a hybrid protein GHbc is obtained by the PCR method and is inserted into a polylinker region of a plasmid vector pUC9.

EFFECT: claimed is recombinant DNA, coding the hybrid vaccine protein GHbc, consisting of a nucleocapsid protein of human hepatitis B virus, fused with gonadoliberin.

2 cl, 4 dwg, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to the field of biochemistry, in particular to polypeptides, which are the inhibitors of methanogen cell and biological markers for detection of φmru phage, as well as polynucleotides, which code the said polypeptides. Disclosed are expression vectors and cloning vectors, which contain the said polynucleotides and host cells, containing the said vectors. Described are conjugated or fused molecules, which are the inhibitors of the methanogen cell and biological markers for detection of φmru phage, as well as antibodies, binding with the said polypeptides. Also disclosed is φmru phage, isolated with application of the described polypeptides. The invention also relates to pharmaceutical compositions and methods of inhibiting the methanogen cell with application of the described polypeptides, conjugated or fused molecules.

EFFECT: application of the invention makes it possible to lyse the methanogen cells inhibiting a paunch of ruminants, and/or deliver inhibitors of the methanogen cells.

24 cl, 8 dwg, 6 ex

FIELD: biotechnologies.

SUBSTANCE: method involves transfectant cells of HeLa line obtained by introduction to their chromosome of plasmid vector pBI/neo/X (X - any eukaryote transcription factor) containing minimum promoter of human cytomegalovirus, gene of green light-harvesting protein, sequence of nucleotides coding the fixation point of transcription factor, and neomycin resistance gene. Activity of transcription factor is determined by measurement of vital fluorescence intensity of the obtained cell culture in presence of test substance in comparison to intact cell culture.

EFFECT: invention allows quick and high-sensitive determination of activity of eukaryote transcription factors.

2 dwg, 1 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology. Method includes introduction of RNA molecule into a bird egg. Introduced RNA molecule contains double-stranded region and results in reduction of the level of molecule of RNA and/or protein, included into determination of sex in birds, in the egg. Invention can be used in poultry breeding.

EFFECT: claimed is method of changing sex characteristics in birds.

7 cl, 3 dwg, 6 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, more specifically to recovered monoclonal antibodies, particularly CDR-grafted humanised antibodies binding to an epitope of human RAGE molecule, and particularly possess an ability to inhibit RAGE binding to various ligands. The invention also refers to a method for preparing the above antibodies, a recovered nucleic acid coding them, an expression vector, a host cell and a pharmaceutical composition.

EFFECT: invention provides treating the diseases or disorders associated with advanced glycation end product (RAGE) receptor, including Alzheimer's disease effectively.

16 cl, 13 dwg, 10 tbl, 19 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and represents a recovered polynucleotide molecule with rEVE function, a recombinant expression vector, an expression shuttle vector, a host cell, as well as methods using the above recovered polynucleotide molecule. The given polynucleotide molecule with rEVE function may be used for preparing recombinant proteins. The given polynucleotide molecule with rEVE function contains a recombinant expression vector element (rEVE) containing a sequence of nucleotide bases specified in a group consisting of the nucleotide base sequence SEQ ID NO:1, the nucleotide base sequence SEQ ID NO:2, an up-regulation fragment of the sequence SEQ ID NO:1, the up-regulation fragment of the sequence SEQ ID NO:2, of the sequence complementary to any sequence as specified above, or combination thereof.

EFFECT: presented invention enables enhancing the expression of one or more proteins.

34 cl, 10 dwg, 17 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: present invention refers to immunology and biotechnology. What is presented is an IL-1β-binding antibody or its IL-1β-binding fragment containing V heavy and light chain regions. The above antibody binds to human IL-1β with dissociation constant less than 1pM. Versions of the antibody are described. There are disclosed corresponding coding nucleic acids (NA), as well as: a NA passage vector to a host cell, the host cell producing a coded polypeptide. What is described is using the antibody for preparing the other format of the above antibody: "camel-like", VHH antibody, nanobody. What is disclosed is a pharmaceutical composition for treating or preventing an IL-1β-related disease in a mammal on the basis of the antibody, as well as a method of treating or preventing the IL-1β-related disease in a mammal.

EFFECT: using the invention provides the novel IL-1β-specific antibodies with high IL-1β affinity that can find application in medicine for preventing, treating the diseases mediated by IL-1β activity.

39 cl, 20 dwg, 6 tbl, 14 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry, particularly to antibodies specifically bound to epidermal growth factor receptors (EGFR), as well as to DNA coding V heavy chain regions of the above antibodies, to DNA coding V light chain regions of the above antibodies. There are disclosed expression vectors containing these DNAs, and animal cell lines for expression of the above antibodies containing these vectors. There are described compositions for treating cancer related to epidermal growth factor receptor (EGFR) containing an effective amount of the above antibodies.

EFFECT: invention enables treating cancer related to epidermal growth factor receptor (EGFR) effectively.

30 cl, 12 dwg, 12 ex, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns an isolated polypeptide, a pharmaceutical composition containing such polypeptide, as well as a method of treating cancer. The presented polypeptide contains an amino acid sequence corresponding to SEQ. ID. NO: 2 or SEQ ID NO: 4. There are also characterised fragments or versions of the presented polypeptide.

EFFECT: group of inventions may be used to stimulate the immune system in treating malignant diseases and for diagnosing loss of immunologic activity.

7 cl, 7 dwg, 1 tbl, 6 ex

Hmo synthesis // 2517602

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and particularly to a bacterial cell stably cultured in a medium, where the cell is adapted to produce oligosaccharides. The cell is transformed such that it contains at least one nucleic acid sequence which encodes an enzyme involved in oligosaccharide synthesis. The cell is further transformed such that it contains at least one nucleic acid sequence which encodes a protein of the sugar efflux transporter family, or functional homologue thereof. The invention also relates to a method of producing oligosaccharides which involve said cell.

EFFECT: invention enables to obtain oligosaccharides with high efficiency.

13 cl, 3 dwg, 2 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and immunology. What is presented is an antibody representing a neutralising VEGFR-2/KDR antibody with its hypervariable regions being identical to the hypervariable regions of TTAC 0001 of VEGFR-2/KDR antibody fused with a binding domain of angiopoietin 2 which is Tie-2 ligand for treating cancer by angiogenesis inhibition. A DNA coding the above antibody, an expression vector containing the above DNA, and a CHO host cell transformed by the above vector for preparing the antibody are also described. What is also presented is a method for preparing the antibody involving: host cell incubation, and the antibody recovery from a culture fluid of CHO cell. What is described is a pharmaceutical composition for treating an angiogenesis-related disease, containing an effective amount of the above antibody and at least one pharmaceutically acceptable carrier.

EFFECT: invention enables preparing the VEGFR-2/KDR antibody fused with the binding domain of angiopoietin 2 which may be used for effective treatment of a disease related to excessive angiogenesis.

13 cl, 10 dwg, 8 ex

Up!