Improved production of protein in bacillus

FIELD: chemistry.

SUBSTANCE: invention relates to field of biotechnology. Claimed is separated chimeric polynucleotide for amplification of production of heterologous protein of interest, which contains polynucleotide sequence of promoter SigA or SigH, functionally connected with polynucleotide, coding protein YmaH, with chimeric polynucleotide connecting sequence, which by, at least, 90% is identical to SEQ ID NO: 1, 2, 3 or 13. Also described are: expression vector, containing claimed nucleotide structure, and host cell Bacillus for production of heterologous protein of interest, which contains said vector. Claimed is method of obtaining modified Bacillus cell, including transformation of host cell of Bacillus-producent of heterologous protein of interest with said vector; and growing said modified cell in optimal conditions. Described is method of obtaining protein of interest in modified Bacillus cell, where method includes cultivation of said host cell; and growing said modified Bacillus cell in optimal conditions. Also described is method of amplification of expression of heterologous protein from Bacillus of interest includes obtaining said modified Bacillus cell; growing modified Bacillus cell in optimal conditions; and expression of said protein of interest in modified Bacillus cell, where expression of said heterologous protein of interest in modified Bacillus cell is amplified in comparison with expression of said protein of interest in said parent Bacillus host-cell.

EFFECT: invention makes it possible to increase output of target protein due to superexpression of protein YmaH.

30 cl, 4 dwg, 3 ex

 

The scope to which the invention relates

The present invention relates to cells that have been genetically modified in order to change their ability to Express and/or to produce proteins of interest. In particular, the present invention relates to modified cells-masters of gram-positive pathogens, such asBacillussp., capable of sverkhekspressiyaymaH. The present invention encompasses polynucleotide constructs and expression vectors containing the polynucleotide sequences encodingYmaHand modified cell-hosts containing these vectors. In particular, the present invention relates to compositions and methods overexpression of YmaH to enhance expression and production of proteins of interest (e.g., proteases) inBacillussp.

Prior art

Genetic engineering allows you to modify the micro-organisms used as biological reactors, cellular "factories", and for the fermentation of food products. In particular, microorganisms of the speciesBacillusproduce and secrete a large number of valuable proteins and metabolites (Zukowski, "Production of commercially valuable products In: Doi and McGlouglin (eds.)Biology of Bacilli: Applications to Industry, Butterworth-Heinemann, Stoneham. Mass pp 311-337 [1992]). Sa is s widely used in industry consist of are B. licheniformis, B. amyloliquefaciensandB. subtilis.Due to the fact that these microorganisms have GRAS status (generally recognized as safe) (generally regarded as safe), strains of these speciesBacillusare natural candidates for the production of proteins used in the food and pharmaceutical industries. Important enzymes are produced by α-amylase, neutral protease and alkaline (or serine) proteases. However, despite advances in understanding the production of proteins in cells of hostsBacillusthat remains a need for improved methods for the expression and production of these proteins by microorganisms.

The invention

The present invention relates to cells that have been genetically modified in order to change their ability to Express and/or to produce proteins of interest. In particular, the present invention relates to modified cells-masters of gram-positive pathogens, such asBacillussp., capable of sverkhekspressiyaymaH. The present invention encompasses polynucleotide constructs and expression vectors containing the polynucleotide sequences encodingYmaHand the modified cells of the host containing the indicated constructs and vectors. In particular, the present invented the e relates to compositions and methods overexpression of YmaH to enhance expression and production of proteins of interest (e.g., proteases) inBacillussp.

In one embodiment of the invention the present invention relates to selected the chimeric polynucleotide, which contains a polynucleotide sequence that defines the SigA promoter functionally linked with polynucleotides coding YmaH protein.

In another embodiment, the present invention relates to selected the chimeric polynucleotide, which contains a polynucleotide sequence that defines the SigA promoter functionally linked with polynucleotides coding YmaH protein, where specified the chimeric polynucleotide includes SEQ ID NO:2 or SEQ ID NO:3.

In another embodiment, the present invention relates to a vector containing a polynucleotide construct containing polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the promoter sigA and/or a sigH.

In another embodiment, the present invention relates to a vector containing a polynucleotide construct containing polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the design contains a polynucleotide SEQ ID NO:1, 2, 3 or 13.

In another embodiment, the present invention relates to a modified cellBacillusthat contains a vector containing a polynucleotide construct, which contain what it polynucleotide, encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the modified cell is able to produce a protein of interest.

In another embodiment, the present invention relates to a modified cell-hostBacillusselected from the group consisting ofB. licheniformis, B subtilis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coagulans, B. circulans, B. lautus, B. pumilus, B. thuringiensis, B. clausiiandB. B. megateriumand containing a vector that contains the polynucleotide construct containing polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the modified cell is able to produce a protein of interest.

In another embodiment, the present invention relates to a modified cell-hostBacilluscontaining a vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the modified cell is able to produce a protein of interest, which is homologous or heterologous to the modified cells.

In another embodiment, the present invention relates to a modified cell-hostBacillussod is Rasa vector, containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the modified cell is able to produce a protein of interest and where the expression of the indicated protein of interest is initiated by the aprE promoter.

In another embodiment, the present invention relates to a modified cell-hostBacilluscontaining a vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the modified cell is able to produce a protein of interest, selected from amylases, proteases, xylanases, lipases, Lekkas, peroxidase, oxidase, koutinas, cellulases, hemicellulase, esterases, peroxidases, catalase, glucose oxidases, pitas, pectinase, glucosides, isomers, transferring enzyme, kinase, fosfates, galactosidases and chitinases, hormones, cytokines, growth factors, receptors, vaccines and antibodies.

In another embodiment, the present invention relates to a modified cellBacilluscontaining a vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide of th is a sequence of sigA promoter and/or sigH, where the modified cell capable of producing the enzyme.

In another embodiment, the present invention relates to a modified cellBacilluscontaining a vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where the modified cell is able to produce protease.

In another embodiment, the present invention relates to a modified cellBacilluscontaining a vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where a modified cell capable of producing at least one subtilisin selected from subtilisin 168, subtilisin BPN', subtilisin Carlsberg, subtilisinB. lentus, subtilisinB. clausii, subtilisin DY, subtilisin 147 and subtilisin 309 and their variants.

In another embodiment, the present invention relates to a modified cellBacillusproducing a protease that is capable of sverkhekspressiyaymaHwhere the modified cell contains a mutation in at least one gene selected from thedegU, degQ, degS, sco4, spollE, degQanddegR.

In another embodiment of the present invention is worn to a modified cell Bacillusproducing a protease that is capable of sverkhekspressiyaymaHwhere the modified cell contains a mutation deg(Hy)32.

In another embodiment, the present invention relates to a modified cellBacillus subtilisproducing a protease capable of sverkhekspressiyaymaHwhere the modified cell contains a mutation in at least one gene selected from thedegU, degQ, degS, sco4, spollE, degQanddegR.

In another embodiment, the present invention relates to a method for producing a modified cellsBacillusincluding: the transformation of the host cellBacillusa vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where a host cellBacillusable to Express the protein of interest; and culturing the modified cellBacillusthe growth conditions conducive to the expression of the protein of interest.

In another embodiment, the present invention relates to a method for producing a modified cellsBacillusincluding: the transformation of the host cellBacillusa vector containing a polynucleotide construct, which is located on the plasmid can replicate and which contains polynucleotide encoding YmaH protein, the function is optional associated with the polynucleotide sequence of the sigA promoter and/or sigH, where a host cellBacillusable to Express the protein of interest; and culturing the modified cellBacillusthe growth conditions conducive to the expression of the protein of interest.

In another embodiment, the present invention relates to a method for producing a modified cellsBacillusincluding: the transformation of the host cellBacillusa vector containing a polynucleotide construct integrated into the genome of the modified cells and which contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where a host cellBacillusable to Express the protein of interest; and culturing the modified cellBacillusthe growth conditions conducive to the expression of the protein of interest.

In another embodiment, the present invention relates to a method for producing a modified cellsBacillusincluding: the transformation of the host cellBacillusa vector containing a polynucleotide construct that contains polynucleotide encoding YmaH protein, functionally associated with the polynucleotide sequence of the sigA promoter and/or sigH, where a host cellBacillusable to Express at least one subtilisin; and growing modi is Anna cells Bacillusthe growth conditions conducive to the expression of subtilisin.

In another embodiment, the present invention relates to a method for production of protein of interest in a modified cellBacilluscomprising culturing the modified cellBacilluscapable of sverkhekspressiyaymaH,and growing the modified cellsBacillusthe growth conditions conducive to the expression of the protein of interest. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method for production of protein of interest in a modified cellBacillus,comprising culturing the modified cellBacilluscapable of sverkhekspressiyaymaH,the cultivation of modified cells in growth conditions conducive to the expression of the protein of interest, and the allocation of interest protein. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates the I to the method of production of protein of interest in a modified cell Bacilluswithin a smaller period of time than in the corresponding precursor cell host where the specified method comprises culturing the modified cellBacilluscapable of sverkhekspressiyaymaH; and culturing the modified cellBacillusthe growth conditions conducive to the expression of the protein of interest. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method for production of protein of interest in a modified cellBacillus,where expression of the protein of interest is initiated by the aprE promoter, and where the method includes culturing the modified cellBacilluscapable of sverkhekspressiyaymaH; and culturing the modified cell to the growth conditions conducive to the expression of the protein of interest. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method of enhancing the expression and representing the interest of the protein of the Bacillusthat includes obtaining a modified cellsBacillususing the method, which involves the overexpression ofymaHin the parent cell hostBacillus; the cultivation of the obtained modified cellsBacillusunder conditions conducive to cell growth and the expression of a protein of interest in a modified cellBacilluswhere expression of the protein of interest in a modified cellBacillusincreases in comparison with expression of the same protein of interest in the parent cell host. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method of increasing expression of the protein of interest fromBacillusthat includes obtaining a modified cellsBacillusby the way, which includes the overexpression ofymaHin the parent cell hostBacillus; the cultivation of the obtained modified cellsBacillusunder conditions conducive to cell growth and the expression of a protein of interest in a modified cellBacilluswhere expression of the protein of interest in a modified cell increases is compared with the expression of the same protein of interest in the parent cell the owner and where overexpression involves the transformation of a parent host cell Bacilluspolynucleotide construct containing polynucleotide encoding YmaH protein, where polynucleotide functionally linked to the polynucleotide sequence of sigA promoter or sigH. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method of increasing expression of the protein of interest fromBacillusthat includes obtaining a modified cellsBacillusby the way, including the overexpression ofymaHin the parent cell hostBacillus; growing the modified cellsBacillusunder conditions conducive to cell growth and the expression of a protein of interest in a modified cellBacilluswhere expression of the protein of interest in the modified cell is enhanced compared to expression of the same protein of interest in the parent cell the owner and where overexpression includes transformation of the host cellBacilluspolynucleotide construct containing a sequence selected from SEQ ID NO: 1, 2, 3 and 13. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some variations the tah implementation cage Bacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method of increasing expression of the protein of interest fromBacillusthat includes obtaining a modified cellsBacillusby the way, including the overexpression ofymaHin the cell-hostBacillus; the cultivation of the obtained modified cellsBacillusunder conditions conducive to cell growth and the expression of a protein of interest in a modified cellBacilluswhere expression of the protein of interest in a modified cellBacillusincreases in comparison with expression of the same protein of interest in a cell-hostBacillusand where overexpression includes transformation of the host cellBacilluspolynucleotide construct, which is located on a plasmid or integrated into the genome of the modified cells and contains polynucleotide encoding YmaH protein, where polynucleotide functionally linked to the polynucleotide sequence of sigA promoter or sigH. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method for enhancing the expression of predstavljajushej the protein of interest from Bacillusthat includes obtaining a modified cellsBacillusby the way, including the overexpression ofymaHin the cell-hostBacilluswild type; growing a modified cellsBacillusunder conditions conducive to cell growth and the expression of a protein of interest in a modified cellBacilluswhere expression of the protein of interest in a modified cellBacillusincreases in comparison with expression of the same protein of interest in a cell-master of the wild type and where overexpression includes transformation of the host cellBacilluswild-type polynucleotide construct, which contains polynucleotide encoding YmaH protein, where polynucleotide functionally linked to the polynucleotide sequence of sigA promoter or sigH. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

In another embodiment, the present invention relates to a method of increasing expression of the protein of interest fromBacillusthat includes obtaining a modified cellsBacillusby the way, including the overexpression ofymaHin the modified cell-hostBacillus; growing the modified cellsBacillusin the us what the conditions, conducive to cell growth and the expression of a protein of interest in a modified cellBacilluswhere expression of the protein of interest in a modified cellBacillusincreases in comparison with expression of the same protein of interest in a modified cell host and where overexpression includes transformation of the modified host cellBacilluspolynucleotide construct containing polynucleotide encoding YmaH protein, where polynucleotide functionally linked to the polynucleotide sequence of sigA promoter or sigH. In some embodiments, the implementation of interest protein is an enzyme, such as subtilisin. In some embodiments, the implementation of the cellBacillusis cellBacillus subtilis.

Short descriptiongraphic material

In figure 1 (A-E) shows the localization of the primers used to obtain the polynucleotide structures according to some variants of implementation of the present invention. Panels B-E indicate the position of primers used to obtain structures SigH, SigA1, SigA2 and SigA3, respectively, relative to the chromosomal sequenceBacillusoperon miaABacillus subtilis(1865428-1867019 pairs of strain 168Bacillus subtilis; NCBI reg. No. NC000964), which is shown in panel A. primer Pair is in P4 - P5 and P6 - P7 are hybrid primers, which at its 5'end contains a "tail" of the base pairs, which are homologous directly amplified sequence and complementary to each other. Complementary to the tails of these hybrid primers allows you to attach amplified DNA promoter Sigma A to amplified YmaH-encoding DNA with obtaining chimeric polynucleotides containing the promotor sequence of the Sigma A, adjacent to the YmaH coding sequence, with a large part of the miaA-coding sequence demeterova or non-existent.

The figure 2 shows the polynucleotide sequence portion of the genomeB. subtilisthat includes the sequence that defines the sigA promoter attached to the end of the sequence that encodes a YmaH protein. This sequence is schematically represented in figure 1 panel A. Shows the beginning of a sequence that encodes a protein miaA, and full-miaA-coding sequence are shown in bold; in addition, shows the beginning of a sequence that encodes a YmaH protein, and full YmaH-encoding sequence are shown in bold and underlined.

In figure 3 (A-B), panel A, shows a graph of the proteolytic activity of subtilisin produced by the control cells, the household is the s Bacillus(42pBS) and modified cells-hostsBacillusthat sverkhekspressiyaymaH(42SigA1 and 42SigH). Panel B illustrates the activity of subtilisin produced by the control cells-hostsBacillus(41pBS) and modified cells-hostsBacillusthat sverkhekspressiyaymaH(41SigH). Proteolytic activity was defined as the increase in optical density at 405 nm due to the hydrolysis and release of p-nitroaniline. The level of enzyme activity is a measure of the effectiveness of overexpression of ymaH in relation to the production of subtilisin cells-hostsBacillus.

Figure 4 is specified level of production of subtilisin control cells-hostsBacillus42pBS19 and modified cells-hostsBacillus42SigH and 42SigA1 that sverkhekspressiyaymaH.

Detailed description of the invention

The present invention relates to cells that have been genetically modified in order to change their ability to Express and/or to produce proteins of interest. In particular, the present invention relates to modified cells of the host, which are gram-positive microorganisms, such asBacillussp., can sverkhekspressiyaymaH. The present invention relates to p is dinucleotides constructs and expression vectors, containing a polynucleotide sequence encodingYmaHand the modified cells of the host containing the polynucleotide constructs and expression vectors. In particular, the present invention relates to compositions and methods overexpression of YmaH to enhance expression and production of proteins of interest (e.g., proteases) inBacillussp.

If it is not specifically mentioned, the present invention is carried out by standard methods known in the art and commonly used in molecular biology, Microbiology, protein purification, in the construction of proteins, sequencing of proteins and DNA and in the technique of recombinant DNA. These methods are known in the art and described in many General guidelines and the scientific literature. All the above - listed patents, patent applications, articles and publications in their entirety are introduced in the present description by reference.

If it is not specified otherwise, all technical and scientific terms used in this application have the meanings mostly understandable to the average expert in the field to which the invention relates. Specialists are well known and available in various scientific dictionaries, in which the definition used in this document terms. Although the implementation of this and the finding, both in theory and in practice, can be applied to any methods and materials similar or equivalent to those described herein methods and materials used, but preferred are some of the methods and materials described in this application. In accordance with these terms, described directly below in more detail and in its entirety is determined by reference to the description of the present invention. It should be noted that the present invention is not limited to the specifically described in this document, methods, protocols, and reagents, which can vary depending on the purpose of their application.

In this form of the singular include the plural, unless contrary to the context of the invention. If it is not specifically mentioned, nucleic acids are written left to right in the direction of 5' → 3'and amino acid sequences are written left to right in the direction from amino - to carboxy-end, respectively.

All patents, patent applications and other publications, including all cited in this document sequences, accurately entered into the present description by reference as if each individual publication, patent or patent application were specifically and individually included in this OPI is the W by reference. All documents cited in the appropriate section of this application, introduced in the present description by reference. However, the citation of any document should not necessarily mean that this document refers to the prototype of the present invention.

In these numerical ranges include all values, including its borders. However, it is envisaged that every maximum numerical limit specified in the present description, can include every lower numerical limit, as if such lower numerical limit has been specified in this application. Each minimum numerical limit specified in the present description, may include more numerical limit as if this greater numerical limit has been specified in this application. Each numeric interval specified in the description of the present application, includes every narrower numerical range that is included in such broader numerical interval as if all these narrower numerical ranges are precisely defined in the description of this application.

The invention is not limited to the various contained in this document aspects or variants of the invention, which mostly can be incorporated into the present description by reference. In accordance with this the m as indicated above, the following terms in more detail determined by reference to all the description as a whole.

In this document, the terms "isolated" and "purified" refers to nucleic acid or amino acid (or other component)that were separated from at least one component with which they are associated in its natural environment.

The terms "chimeric polynucleotide", "chimeric polynucleotide construct" and "heterologous design nucleic acid" means polynucleotide, which consists of parts of different genes, including regulatory elements. Thus, in some embodiments, the implementation of the chimeric polynucleotide design includes a protein-coding region, functionally associated with the promoter, which is not the native promoter. In some embodiments, the implementation of the chimeric polynucleotide means a polynucleotide sequence that comprises a polynucleotide sequence that defines a promoter functionally linked to a polynucleotide sequence that encodes a protein. In some embodiments, implementation, promoter and encoding polynucleotide are adjacent.

The term "determining", if it is used in the description of a promoter refers to a polynucleotide sequence, the content is common promoter elements, providing transcription.

In this document, the term "promoter" means a nucleic acid sequence that triggers a/carries out the transcription below the gene. Usually, such a promoter is suitable for the host cell in which expression of the gene. The promoter, together with other nucleic acid sequences that regulate transcription and translation (also called "regulatory sequences"), is required for the expression of this gene. In General, sequences regulating transcription and translation are, but are not limited to, promoter sequences, binding sites with the ribosome, the sequence of initiation and termination of transcription, the sequence of initiation and termination of translation, the upstream sequence elements located above promoter (UP elements), and sequences such as enhancers or activators. In some embodiments of the invention, the promoter also includes a transcription of the leader sequence.

In this document, the terms "promoter Sigma A" and "SigA promoter" refers to a polynucleotide sequence containing core-promoter sequences which include sequences directly races is uznavaemye relevant factor σ And. The SigA promoter is included in the sequence, which is normally located above the miaA-coding region.

In this document, the terms "promoter Sigma H" and "SigH promoter" refers to a polynucleotide sequence containing core-promoter sequences which include sequences that are directly recognized by the appropriate factor σH. The promoter SigH included in the sequence, which is normally located aboveymaH-coding region (Britton et al. J. Bacteriol. 184:4881-4890 [2002]). The core promoter comprises the promoter sequence containing the sequence directly recognized by the appropriate factor σ, and spacer elements sequence located between the sequences that are directly recognized by the appropriate factor σ.

In this document the term "aprE promoter" means a promoter polynucleotide sequence, which usually triggers the expression of subtilisin inB. subtilis(Ferrari et al., J Bacteriol. 170:289-295 [1988]). As for the aprE promoter, in this document the term "aprE promoter" means a promoter aprE wild type and its mutants. In some embodiments of the invention, the aprE promoter comprises a nucleotide sequence necessary for transcription regulation, under the action of DegU, ScoC, AbrB and l is the God of another regulator of this promoter, and/or transcription of the leader sequence AprE (Hambraeus et al., Microbiology 148:1795-1803 [2002]).

In some alternative embodiments of the invention, the aprE promoter does not include all nucleotide sequences required for transcription regulation, under the action of DegU, ScoC, AbrB and other regulators, and/or does not include a transcription of the leader sequence aprE.

The terms "regulatory segment, "regulatory sequence" and "sequence expression regulation" means a polynucleotide sequence DNA, functionally associated with the polynucleotide sequence of DNA which encodes the amino acid sequence of the polypeptide chain, which results in expression of the encoded amino acid sequence. The regulatory sequence can inhibit, suppress or stimulate the expression of the operatively linked polynucleotide sequence that encodes the amino acid. In some embodiment of the invention, the regulatory sequence contains a promoter functionally linked to a DNA sequence that encodes a regulator of transcription YmaH. In some embodiments of the invention specified promoter is heterologous with respect to geneymaH(for example, the specified prom the torus is the promoter, not directly involved in the initiation of expression of YmaH protein). For example, in some embodiments, the implementation specified by the promoter is the promoter Sigma A, functionally linked to DNA that encodes a YmaH protein. In some other embodiments, the implementation of the specified promoter is a promoter that directly triggers the expression of YmaH protein and which is functionally linked to DNA that encodes a YmaH, since this DNA is natural for data owners.

In this document the terms "polynucleotide" and "nucleic acid" are used interchangeably and mean a polymeric form of nucleotides of any length. These terms include, but are not limited to, single-stranded DNA, double-stranded DNA, genomic DNA, cDNA, or a polymer containing purine and pyrimidine bases or other natural, chemically modified, biochemically modified, non-natural or derivationally nucleotide bases. Non-limiting examples of polynucleotides are genes, gene fragments, chromosomal fragments, EST, exons, introns, mRNA, tRNA, rRNA, ribozymes, cDNA, recombinant polynucleotides, branched polynucleotides, plasmids, vectors, isolated DNA having any sequence, isolated RNA, with any sequence, nukleinovokisly probes and Ribery. It should be noted that due to the degeneracy of the genetic code can be produced a multitude of nucleotide sequences encoding this protein.

In this document, the term "gene" means a chromosomal segment of DNA involved in producing a polypeptide chain, which may include, but may not include the area located before and after the coding regions (for example, 5'-untranslated (5'-UTR) or leader sequence and the 3'-untranslated (3'-UTR) trailer sequences, and intervening sequences (introns)that are located between individual coding segments (exons)). In some embodiments of the invention, the gene encodes commercially available and are important from the industrial point of view, proteins or peptides, such as enzymes, including, but not limited to, protease, cellulase, carbohydrase, such as amylase and glucoamylase, cellulase, oxidase, isomerases, transferases, kinases, phosphatases and lipases. In some other embodiments of the invention specified gene encodes proteins encoded by the operon which contains miaA (for example,miaAorymaH). However, it should be noted that the present invention is not limited to any particular enzyme or protein. In some other embodiments, the implementation of the specified gene encodes the other is their proteins or peptides, such as growth factors, cytokines, ligands, receptors and inhibitors, as well as vaccines and antibodies. In some embodiments, the implementation of the gene of interest is a natural gene, while in other embodiments, the implementation of this gene is mutated gene or a synthetic gene.

In this document the term "synthetic" refers to a polynucleotide molecule produced byin vitro by chemical or enzymatic synthesis. This term includes, but is not limited to, variants of nucleic acids obtained with the use of optimal codons occurring organisms owners, such as, but not limited to,Bacillussp.

In this document, the term "polymerase chain reaction" ("PCR") refers to the methods described in U.S. patent No. 4683195, 4683202 and 4965188 that are entered into the present description by reference, where such methods include increasing the concentration of a segment of a target sequence in a mixture of genomic DNA without cloning or purification. This method of amplification of a target sequence consists of introducing a large excess of two oligonucleotide primers to the mixture of DNA containing the desired sequence of a target, followed by a certain number of cycles in the presence of DNA polymerase. Two primers are elementarnymi their respective chains of double-stranded target sequence. For the implementation of the amplification mixture is denatured and then the primers hybridized them with complementary sequences in the molecule target. After annealing the primers extend under the action of the polymerase, resulting in a new pair of complementary circuits. The stage of denaturation, annealing of primers and extension under the action of a polymerase can be carried out repeatedly (i.e. the stage of denaturation, annealing and extension constitute one "cycle"and can be a lot of "cycles") to obtain the high concentration of the amplified segment of the desired target sequence. The length of the amplified segment of the desired target sequence is determined by the positions of the primers with respect to each other, and therefore, this length is the controlled parameter. Since the process is iterative, then this method is called "polymerase chain reaction" (hereinafter referred to "PCR"). As required amplificatoare segments of the target sequence become the predominant sequences (from the point of view of their concentration) in the mixture, they are called "PCR amplificatoare".

In this document the term "reagents for amplification means reagents (deoxyribonucleotide-triphosphates, buffer and the like)necessary for amplification, except for the m primers, nukleinovokisly matrix and enzyme for amplification. Typically, the reagents for amplification, together with other components of the reaction mixture, is placed in the reaction vessel and stored in such vessel (test tube, microlance etc).

Using PCR can amplify a single copy of a specific target sequence in genomic DNA to a level that can be detected using several different methods (e.g., hybridization with a labeled probe; the introduction of biotinylated primers followed by detection conjugate "avidin-enzyme"; and the introduction of32P-labeled deoxynucleotide-triphosphates, such as dCTP or dATP, into amplificatory segment). In addition to genomic DNA, any oligonucleotide or polynucleotide sequence may be amplified using the corresponding set of molecules primers. In particular, amplificatoare segments, obtained by PCR, are themselves matrices, which can be used for subsequent PCR amplification.

In this document the terms "PCR product, PCR-fragment" and "amplification product" refers to the mixture of compounds obtained after two or more cycles of PCR stages of denaturation, annealing and elongation. These terms include cases when the amplification of one or more NEGP is having one or more sequences of target.

In this document the terms "restriction endonuclease" and "restriction enzymes" refer to bacterial enzymes, each of which cut double-stranded DNA at specific nucleotide sequences or near this sequence.

In this document, the term "recombinant" refers to polynucleotide or polypeptide that is normally not present in this cell the owner. In some embodiments of the invention the recombinant molecules containing two or more natural sequences that are functionally related to each other, as this usually does not occur in nature.

Nucleic acid is operatively linked"when it is in functional relationship with another nucleic acid sequence. For example, a polynucleotide promoter sequence functionally linked to polynucleotides coding for a polypeptide if it affects the transcription of the sequence. In some other embodiments of the invention the binding site with the ribosome is functionally associated with the coding sequence if its localization facilitates translation. In some embodiments of the invention, the term "functionally linked" means that are related to each other polynucleotide sequences are Smin the mi. This is done by legirovaniem in suitable restriction sites. If such sites are present, in accordance with standard practice can be used synthetic oligonucleotide adaptors or linkers.

In this document, the term "homologous genes" means genes, which differ from each other, but are usually related molecules, which correspond to each other and are either identical or have a very high degree of similarity. This term encompasses genes that were separated in the process of speciation (i.e. the formation of new species) (e.g., ontologique genes), and genes that were separated in the process of genetic duplication (for example, analogichnye genes).

In this document, the term "ortholog" and "ontologique genes" means the genes present in different species that evolved from a common gene ancestor (i.e. homologous gene) in the process of speciation. Usually orthologues retain their function in the process of evolution. Identification of orthologues is used for accurate prediction of gene function in newly sequenced genomes.

In this document the term "paralog" and "analogichnye genes" means genes which were related as a result of duplications in the genome. Orthologues retain their functions in% the CE evolution, and paralogy acquire new functions, but some functions of paralogous often correspond to their original functions. Examples of gene-paralogon are, but are not limited to, genes encoding trypsin, chymotrypsin, elastase and thrombin, and they are all serine proteases, and in the aggregate are present in the same species.

In this document, the term "homology" refers to the similarity or sequence identity, and preferably identity. Homology determined by standard methods known in the art (see, for example, in the publication of Smith and Waterman, Adv Appl Math 2:482, 1981; Needleman and Wunsch, J. Mol. Biol., 48:443, 1970; Pearson and Lipman, Proc. Natl. Acad. Sci. USA, 85:2444, 1988; and programs such as GAP, BESTFIT, FASTA and TFASTA included in the software package Wisconsin Genetics Software Package (Genetics Computer Group, Madison, WI); and Devereux et al, Nucl. Acid. Res., 12:387-395, 1984).

In this document, the term "analogous sequence" means a sequence in which the function of the gene is essentially the same as the function of the gene, constructed on the basis of the preferred strain ofBacillus subtilis(that is,Bacillus subtilis168). In addition, similar genes are genes, the sequence of which at least about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98%, about the RNO 99% or about 100% identical to the gene sequence of strain Bacillus subtilis168. Alternatively, the analogous sequence to align them have 70-100%compliance with the genes present in the genome ofBacillus subtilis168 and/or have at least 5-10 genes found in the region of their alignment with the genes of the genomic regionB. subtilis168. In additional embodiments of the invention, the specified sequence has more than one of the above properties. A similar sequence determined by the known methods of sequence alignment. The most common method of alignment is a BLAST, although, as indicated above and below, to align the sequences may also be applied by other methods.

One example of a suitable algorithm is an algorithm a PILEUP. The PILEUP algorithm allows the alignment of multiple sequences from a group of related sequences by sequential pairwise alignment. For the implementation of the alignment can be also built a tree diagram illustrating a cluster relationships. The program PILEUP uses a simplified method of successive alignment described by Feng and Doolittle (Feng and Doolittle, J. Mol. Evol., 35:351-360, 1987). This method is similar to the method described by Higgins and Sharp (Higgins and Sharp, CABIOS 5:151-153, 1989). Appropriate parameters are a PILEUP: "price" gap is 3,00 default "price" the length of the gap of 0.10 by default, and weighted end gaps.

Another example of a suitable algorithm is the BLAST algorithm, described in Altschul et al., (Altschul et al, J. Mol. Biol, 215:403-410, [1990]; and Karlin et al., Proc. Natl. Acad. Sci. USA, 90:5873-5787, [1993]). Particularly suitable program BLAST program is the WU-BLAST-2 (see, Altschul et al., Meth. Enzymol., 266:460-480, [1996]). The program WU-BLAST-2 uses several search parameters, most of which are taken as default values. The adjustable parameters are set with the following default values: coverage with overlap = 1, overlap fraction = 0,125, the maximum word length (T) = 11. Parameters HSP's and HSP S2 are dynamic values, and these parameters are set by the program depending on the specific sequence and composition of the particular database in which the search of interest sequence. However, to increase the sensitivity of these values can be adjusted. The percent (%) amino acid sequence identity is determined by the number of matching identical residues divided by the total number of residues of the "longer" sequence in the aligned region. "Longer" sequence is a sequence with the most valuable residues in the aligned region (samples of the crystals, input using WU-Blast-2 to maximize the "weight" of alignment, not included).

Thus, "percent (%) identity to the sequences of nucleic acid" is defined as the percentage of nucleotide residues in the sequence of the candidate, which is identical to the nucleotide residues of the original sequence (i.e., interest sequence). In a preferred method uses the BLASTN module of the program WU-BLAST-2 set to the default, where the overlapping and overlapped fraction are set to 1 and 0.125, respectively.

In some embodiments of the invention, the alignment includes the introduction of gaps in the aligned sequences. In addition, for sequences that contain more or fewer nucleotides compared with the sequences of the nucleic acid candidate, the percent homology determined based on the number of homologous sequences in relation to the total number of nucleotides. So, for example, homology of sequences that are shorter than the sequences identified in this application and discussed below, determined using the number of nucleotides in the shorter sequence.

In this document, the terms "polynucleotide construct", "expression the th cluster" and "expression vector" mean the design DNA containing a DNA sequence which is functionally linked to a suitable regulatory sequence capable of expression of the DNA in a suitable host. Such regulatory sequences include promoters that initiate transcription; optional sequence operator governing such transcription; a sequence encoding a suitable binding sites with ribosome present in mRNA; sequences that regulate the termination of transcription and translation. Typically, the polynucleotide construct comprises the area of the regulation of transcription (e.g., a promoter), functionally associated with the protein coding region. In some embodiments of the invention the polynucleotide construct contains protein-coding region, which is functionally connected with native promoter (i.e. promoter, which is related with the natural coding sequence). For example, the polynucleotide construct according to the invention contains a promoter sigH andymaH-coding sequence. In other embodiments of the invention, polynucleotide structure contains protein-coding region, which is functionally linked to the promoter, which, by its nature, is not contiguous with the coding sequence (i.e., specified by nucleotide the design contains a chimeric polypeptide, in which the promoter is in a position not corresponding to its natural position relative to the coding sequence). For example, the sigA promoter functionally linked toymaH-coding sequence. In other embodiments of the invention, the polynucleotide sequence contains more than one promoter or more than one protein-coding region (for example, the polynucleotide construct contains a polycistronic sequence, including the promoter and coding region present in the operon). In some other embodiments of the invention the polynucleotide construct or expression cluster contains a selective marker (e.g., a token resistance to the antibiotic, such as the gene encoding chlorophenylacetyl-transferase), which, in the presence of the corresponding antibiotic, allows you to amplify polynucleotide construct into the genome of the host cell. Polynucleotide construct can be introduced into a plasmid genome, mitochondrial DNA, plastid DNA, virus, or a fragment of the nucleic acid. In some embodiments of the invention the specified vector is a plasmid, a phage particle, or simply a potential genomic insert. In some other embodiments of the invention the vector, after its transformation in the cell-master, replicated and functioning of the em regardless of the genome of the host, or, in some alternative cases, integrated into its own genome. In this document, the terms "plasmid", "expression plasmid" and "vector" are often used interchangeably as the plasmid is the most common form of vector commonly used at the present time. However, the present invention includes other forms of expression vectors, which have equivalent functions and which are either known in the art or will be known in the future. "Vectors" are cloning vectors, expression vectors, Shuttle vectors, plasmids, phage or viral particles, structure of DNA, clusters, etc.

In this document, the term "plasmid" means a circular double-stranded (DC) DNA construct used as a cloning vector, which forms an extrachromosomal self-replicating genetic element in many bacteria and some eukaryotes. In some embodiments of the invention, the plasmid is introduced into the genome of the host cell. The term "plasmid" includes mnogoopytnyi plasmid that can integrate into the genome of the host cell by homologous recombination.

In this document, the terms "transformed" and "stably transformed" refers to a cell that has a non-native (heterologous) on nucleotide sequence, integrated into its genome, or existing in the form of episomal plasmids, persisting at least two or more generations. In this document, the term "expression" means the process by which polynucleotide transcribed, and the resulting transcript is translated with the formation of the polypeptide. This process involves transcription and translation.

In this document, the term "overexpression" refers to the process by which a gene containing a sequence encoding the polypeptide, artificially expressed in a modified cell-level expression of the encoded polypeptide, exceeding the level of expression of the same polypeptide in the precursor host cell. Thus, although this term is usually used in relation to gene, however, the term "overexpression" can also be used in relation to a protein, and in this case, it means an increased protein level, resulting from overexpression of the gene encoding this protein. In some embodiments of the invention, the overexpression of the gene encoding the protein is achieved by increasing the copy number of the gene encoding the protein. In other embodiments of the invention, the overexpression of the gene encoding the protein is achieved by increasing the strength of binding to the promoter region and/or the binding site is ment with the ribosome, that leads to increased levels of transcription and/or translation of the gene encoding the protein. In other embodiments of the invention overexpression can be achieved by increasing the number of copies of the gene and the strength of binding to the promoter region and/or the binding site with the ribosome. In some embodiments of the invention, the overexpression of the gene encoding the protein occurs as a result of expression of at least one copy of the corresponding coding polynucleotide present at mnogostadiinoi plasmid, which was introduced into the cell host. In other embodiments of the invention, the overexpression of the gene encoding the protein occurs as a result of expression of two or more copies of the corresponding coding polynucleotide integrated into the genome of the host cell.

The term "a host cell" means a suitable cell among cells that serve as hosts for the expression vector containing the DNA according to the invention. A suitable cell host may be natural a host cell or a host cell of a wild type or a cell can be modified in a host cell. In one embodiment of the invention specified the host-cell is a gram-positive microorganism. In some preferred embodiments of the invention, this term refers to cells belonging to the genusBacillus.

<> In this document, the term "cellBacillus" includes all members of this type, known in the art, including, but not limited to,B. subtilis, B. licheniformis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. clausii, B. halodurans, B. B. megaterium, B. coagulans, B. circulans, B. lautusandB. thuringiensis. It should be noted that bacteria of the genusBacillusconstantly subjected to taxonomic reorganization. Thus, it is envisaged that microorganisms such are the species that have been reclassified, including, but not limited to, such microorganisms asB. stearothermophilus, which is now called "Geobacillus stearothermophilus". The production of resistant endospore in the presence of oxygen is considered as a characteristic that defines the genusBacillusalthough this characteristic is typical for newly identified bacteria such asAlicyclobacillus, Amphibacillus, Aneurinibacillus, Anoxybacillus, Brevibacillus, Filobacillus, Gracilibacillus, Halobacillus, Paenibacillus, Salibacillus, Thermobacillus, UreibacillusandVirgibacillus.

The term "a host cell wild-type" means a cell of a host that has not been genetically modified by recombinant methods.

In this document the term "wild-type" refers to a gene or gene product that has the properties of a gene or gene product isolated from a natural source. Usually wild-type gene is the th gene, which most often occurs in a defined population of cells, and therefore it is sometimes called "normal genome or the genome of wild type". In this document the terms "sequence of wild-type and wild-type gene" are used interchangeably and mean a sequence that is native or normally present in the cell host. The sequence of the wild type can encode homologous or heterologous protein.

In this document, the terms "modified a host cell", "changed cell" and "modified strain" refers to a genetically engineered cell host (organism), in which the protein of interest is expressed and/or is produced at the level of the expression or production in excess of the level of expression and/or production of the same protein of interest under cultivation unmodified host cell or host cell of wild-type, essentially the same growth conditions. In some embodiments of the invention a modified cell, the host cell is producing recombinant protease.

In this document, the terms "modified cell" and "modified a host cell" means a cell of the host wild-type or modified cell host, which were genetically engineered so that they who were withexpression gene encoding YmaH protein. In some embodiments of the invention modified the host-cell is a host cell producing a recombinant protease. In some embodiments of the invention, a modified a host cell has the ability to Express and/or to produce a protein of interest at a higher level than a host cell of a wild type or modified parent a host cell.

In this document, the term "parent cell" or "cell-precursor" means a cell which is modified by a host cell, and the parent cell or cell-precursor may be a cell of a wild type or modified cell. In some embodiments of the invention modified parent cell has the ability to Express and/or to produce a protein of interest at higher levels than the unmodified parental cell/cell-predecessor or parent cell/cell-predecessor of the wild type.

The term "introduced"in this document in relation to the introduction of nucleic acid sequence in a cell, refers to any method suitable for transferring nucleic acid sequence into the cell. Such methods of introduction include, but are not limited to, fusion of protoplasts, transformation is Ktsia, transformation, conjugation and transduction (see, e.g., Ferrari et al., "Genetics," in Hardwood et al., (eds.),Bacillus, Plenum Publishing Corp., pages 57-72, [1989]).

In this document, the terms "transformed" and "stably transformed" refers to a cell that has negativnuu (heterologous) polynucleotide sequence integrated into its genome, or a heterologous polynucleotide sequence that is present in the form of episomal plasmid, which is stored in at least two subsequent generations.

In this document the terms "transforming DNA/transforming polynucleotide", "transforming sequence and DNA-design/polynucleotide structure" means DNA used to introduce sequences into the cell-master or master-organism. "Transforming DNA" is DNA used to introduce sequences into the cell-master or master-organism. DNA can be obtainedin vitro by PCR or any other appropriate methods. In some preferred versions of the invention, the transforming DNA comprises embedded sequence, while in other preferred embodiments of the invention, it also includes embedded sequence, flanked by homologous the mi boxes. In yet another embodiment of the invention transforming DNA includes other non-homologous sequence attached at the ends (i.e. "odd sequence" or flanks). In some embodiments of the invention the ends close to the transforming DNA was formed into a closed loop, such as, for example, the insert in the vector.

In this document, the term "nucleotide sequence encoding a selective marker" means a nucleotide sequence that has the ability to be expressed in cells of the host, where the expression of the selective marker tells the cells containing the expressed gene, the ability to grow in the presence of an appropriate selective agent or in the absence of the primary nutrients.

In this document the term "breeding marker" means a gene that is able to be expressed in cells of the host, which facilitates the selection of those hosts containing the vector. Examples of such breeding markers include, but are not limited to, antimicrobial agents (e.g., kanamycin, erythromycin, actinomycin, chloramphenicol and tetracycline). Thus, the term "breeding marker" means genes that indicate the absorption of this the host-cell plug and interest DNA or done by the pressure of some other reactions. Usually breeding markers are genes that tell the cell host resistance to microbial or metabolic advantage that it allows to differentiate cells containing exogenous DNA from cells that were not purchased any of exogenous sequences in the transformation process. The term "endogenous breeding marker" means the marker is localized in the genome of the transformed microorganism. Endogenous breeding marker encodes a gene that is different from the breeding gene marker that is present on the transforming DNA constructs.

In this document the terms "amplification" and "gene amplification" means the process by which specific DNA sequences are disproportionately replicated, resulting in amplificatory gene present in the genome with a large number of copies, than in the initial state. In some embodiments of the invention the selection of cells by culturing in the presence of the drug (e.g., inhibitor inhibiting enzyme) leads to amplification of any endogenous gene encoding a gene product required for cell growth in the presence of drugs, or amplification of exogenous (i.e. embedded) sequences encoding this gene product, or to Toya another amplification. The selection of cells by culturing in the presence of the drug (e.g., inhibitor inhibiting the enzyme) can lead to amplification of any endogenous gene encoding a gene product required for cell growth in the presence of drugs, or amplification of exogenous (i.e., embedded) sequences encoding this gene product, or to both amplification.

In this document, the term "polypeptide" means a compound consisting of amino acid residues linked by peptide bonds. In some embodiments of the invention herein the term "protein" is synonymous with the term "polypeptide". In some alternative embodiments of the invention, the term refers to a complex of two or more polypeptides. Thus, in the present document, the terms "protein" and "polypeptide" are used interchangeably.

In this document the terms "YmaH protein" and "protein Hfq are used interchangeably and mean a protein that increases expression of protein of interest. In the context of the present description "YmaH protein" means a protein YmaH wild type and its variants, including orthologues.

In this document, the term "variant" means a protein derived from the protein precursor (for example, YmaH proteinB. subtilis) attaching the one or more amino acids to the C-end or to the N-end or to both ends, replacement of one or several amino acids at one or at several different sites, amino acid sequence, deletion of one or more amino acids at either end of the protein or at both ends of the protein or at one or more sites in the amino acid sequence, and/or insertions of one or several amino acids at one or more sites in the amino acid sequence. The term "protein YmaHB. subtilismeans YmaH proteinB. subtilismodified as described below. The production version YmaH proteinB. subtilispreferably achieved by modifying a DNA sequence that encodes a native protein, the transfer of this DNA sequence in a suitable host, and expression of the modified DNA sequence with the formation of derivatizing enzyme. Options YmaH proteinB. subtilisare peptides having amino acid sequences which differ from the amino acid sequence of the enzyme precursor, where this option YmaH proteinB. subtilisretains the ability to enhance the production of protein of interest in cells ofB. subtiliswhere sverkhekspressiya YmaH protein. The activity of this variant can be increased or decreased in relation to the factor secretion predecessor. It is considered that options is according to the invention can occur from the DNA fragment, encoding a variant protein YmaHB. subtilismoreover , downregulation of variant protein YmaHB. subtilisretains its functional activity.

The terms "protein of interest" and "interest polypeptide" means a protein/polypeptide produced by the host-cell. Usually interest proteins are proteins that have commercial value. Of interest protein may be homologous or heterologous with respect to the host. In some embodiments of the invention of interest protein is secreted polypeptide, and in particular, the enzyme, including, but not limited to, amylolytic enzymes, proteolytic enzymes, cellulities enzymes, oxidoreductase enzymes and enzymes that destroy the walls of plants. In other embodiments of the invention such enzymes include, but are not limited to, amylase, protease, xylanase, lipase, laccase, peroxidase, oxidase, cutinase, cellulase, hemicellulase, esterase, peroxidase, catalase, glucose-oxidase enzyme, phytase, pectinase, glucosidase, isomerases, transferases, galactosidase and chitinases. In other embodiments of the invention expressing the polypeptide is a hormone, cytokine, growth factor, receptor, vaccine, antibody or the like, it Should be noted that this is sabreena is not limited to any particular proteins/polypeptides, and in some preferred embodiments of the invention of interest expressed protein is a protease.

In this document, the term "heterologous protein" means a protein or polypeptide that is not normally present in the cell host. Examples of heterologous proteins include enzymes, such as hydrolases, including proteases, cellulase, amylase, other carbohydrate and lipases; isomerases such as racemase, epimerase, tautomerase or mutase; transferases, kinases of fosfates. In some embodiments of the invention these proteins are therapeutically valuable proteins or peptides, including, but not limited to, growth factors, cytokines, ligands, receptors and inhibitors, as well as vaccines and antibodies. In some alternative embodiments of the invention specified in protein are commercially available and represent the industrial interest is a protein or peptide (e.g., protease, carbohydrase, such as amylase and glucoamylase, cellulase, oxidase and lipase). In some embodiments of the invention protein-coding genes, are natural genes, and in other embodiments of the invention are mutated and/or synthetic genes. In some embodiments of the invention protein-coding genes, are natural genes, and in other embodiments of the invention are used mu is new and/or synthetic genes.

In this document, the term "homologous protein" means native or natural protein or polypeptide or protein or polypeptide present in the cell host. The present invention encompasses cell-hosts, producing homologous protein and obtained by the methods of recombinant DNA. In alternative embodiments the invention, the homologous protein is native protein produced by other microorganisms, including, but not limited to,E. coli. The present invention encompasses cell-hosts, producing homologous protein in the techniques of recombinant DNA. The present invention also encompasses cells of the hosts that have one or more deletions or one or more breaks in the nucleic acids encoding the natural(e) homologous(e) protein(protein) (e.g., protease), and which contain a nucleic acid encoding a repetitive(iesa) homologous(e) protein(proteins) in recombinant form (i.e. in the expression cluster). In other embodiments of the invention a host cell produces homologous protein.

In this document the terms "protease" and "proteolytic activity" refer to a protein or peptide which is able to hydrolyze peptides or substrates having a peptide bond. To determine p is osteoliticescoy activity there are many well known methods (Kalisz, "Microbial Proteinases," In: Fiechter (ed.),Advances in Biochemical Engineering/Biotechnology, [1988]). So, for example, proteolytic activity can be determined by performing comparative analyses, which allow to analyze the corresponding ability of the protease to hydrolyze commercially available substrate. Representative substrates that can be used in this analysis protease or proteolytic activity, include, but are not limited to, dimethylation (Sigma C-9801), bovine collagen (Sigma C-9879), bovine elastin (Sigma E-1625) and bovine keratin (ICN Biomedical 902111). Colorimetric analyses that use such substrates are well known in the art (see, for example, application WO 99/34011 and U.S. patent No. 6376450 that are introduced in the present invention by reference). Analysis AAPF (see, for example, Del Mar et al., Anal Biochem, 99:316-320, [1979]) is also used to determine the level of production of the Mature protease. In this analysis, we measure the rate of release of p-nitroaniline as specified enzyme hydrolyzes soluble synthetic substrate, i.e. succinyl-alanine-alanine-Proline-phenylalanine-p-nitroanilide (sAAPF-pNA). The rate of production of yellow color after hydrolysis was measured on the spectrophotometer at a wavelength of 410 nm, and this speed is proportional to the concentration of active enzyme.

This is the document the term "activity" means the biological activity, associated with a specific protein, such as proteolytic activity associated with protease. The term "biological activity" means any activity, which is usually assumed to be a specialist, has this protein.

The term "production", if it refers to the interest squirrel covers the stages of processing in the production of polypeptides, including destruction of the Pro-region, which usually leads to the formation of the active Mature form of the polypeptide, which is known to be formed in the maturation process. In some embodiments of the invention producing the polypeptide includes the removal of the signal peptide that is known to occur in the process of protein secretion (see, for example, Wang et al., Biochemistry 37:3165-3171 (1998); and Power et al., Proc. Natl. Acad. Sci. USA 83:3096-3100 [1986]). In some embodiments the invention, the expressed protein is present in the intracellular environment in which it is expressed, and in other embodiments the invention, the expressed protein is secreted in the extracellular space. Thus, In some embodiments of the invention producing the protein of interest includes the implementation of the expression of the protein in cells and its secretion into the extracellular environment. For example, the production of protease covers two stages of processing Panora the measuring protease, including: 1) removal of the signal peptide, which is known to occur during protein secretion and 2) removal of the Pro-region, which, as is well known, leads to the formation of the active Mature form of the enzyme and which, as you know, is in the process of maturation (Wang et al., Biochemistry 37:3165-3171 (1998); Power et al., Proc Natl Acad Sci USA 83:3096-3100 [1986]).

In this document the term "early expression and/or early production" means that the expression and/or production of the protein of interest in the cell host is earlier than usually observed in the precursor/owner-the parent. In some embodiments of the invention "early expression and/or early production" of interest of the protein in the host, in which the observed overexpression of YmaH, occurs earlier than in the host, which does not occur overexpressionymaH.

In this document, the term "enhancing" refers to an increased level of production of proteins of interest. In its preferred embodiments, the present invention relates to the amplification (i.e. higher level) the production of protein of interest in a modified master. In these embodiments of the invention the term "increased" production means increased production compared to normal levels of production remodification is authorized by the owner of wild-type or modified by the owner of the parent (for example, cells of wild-type or modified cells, which are not sverkhekspressiya activator of transcription, such as YmaH).

Polypeptides YmaH and polynucleotide constructs encoding these polypeptides

In some embodiments implementing the present invention relates to polynucleotide constructs containing the promoter and a polynucleotide sequence encoding a YmaH protein. YmaHB. subtilisalso known as HFQ_BACSU, is an RNA-binding protein, is a member of the Hfq-family RNA-binding proteins (Sauter et al., Nucleic Acid Res 31:4091-4098, [2003]). YmaH protein is encoded in theBacillus subtilisgeneymaHthat is the ortholog of the gene hfqE. coli(Silvaggi et al., J Bacteriol. 187(19): 6641-6650, [2005]). YmaH is a common and pervasive RNA-binding protein that acts as a pleiotropic regulator of RNA metabolism in prokaryotes and is required for stabilization of specific transcripts and decomposition of other components. YmaH is associated primarily with unstructured A/U-rich RNA sequences and their sequence and structure similar to the eukaryotic Sm proteins. It is also known that YmaH is associated with small RNA molecules, called seboregulating, which increase the stability or efficiency of translation of the RNA is of transcriptof.

The present invention relates to methods and compositions used to implement the overexpressionymaHwhere these methods and compositions enhance the level of production of protein of interest in cells of the hosts that have been modified so that they were sverkhekspressiyaymaH. In addition, as indicated in the description of this application, overexpression ofymaHenhances the production of protease in the cells of hostsBacillus. Overexpression ofymaHcan be achieved by various methods, including increasing the level of transcription and/or translation YmaH-encoding polynucleotide. So, for example, at the level of transcription, overexpression ofymaHcan be achieved by increasing the number of polynucleotide sequences encodingymaHin the cells of the host and/or increase the strength of binding of promoterymaHto improve the activity cognates RNA polymerase. At the level of broadcast overexpression ofymaHcan be achieved by increasing the translational activity by mutation of the binding site with the ribosome (RBS) in order to increase the affinity of ribosomes for RBS. For the person skilled in the art it is obvious that overexpression ofymaHcan be achieved by increasing the number of copies of a geneymaHtaken separately or in combination the other possible modifications, introduced in geneymaHin order to achieve overexpressionymaH.

The present invention relates to compositions containing polynucleotide constructs, vectors and cells of the host, capable to sverkhekspressiyaymaH. The present invention also relates to methods of applying the compositions according to the invention in order overexpression of interest protein. Polynucleotide constructs according to the invention contain polynucleotide sequence encoding the YmaH protein and the promoter SigA and/or a SigH.

In one implementation of the present invention relates to overexpressionymaHby increasing the number of polynucleotide sequences encodingymaH. For example, the present invention relates to polynucleotide constructs containing polynucleotide sequence, encodingymaHfunctionally linked to the promoterymaH. PromoterymaHcan be any promoter that initiates the expression of ymaH (for example, the SigA promoter and/or SigH), and any sequence of nucleic acid, which has transcriptional activity in selected cell host, and mutant, truncated, and hybrid promoters, which may be obtained from genes encoding extracellular or intracellular polypeptides either homologous or g is teologiczne in relation to the cells of the host. The promoter sequence may be native or foreign to the host cells.

In some embodiments the invention, the promoter sequence may be obtained from a bacterial source. In some embodiments the invention, the promoter sequence may be obtained from gram-positive bacteria such as strains ofBacillus(for example,Bacillus alkalophilus, Bacillus amyloliquefaciens, Bacillus brevis, Bacillus circulans, Bacillus clausii, Bacillus coagulans, Bacillus firmus, Bacillus lautus, Bacillus lentus, Bacillus licheniformis, Bacillus B. megaterium, Bacillus pumilus, Bacillus stearothermophilus, Bacillus subtilisorBacillus thuringiensis);or a strain ofStreptomyces(for example,Streptomyces lividansorStreptomyces murinus); or from gram-negative bacteria (for example,E. coliorPseudomonassp.).

TranscriptionymaHusually runs two promoters: promoter SigA, which is located above the miaA-coding region and promoter SigH, which is located immediately above forymaH-the coding region of the operon miaAB. subtilis. In certain embodiments, the present invention relates to polynucleotide constructs that contain a polynucleotide sequence encoding a YmaH and the SigA promoter (e.g., SEQ ID NO:2 and 3). In SEQ ID NO:2 and 3 presents ways in whichymaH-the coding sequence is a contiguous sequence of SigA promoter and forms a chimeric polynucleotide the current design. In some preferred embodiments of the invention chimeric polynucleotide constructs containing the promoter sequence, which by its nature is not contiguous with theymaH-coding sequence. For example, in SEQ ID NOS:2 and 3 presents chimeric constructs SigA1 and SigA2, respectively, where each of these structures contains a SigA promoter functionally linked to a polynucleotide sequence that encodes aymaH.

GCGCCGAATTCTCATACCCTGAAAGGAAAGACAAGGGAAATTGTCGGCAATGAGCCGCTC GGCAGGTAGAAGGATGTTTACCGATGCAAAAAAAGGGCAAAATGGATAGGTGGTTGTCCA TGTTGAATGCTATAATGGGGGAGATTTATAAAAGAGAGTGATACATATTGAATAATACGAAG CAGCCCCACACATATAGCAGGAAAACTCGAACTTTAATCGAAACTGTATGATATAGAGAAT CAAGGAGGACGAAACATGAAACCGATTAATATTCAGGATCAGTTTTTGAATCAAATCCGGA AAGAAAATACGTATGTCACTGTTTTTTTGCTGAACGGCTTTCAGTTGCGGGGCCAGGTGAA AGGCTTTGATAACTTTACCGTATTGTTGGAATCGGAAGGTAAGCAGCAGCTTATATATAAAC ATGCGATCTCAACGTTTGCGCCGCAAAAAAACGTCCAGCTTGAACTCGAATAGATCAAAAA ATGCCATGTCAAGACATGAGGAAAGGCTGTCGGGGGTTCCCGGCGGCCATTTTTAACATG AATCCACTTTTGCTCCAAGCTTTTTGTGTAAGCTGACCATGCCAAGGCACGGTCTTTTTTTA TGAGGGATCCGGTGCC (SEQ ID NO:2)

GCGCCGAATTCTCATACCCTGAAAGGAAAGACAAGGGAAATTGTCGGCAATGAGCCGCTC

GGCAGGTAGAAGGATGTTTACCGATGCAAAAAAAGGGCAAAATGGATAGGTGGTTGTCCA TGTTGAATGCTATAATGGGGGAGATTTATAAAAGAGAGTGCTCGAACTTTAATCGAAACTG TATGATATAGAGAATCAAGGAGGACGAAACATGAAACCGATTAATATTCAGGATCAGTTTTT

GAATCAAATCCGGAAAGAAAATACGTATGTCACTGTTTTTTTGCTGAACGGCTTTCAGTTGC

GGGGCCAGGTGAAAGGCTTTGATAACTTTACCGTATTGTTGGAATCGGAAGGTAAGCAGC

AGCTTATATATAAACATGCGATCTCAACGTTTGCGCCGCAAAAAAACGTCCAGCTTGAACT CGAATAGATCAAAAAATGCCATGTCAAGACATGAGGAAAGGCTGTCGGGGGTTCCCGGCG GCCATTTTTAACATGAATCCACTTTTGCTCCAAGCTTTTTGTGTAAGCTGACCATGCCAAGG CACGGTCTTTTTTTATGAGGGATCCGGTGCC (SEQ ID NO:3)

In another embodiment, the present invention relates to polynucleotide constructs that contain a polynucleotide sequence which, which encodes YmaH and the SigA promoter (e.g., SigH-design of SEQ ID NO:1 below). In SEQ ID NO:1 also presents polynucleotide construct that contains theymaH-coding sequence, which by its nature is adjacent to the promoter SigH.

GGCACCGAATTCGACGTGGTTTCGCAACAAAATGCAGGTCACATGGTTCGATATGACACC GCCTGTTGATATGGAGCTGAAAAAAAAGGAAATTTTCACACATATAGCAGGAAAACTCGAA CTTTAATCGAAACTGTATGATATAGAGAATCAAGGAGGACGAAACATGAAACCGATTAATAT TCAGGATCAGTTTTTGAATCAAATCCGGAAAGAAAATACGTATGTCACTGTTTTTTTGCTGA ACGGCTTTCAGTTGCGGGGCCAGGTGAAAGGCTTTGATAACTTTACCGTATTGTTGGAATC GGAAGGTAAGCAGCAGCTTATATATAAACATGCGATCTCAACGTTTGCGCCGCAAAAAAAC GTCCAGCTTGAACTCGAATAGATCAAAAAATGCCATGTCAAGACATGAGGAAAGGCTGTCG GGGGTTCCCGGCGGCCATTTTTAACATGAATCCACTTTTGCTCCAAGCTTTTTGTGTAAGC TGACCATGCCAAGGCACGGTCTTTTTTTATGAGGGATCCGGAGCC (SEQ ID NO: 1)

In another embodiment, the present invention relates to polynucleotide constructs containing a polynucleotide YmaH-encoding sequence and a promoter SigA and SigH (for example, design SigA3 SEQ ID NO: 13, below).

TCATACCCTGAAAGGAAAGACAAGGGAAATTGTCGGCAATGAGCCGCTCGGCAGGTAGAA GGATGTTTACCGATGCAAAAAAAGGGCAAAATGGATAGGTGGTTGTCCATGTTGAATGCTA TAATGGGGGAGATTTATAAAAGAGAGTGATACATATTGAATAATACGAAGCAGCCCGTTGT CATTTTAGTCGGACCGACGGCAGTGGGGAAAACCAATTTAAGTATTCAGCTAGCCAAATCC TTAAACGCGGAAATTATCAGCGGAGATTCGATGCAGATTTATAAAGGGATGGATATTGGAA CAGCTAAAATTACCGAACAGGAGATGGAGGGAGTGCCCCATCATCTGATTGACATTTTAGA TCCCCAAGACTCTTTCTCTACTGCCGATTATCAAAGCTTAGTAAGAAATAAAATCAGCGAGA TTGCAAATAGAGGAAAGCTTCCGATGATTGACGGCGGTACAGGGCTTTATATACAATCTGA GCTTTACGATTATACATTTACGGAAGAGGCAAATGATCCCGTGTTTCGAGAGAGCATGCAA ATGGCTGCTGAGCGGGAAGGCGCTGACTTTCTTCATGCCAAACTTGCTGCAGCAGATCCC GAGGCAGCAGCTGCGATTCATCCGAATAATACAAGAAGAGTCATTCGCGCACTGGAAATTT TACATACGTCCGGAAAAACGATGTCCCAGCATTTGAAGGAACAAAAACGAGAACTTCTGTA CAATGCAGTGTTAATTGGCCTGACAATGGATAGAGACACGCTTTACGAAAGAATTAATCAG CGGGTCGATTTGATGATGCAGTCAGGCCTTCTTCCGGAAGTGAAACGCTTATACGACAAG AACGTGAGAGACTGTCAATCAATACAGGCGATAGGCTATAAAGAGCTGTATGCTATTTTG ACGGTTTTGTGACACTTTCCGATGCTGTCGAACAGCTAAAGCAGAACTCGAGGCGGTATG CGAAACGCCAGCTGACGTGGTTTCGCAACAAAATGCAGGTCACATGGTTCGATATGACAC CGCCTGTTGATATGGAGCTGAAAAAAAAGGAAATTTTCACACATATAGCAGGAAAACTCGA ACTTTAATCGAAACTGTATGATATAGAGAATCAAGGAGGACGAAACATGAAACCGATTAATA TTCAGGATCAGTTTTTGAATCAAATCCGGAAAGAAAATACGTATGTCACTGTTTTTTTGCTG AACGGCTTTCAGTTGCGGGGCCAGGTGAAAGGCTTTGATAACTTTACCGTATTGTTGGAAT CGGAAGGTAAGCAGCAGCTTATATATAAACATGCGATCTCAACGTTTGCGCCGCAAAAAAA CGTCCAGCTTGAACTCGAATAGATCAAAAAATGCCATGTCAAGACATGAGGAAAGGCTGTC GGGGGTTCCCGGCGGCCATTTTTAACATGAATCCACTTTTGCTCCAAGCTTTTTGTGTAAG CTGACCATGCCAAGGCACGGTCTTTTTTTATGAG (SEQ ID NO: 13)

Examples of suitable promoters for regulation of gene expressionymaHare the promoters of SigA and SigH coming from operonB. subtilisthat covers the gene encoding miaA. For example, in one of its variants, the present invention relates to a polynucleotide sequence that defines the SigA promoter (SEQ ID NO: 14, below).

TCATACCCTGAAAGGAAAGACAAGGGAAATTGTCGGCAATGAGCCGCTCGGCAGGTAGAA GGATGTTTACCGATGCAAAAAAAGGGCAAAATGGATAGGTGGTTGTCCATGTTGAATGCTA TAATGGGGGAGATTTATAAAAGAGAGTGATACATA (SEQ ID NO:14)

In another embodiment, the present invention relates to a polynucleotide sequence that defines a SigH promoter (SEQ ID NO: 16, below).

AAAGGAAATTTTCACACATATAGCAGGAAAACTCGAACTTTAATCGAAACTGTATGATATAG

AGAATCAAGGAGGACGAAAC (SEQ ID NO:16)

Other examples of promoters that can be used for gene expressionymaHare the promoters Sigma A recognized factor σAndincluding the promoter of the gene and agarasesStreptomyces coelicolor(dagA), the promoter of the gene of the alkaline proteaseBacillus lentus(aprH), the promoter of the gene of the alkaline proteaseBacillus licheniformis(gene subtilisin Carlsberg), the promoter of the gene of LavansaariBacillus subtilis(sacB), the promoter of the gene alpha-amylaseBacillus subtilis(amyE), the promoter of the gene alpha-amylaseBacillus licheniformis(amyL), the promoter of the gene maltogenic amylaseBacillus stearothermophilus(amyM), and promote the gene alpha-amylase Bacillus amtyloliquefacietis(amyQ). Examples of promoters that can be used for gene expressionymaHare the promoters Sigma H, identifiable factors σHincludingspoOA, spoOF, spoVGandcitG (see, Helmann, J. D. and C. P. Moran. 2002. RNA polymerase and sigma factors, pp.289-312 in A. L. Sonenshein, J. A. Hoch and R. Losick (ed), Bacillus subtilis and its closest relatives: from genes to cells. American Society for Microbiology, Washington, D.C.).

In some embodiments implementing the present invention relates to the use of consensus promoters SigA and/or a SigH. Constructing consensus promoter can be carried out by the method of site-directed mutagenesis with obtaining promoter, conformation which more accurately corresponds to the conformation of the known consensus sequences for the "-10" and "-35"regions vegetative promoters "type SigmaA"Bacillus subtilis(Voskuil et at., Mol. Environ 17: 271 279 [1995]). In other embodiments of the invention consensus promoter construct using site-directed mutagenesis with obtaining promoter, conformation which more accurately corresponds to the conformation of the known consensus sequences for the "-10" and "-35"regions vegetative promoters "type Sigma H"Bacillus subtilis(see, publications and Moran Helman in Bacillus subtilis and the most closely related publications, Ch.21, pg289-312; Sonenshein et al (2002 ASM Press, Washington, D.C.). Consensus sequence for the "-35"region of the promoter type sigma is A TGaca, for the "-10"region - tgnTATaat, and the consensus sequence for the "-35"region of the promoter sigma H is a sequence RnAGGAwWW, and for the "-10"region - RnnGAAT. Capital letters identified a highly conserved position; lower beeches indicated less conservative position; the abbreviation R may indicate A or G and W can mean A or T. the Consensus sequence of the promoter can be obtained for any promoter that can function in the cell-hostBacillus.

In some embodiments of the invention the SigA promoter, which comprises SEQ ID NO: 14, is determined by the polynucleotide sequence, which is normally located above the miaA-coding sequence (SEQ ID NO: 15, below), and the promoter SigH, which comprises SEQ ID NO: 16, is determined by the polynucleotide sequence, which is normally located aboveymaH-coding region (SEQ ID NO:17, below).

TTGAATAATACGAAGCAGCCCGTTGTCATTTTAGTCGGACCGACGGCAGTGGGGAAAACC AATTTAAGTATTCAGCTAGCCAAATCCTTAAACGCGGAAATTATCAGCGGAGATTCGATGC AGATTTATAAAGGGATGGATATTGGAACAGCTAAAATTACCGAACAGGAGATGGAGGGAGT GCCCCATCATCTGATTGACATTTTAGATCCCCAAGACTCTTTCTCTACTGCCGATTATCAAA GCTTAGTAAGAAATAAAATCAGCGAGATTGCAAATAGAGGAAAGCTTCCGATGATTGACGG CGGTACAGGGCTTTATATACAATCTGAGCTTTACGATTATACATTTACGGAAGAGGCAAAT GATCCCGTGTTTCGAGAGAGCATGCAAATGGCTGCTGAGCGGGAAGGCGCTGACTTTCTT CATGCCAAACTTGCTGCAGCAGATCCCGAGGCAGCAGCTGCGATTCATCCGAATAATACA AGAAGAGTCATTCGCGCACTGGAAATTTTACATACGTCCGGAAAAACGATGTCCCAGCATT TGAAGGAACAAAAACGAGAACTTCTGTACAATGCAGTGTTAATTGGCCTGACAATGGATAG AGACACGCTTTACGAAAGAATTAATCAGCGGGTCGATTTGATGATGCAGTCAGGCCTTCTT CCGGAAGTGAAACGCTTATACGACAAGAACGTGAGAGACTTCAATCAATACAGGCGATA GGCTATAAAGAGCTGTATGCATATTTTGACGGTTTTGTGACACTTTCCGATGCTGTCGAAC AGCTAAAGCAGAACTCGAGGCGGTATGCGAAACGCCAGCTGACGTGGTTTCGCAACAAAA TGCAGGTCACATGGTTCGATATGACACCGCCTGTTGATATGGAGCTGAAAAAAAAGGAAAT TTTCACACATATAGCAGGAAAACTCGAACTTTAA (SEQ ID NO: 15)

ATGAAACCGATTAATATTCAGGATCAGTTTTTGAATCAAATCCGGAAAGAAAATACGTATGT CACTGTTTTTTTGCTGAACGGCTTTCAGTTGCGGGGCCAGGTGAAAGGCTTTGATAACTTT ACCGTATTGTTGGAATCGGAAGGTAAGCAGCAGCTTATATATAAACATGCGATCTCAACGT TTGCGCCGCAAAAAAACGTCCAGCTTGAACTCGAATAG (SEQ ID NO: 17)

The present invention also encompasses the promoter sequences that were motivovany to increase the promoter activity compared with the activity of the corresponding promoter wild type, and thus for overexpression of YmaH protein. Thus, it should be noted that in the construction according to the invention can be used variants of the sequences that define the promoters SigA and SigH. Methods design options promoters inBacillussp. well known in the art (see, for example, Helmann et al., 2002. RNA polymerase and sigma factors, pp289-312 In A. L. Sonenshein, J. A. Hoch and R. Losick (ed),Bacillus subtilisand its closest relatives: from genes to cells. American Society for Microbiology, Washington, D.C.). This is provided that the present invention is not limited to any specific promoters, since it is known that the present invention can be used with any suitable promoter. However, In some embodiments of the invention specified by the promoter is the promoter sigHB. subtilisand in other embodiments of the invention specified by the promoter is the promoter sigAB. subtilis. In other embodiments of the invention promoters sigH and sigA serve the overexpression of YmaH protein.

In some valentinorossini invention, polynucleotide constructs according to the invention also contains the necessary binding site with the ribosome, for optimum translation of the RNA transcriptymaH. In some embodiments of the invention the polynucleotide construct contains a sequence of the binding site with the ribosome (RBS) miaA gene (AAGAGAG; SEQ ID NO:21), and in other embodiments of the invention the polynucleotide construct contains a sequence of RBS geneymaH(GGAGG; SEQ ID NO:22). In other embodiments of the invention the polynucleotide construct contains sequences of the binding site with the ribosome genes miaA andymaH. In certain embodiments, the present invention relates to structures having the promoter sequence of the binding site with the ribosome aboveymaH-coding sequence. The present invention is not limited to those described herein sequences of the binding site with the ribosome, since the present invention also encompasses any suitable sequence of the binding site with the ribosome, which were motivovany to increase the level of gene expressionymaH. Methods of obtaining the mutated sequences of the binding site with the ribosome, raising the level of gene expression inBacillusknown to specialists. For example, Band (Band) and Henderon (Henner) was successfully implemented increased expression level of interferon inB. subtilisby modification of RBS with obtaining a pair OS is Avani, closely related to 16S rRNA (Band, L. and D. J. Henner, DNA 3:17-21 [1984]).

Natural YmaH proteinBacillus subtilisis a protein of 73 amino acids (SEQ ID NO:4)encoded by polynucleotides of 219 base pairs (222, including the stop codon) (EMBL Primary Accession Number Z99113; SEQ ID NO:17).

MKPINIQDQFLNQIRKENTYVTVFLLNGFQLRGQVKGFDNFTVLLESEGKQQLIYKHAISTFAPQKNVQLELE (SEQ ID NO:4)

Thus in some embodiments of the invention the polynucleotide sequence design, YmaH coding is a natural polynucleotide sequence present in the genome of strain 168Bacillus subtiliswild-type (SEQ ID NO:4). The present invention also encompasses variants of the YmaH protein, including options YmaH protein derived from the protein of the wild type as a result of deletions (i.e. truncation), add or replace one or more amino acids at one or more provisions of the native protein. Methods for the introduction of such deletions, additions and substitutions, mostly known in the art. So, for example, amino acid sequence variants of the polypeptide can be obtained by introducing mutations in the cloned DNA sequence encoding interest of the native protein. Methods mutagenesis and modifications of the nucleotide sequence are well known in the art (see, for example, the publication of Kunkel (1985) Proc. Natl. Acad. Sci. USA 82:488 492; Kunkel et al. (1987) Methods Enzymol. 154:367 382; U.S. patent 4873192; and tiruemye in them, introduced in the present description by reference). When designing variants of interest protein modifications in nucleotide sequences encoding these options should be made so that these variants retain the desired activity. As we all know, due to the degeneracy of the genetic code, YmaH protein encoded various modified polynucleotide. In some other embodiments, the present invention relates to polynucleotides containing a nucleotide sequence that is at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98% or at least about 99% identical to the polynucleotide sequence of SEQ ID NO: 17.

In other embodiments the invention, the polynucleotide constructs according to the invention contain YmaH-encoding sequence, similar YmaH coding sequence of strain 168Bacillus subtilis. The genome of this strain, which is one 4215 TPN-gene has been well characterized (see, Kunst et al., Nature 390:249-256 [1997]; and (Henner et al., Environ. Rev., 44:57-82 [1980]). In some embodiments, from whom retene polynucleotide constructs according to the invention contain a polynucleotide sequence, encoding the YmaH protein, amino acid sequence which is at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 92%, at least about 95%, at least about 97%, at least about 98% and at least about 99% identical to the amino acid sequence of the protein YmaH wild type, where this protein has a comparable or increased ability to enhance the production of protein of interest in cells of the host compared to the wild-type polypeptide (SEQ ID NO:4) and retains the ability to increase the level of expression of a protein of interest in cells of the host. In other embodiments, the present invention relates to polynucleotide constructs containing polynucleotide sequences that are homologous, ontologyname or analogichnymi genes with the sequenceBacilluswild-type SEQ ID NO:17, and which retain the ability to increase production of protein of interest.

The present invention also encompasses polynucleotide constructs comprising sequences encoding the YmaH protein, which have structural and/or functionality is a great similarity. In some embodiments of the invention, these proteins are derived from various microorganisms of the genus and/or species, including microorganisms of different classes (e.g., bacterial protein and protein fungi). In some embodiments of the invention, these proteins are derived from various microorganisms of the genus and/or species. In additional embodiments of the invention related proteins originate from the same species. Indeed, it is envisaged that the present invention is not limited to related proteins originating from any (any) specific(s) source(s). In addition, the term "related proteins" encompasses homologues with tertiary structure and homologues with the primary sequence (for example, YmaH according to the invention). For example, the present invention covers these homologues, including, but not limited to, the YmaH protein, such as YmaHE. coli (HFQ_ECOLI), Shighella flexneri (HFQ_SHIFL), Salmonella typhimurium (HFQ_SALTY), Yersinia enterocolitica (HFQ_YEREN), Yersinia pestis (HFQ_YERPE), Erwinia carotovora (HFQ_ERWCA), Haemophilus influenzae (HFQ_HAEIN), Pasteurella multocida (HFQ_PASMU), Vibrio cholerae (HFQ_VIBCH), Pseudomonas aeruginosa (HFQ_PSEAE), Xanthomonas axonopodis (HFQ_XANAC), Xanthomonas campestris (HFQ_XANCP), Xylella of (GSQ_XYLFA), Neisseria meningitidis (HFQ_NEIMA), Ralstonia solanacearum (HFQ_RALSO), Agrobacterium tumefaciens (HFQ_AGRTS), Brucella melitensis (HFQ_BRUME), Rhizobium loti (HFQ_RHILO), Azorhizobium caulinodans (HFQ_AZOCA), Caulobacter crescentus (HFQ_CAUCR), Aquifex melitensis (HFQ_AQUAE), Thermotoga maritime (HFQ_THEMA), Clostridium acetobutylicum (HFQ_CLOAB), Clostridium perfringens (HFQCLQPE), Bacillus halodurans (HFQ_BACHD), Bacillus subtilis (HFQ_BACSU), Thermoanaerobacter tengcongensis (HFQ_THETN), S. aureaus (Q99UG9)andM. jannasci (Q58830)(Sauter et al., Nucleic Acids Res. 31:4091-4098 [2003]).

Related proteins (and their derivatives) include options YmaH protein. In some preferred embodiments of the invention, variants of proteins differ from the parent protein and from each other by a small number of amino acid residues. The number of different amino acid residues may be 1 or more, and preferably about 1, 2, 3, 4, 5, 10, 15, 20, 30, 40, 50 or more amino acid residues. In some preferred embodiments of the invention, the number of different amino acids in these cases is approximately from 1 to 10. In some especially preferred embodiments of the invention related proteins, and in particular, variants of proteins have amino acid sequences identical to at least about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, about 97%, about 98% or about 99%. For more options YmaH protein according to the invention can be applied to various methods known in the art, including, but not limited to, site-saturating mutagenesis, scanning mutagenesis, insertional mutagenesis, nonspecific mutagenesis, site-directed mutagenesis and direct the evolution and razlichnykh recombinatory methods.

Characterization of proteins of wild-type and mutant proteins carry out any suitable methods, preferably based on assessment of interest properties. So, for example, provides that can be used YmaH protein, can enhance the production of protein of interest.

In some embodiments of the invention the recombinant polynucleotide according to the invention include polynucleotide sequences that can be optimized codons for expression YmaH protein in the cell host. Because the table of codons that specify the frequency of occurrence for each codon, well known in the art (see, for example, Nakamura et al., Nucl. Acids Res., 28:292 [2000]) or can be easily obtained, can be easily selected such nucleic acids, which give the corresponding amino acid sequence of the expressed protein. In some embodiments of the invention optimized codons of the sequence contain polynucleotide encoding the YmaH protein that is at least about 70% identical to the sequence of SEQ ID NO:4.

Vectors containingymaH

The present invention relates to vectors containing the polynucleotide constructs according to the invention. These vectors introduced into the cell host to implement when AirExpress YmaH protein.

In some embodiments of the invention, the overexpression of the polypeptide occurs as a result of expression of one or more copies of the corresponding YmaH-encoding polynucleotide present at mnogostadiinoi/can replicate the plasmid, which was introduced into the cell host. Thus, in certain embodiments, the present invention relates to a vector containing a polynucleotide construct introduced into this vector. In some embodiments of the invention the specified vector is mnogoopytny/can replicate the plasmid vector, forming extrachromosomal self-replicating genetic element that sverkhekspressiya YmaH in the cell host. Typically, this vector is a plasmid vector that carries breeding marker gene, which allows for easy selection of host cells containing this plasmid. Vectors which are autonomously replicated in a cell host, are the vectors containing the origin of replication that allows a given vector autonomously replicate in the cellBacillus. Examples of bacterial original replication are originy replication of plasmids pBR322, pUC19, pACYC177, and pACYC184, provides replication inE. coliand plasmids pUB110, pC194, pE194, pTA1060, and pAMβ1, provides replication inBacillus. This origin of replication may have a mutation, consistent Yes the Noah plasmid thermal sensitivity in the cell Bacillus(see, for example, Ehrlich, Proceedings of the National Academy of Sciences USA 75:1433 [1978]).

As mentioned above, in some embodiments of the invention polynucleotide encoding YmaH protein, is introduced into a cell of the host by the expression vector able to replicate in the cell host. Suitable plasmids that can replicate and integrate intoBacillus, known in the art (see, for example, Harwood and Cutting (eds),Molecular Biological Methods forBacillus, John Wiley & Sons, [1990], and in particular Chapter 3; suitable plasmids can replicate forB. subtilisare plasmids listed on page 92).

In some embodiments of the invention, the overexpression of the polypeptide YmaH is the result of the expression of at least one copy of the YmaH-encoding polynucleotide integrated into the genome of the host cell. Thus, in some embodiments of the invention, if the vector introduced into the cell host, it is integrated into its genome and replicated together with the genome in which it was integrated. When this can be integrated multiple copies of the geneymaHin several provisions of the genome of the host cell. Alternatively, amplificatory expression cluster carrying a sequence encoding a YmaH, and selective marker (e.g., a marker of resistance to the antimicrobial agent, such as a gene, the code is highlighted chloramphenicol-acetyltransferase), can be integrated into the genome via a single crossover event, and then amplified by stimulation of the transformed host cells to increasing concentrations of the appropriate antimicrobial agent (e.g., chloramphenicol).

In other embodiments implementing the present invention relates to polynucleotide constructs included in the vector for integration. In some embodiments of the invention, polynucleotide constructs according to the invention, which is introduced into a vector for integration, bring in the chromosomal sequence, host cellsBacillusin order to create a modified host cells containing a stable tandem units from the multiple copies of the vector. The polynucleotide construct which is included in the vector for integration usually contains breeding marker gene that tells cells resistance to antimicrobial agent and provides amplification of the integrated designymaH. This may occur tandem integration into one site, and adekoya and dvuhshatrovaya integration. Polynucleotide design, regardless of whether it is in a vector or used separately without plasmid DNA, can be used to transform host cells by any suitable method known specialist is.

Methods for introducing DNA into cellsBacillusconducted using plasmid constructs and by transfer of plasmids into bacterial cells are the masters, well-known to specialists. In some embodiments of the invention, plasmids isolated fromE. coliand transferred toBacillus. However, the method of embedding in microorganisms, such asE. colinot a big deal, a in some embodiments of the invention, a DNA construct or DNA vector is directly injected into the cell hostBacillus.

Suitable methods for introducing polynucleotide sequences into cellsBacilluswell known in the art (see, e.g., Ferrari et al., "Genetics," in Harwood et al. (ed.), Bacillus, Plenum Publishing Corp. [1989], pages 57-72; Saunders et al., J. Bacteriol., 157:718-726 [1984]; Hoch et al., J. Bacteriol., 93:1925 -1937 [1967]; Mann et al., Current Environ., 13:131-135 [1986]; and Holubova, Folia Environ., 30:97 [1985]; Chang et al., Mol. Gen. Genet, 168:11-115 [1979]; Vorobjeva et al., FEMS Environ. Lett., 7:261-263 [1980]; Smith et al., Appl. Env. Environ., 51:634 [1986]; Fisher et al., Arch. Environ., 139:213-217 [1981]; and McDonald, J. Gen. Environ., 130:203 [1984]). Indeed, methods such as transformation, including the transformation and integration of protoplasts, as well as transduction and fusion of protoplasts, are known and can be used in the present invention. Methods of transformation are particularly preferred for the introduction of DNA constructs obtained in accordance with the present invention, in the cell of the host.

In some the older versions of the invention, transformation of host cells, besides the well-known methods, carried out directly (i.e. before the introduction of DNA constructs into the cell host, these cells are not subjected to the intermediate amplification or any other processes). Known physical and chemical methods, which are normally used for introducing DNA into a cell of the host, is the introduction of DNA constructs into the cell host, which allows you not to resort to the introduction of this construct into a plasmid or vector. Such methods include, but are not limited to, electroporation, the introduction of the "naked" DNA or liposome, etc. In additional embodiments of the invention, DNA constructs injected with plasmid, without embedding these constructs in plasmid. In other embodiments the invention, the selective marker is removed from a modified strain ofBacillusmethods known in the art (see, Stahl et al., J. Bacteriol., 158:411-418 [1984]; and (Palmeros et al., Gene 247:255 -264 [2000]).

Known methods used for transformationBacillusare methods such as transformation preserving plasmid marker, which includes the absorption of the donor plasmid competent cells bearing partially homologous plasmid-resident (Contente et al., Plasmid 2:555-571 [1979]; Haima et al., Mol. Gen. Genet, 223:185-191 [1990]; Weinrauch et al., J. Bacteriol., 154:1077-1087 [1983]; and (Weinrauch et al., J. Bacteriol., 169:1205-1211 [1987]). This is a method based on recombination between embedded donor plasmid and homologous region "helper" plasmid resident in the simulation engine of transformation of the chromosome.

Other methods of transformation, including the transformation of the protoplasts, well known in the art (see, e.g., Chang and Cohen, Mol. Gen. Genet, 168:111-115 [1979]; Vorobjeva et al., FEMS Environ. Lett., 7:261-263 [1980]; Smith et al., Appl. Env. Environ.,51:634 [1986]; Fisher et al., Arch. Environ., 139:213-217 [1981]; McDonald [1984] J. Gen. Environ., 130:203 [1984]; and Bakhiet et al., 49:577 [1985]). In addition, the publication of Mann et al., (Mann et al., Curr. Environ., 13:131-135 [1986]) described the transformation of protoplastsBacillusand in the publication Holubova (Holubova, Environ., 30:97 [1985]) described methods for introducing DNA into protoplasts using DNA-containing liposomes. In some embodiments of the invention, in order to know whether the gene of interest in a cell host, use of marker genes. In some embodiments of the invention the polynucleotide sequenceymaHcontained in the vector according to the invention, encodes a YmaH protein having SEQ ID NO:4, or its variants.

In other embodiments of the invention in addition to these methods provide a direct transformation of the host cells. When "direct transformation", before the introduction of the modified polynucleotide cells of the host (i.e.,Bacillusthese cells are not subjected to the intermediate stage of amplification or any other processes. Known physical and chemical methods, which are usually used by professionals for the introduction of modified the frame of polynucleotide in the cell-master, is the introduction of a modified polynucleotide in the cell host, which allows you not to resort to the introduction of this polynucleotide in a plasmid or vector. Such methods of introducing DNA into cells include, but are not limited to, the use of competent cells, and the use of "artificial"methods such as precipitation with calcium chloride, electroporation, etc. Thus, in accordance with the present invention is used "naked" DNA, liposomes, etc. In other embodiments of the invention modified polynucleotide injected with plasmid, without embedding these polynucleotide in the plasmid. In some embodiments implementing the present invention relates to a vector containing polynucleotide encoding YmaH protein and functionally associated with the sigA promoter (e.g., SEQ ID NO:2 and 3). In other embodiments of the invention, the vector contains YmaH-encoding polynucleotide, functionally associated with a sigH promoter (e.g., SEQ ID NO:1). In other embodiments of the invention the specified vector contains a polynucleotide construct that contains YmaH-encoding sequence, the sigA promoter and promoter sigH (for example, SEQ ID NO: 13).

In some embodiments of the invention ymaH sverkhekspressiya in neintegriruemykh vector. In some embodiments of the invention ymaH of spherexp siruela in the cell-master, in which one or more chromosomal genes have been modified (for example, degU) and/or deleterow (for example,nprEfrom genomeBacillus. In some embodiments of the invention, one or more natural chromosomal regions have been modified and/or deleterow from the corresponding genome of the hostBacilluswild-type. In certain preferred embodiments, the present invention relates to methods and compositions used to increase the level of expression and/or secretion of at least one protein of interest inBacillus.

Cell host containingymaH

The present invention relates to modified cells to the hosts that have been genetically modified in order overexpressionymaHand that they have an increased ability to produce proteins of interest. In particular, the present invention relates to modified cells-masters of gram-positive pathogens, such asBacillussp., which sverkhekspressiyaymaH. In some embodiments of the invention,ymaHsverkhekspressiya in the wild-type microorganisms, and in other embodiments of the invention YmaH sverkhekspressiya in the modified cells of the host. In some embodiments of the invention, a modified cell-x is Zain has the ability to produce a protein of interest at a higher level, than its predecessor wild type. In some especially preferred embodiments of the invention overexpression of YmaH in overproducers modified the hosts parents also leads to increase production of protein of interest. In some embodiments of the invention overexpression of YmaH in a modified host-parent induces the production of protein of interest over a shorter period of time than the corresponding unmodified host parent. Overexpression ofymaHin the cell host is achieved using vectors and structures according to the invention described in this application. Thus, in some embodiments implementing the present invention relates to a modified cell host, which is obtained by transformation of the host cell wild-type or modified host cell a vector containing YmaH-encoding sequence functionally linked to a sigA promoter and/or sigH. In particular, the modified cells are the owners of according to the invention have the ability to produce a protein of interest, and in some embodiments the invention, the modified cells are the masters contain polynucleotide constructs encoding the YmaH (for example, SEQ ID NO:1, , 3 or 13).

In certain embodiments, the present invention relates to methods overexpressionymaHin the cells of the host to increase production of protein of interest. Of interest protein can be either homologous or heterologous with respect to the host. In some embodiments of the invention of interest protein is secreted polypeptide, and in particular the enzyme, including, but not limited to, amylolytic enzymes, proteolytic enzymes, cellulities enzymes, oxidoreductase enzymes and enzymes that destroy the walls of plants. In other embodiments of the invention such enzymes include, but are not limited to, amylase, protease, xylanase, lipase, laccase, peroxidase, oxidase, cutinase, cellulase, hemicellulase, esterase, peroxidase, catalase, glucose-oxidase enzyme, phytase, pectinase, glucosidase, isomerases, transferases, kinases of fosfates, galactosidase and chitinases. In other embodiments of the invention of interest protein is a hormone, cytokine, growth factor, receptor, vaccine, antibody or the like, it Should be noted that the present invention is not limited to any particular protein, and in some embodiments of the invention of interest protein is p is Oteiza.

In some embodiments of the invention the cells of the host areBacillus sp., Streptomyces sp., Escherichia sp. orAspergillus sp. In other embodiments of the invention of interest proteins are protease produced by cells of the host of the genusBacillus(see, for example, U.S. patent No. 5264366, U.S. patent No. 4760025 and RE 346060). In some embodiments of the invention of interest by a strain of Bacillus is alcaliphilic microorganismBacillus. Experts know a lot alcaliphilic strains ofBacillus(see, for example, U.S. patent No. 5217878; and Aunstrup et al., Proc IV IFS: Ferment. Tech. Today, 299-305 [1972]). Another type of special interest strainBacillusis the cage of an industrial strain ofBacillus. Examples of industrial strains ofBacillusinclude, but are not limited to,theB. licheniformis, B. lentus, B. subtilis, B. clausiiandB. amyloliquefaciens. In additional embodiments of the invention, the strain-hostBacillusselected from the group consisting ofB. licheniformis, B subtilis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coagulans, B. circulans, B. lautus, B. pumilus, B. thuringiensisandB. B. megateriumand other microorganisms of the genusBacillus. In preferred embodiments of the invention are cellsB. subtilis.

In some embodiments of the invention industrial strains-hosts are selected from the group consisting of non-recombinant strains ofBacillussp., Mutan the s natural strain of Bacillusand recombinant strains of hostsBacillus. The preferred strain-host is a recombinant strain, where polynucleotide encoding interest polypeptide was previously entered into the cell host. Other preferred strain-host is a strain-hostBacillus subtilisand in particular recombinant strain-hostBacillus subtilis. Many strains ofB. subtilisknown in the art and are suitable for use in the present invention (see, for example, 1A6 (ATCC 39085), 168 (1A01), SB19, W23, Ts85, B637, PB1753-PB1758, PB3360, JH642, 1A243 (ATCC 39087), ATCC 21332, ATCC 6051, MI 13, DE100 (ATCC 39094), GX4931, PBT 110 and strain PEP 211; Hoch et al., Genetics, 73:215-228 [1973]; U.S. patent No. 4450235; U.S. patent No. 4302544; EP 0134048).B. subtiliswidely used by professionals as a master for the implementation of expression (see Palva et al., Gene, 19:81-87 [1982]; Fahnestock and Fischer, J. Bacteriol., 165:796-804 [1986]; and Wang et al., Gene 69:39-47 [1988]).

Cell-hosts, of particular interest are cells of industrial strains ofBacillusproducing protease. High efficiency production of protease by these strains can be further enhanced using modified strains ofBacillusreceived in accordance with the present invention. Particularly preferred hosts suitable for the expression of industrial strains ofBacillusproducing protease. In some the older versions of the invention, the application of these strains according to the invention also allows to further increase the level of production of protease. As mentioned above, there are two main types of proteases, usually secreted byBacillussp., namely neutral protease (or metalloprotease") and alkaline protease (or "serine" protease). In addition, as mentioned above, subtilisin is a preferred serine protease used in the present invention. Were identified and sequenced subtilisinBacillusa wide range, such as subtilisin 168, subtilisin BPN', subtilisin Carlsberg, subtilisin DY, subtilisin 147, subtilisin 309 (see, for example, EP 414279 B; WO 89/06279; and Stahl et al., J. Bacterid., 159:811-818 [1984]), subtilisinB. lentusand subtilisinB. clausii(J. C. van der Laan, G. Gerritse, J. L. Mulleners, R. A. van der Hoek and W. J. Quax. Appl Environ Environ. 57: 901-909 [1991]).

In some embodiments, implementation of the present invention, the strain-hostsBacillusproduce mutant protease (e.g., options). The literature provides many examples of modified and standard proteases (see, for example, WO 99/20770; WO 99/20726; WO 99/20769; WO 89/06279; RE 34606; U.S. patent No. 4914031; U.S. patent No. 4980288; U.S. patent No. 5208158; U.S. patent No. 5310675; U.S. patent No. 5336611; U.S. patent No. 5399283; U.S. patent No. 5441882; U.S. patent No. 5482849; U.S. patent No. 5631217; U.S. patent No. 5665587; U.S. patent No. 5700676; U.S. patent No. 5741694; U.S. patent No. 5858757; U.S. patent No. 5880080; patent U.S. No. 6197567; and U.S. patent No. 6218165.

In some embodiments of the invention, xpressia protein of interest in cells of the host is initiated by the promoter aprEgeneaprEfrom which usually transcribed subtilisinB. subtilis. GeneaprEtranscribed by the sigma factor A (σAnd), and its expression is largely regulated by several regulators, such as: DegU/DegS, AbrB, Hpr and SinR (Valle and Ferrari (1989) In: Smith I,Slepecky RA, Setlow P (eds) Regulation of Procaryotic Development. American Society for Microbiology. Washington, DC, pp 131-146), was identified consensus promotor Sigma A: TGGGTCTTGACAAATATTATTCCATCTATTACAATAAATTCACAGA (SEQ ID NO:23; US 2003014846; Helman et al., 1995, Nucleic Acid Research, Vol. 24, pp. 2351-2360). In some embodiments the invention, a host cell contains a promoteraprEthat is a promoteraprEwild-type: TGGGTCTACTAAAATATTATTCCATCTATTACAATAAATTCACAGA (SEQ ID NO:24; publication of patent application U.S. No. 20030148461).

In other embodiments of the invention the expression of the protein of interest by the cells of the host is initiated by the mutant promotersaprEB. subtilis. In some embodiments, the implementation, the present invention relates to a cell-hostsBacilluscontaining mutant promoteraprEfunctionally associated with a polynucleotide sequence that encodes a protein of interest. Thus, the present invention encompasses cells of the host expressing the protein of interest from the mutant promoteraprE. An example of a mutant promoteraprEis Mut is ntny promoter aprEhaving the sequence TGGGTCTTGACAAATATTATTCCATCTATTACAATAAATTCACAGA (SEQ ID NO: 25), as described in published patent application U.S. No. 20030148461. Any of the methods herein proteins of interest (such as subtilisinBacillus) can be transcribed from a promoteraprE. In certain embodiments, the present invention relates to a modified cell-hostBacillusable to Express the protein of interest of promoteraprE. In some embodiments of the invention modified the host-cell is modified cell-hostB. subtilisable to Express the protease under the action of the promoter ofaprE. In some embodiments of the invention the promoteraprEincludes regulatory promoter elementsaprEand/or transcription of the leader sequenceaprEand in other embodiments of the invention the promoteraprEdoes not include regulatory promoter elementsaprEand/or transcription of the leader sequenceaprE.

In addition to promoteraprEthe present invention also encompasses compositions and methods to be used for expression of interest protein of the host-cell, where expression of the gene encoding protein of interest, is triggered by any promoter suitable for the initiation of transcription of the gene of interest, p is and the condition, that the specified promoter contains a transcription of the leader sequence of the geneaprE.

In another embodiment of the invention by the owner of theBacillusisBacillussp., which contains a mutation or deletion in at least one of the genes degU, degS, degR and/or degQ. The preferred mutation is a mutation in the gene degU, and the preferred mutation is a mutation degU(Hy)32 (see Msadek et al., J. Bacterid., 172:824-834 [1990]; and (Olmos et al., Mol. Gen. Genet., 253:562-567 [1997]). The most preferred strain-host is a bacteriumBacillus subtiliscarrying mutationdegU(Hy)32. In another embodiment of the invention the hostBacilluscontains a mutation or a deletion in scoC4 (see Caldwell et al., J. Bacteriol., 183:7329-7340 [2001]); andspollE(See, Arigoni et al., Mol. Environ., 31:1407-1415 [1999]). In some embodiments of the invention such mutations are single, and in other embodiments of the invention are combinations of these mutations. In some embodiments of the invention modifiedBacillusaccording to the invention is obtained from the strain-hostBacillusthat contains a mutation in one or more of the above-mentioned genes. In some embodiments of the invention the modified hostBacilluspossessing an enhanced ability to produce a protein of interest, are chosen as the host cell according to the invention. In some var is the ants of the invention, a modified cell-host Bacillushas a high ability to produce protease.

Methods of cultivation

The present invention relates to methods of producing protein of interest in a modified cellBacilluscapable of sverkhekspressiyaymaHby culturing the modified cell with the ability to produce a protein of interest, and growing the cells in the growth conditions suitable for expression of the protein of interest. In some embodiments of the invention the cells of the host and the modified cells are the owners of according to the invention are cultured in standard growth media. Suitable specific culturing conditions, such as temperature, pH and the like, known to specialists in this field. Additional preferred culturing conditions well known in the art and described in various publications.

In some embodiments the invention, the protein of interest produced modified the host-cell, is present in the intracellular environment of the host cell, while in other embodiments of the invention of interest protein produced by the host-cell, secreted in the extracellular space (i.e. in the culture medium). Thus, in some embodiments, the implementation of whom subramania protein of interest can be selected from the intracellular environment, in which it is expressed, by lysis of the host cell and selection of interest of the protein by methods known in the art. In other embodiments the invention, the modified cells are the owners of cultivated under conditions suitable for the expression and excretion of interest of the protein from cell culture. Of interest protein produced modified the host-cell, sverkhekspressiyaymaHaccording to the invention, is secreted into the culture medium. In some embodiments of the invention, the protein of interest (e.g., protease)produced by cells isolated from the culture medium by standard methods, including, but not limited to, the selection of host cells from the medium by centrifugation or filtration, deposition of proteinaceous components of the supernatant or filtrate by using salts (e.g. ammonium sulfate), the chromatographic purification (for example, purification using ion-exchange chromatography, gel filtration, affinity chromatography and the like). Thus, in the present invention for selecting proteases (proteases) according to the invention can be applied to any method. Indeed, it is envisaged that the present invention is not limited to any particular method of treatment.

In some embodiments, the implementation of the ia of the invention are used, and other recombinant constructions, allows you to attach a heterologous or homologous polynucleotide sequences encoding proteins of interest, to the nucleotide sequence that encodes a polypeptide domain that facilitate purification of soluble proteins (Kroll D.J. et al., DNA Cell Biol 12:441-53 [1993]). Such easy-to-clean domains include, but are not limited to, peptides, forming chelate complexes with metals such as modules "histidine-tryptophan"that allow purification on immobilized metals (Porath, Protein Expr Purif 3:263-281 [1992]), protein a domains that allow purification on immobilized immunoglobulin, and the domain used in the system extension/affinity purification FLAGS (Immunex Corp, Seattle WA). To facilitate purification, among domain for cleaning and heterologous protein can also be included tsepliaeva linker sequence such as factor XA or enterokinase (Invitrogen, San Diego, CA).

In some embodiments the invention, the transformed cell host according to the invention is cultivated in a suitable nutrient medium under conditions conducive to the expression of the protein of interest (e.g., protease), followed by separation of the resulting protease from the culture. The medium used for culturing cells includes any standard environment, suitable for the Multivitamine host cells, such as minimal or complex media containing appropriate supplements. Suitable media are supplied by commercial firms-suppliers or they can be obtained in accordance with published protocols (for example, as described in catalogues of the American type culture collection). In some embodiments of the invention cells are the owners of cultivated under the conditions of fermentation in periodical culture, periodical culture injection or continuous culture. Classical methods of fermentation in periodical culture is carried out in a closed system, where the culture medium is prepared prior to fermentation, and then Wednesday inoculant desirable(and) the microorganism(s), and such fermentation does not require adding to the environment of any component. In some cases, when carrying out the fermentation in the periodical culture, in the culture medium change pH and oxygen content, and the content of carbon source remains unchanged. The content of metabolites and cell biomass in the fermentation system in periodical culture continually change until the cessation of fermentation. In the system of fermentation in periodical culture cell growth usually passes through a static lag-phase to phase substantial logarithmic growth and finally to STATSIONAR the phase, in which the growth rate is reduced or if the growth stops. Untreated cells in the stationary phase will eventually die. Generally speaking, the greatest amount of protein produced by cells in the logarithmic phase.

A variation of the standard periodic fermentation system is periodic fermentation feed. In this system, nutrients (e.g., carbon source, nitrogen source, O2and usually, the other nutrients are added only when their concentration in the culture falls below the threshold level. Periodic fermentation with water are suitable in the case where the suppression of catabolites may inhibit the metabolism of cells and when it is desirable to limit the amount of nutrients in the environment. Determining the actual concentration of nutrients in the periodic fermentation recharge carried out on the basis of changes defined by factors such as pH, dissolved oxygen and the partial pressure of waste gases such as CO2. Fermentation in periodical culture and fermentation in the periodical culture of the injection are standard methods, well known to experts.

Continuous fermentation is an open system in which the op is delannoy culture medium is continuously added to the bioreactor, and the same number of air-conditioned environment at the same time removed for processing. In continuous fermentation culture constant at high density, where the cells are located mainly in the logarithmic growth phase.

Continuous fermentation allows to modulate one factor or any number of factors affecting the growth of cells and/or the concentration of the final product. For example, in some embodiments of the invention the limiting nutrients, such as carbon source or nitrogen source, is maintained at a constant level, and all other parameters can be changed. In other systems a number of factors that affect cell growth, is constantly changing, and the cell concentration determined by the turbidity of the medium remains constant. In continuous systems, the cells should be maintained in the stationary growth phase. Thus, the cell loss occurring in the outflow of the environment, can be compensated for by the growth rate of the cells during fermentation. Methods of modulating nutrients and growth factors for continuous fermentation, as well as methods of maximizing the rate of formation of product is known to specialists in this field and can be used for the production of protein of interest (e.g., proteases) of the methods according to the invention.

Ka is indicated above, overexpression ofymaHin the cell-master leads to increase production of protein of interest compared with the level of production of the same protein in an appropriate cell host wild-type or modified parent cell host. In some embodiments of the invention overexpression ofymaHin the cell-hostBacillusleads to increase production of protein of interest, which exceeds the level of production achieved in the corresponding cell, which is not sverkhekspressiyaymaH. In some embodiments implementing the present invention relates to cells-masters of the wild type or recombinant (modified) cells-hostsBacillusthat sverkhekspressiyaymaH. In some embodiments of the invention indicated recombinant cell hostBacilluswas modified in order to message her ability to produce higher levels of protease than the unmodified parental cell/cell-predshestvennicaBacillusunder cultivation in the same growth conditions.

The present invention also includes methods of producing protein of interest in a modified cell, which sverkhekspressiyaymaHduring a smaller period of time than in the cell-previous the Nike. So, for example, the modified cells are the owners of according to the invention have the ability to produce a protein of interest at a higher level and within a smaller period of time than the corresponding unmodified cell-predecessor. Thus, in certain embodiments, the present invention relates to methods of producing protein of interest (e.g., protease) at a higher level than the parent a host cell, and for the period 1/6 of the period of time for which the cell-the predecessor to Express this protein at the maximum level. In other embodiments of the invention, the modified host produces the protein of interest over a period of time of about 1/5, about 1/4, about 1/3 to about 1/2 of the time for which the cell-the predecessor to Express this protein at the maximum level.

Measurement of the level of production/activity

In certain embodiments, the present invention relates to methods for increasing the level of expression of interest squirrel cage-hostBacillusby obtaining modified hostBacillusthat sverkhekspressiyaymaH, culturing the modified hostBacillusin suitable conditions, Rostam the production of the host-cell protein of interest at a higher level compared to the cell-precursor. In some embodiments of the invention the modified cellBacillusget out of the cageBacilluswild-type. In other embodiments of the invention the modified cellBacillusreceive from a modified host cell. The level of production of protein of interest the host-cell can be determined as a function of the activity of the produced protein. In some embodiments of the invention in a method of increasing expression of a protein of interest using a modified cell-hostBacillus, which was transformed polynucleotide construct that encodes a YmaH and functionally associated with the sigA promoter and/or sigH. In some embodiments of the invention, polynucleotide constructs that contain a sequence selected from SEQ ID NO: 1, 2, 3, and 13. In some embodiments of the invention the polynucleotide construct is present on the plasmid that replicates in the cells ofBacillusand in other embodiments of the invention the polynucleotide construct integrated into the genome of the modified cellsBacillus. As discussed above, the modified cellBacillusable to produce a protein of interest, including, but not limited to, a protein, selected from the amylolytic enzymes, proteolytic enzymes, cellulities enzymes, oxidoreductase farms is now and enzymes destroying walls of plants. In other embodiments of the invention such enzymes include, but are not limited to, amylase, protease, xylanase, lipase, laccase, peroxidase, oxidase, cutinase, cellulase, hemicellulase, esterase, peroxidase, catalase, glucose-oxidase enzyme, phytase, pectinase, glucosidase, isomerases, transferases, kanazi phosphatase, galactosidase and chitinases. In other embodiments of the invention of interest protein is a hormone, cytokine, growth factor, receptor, vaccine, antibody or the like While it is envisaged that the present invention is not limited to any particular protein, and in some especially preferred embodiments of the invention of interest protein is a protease.

There are a variety of assays known to the average expert in this field and used for detecting and measuring the activity of interest are proteins produced by cells of the host according to the invention. In particular, these assays are suitable for measurement by activity, which is carried out based on the level of release of acid-soluble peptides from casein or hemoglobin, and such activity is determined by measuring the optical density at 405 nm or colorimetric method Polina (see, for example, Bergmeyer et al., "Methods of Enzymatic Analysis vol. 5,Peptidases, Proteinases and their Inhibitors, Verlag Chemie, Weinheim [1984]). Can be done some other tests, including solubilization chromogenic substrates (see, for example, Ward, "Proteinases," in Fogarty (ed.).,Microbial Enzymes and Biotechnology, Applied Science, London, [1983], pp 251-317). Other representative assays include, but are not limited to, the analysis, conducted using succinyl-Ala-Ala-Pro-Phe-para-nitroanilide (SAAPFpNA) and sulfonate sodium salt of 2,4,6-trinitrobenzene (TNBS analysis). Suitable methods can be found in various other publications, known in the art (see, for example, Wells et al., Nucleic Acids Res. 11:7911-7925 [1983]; Christianson et al., Anal. Biochem., 223:119-129 [1994]; and Hsia et al., Anal Biochem., 242:221-227 [1999]). However, one should not assume that the present invention be limited to any specific analytical methods.

Other means of determining levels of production of protein of interest in cells of the host and detection of expressed proteins are conducting immunoassays using polyclonal or monoclonal antibodies specific to the indicated protein. Examples of such tests are the enzyme-linked immunosorbent assay (ELISA), radioimmunoassay (RIA), fluorescent immunoassay (FIA), and cell sorting with activation of fluorescence (FACS). However, there are other methods that can be used to assess the performance, allaudio protein of interest (see, for example, Hampton et al.,Serological Methods, A Laboratory Manual. APS Press, St. Paul, MN [1990]; and Maddox et al., J. Exp. Med., 158:1211 [1983]). In some preferred versions of the invention, the level of production of protein of interest in cells of the host according to the invention exceeds the level of production of the protein in an appropriate host wild-type or modified master. As we all know cellBacillusproduced in accordance with the present invention, supported and cultivated under conditions suitable for the expression and excretion of interest polypeptide from the cell culture. It should be noted that the present invention is not limited to any specific analytical methods.

The level of production of protease modified cell host according to the invention in comparison with the level of production of the same protease cell-masters of the wild-type or modified parent cells masters can be defined as the ratio of the activities. The ratio of activities can be expressed as the ratio of the enzymatic activity of interest protein produced by the cell host, which sverkhekspressiyaymaHto the enzymatic activity of the protein of interest produced is relevant to the respective cell master, which is not sverkhekspressiyaymaH. Ratio equal to or greater than 1, means that the protein of interest produced by the cell host, which sverkhekspressiyaymaH, is produced at a level equal to or greater than the level at which is produced the same protein of interest in the appropriate cell host, which is not sverkhekspressiyaymaH. For example, the ratio of activities of 1.5 means that the level of interest of the protein produced by the cell host, which sverkhekspressiyaymaH1.5 times the level of production of the same protein of interest in the appropriate cell host, which is not sverkhekspressiyaymaHunder cultivation in the same conditions (i.e. cell-hosts expressing theymaHproduce protein of interest is 50% larger than the corresponding a host cell that does not sverkhekspressiyaymaH). In some embodiments of the invention the ratio of activities is at least 1, at least about 1.05 is at least about 1.1, at least about 1.2, at least about 1.3, at least about 1.4, at least about 1.5, at least about 1.6, at least 1.7, at least about 1.8, at least about 9, or at least about 2. In other embodiments of the invention, the ratio of activities is at least approximately 2.1, at least about 2.2, at least about 2.3, at least about 2.4, at least about 2.5, at least about 2.6, at least about 2.7, at least about 2.8, at least about 2.9, or at least about 3. In other embodiments of the invention the ratio of the activity is at least about 3.5, at least about 4.0, or at least about 5. In some embodiments of the invention, the desired ratio is 1 or higher.

Alternatively, the level of production of protease in the modified cell host according to the invention can be expressed as the percentage increase of the level of production compared with the level of production in the parent cell host. In the methods according to the invention, a modified cellBacillusproduces the polypeptide at a level that is preferably at least about 25%, more preferably at least about 50%, more preferably at least about 75%, more preferably at least about 100%, more preferably at least about 200%, most preferably at least about 300%, and especially site is preferably at least about 400% greater than the level of production of the polypeptide in the host wild-type or modified master-parent. Thus, in some embodiments of the invention, the level of production of protein of interest in a cell host, which sverkhekspressiyaymaHincreases at least about 0.5%, about 1.0%, about 1.5%, about 2.0%, about 2.5%, about 3.0%, about 4.0%, about 5.0%, about 8.0%, about 10%, about 15%, about 20%, about 25%, about 30%, about 40%, about 50%, at least about 60%, at least about 70%at least about 80%, at least about 90%, at least about 100% or more compared with the level of production of the same protein of interest in a cell host, which is not sverkhekspressiyaymaH. In other embodiments of the invention, the level of production of protein of interest in a cell host, which sverkhekspressiyaymaHincreases at least about 110%, about 120%, about 130%, about 140%, about 150%, about 160%to about 170%, about 180%, about 190%, at least about 200% or more compared with the level of production of the same protein of interest in a cell host, which is not sverkhekspressiyaymaH.

To further illustrate the present invention and its advantages below lead the I specific examples, which allow to better understand the present invention and should not be construed as limiting its scope.

Experimental part

To illustrate some of the preferred options and aspects of the present invention the following examples, which should not be construed as limiting the scope of the invention.

In the description of the experimental part, which is provided below, the following abbreviations are used: ppm (millionths); M (both molarity); mm (mmol); μm (micromol); nm (nanomole); mol (moles); mmol (mmol); μmol (micromol); nmol (nanomole); g (grams); mg (milligrams); μg (micrograms); PG (picograms); l (liters); ml (milliliters); μl (Microlitre); cm (centimeters); mm (millimeters); μm (micrometers); nm (nanometers); units (units); V (volts); MW (molecular weight); sec (seconds); min (minute/minutes); HR (hour/hours); °C (degrees Celsius); Dostal (sufficient); ND (did not); NA (not applicable); rpm (revolutions per minute); H2O (water); dH2O (deionized water); HCl (hydrochloric acid); A.K. (amino acid); BP (base pairs); TPN (thousand base pairs); KD (kilodaltons); cDNA (copy or complementary DNA); DNA (deoxyribonucleic acid); idnk (single stranded DNA); dzanc (double-stranded DNA); dNTP (deoxyribonucleotide-triphosphate); RNA (ribonucleic acid is one); MgCl2(magnesium chloride); NaCl (sodium chloride); Cm (chloramphenicol); mass./about. (weight to volume);./about. (volume/volume); g (gravity); OD (optical density); buffered phosphate solution, Dulbecco (DPBS); OD280(optical density at 280 nm); OD600(optical density at 600 nm); A405(optical density at 405 nm); PAGE (polyacrylamide gel electrophoresis); PBS (phosphate buffered saline [150 mm NaCl, 10 mm phosphate-sodium chloride buffer, pH 7,2]); PBST (PBS + 0.25% tween®-20); PEG (polyethylene glycol); PCR (polymerase chain reaction); LTOs (sodium dodecyl sulphate); Tris (Tris(hydroxymethyl)aminomethane); HEPES (N-[2-hydroxyethyl]piperazine-N-[2-econsultancy acid]); HBS (HEPES-buffered saline); LTOs (sodium dodecyl sulphate); bME, BME and βME (beta mercaptoethanol or 2-mercaptoethanol); Tris-HCl (hydrochloride Tris[hydroxymethyl]aminomethane); Trizin (N-[Tris(hydroxymethyl)methyl]glycine); DMSO (dimethylsulfoxide); Taq (DNA polymerase Thermus aquaticus); fragment maple (large fragment of DNA polymerase I (maple)); rpm (revolutions per minute); EGTA (ethylene glycol-bis(β-aminoacylase ether)-N,N,N', N'-tetraoxane acid); EDTA (ethylenediaminetetraacetic acid); bla (gene β-lactamase or a gene of resistance to ampicillin); DNA2.0 (DNA2,0, Menlo Park, CA); OXOID (Oxoid, Basingstoke, Hampshire, UK); Corning (Corning Life Sciences, Corning, NY); ATCC (American type culture collection, Rockville, MD); equetech (Sequetech Corporation, Mountainview, CA); Gibco/BRL (Gibco/BRL, Grand Island, NY); Sigma (Sigma Chemical Co., St. Louis, MO); Pharmacia (Pharmacia Biotech, Pisacataway, NJ); NCBI (national center for biotechnology information); Applied Biosystems (Applied Biosystems, Foster City, CA); Clontech (CLONTECH Laboratories, Palo Alto, CA); Operon Technologies (Operon Technologies, Inc., Alameda, CA); Bachem (Bachem Bioscience, Inc., King of Prussia, PA); Difco (Difco Laboratories, Detroit, Ml); GIBCO BRL or Gibco BRL (Life Technologies, Inc., Gaithersburg, MD); Millipore (Millipore, Billerica, MA); Bio-Rad (Bio-Rad, Hercules, CA); Invitrogen (Invitrogen Corp., San Diego, CA); NEB (New England Biolabs, Beverly, MA); Sigma (Sigma Chemical Co., St. Louis, MO); Pierce (Pierce Biotechnology, Rockford, IL); Takara (Takara Bio Inc. Otsu, Japan); Roche (Hoffmann-La Roche, Basel, Switzerland); EM Science (EM Science, Gibbstown, NJ); Qiagen (Qiagen, Inc., Valencia, CA); Molecular Devices (Molecular Devices Corp., Sunnyvale, CA); R&D Systems (R&D Systems, Minneapolis, MN); Stratagene (Stratagene Cloning Systems, La JoIIa, CA); and Microsoft (Microsoft, Inc., Redmond, WA).

Example 1

Obtaining a polynucleotide constructs SigA and SigH

Were obtained polynucleotide constructs SigH, SigA1 and SigA2 that sverkhekspressiyaymaHin the cells of hostsB. subtilis.

Were designed PCR primers that are homologous to the genome ofBacillus subtilis(figure 1A) and contain a restriction site from 6 pairs of nucleotides, located at a distance of 6 nucleotides from the 5'end of the primer. These primers were designed to create a unique restriction sites located above and below from the ends of this design. The main source of genomic sequence (Kunst et al., Nature 390:249-256 [1997]), the site localize the AI gene and information about the start - and stop-codons were obtained from the NCBI database: complete genome Bacillus subtilissubsp.subtilisstrain 168, or the server SubtiList World Wide Web Server, known to specialists (Moser, I. 1998. FEBS Lett. 430(1-2):28-36). Database NCBI ACC No NC000964, consider the sequence given as SEQ ID NO: 13 with coordinates 1865428-18670191.

Was obtained SigH-construct (SEQ ID NO:1), containing a polynucleotide sequence comprising the promoter Sigma H and related sequence encoding a YmaH protein. The promoter Sigma H is usually located in the polynucleotide sequence containing the miaA gene, localized near the 3'-end and directly above geneymaH. The entire sequence of the promoter Sigma H and the adjacent coding sequence ofymaHamplified by PCR using the direct primer P1: GGCACCGAATTCGACGTGGTTTCGCAACAAAATGCAG (SEQ ID NO:5; the provisions 987-1011 SEQ ID NO:13), with restrictionEcoRI-site attached to the 5'-end, and the reverse primer P2: GGCACCGGATCCCTCATAAAAAAAGACCGTGCCTTGG (SEQ ID NO:6, positions 1472-1496 SEQ ID NO:13), with restrictionBamHI site (figure 1B).

SigA1 and SigA2-design was received in three stages by means of: 1) amplification of specific fragments of the chromosomal DNAB. subtilis, 2) cleaning and building fragments and 3) amplification of the assembled product by PCR.

SigA1-construct (SEQ ID NO:2) was obtained using two sets of primers (figure 1C). The first set of primers: forward primer P3: GCGCCGAATTCTCATACCCTGAAAGGAAAGACAAGG (SEQ ID NO: 7), lokalizovany the 5'-end of SEQ ID NO: 13; and reverse primer P4: TTCGAGTTTTCCTGCTATATGTGTGGGGCTGCTTCGTATTATTCAATATG (SEQ ID NO:8), localized at positions 153 to 177 BP in SEQ ID NO 13, was used for the first amplification of the fragment containing the SigA promoter, the binding site with the ribosome, the start codon and the first few codons of the gene miaA. The second set of primers: forward primer P5: CATATTGAATAATACGAAGCAGCCCCACACATATAGCAGGAAAACTCGAA (SEQ ID NO:9), localized in the provisions from 1071 to 1095 BP for SEQ ID NO: 13; and the reverse primer P2 (SEQ ID NO:6) was used for amplification of the second fragment containing the DNA sequence encoding a YmaH protein. Reverse primer P4 and direct primer P5 represent hybrid primers, which were designed to contain the "tails", complementary to each other, but not homologous sequence, which was amplified in order to eliminate the built-in coding sequence miaA. Then the two fragments were annealed, resulting in a SigA1-design contained a SigA promoter, ribosome binding site and the initiation of transcription of themiaA. SigA1-amplified design with live primers P3 (SEQ ID NO:7) and reverse primer P2 (SEQ ID NO:6), which contained the restriction siteEcoRI and restriction siteBamHl, respectively, and then ligated with polylinkers can replicate plasmids pBS19. Polynucleotide follower of the awn pBS19 presented below (SEQ ID NO:12). Plasmid pBS19 can be replicated inE. coliandB. subtilisand contains a marker gene for selection for resistance to chloramphenicol.

GAATTCGAGCTCGGTACCCGGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTTGG

CGATCCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACACATGCAGCTCCCG

GAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGC

GTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCATGACCCAGTCACGTAGCGATAGC

GGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCAGATTGTACTGAGAGTGCACCATAT

GCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGC

TTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCA

CTCAAAGGCGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAGAACATGTG

AGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCA

TAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAA

CCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCC TGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGC

GCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTG

GGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGT

CTTGAGTCCAACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACTGGTAACAGG

ATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTAC

GGCTACACTAGAAGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAA

AAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGT

TTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCT

ACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTTGGTCATGAGATTAT

CAAAAAGGATCTGGAGCTGTAATATAAAAACCTTCTTCAACTAACGGGGCAGGTTAGTGAC

ATTAGAAAACCGACTGTAAAAAGTACAGTCGGCATTATCTCATATTATAAAAGCCAGTCATT

AGGCCTATCTGACAATTCCTGAATAGAGTTCATAAACAATCCTGCATGATAACCATCACAAA

CAGAATGATGTACCTGTAAAGATAGCGGTAAATATATTGAATTACCTTTATTAATGAATTTTC

CTGCTGTAATAATGGGTAGAAGGTAATTACTATTATTATTGATATTTAAGTTAAACCCAGTAA

ATGAAGTCCATGGAATAATAGAAAGAGAAAAAGCATTTTCAGGTATAGGTGTTTTGGGAAA

CAATTTCCCCGAACCATTATATTTCTCTACATCAGAAAGGTATAAATCATAAAACTCTTTGAA

GTCATTCTTTACAGGAGTCCAAATACCAGAGAATGTTTTAGATACACCATCAAAAATTGTAT

AAAGTGGCTCTAACTTATCCCAATAACCTAACTCTCCGTCGCTATTGTAACCAGTTCTAAAA

GCTGTATTTGAGTTTATCACCCTTGTCACTAAGAAAATAAATGCAGGGTAAAATTTATATCC

TTCTTGTTTTATGTTTCGGTATAAAACACTAATATCAATTTCTGTGGTTATACTAAAAGTCGT

p> TTGTTGGTTCAAATAATGATTAAATATCTCTTTTCTCTTCCAATTGTCTAAATCAATTTTATTA

AAGTTCATTTGATATGCCTCCTAAATTTTTATCTAAAGTGAATTTAGGAGGCTTACTTGTCTG

CTTTCTTCATTAGAATCAATCCTTTTTTAAAAGTCAATATTACTGTAACATAAATATATATTTT

AAAAATATCCCACTTTATCCAATTTTCGTTTGTTGAACTAATGGGTGCTTTAGTTGAAGAATA

AAAGACCACATTAAAAAATGTGGTCTTTTGTGTTTTTTTAAAGGATTTGAGCGTAGCGAAAA

ATCCTTTTCTTTCTTATCTTGATAATAAGGGTAACTATTGCCGGTTGTCCATTCATGGCTGA

ACTCTGCTTCCTCTGTTGACATGACACACATCATCTCAATATCCGAATAGGGCCCATCAGT

CTGACGACCAAGAGAGCCATAAACACCAATAGCCTTAACATCATCCCCATATTTATCCAATA

TTCGTTCCTTAATTTCATGAACAATCTTCATTCTTTCTTCTCTAGTCATTATTATTGGTCCATT

CACTATTCTCATTCCCTTTTCAGATAATTTTAGATTTGCTTTTCTAAATAAGAATATTTGGAG

AGCACCGTTCTTATTCAGCTATTAATAACTCGTCTTCCTAAGCATCCTTCAATCCTTTTAATA

ACAATTATAGCATCTAATCTTCAACAAACTGGCCCGTTTGTTGAACTACTCTTTAATAAAATA

ATTTTTCCGTTCCCAATTCCACATTGCAATAATAGAAAATCCATCTTCATCGGCTTTTTCGTC

ATCATCTGTATGAATCAAATCGCCTTCTTCTGTGTCATCAAGGTTTAATTTTTTATGTATTTC

TTTTAACAAACCACCATAGGAGATTAACCTTTTACGGTGTAAACCTTCCTCCAAATCAGACA

AACGTTTCAAATTCTTTTCTTCATCATCGGTCATAAAATCCGTATCCTTTACAGGATATTTTG

CAGTTTCGTCAATTGCCGATTGTATATCCGATTTATATTTATTTTTCGGTCGAATCATTTGAA CTTTTACATTTGGATCATAGTCTAATTTCATTGCCTTTTTCCAAAATTGAATCCATTGTTTTTG

ATTCACGTAGTTTTCTGTATTCTTAAAATAAGTTGGTTCCACACATACCAATACATGCATGT

GCTGATTATAAGAATTATCTTTATTATTTATTGTCACTTCCGTTGCACGCATAAAACCAACAA

GATTTTTATTAATTTTTTTATATTGCATCATTCGGCGAAATCCTTGAGCCATATCTGACAAAC

TCTTATTTAATTCTTCGCCATCATAAACATTTTTAACTGTTAATGTGAGAAACAACCAACGAA

CTGTTGGCTTTTGTTTAATAACTTCAGCAACAACCTTTTGTGACTGAATGCCATGTTTCATT

GCTCTCCTCCAGTTGCACATTGGACAAAGCCTGGATTTACAAAACCACACTCGATACAACT

TTCTTTCGCCTGTTTCACGATTTTGTTTATACTCTAATATTTCAGCACAATCTTTTACTCTTTC

AGCCTTTTTAAATTCAAGAATATGCAGAAGTTCAAAGTAATCAACATTAGCGATTTTCTTTTC

TCTCCATGGTCTCACTTTTCCACTTTTTGTCTTGTCCACTAAAACCCTTGATTTTTCATCTGA

ATAAATGCTACTATTAGGACACATAATATTAAAAGAAACCCCCATCTATTTAGTTATTTGTTT

AGTCACTTATAACTTTAACAGATGGGGTTTTTCTGTGCAACCAATTTTAAGGGTTTTCAATA

CTTTAAAACACATACATACCAACACTTCAACGCACCTTTCAGCAACTAAAATAAAAATGACG

TTATTTCTATATGTATCAAGATAAGAAAGAACAAGTTCAAAACCATCAAAAAAAGACACCTTT

TCAGGTGCTTTTTTTATTTTATAAACTCATTCCCTGATCTCGACTTCGTTCTTTTTTTACCTCT

CGGTTATGAGTTAGTTCAAATTCGTTCTTTTTAGGTTCTAAATCGTGTTTTTCTTGGAATTGT

GCTGTTTTATCCTTTACCTTGTCTACAAACCCCTTAAAACGTTTTTAAAGGCTTTTAAGCC

GTCTGTACGTTCCTTAAG (SEQ ID NO: 12)

SigA2-construct (SEQ ID NO:3) was obtained by the method described for obtaining SigA1-design, using the following primers (figure 1D). The first fragment containing the SigA promoter, amplified using the direct primers P3 (SEQ ID NO:7) and reverse hybrid primer P7: CATACAGTTTCGATTAAAGTTCGAGCACTCTCTTTTATAAATCTCCCCCA (SEQ ID NO:11), localized in the provisions from 125 to 149 BP for SEQ ID NO:13. The second fragment containing the DNA sequence encoding a YmaH protein, amplified using the direct hybrid primer P6: TGGGGGAGATTTATAAAAGAGAGTGCTCGAACTTTAATCGAAACTGTATG (SEQ ID NO: 10), localized in the provisions from 1090 to 1114 BP for SEQ ID NO:13 and a reverse primer P2 (SEQ ID NO:6). Then the two fragments were annealed, resulting in a SigA2-design contained a SigA promoter, ribosome binding site and the initiation of transcription of theymaH.

The present invention also includes a fourth SigA-design (SigA3; SEQ ID NO: 13; figure 1E), which was obtained by amplification ofmiaA ymaHin the field of chromosomal DNABacillusthat includes the SigA promoter, a region encoding a protein MiaA, the promoter SigH-YmaH and a region encoding a YmaH protein.

SigA3 design was obtained using the direct primer GCGCGCGAATTCAGGGAAATTGTCGGCAATGAGCCGCTCGGC (SEQ ID NO: 18) and reverse primer GCGCGCCATGGCTGATTCGTCTCAGTTCTGCTTCACTTTCA (SEQ ID NO: 19). SEQ ID NO:13 has a restriction site EcoRI at the 5'-end is a fragment, and SEQ ID NO:19 has an NcoI site at the other end. This allows you to clone the fragment into the vector pBN3 presented below as SEQ ID NO:20.

GACGTCTAAGAAACCATTATTATCATGACATTAACCTATAAAAATAGGCGTATCACGAGGCC

CTTTCGTCTTCAAGAATTAATTCTCATGTTTGACAGCTTATCATCGATAAGCTTGCATGCCT

GCAGGTCGACTCTAGAGGATCCCCGGGTACCGAGCTCGAATTCCTTAAGGAACGTACAGA

CGGCTTAAAAGCCTTTAAAAACGTTTTTAAGGGGTTTGTAGACAAGGTAAAGGATAAAACA

GCACAATTCCAAGAAAAACACGATTTAGAACCTAAAAAGAACGAATTTGAACTAACTCATAA

CCGAGAGGTAAAAAAAGAACGAAGTCGAGATCAGGGAATGAGTTTATAAAATAAAAAAAGC

ACCTGAAAAGGTGTCTTTTTTTGATGGTTTTGAACTTGTTCTTTCTTATCTTGATACATATAG

AAATAACGTCATTTTTATTTTAGTTGCTGAAAGGTGCGTTGAAGTGTTGGTATGTATGTGTT

TTAAAGTATTGAAAACCCTTAAAATTGGTTGCACAGAAAAACCCCATCTGTTAAAGTTATAA

GTGACTAAACAAATAACTAAATAGATGGGGGTTTCTTTTAATATTATGTGTCCTAATAGTAG

CATTTATTCAGATGAAAAATCAAGGGTTTTAGTGGACAAGACAAAAAGTGGAAAAGTGAGA

CCATGGAGAGAAAAGAAAATCGCTAATGTTGATTACTTTGAACTTCTGCATATTCTTGAATT

TAAAAAGGCTGAAAGAGTAAAAGATTGTGCTGAAATATTAGAGTATAAACAAAATCGTGAAA

CAGGCGAAAGAAAGTTGTATCGAGTGTGGTTTTGTAAATCCAGGCTTTGTCCAATGTGCAA

CTGGAGGAGAGCAATGAAACATGGCATTCAGTCACAAAAGGTTGTTGCTGAAGTTATTAAA

CAAAAGCCAACAGTTCGTTGGTTGTTTCTCACATTAACAGTTAAAAATGTTTATGATGGCGA

AGAATTAAATAAGAGTTTGTCAGATATGGCTCAAGGATTTCGCCGAATGATGCAATATAAAA

AAATTAATAAAAATCTTGTTGGTTTTATGCGTGCAACGGAAGTGACAATAAATAATAAAGAT

AATTCTTATAATCAGCACATGCATGTATTGGTATGTGTGGAACCAACTTATTTTAAGAATAC

AGAAAACTACGTGAATCAAAAACAATGGATTCAATTTTGGAAAAAGGCAATGAAATTAGACT

ATGATCCAAATGTAAAAGTTCAAATGATTCGACCGAAAAATAAATATAAATCGGATATACAA

TCGGCAATTGACGAAACTGCAAAATATCCTGTAAAGGATACGGATTTTATGACCGATGATG

AAGAAAAGAATTTGAAACGTTTGTCTGATTTGGAGGAAGGTTTACACCGTAAAAGGTTAATC

TCCTATGGTGGTTTGTTAAAAGAAATACATAAAAAATTAAACCTTGATGACACAGAAGAAGG

CGATTTGATTCATACAGATGATGACGAAAAAGCCGATGAAGATGGATTTTCTATTATTGCAA

TGTGGAATTGGGAACGGAAAAATTATTTTATTAAAGAGTAGTTCAACAAACGGGCCAGTTT

GTTGAAGATTAGATGCTATAATTGTTATTAAAAGGATTGAAGGATGCTTAGGAAGACGAGTT

ATTAATAGCTGAATAAGAACGGTGCTCTCCAAATATTCTTATTTAGAAAAGCAAATCTAAAAT

TATCTGAAAAGGGAATGAGAATAGTGAATGGACCAATAATAATGACTAGAGAAGAAAGAAT

GAAGATTGTTCATGAAATTAAGGAACGAATATTGGATAAATATGGGGATGATGTTAAGGCT

ATTGGTGTTTATGGCTCTCTTGGTCGTCAGACTGATGGGCCCTATTCGGATATGAGATGA

TGTGTGTCATGTCAACAGAGGAAGCAGAGTTCAGCCATGAATGGACAACCGGTGAGTGGA

AGGTGGAAGTGAATTTTGATAGCGAAGAGATTCTACTAGATTATGCATCTCAGGTGGAATC AGATTGGCCGCTTACACATGGTCAATTTTTCTCTATTTTGCCGATTTATGATTCAGGTGGAT

ACTTAGAGAAAGTGTATCAAACTGCTAAATCGGTAGAAGCCCAAACGTTCCACGATGCGAT

TTGTGCCCTTATCGTAGAAGAGCTGTTTGAATATGCAGGCAAATGGCGTAATATTCGTGTG

CAAGGACCGACAACATTTCTACCATCCTTGACTGTACAGGTAGCAATGGCAGGTGCCATGT

TGATTGGTCTGCATCATCGCATCTGTTATACGACGAGCGCTTCGGTCTTAACTGAAGCAGT

TAAGCAATCAGATCTTCCTTCAGGTTATGACCATCTGTGCCAGTTCGTAATGTCTGGTCAA

CTTTCCGACTCTGAGAAACTTCTGGAATCGCTAGAGAATTTCTGGAATGGGATTCAGGAGT

GGACAGAACGACACGGATATATAGTGGATGTGTCAAAACGCATACCATTTTGAACGATGAC

CTCTAATAATTGTTAATCATGTTGGTTACCTGCCTCGCGCGTTTCGGTGATGACGGTGAAA

ACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTAAGCGGATGCCGGG

AGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCGCAGCCA

TGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCGGCATCAGAGCA

GATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAA

ATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGCTCGGTCGTTCG

GCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCCACAGAATCAGG

GGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAA

GGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCG

ACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCC

TGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGATACCTGTCCGC

CTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGGTATCTCAGTTCG

GTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTTCAGCCCGACCG

CTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACACGACTTATCGCCA

CTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGCGGTGCTACAGA

GTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTTGGTATCTGCGCT

CTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCCGGCAAACAAACCA

CCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGAT

CTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACG

TTAAGGGATTTTGGTCATGAGATTATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAA

ATGAAGTTTTAAATCAATCTAAAGTATATATGAGTAAACTTGGTCTGACAGTTACCAATGCTT

AATCAGTGAGGCACCTATCTCAGCGATCTGTCTATTTCGTTCATCCATAGTTGCCTGACTC

CCCGTCGTGTAGATAACTACGATACGGGAGGGCTTACCATCTGGCCCCAGTGCTGCAATG

ATACCGCGAGACCCACGCTCACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGA

AGGGCCGAGCGCAGAAGTGGTCCTGCAACTTTATCCGCCCCATCCAGTCTATTAATTGTT

GCCGGGAAGCTAGAGTAAGTAGTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTG

CTACAGGCATCGTGGTGTCACGCTCGTCGTTTGGTATGGCTTCATTCAGCTCCGGTTCCC

AACGATCAAGGCGAGTTACATGATCCCCCATGTTGTGCAAAAAAGCGGTTAGCTCCTTCG

GTCCTCCGATCGTTGTCAGAAGTAAGTTGGCCGCAGTGTTATCACTCATGGTTATGGCAGC ACTGCATAATTCTCTTACTGTCATGCCATCCGTAAGATGCTTTTCTGTGACTGGTGAGTACT

CAACCAAGTCATTCTGAGAATAGTGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAA

TACGGGATAATACCGCGCCACATAGCAGAACTTTAAAAGTGCTCATCATTGGAAAACGTTC

TTCGGGGCGAAAACTCTCAAGGATCTTACCGCTGTTGAGATCCAGTTCGATGTAACCCACT

CGTGCACCCAACTGATCTTCAGCATCTTTTACTTTCACCAGCGTTTCTGGGTGAGCAAAAA

CAGGAAGGCAAAATGCCGCAAAAAAGGGAATAAGGGCGACACGGAAATGTTGAATACTCA

TACTCTTCCTTTTTCAATATTATTGAAGCATTTATCAGGGTTATTGTCTCATGAGCGGATACA

TATTTGAATGTATTTAGAAAAATAAACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGTG

CCACCT (SEQ ID NO:20)

All PCR reactions were performed in a volume of 50 µl, containing 1-2 μl of DNA, or in a mixture to resuspendable colonies, 5 ál 10X buffer Pfu Ultra (Stratagene), 1 μl 10 mm dNTP-mix (Roche)and 0.5 μl 0.2 μm primers, 1 μl polymerase Pfu Ultra High Fidelity and then added water to a total volume of 50 µl. PCR was performed under the following conditions: 95°C, 2 minutes, 30 cycles: 95°C, 30 seconds, 62°C. 30 seconds, 72°C 1 min, and then 1 cycle: 72°C, 10 minutes.

The obtained PCR fragments were subjected to gel purification using the set for gel purification Qiagen according to manufacturer's instructions.

Hybrid construction was obtained by annealing of 0.25 ál aliquot of the purified PCR fragments, which were mixed and added to a freshly prepared PCR mixture obtained in accordance with the above Protocol using primers P3 and P2. Total volume of PCR mixture was 50 μl. Conditions of PCR would be and is similar to the above-mentioned conditions, except that the annealing temperature was adjusted in accordance with the Tm of the primers.

Need SigH-, SigA1 and SigA2-design ligated into the plasmid pBS19, which were hydrolysed by enzymesEcoRI andBamHI obtaining vectors expressing SigA and SigH and used to transform host cells as described in example 2.

Mixture for transformation were sown on the plates containing LB medium + 1.6% of separated milk + 5 μg/ml of chloramphenicol. The next day colonies, forming a halo, collected and sown to obtain monocolonal. Cleaning of the colonies was performed twice. Five individual clones were analyzed by sequencing the region of the aprE promoter. All of these clones had a consensus sequence in the-35-region of the aprE promoter.

Example 2

Transformation of host cells and expression of protease aprE

Five microlitres legirovannoi mixtures containing design SigA or SigH, used to transform Top10 cellsE. coli(Invitrogen) by electroporation. Transformed cells were sown on the plates with LB agar containing 5 ppm/ml chloramphenicol (Cm), and the colony was left overnight cultivation at 37°C. Individual colonies were collected and transferred into tubes containing 5 ml LB + 5 ppm/ml Cm. The cultures were grown overnight at 37°C with shaking at 250 rpm Plasmid DNA was obtained from the of ultor E. coliand part of the plasmid DNA preparation sequenced (Sequetech). Automated sequence analysis was performed using computer programs Phrep, Phrap, Consed, Custal W.

The plasmids bearing construction, located to the right of each of the three expression vectors were used to transform host cellsB. subtilis. Expression vectors containing the constructs SigH (SEQ ID NO:1) and SigA1 (SEQ ID NO:2) and SigA2 (SEQ ID NO:3), which were marked pBS19 ymaH-H and pBS19 ymaH-A1 and pBS19 ymaH-A2, was transferred into strains BG2941 and BG2942B. Subtilisas is described below. Two microliters of plasmid DNA carrying the appropriate design, was used to transform 100 μl of cells of strain BG 2941B. subtilis(ΔnprE, amyE::PxylRA-comK-phleoRand strain BG2942B. subtilis(ΔnprE, degU(Hy)32, amyE::PxylRA-comK-phleoR). Transformants BG2941 and BG2942, supporting structures SigH, meant 41SigH and 42SigH respectively, and transformants BG2941 and BG2942, supporting structures SigA1, meant 41SigA1 and 42SigA1 respectively. Some cells masters BG2941 and BG2942 were also transformed with control plasmid pBS19 and marked 41pBS19 and 42pBS19. Cell owners BG2941 and BG2942 carry a deletion of the genenprEthat leads to the elimination of the greater part of the background proteolytic activity not related to aprE, and thereby facilitates the determination of the level of production of alkaline protease (aprE). Cell owners BG2941 and 2942 also carry the class is EP amyE::PxylRA-comK-phleoRthat allows to obtain competent cells by inducing the growth of culture in the presence of xylose (Hahn et al., Environ Mol. 18:755-67 [1995]). Cell owners 2942 also carry a mutation in the gene degU (mutation degU(Hy)32), which itself several times increases the level of subtilisin secreted by cells of the host, compared to the level of subtilisin secreted by cells of the host, which does not carry the mutation degU(Hy) (Msadek et al. J Bacteriol, 172:824-834 [1990]).

The effect of overexpression of YmaH in the cells of hostsBacillusqualitatively and quantitatively evaluated in the assays described in example 3.

Example 3

The effect of overexpression of ymaH on the production of protease

Analysis using casein: Effect of overexpression of ymaH on the production of protease in the cells of hostsBacillusfirst was evaluated using a quantitative analysis, which compared the size of the halo produced by the colonies grown on agar tablets containing casein in the form of separated milk. Because the protease enzyme produced by the cells ofBacillushe decomposes the casein contained in the separated milk, and forms a zone of transparency or halo around the growing colonies. Cell owners who have inactivated the protease, will form a small halo or will not form a halo around the colony is. Thus, the size of the halo can be a qualitative assessment of the amount of protease produced by secreting its colony (Wells, T. A. et al. Nucleic Acids Res., 11, 7911-7925: [1983]).

Cell owners BG2941 and BG2942B. subtilistransformed SigH - or SigA1-expressing vectors were sown on the plates with LB agar containing 1.6% of separated milk and 5 ppm/ml Cm, and incubated overnight at 37°C. the next day, colonies from some of the transformants formed separate monoclone on tablets with LB agar containing 5 ppm/ml Cm, after which the plates were incubated over night at 37°C. the Isolates monocolonal collected and put spots on tablets of the same type and again incubated at 37°C during the night.

The largest halos were produced by cells of the host 42SigH carrying the mutation degU(Hy)32 and the design SigH capable sverkhekspressiyaymaH. In particular, the size of the halo cells 42SigH indicates that overexpression ofymaHalso leads to increased level of production of subtilisin in the cells of the hosts, who have produced this enzyme at a level exceeding the level of production of this enzyme in wild-type cells, i.e. cells 42SigH produce halos larger than the size of the halo produced by cells 42pBS19 carrying the mutation degU(Hy), but not bearing construction which is capable with erbexpression ymaHand these cells in turn produce the halo, the amount of which exceeds the size of the halo produced by cells 41pBS19, not carrying the mutation degU(Hy)32 and not bearing construction which is capable of sverkhekspressiyaymaH. The size of the halo produced by cells 42SigH, also exceeds the size of the halo produced by cells 41 SigH, not carrying the mutation degU(Hy), but bearing design SigH capable sverkhekspressiyaymaH.

AAPF-analysis - production of subtilisin transformed cells mastersBacillus42SigH, 42SigA1, 41SigA2 that sverkhekspressiyaymaHand their respective control cells 42pBS19 and 41pBS19 quantitatively evaluated as a function of the activity of secreted proteases aprE. Proteolytic activity secreted protease was determined as the rate of hydrolysis of the substrate succinyl-L-Ala-L-Ala-L-Pro-L-Phe-p-nitroanilide (AAPF from Sigma Chemical Co). This analysis has measured the production of protease as the optical density at 405 nm/min, obtained after hydrolysis and release of p-nitroanilide (Estell et al., J. Biol. Chem., 260:6518-6521 [1985]). Measurement was performed using a computer program Sofmax Pro, under specific conditions, such as: type of reaction: kinetic; recovery: point Vmax (best read in 15 of 28 points); Lm1: 405 nm; time: 5 minutes; interval: 11 seconds.

Liquid culture control the host cells 41pBS19 and 42pBS19 B. subtilisand host cells, sverkhekspressiyaymaH, was obtained by inoculation of 5 ml of LB medium containing 5 ppm/ml chloramphenicol (Cm), monocolonal transformed cells 41 SigH and 42SigA1 and 42SigH and cell cultivation with shaking at 37°C until cells reached the middle of the logarithmic phase of growth. Each culture was diluted 1:100 in fresh complex medium containing 5 ppm/ml Cm, and left for cultivation at 37°C with shaking at 250 rpm/min samples of the cultures were taken over the time periods indicated on the figures. The samples were centrifuged, and supernatant analyzed for the production of subtilisin.

Ten microlitres each supernatant culturesB. subtilisbred 100 Microlitre Tris-buffer containing 10 mm Tris + 0.005% tween®-80, pH 8,6; and 25 μl of 100 mg/ml AAPF. Then we determined the activity of each of these proteases, and the effects of overexpression of YmaH on the production of protease shown in figures 3A-B and figure 4.

In figures 3A and 3B it is shown that overexpression ofymaHin the cells of hostsBacillusregardless of the presence (42SigA and 42SigH; figure 3A) or absence (SigH 41; figure 3B) mutations degU(Hy), leads to increased level of production of subtilisin aprE, which is several times the level produced by the respective control cells 41pBS19 and 42pBS19. In addition, cells that sverkhekspressiya ymaHproduce subtilisin at a level exceeding the level of production of subtilisin cells that do not sverkhekspressiyaymaH. For example, figure 3A shows that the cells 42sigH 20 hours of cultivation produce almost the same amount of subtilisin, which produce parental control cells for 48 hours. Similarly, figure 3B shows that the cells 41sigH 25 hours produce more subtilisin than the control cells 41pBS 48 hours. On the graph presented on figure 4, it is shown that cells which ExpressymaHunder the action of the promoter SigH (42SigH), produce subtilisin at a level exceeding the level of subtilisin produced by cells in which the expressionymaHinduced promoter sigma (42SigA). Figure 4 also shows that overexpression ofymaHregardless of whether it is induced by promoter SigH or SigA, leads to increased level of production of subtilisin already at least one hour after the start of culturing cells.

1. Selected the chimeric polynucleotide forgainproduction of interest heterologous protein containing the polynucleotide sequence of SigA promoter or SigH, functionally associated with polynucleotides coding YmaH protein and the chimeric polynucleotide contains the selected, which at least 90% identical to SEQ ID NO: 1, 2, 3 or 13.

2. Selected the chimeric polynucleotide according to claim 1, comprising SEQ ID NO: 1, 2, 3 or 13.

3. The expression vector chimeric polynucleotide to increase production of interest heterologous protein containing the chimeric polynucleotide according to claim 1.

4. The vector according to claim 3, where specified the chimeric polynucleotide contains SEQ ID NO: 1, 2, 3 or 13.

5. A modified cell-hostBacillus,containing the vector according to claim 3, where this modified cell-hostBacillusable to produce interest heterologous protein.

6. Modified cell according to claim 5, where the cell isBacillusselected from the group consisting ofCentury licheniformis, subtilis, B. lentus, B. brevis, B. stearothermophilus, B. alkalophilus, B. amyloliquefaciens, B. coagulans, B. circulans,Century lautus,B. pumilus, B. thuringiensis, B. clausiiandB. B. megaterium.

7. Modified a host cell according to claim 5, where the protein of interest is homologous or heterologous with respect to the said modified cell-master.

8. Modified a host cell according to claim 5, where the promoteraprEinitiates the expression of the indicated protein of interest.

9. A host cell according to claim 5, where the specified interest protein selected from the group consisting of amylases, proteases, xylanases, lipases, Lekkas, peroxidase, oxidase, koutinas, C is lulas, hemicellulase, esterases, peroxidases, catalase, glucose oxidases, pitas, pectinase, glucosides, isomers, transferring enzyme, kinase, fosfates, galactosidases and chitinases, hormones, cytokines, growth factors, receptors, vaccines and antibodies.

10. A host cell according to claim 5, where the specified interest protein is an enzyme.

11. A host cell of claim 10, where the specified enzyme is a protease.

12. A host cell according to claim 11, where the specified protease is subtilisin selected from the group consisting of subtilisin 168, subtilisin BPN', subtilisin Carlsberg, subtilisin B.lentus,subtilisin B.clausii,subtilisin DY, subtilisin 147, subtilisin 309 and their variants.

13. Modified cellBacillus,containing the vector according to claim 3, which is the cell, producing a protease capable of sverkhekspressiyaYmaH,where the modified cell contains a mutation in at least one gene selected from thedegU, degQ, degS, sco4, spollE, degQanddegR,where the mutation increases the ability to produce protease.

14. Modified cell according to item 13, where the specified mutation isdeg(Hy)32.

15. Modified cell according to item 13, where the specified cellBacillusis cell-Centurysubtilis.

16. A method of obtaining modified cellsBacillus,including:
a) transforming the host cellBacillusthe vector according to claim 3, g is e cell Bacillusable to Express the interest of a heterologous protein; and
b) cultivation of the specified modified cells in growth conditions conducive to the expression specified interest heterologous protein.

17. The method according to clause 16, where the specified vector containing the specified polynucleotide construct, is located on the plasmid can replicate.

18. The method according to clause 16, where this design is integrated into the genome of the modified cells.

19. The method according to clause 16, where the specified interest protein is subtilisin.

20. A method of obtaining a protein of interest in a modified cellBacillusable to produce the specified interest heterologous protein, where the method includes:
a) culturing the modified host cell according to claim 5, where the modified cell can sverkhekspressiyaYmaH;and
b) cultivation of the specified modified cellsBacillusthe growth conditions conducive to the expression specified interest heterologous protein.

21. The method according to claim 20, further comprising the extraction of the specified protein of interest.

22. The method according to claim 20, where the specified protein of interest is produced over a shorter period of time than the period of time for which the specified protein is produced corresponding to the host-cell-precursor.

23. The method according to claim 20, where the aprE promoter initiates the expression of the indicated protein of interest.

24. The method according to claim 20, where the specified interest protein is an enzyme.

25. The way to increase expression of interest heterologous protein ofBacillusincluding:
a) obtaining a modified cellsBacillus,containing sverkhekspressiyaYmaH,by transforming the parent host cellBacillusthe chimeric polynucleotide according to claim 1;
b) growing the modified cellsBacillusin terms ofconducive to cell growth, and
c) expression of the indicated protein of interest in a modified cellBacillus,where the expression specified interest heterologous protein in a modified cellBacillusincreases in comparison with the expression of the indicated protein of interest in a specified parent cell hostBacillus.

26. The method according A.25 where specified the chimeric polynucleotide contains a polynucleotide sequence selected from SEQ ID NOS: 1, 2, 3 and 13.

27. The method according A.25 where specified the chimeric polynucleotide is a plasmid or integrated into the genome of the modified cells.

28. The method according A.25 where specified the host-cell is a cell of wild-type.

29. The method according A.25, where the specified tile is Oh-host is modified a host cell.

30. The method according A.25, where the specified interest protein is an enzyme.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Claimed is strain of Fusarium sambucinum, deposited in VKPM collection under number F-1161. Claimed strain is producent of protein food biomass.

EFFECT: invention makes it possible to accumulate biomass with high protein content with higher quantity of valuable unsaturated fatty acids, complete in composition.

2 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Claimed is method of obtaining food fungal biomass with high protein content. Multicycle deep cultivation of Fusarium sambucinum All-Russian collection of industrial microorganisms F-1161 on liquid nutritional medium, containing sources of carbon, nitrogen, mineral salts, separation and drying of wet fungus biomass are carried out. Cultivation is performed at pH from 3.5 to 7.0 under conditions of air aeration from 0.5 to 2.0 l/l/min. Temperature mode in each cycle of fermentation is supported from the beginning of the cycle to the point of switch at the level from 26 to 30°C, and further to the end of the cycle at the level from 22 to 25°C. Point of switch is determined by accumulation of biomass to concentration from 45 to 60% from maximally achievable in fermentation apparatus, or point of switch is determined by concentration of dissolved oxygen by its reduction to the value from 20 to 40% of saturation ( calculated per atmospheric air pressure).

EFFECT: invention makes it possible to obtain the largest accumulation of biomass with high protein content with specified quantity of nucleic acids.

4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Disclosed is a purified preparation of recombinant human N-acetylgalactosamine-6-sulfatase (GALNS) enzyme, where said enzyme includes an amino acid sequence which is at least 95% identical to amino acids 27-522 SEQ ID NO:4, which is suitable for treating a subject suffering from a lysosomal storage disease associated with GALNS, where: (a) said GALNS enzyme preparation has purity of at least about 95% as determined by Coomassie Blue staining when subjected to SDS-PAGE under non-reducing conditions; and (b) the cysteine residue at position 79 of at least 50% of molecules of the GALNS enzyme in said GALNS enzyme preparation is converted to Cα-formylglycine (FGly); where said GALNS enzyme is N-linked glycosylated at the asparagine residues at positions 204 and 423, wherein at least about 50% of the oligomannose chains attached to the asparagine residue at position 204 are bis-phosphorylated. Disclosed is a method of treating a subject suffering from mucopolysaccharidosis type IVa (MPS IVa), Morquio A syndrome or multiple sulfatase deficiency (MSD), which involves administering a therapeutically effective amount of said purified preparation of recombinant human GALNS to the subject.

EFFECT: invention enables to obtain a pharmaceutical preparation of recombinant highly phosphorylated human GALNS, having a high content of molecules with a cysteine residue at position 79 converted to Cα-formylglycine, owing to which it is highly absorbed through the mannose-6-phosphate receptor (MPR) and has high activity.

29 cl, 13 dwg, 15 tbl, 11 ex

FIELD: biotechnologies.

SUBSTANCE: mutant strain is obtained by impact on Glarea lozoyensis ATCC 20957 strain by nitrosoguanidine and it is deposited in CGMCC with number CGMCC 2933.

EFFECT: fungi strain has stable genetic and productive properties, produces low quantity of impurities during fermentation and is acceptable for commercial production of antibiotic.

6 cl, 2 dwg, 2 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: there proposed is an antibody specific to TENB2 containing light and heavy chains. Heavy chain contains substitution for free (reaction capable) cysteine A121C that corresponds to A114C (Kabat numbering) or A118C (Eu numbering). Conjugate versions are proposed for prostate cancer treatment containing antibody covalently bound to auristatin, also by means of linker. The following is described: pharmaceutical composition for prostate cancer treatment that uses as active beginning the antibody or its conjugate; product for prostate cancer treatment on the basis of such composition. The invention proposes: method for defining protein TENB2 in the sample - on the basis of antibody as well as analysis for revealing prostate cancer cells at mammal and method for cell proliferation inhibiting on the base of antibody conjugate and auristatin. There described is the method for obtaining antibody conjugate (Ab) and auristatin (D) with expression Ab-(L-D)p, where p is equal from 1 to 4, and L is linker.

EFFECT: invention application provides conjugates with increased stability in serum in comparison with the same conjugates without A121C substitution in antibody that can be used in medicine.

33 cl, 18 dwg, 2 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: expression vector includes: (a) replication origin OriP obtained from Epstein-Barr virus (EBV), where replication origin contains: 1) symmetry element of the second order (DS); and 2) duplication section (FR) that contains fixation point EBNA; (b) replication origin SV40; (c) insertion section for inserting a gene of concern; (d) promoter EF-1b functionally bound to the insertion section; (e) poly-A signal; (f) bacterial replication origin; (g) selected marker; and unnecessarily containing (h) sequence of nucleic acid, which codes constant area of heavy or light chain of antibody, which is functionally bound to the insertion section. With that, replication origin OriP is bound to an initiation factor of replication EBNA 1, which acts from outside and is not coded with an expression vector.

EFFECT: use of an expression vector in an extracted host cell, a set and a method for obtaining recombinant protein provides production of abundant protein expression.

26 cl, 25 dwg, 3 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes a method for obtaining recombinant core protein of hepatitis E virus (rtHEV-ORF2) and recombinant vaccine for prophylaxis of hepatitis E virus. Core protein is obtained by cultivation of recombinant yeast strain Hansenula polymorpha "КБТ"-11/pHEV-001, which contains DNA sequence integrated into genom of yeast cell and coding the fragment of amino-acid sequence from position 86 to 607 of core protein of hepatitis E virus of genotype 3 (rtHEV-ORF2) under control of promoter of MOX gene. The method allows obtaining immunogenic antigene of hepatitis E virus, which has properties of natural protein. Based on the obtained antigene there created is recombinant vaccine for prophylaxis of hepatitis E virus. Vaccine includes effective amount of rtHEV-ORF2 protein, adjuvant and a physically acceptable diluter.

EFFECT: vaccine is immunodominant and non-toxic and has no by-effects.

3 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: renatured membrane protein obtaining method is proposed. The above method involves production of a homogeneous solution containing a denatured membrane protein, a detergent mixture, phospholipide or phospholipide mixture and apolipoprotein or its equivalent with: further removal of detergents and formation of lipid-protein nanodiscs (LPND) containing renatured protein.

EFFECT: method provides production of renatured membrane proteins with high yield, which are built into LPND, which can be used at development of new medical products, biocatalysts, biosensors and biophotonic devices.

8 dwg, 2 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes a production method of recombinant protein through its hybrid precursor substance with natural decomposition site with enteropeptidase. The result is achieved by replacement in natural decomposition site with enteropeptidase Asp-Asp-Asp-Asp-Lys of amino-acid residue of lysine (Lys) with amino-acid residue of arginine (Arg) and further decomposition of hybrid precursor substance with light catalytic subunit of enteropeptidase of a human being or a bull.

EFFECT: improving quality and yield of target product under conditions when hybrid protein detects additional sites of decomposition with enteropeptidase.

3 tbl, 3 dwg, 4 ex

FIELD: chemistry.

SUBSTANCE: present inventions relate to protein engineering, plant molecular biology and pest control, as well as a hybrid insecticide protein and use thereof. Described is a hybrid insecticide protein which includes from the N-end to the C-end an N-end portion of Cry3A protein which is fused with the C-end portion of Cry1Ab protein, wherein the position of the crossover of the Cry3A protein and the Cry1Ab protein is located in a conservative block 2, in a conservative block 3 or in a conservative block 4 and has anti-western corn rootworm activity. Also disclosed are nucleic acid molecules which code the novel proteins, methods of producing proteins, methods for use thereof, as well as transgenic plants and seeds thereof which contain such proteins.

EFFECT: inventions enable to obtain cheap means of controlling Diabrotica worms.

39 cl, 8 dwg, 9 tbl, 46 ex

FIELD: biotechnologies.

SUBSTANCE: compositions containing active versions of alpha-amylase are proposed. Besides a new version of alpha-amylase, compositions as per the invention usually contain at least one additional ferment, a detergent, one surface-active substance, one complexing agent, an oxidiser, an acidifying agent, an alkaliser, a peroxide source, a harness source, salt, a detergent complexing agent, a polymer, a stabilising agent or a conditioner. Besides, application methods of those compositions for scouring of woven fabric, for washing or cleaning of products, such as dishware or linen, which are contaminated with starch-containing substances, are described.

EFFECT: improved thermal stability relative to parental; form of AmyS-like alpha-amylase, from which they have been obtained.

10 cl, 12 tbl, 24 dwg, 14 ex

FIELD: chemistry.

SUBSTANCE: described is a version of Bacillus licheniformis alpha-amylase having an amino acid sequence which is at least 90% identical the SEQ ID NO: 4 sequence and contains a substitution of S239Q, corresponding to SEQ ID NO:4 given in the description. Provided are a nucleic acid which codes said version; an expression vector containing said nucleic acid; and a host cell containing said vector or nucleic acid. Described are compositions containing the disclosed alpha-amylase and used for starch liquefaction, starch saccharification, starch processing, textile desizing, baking, as well as detergent compositions and an additive. Disclosed is a method of producing ethanol comprising the following steps: a) using the starch liquefaction composition on ground maize or starch suspension; b) starch saccharification; c) fermentation of the saccharified starch; d) obtaining ethanol.

EFFECT: invention enables to obtain compositions containing alpha-amylase, having high thermostability and melting point.

43 cl, 3 tbl, 9 dwg, 6 ex

FIELD: microbiological industry, biotechnology.

SUBSTANCE: invention relates to production of bacterial preparations. Method involves construction of recombinant plasmid DNA comprising gene determining the resistance to erythromycin (ErmC), sequence of DNA fragment of B. thuringiensis subsp. tenebrionis encoding synthesis of δ-endotoxin cry IIIA, sequence of DNA fragment of chromosome B. thuringiensis subsp. kurstaki of size 448 nucleotide pairs, sequence of DNA fragment of chromosome B. thuringiensis subsp. kurstaki of size 501 nucleotide pairs, and sites for cleavage with restriction site-specific endonucleases Eco RI, Pst I, Bam HI, Hind III and Kpn I. The strain B. thuringiensis subsp. kurstaki comprising the indicated recombinant plasmid DNA is prepared. Invention provides preparing the strain B. thuringiensis possessing the enhanced insecticide activity with respect to representatives of Lepidoptera, Coleoptera and Homoptera orders showing the damage effects on agriculture cultures and crops.

EFFECT: valuable properties of plasmid DNA.

3 cl, 5 dwg, 6 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: claimed invention relates to immunology and biotechnology. Claimed is binding protein for binding one or more targets, which contains four polypeptide chains forming four functional antigen-binding sites. Four polypeptide chains contain VD1-(X1)n-VD2-C-(X2)n. VD1 stands for first variable domain of heavy chain, VD2 stands for second variable domain of heavy chain, C stands for CH1 domain, X1 stands for polypeptide linker, on condition that it is not constant domain, and X2 stands for Fc-region, and n equals 0 or 1. Two polypeptide chains contain VD1-(X1)n-VD2-C. VD1 stands for first variable domain of light chain, VD2 stands for second variable domain of light chain, C stands for CL domain, X1 stands for linker, on condition that it is not constant domain; and n equals 0 or 1. Conjugate of binding protein with visualising detecting cytotoxic or therapeutic agent is described. Disclosed are: nucleic acids (NA), coding polypeptide chains, as well as expressing vectors, vectors for replication, host cells which contain them, and method of obtaining antibody applying cells. Described is pharmaceutical composition for treatment or preventing target-associated disease or disorder based on binding protein. Method of treatment by introduction of binding protein is described.

EFFECT: application of invention provides new format (DVD-Ig) of antigen-binding molecules, which in the same dosage possess higher activity with respect to target than respective full-size antibodies, which can be applied in medicine for prevention and treatment of various diseases.

45 cl, 27 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a recombinant cell of Ralstonia eutropha, designed to obtain 2-hydroxyisobutyric acid. The cell is transformed by a plasmid with the sequence SEQ ID NO: 2.

EFFECT: cell bearing said plasmid produces 2-hydroxyisobutyric acid in concentration of up to 0,72 mmol/kg.

4 dwg, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to immunology. Described are antibodies against VEGF, one on which contains complementary regions with amino acid sequences SEQ ID NO:1, 2, 3, 4, 6 and 7, another contains complementary regions with amino acid sequences SEQ ID NO:1, 2, 3, 5, 6 and 7, disclosed in description. Also described are polynucleotides, coding said antibodies; espression vectors, containing said polynucleotides, and host cells, intended for obtaining antibodies in accordance with the claimed invention. Claimed is method of obtaining antibodies against VEGF, which includes expression of vector in host cell and separation of antibody. Disclosed is method of obtaining immunocongugate of antibody against VEGF, which includes conjugation of antibody with drug or cytotoxic agent. Described is method of VEGF identification, which includes identification of complex VEGF-antibody against VEGF in biological sample. In addition, described are compositions for treatment of VEGF-associated disease, one of which contains efficient quantity of antibody against VEGF, and another - efficient quantity of polynucleotide, coding said antibody. Also disclosed are methods of: 1) treating tumour, cancer or VEGF-associated cell proliferative disease; 2) inhibition if angiogenesis in subject and 3) inhibition of vascular permeability; consisting in introduction to subject of efficient quantity of antibody against VEGF in accordance with claimed invention.

EFFECT: invention makes it possible to obtain antibodies against VEGF and apply them for treatment of VEGF-associated diseases.

41 cl, 16 dwg, 2 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly a method for specific collection of DNA molecules (DNA aptamers) with high affinity for a recombinant protein target. Said method involves synthesis of a single polypeptide chain of a recombinant protein containing a fragment of glutathione S-transferase, a protein target, a peptide sequence split by the B. Anthracis lethal factor, a peptide which is biotinylated in vitro under the action of an E.coli biotin-ligase enzyme, binding the obtained recombinant polypeptide with an oligonucleotide library and immobilising the protein on paramagnetic particles bearing glutathione, washing the paramagnetic particles with the immobilised polypeptide from unbound oligonucleotides in a liquid stream, splitting the protein target with the bound DNA aptamers from the surface of paramagnetic particles with the B. anthracis lethal factor, separating and amplifying the DNA sequence with affinity to the recombinant protein target in a polymerase chain reaction and obtaining a set of single-chain DNA aptamers that are specific to the protein target.

EFFECT: invention provides efficient production of DNA aptamers with high affinity for recombinant protein targets.

4 dwg, 4 ex

Up!