Muteins of tear lipocalin, possessing affinity to human c-met receptor tyrosine kinase and methods of obtaining them

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of biotechnology, namely to muteins of human tear lipocalin, and can be used in medicine. Mutein of human tear lipocalin (hTLc) has identifiable affinity of binding with human receptor Met (c-Met) receptor tyrosine kinase, or its domain, or fragment of human c-Met. Mutein contains from 6 to 18 amino acid substitutions relative to amino acid sequence of mature lipocalin of human tear liquid (SWISSPROT DATABANK ENTRY P31025; SEQ ID NO:36), selected from group, consisting of Arg 26→Thr, Val, Pro, Ser, Gly; Glu 27→Gln, Gly, Val, Ser; Phe 28→Met, Asp; Pro 29→Leu, Ile, Ala, Trp; Glu 30→Leu, Gly, Arg, Phe; Met 31→Ser; Asn 32→Leu, Arg, Val, Gln; Leu 33→Tyr, Val, Ile, Thr, Phe; Glu 34→Val, Arg, Ala; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile, Val; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly. Mutein can also additionally contain the following substitutions: Cys 61→Ser; Cys 101→Ser; Cys 153→Ser; Arg 111→Pro; Lys 114→Trp; Thr 37→Ser; Met 39→Ile, Leu; Asn 48→Ser; Lys 52→Thr, Met; Met 55→Leu; Lys 65→Arg, Leu; Ala 79→Leu, Ser; Ala 86→Thr; Ile 89→Ser, Gln, Thr, His; Thr 40→Cys; Glu 73→Cys; Arg 90→Cys; Asp 95→Cys; Lys 121→Cys; Asn 123→Cys and Glu 131→Cys.

EFFECT: invention makes it possible to efficiently treat pathological disorders, which involve pathway HGF/c-Met, as well as to perform identification of human c-Met in sample.

40 cl, 16 dwg, 9 tbl, 25 ex

 

In this application claimed priority to provisional application U.S. 61/024658, filed January 30, 2008, the contents of which are incorporated so by reference in its entirety for all purposes.

The present invention relates to mutein of lipocalin lacrimal fluid of humans (hTLc), with detectable by the ability of binding to the Met receptor receptor (c-Met), or a domain or fragment. This mutein contains amino acid substitutions in at least one position of the sequence corresponding to the provisions of the sequence 26-34, 56-58, 80, 83, 104-106 and 108 in the hTLC. The invention also relates to the corresponding molecules of nucleic acids encoding such mutein, and the way they are received. In addition, the invention relates to a method for producing such mutein. Finally, the invention is directed to a pharmaceutical composition containing such lipocalin mutein, and various applications mutein.

Met-receptor tyrosinekinase (RTK), first identified as the product of the human oncogene Tpr-Met (Park et al., Proc. Natl. Acad. Sci, USA, Vol.84, str-6383, 1987). The ligand for c-Met was identified as a growth factor hepatitas (HGF). HGF originally identified as a mitogen for hepatocytes in culture. HGF is identical to the scattering factor (SF)produced from fibroblast factor which is capable is equal to the scattering layers of epithelial cells, as well as the Genesis of branching tubules epithelium grown in three-dimensional cultures. HGF/SF is, thus, a unique growth factor, which causes multiple cellular responses, including mitogens, cell motility and morphogenesis.

HGF/SF and c-Met are expressed in many tissues in adults. Protein C-Met is expressed mainly in epithelial cells but also in endothelial cells, nerve cells, hepatocytes, hematopoietic cells, melanocytes. It is possible that c-Met is one of the most important membrane receptors. Its activation plays a key role in cellular physiology: mitogenes, mutagenese, morphogenesis. It seems that HGF/SF is produced by cells of mesenchymal origin.

If HGF/SF activates c-Met, the first protein that is activated during transcription are Grb2 (protein 2 that communicates with the growth factor receptor) and Gab 1 (connecting element 1 associated protein 2, communicates with the growth factor receptor). Grb2, in turn, can activate a number of kinase pathways, including the path from Ras to Raf to MEK and to MARK (mitogen-activated protein kinase). Gab 1 activates PI3K (phosphoinositide-3-kinase), which activates STAT3 (signal Converter and activator of transcription). Activation of c-Met also induces the activation of beta-catenin, a key component of wnt-the uti, which moves to the nucleus and participates in the regulation of transcription.

The path of the HGF/c-Met plays an important role in cancer development. First, through activation key oncogenic pathways (Ras, PI3K/STAT3, beta-catenin), and secondly, through the proliferation of endothelial cells (neoangiogenesis), thirdly, through increased production of proteases and, therefore, cell dissociation, leading to metastasis.

Various new therapeutic approaches, some of them are in phase I or II clinical trials aimed at the path of HGF/c-Met. Such approaches include anti-HGF monoclonal antibodies, such as humanitariannet form AV299 from AVEO or a fully human antibody, called antibody armature 102 from Amgen (AMGI 02). Another approach is the use of truncated variants of c-Met, which act as traps. One such example is a shortened version called CGEN241, from COMPUGEN. Also for therapeutic use of inhibitors of protein kinase (small molecules)that inhibit c-Met-induced way. Examples of such small molecule inhibitors of protein kinases include ARQI 97 from ARQULE, XL880 from EXELIXIS, SGX523 from SGX Pharmaceuticals, MP470 from SUPERGEN or PF2341066 from PFIZER.

But still it is desirable to have additional available compounds that bind c-Met and which can, for example, be used for tera is efticiency purposes.

Thus, the aim of the invention is to propose Malinov of lipocalin lacrimal fluid of humans with high affinity binding to a given target.

This goal is achieved, for example, using mutein of lipocalin lacrimal fluid of humans (hTIc)having detectable affinity binding to the Met receptor receptor human (c-Met), or a domain or fragment, where such mutein contains amino acid substitution in at least one position of the sequence corresponding to the provisions of the sequence hTLC 26-34, 56-58, s, 104-106 and 108.

In a related aspect, the present invention proposes a method of obtaining mutein of lipocalin lacrimal fluid of humans, where mutein binds to c-Met with detectable affinity binding. This method includes:

(a) the exposure of the nucleic acid molecule that encodes lipocalin lacrimal fluid of humans, mutagenesis in at least one codon of any of the provisions of the amino acid sequence 26-34, 56-58, 80, 83, 104-106 and 108 of the linear polypeptide sequence of native Mature lipocalin tear fluid of a person, where at least one of the codons encoding cysteine residues in positions sequence 61 and 153 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans, Muti is IAOD, to encode any amino acid residue, thus obtained a set of nucleic acids encoding mutiny of lipocalin tear fluid of man,

(b) expressiona one or more nucleic acid molecules mutein obtained in (a), in the expression system, so the result is one or more than one mutein, and

(C) enrichment of one or more Malinov obtained in stage (b) and having detectable binding affinity of against the Met, through selection and/or isolation.

In this context it should be noted that the inventors have unexpectedly discovered that the removal of structural disulfide bonds (at the library level corresponding nepodvizhnykh the impact of nucleic acids) of lipocalin wild type of tear fluid, comprising residues 61 and 153 of cysteine (see Breustedt, et al. (2005), The 1.8-A crystal structure of human tear lipocalin reveals an extended branched cavity with capacity for multiple ligands. J. Biol. Chem. 280, 484-493), gives mutiny of lipocalin tear fluid, which not only stably folded, but, in addition, it can also bind this artificial ligand with affinity in the low picomolar interval.

The term "mutagenesis" as used in this description means that the experimental conditions are chosen so that the amino acid occurring naturally in this position pic is egovernance of lipocalin lacrimal fluid of humans (Swiss-Prot data bank entry P31025), may be replaced by at least one amino acid which is not present in this particular position in the respective natural polypeptide sequence. The term "mutagenesis" also includes (optional) modify the length of the segments in sequence by deletion or insertion of one or more amino acids. Thus, in the scope of the invention is that, for example, one amino acid at the selected position of the sequence is replaced by the length of the three random mutation that leads to the insertion of two amino acid residues compared to the length of the corresponding segment of the wild-type protein. Such insertion deletions can be entered independently of each other in any of the peptide segments, which can be subjected to mutagenesis according to the invention. In one typical embodiment of the invention the insertion of multiple mutations can be introduced in the loop AB selected lipocalin frame (see international patent application WO 2005/019256, which is incorporated in this description by reference in its entirety). The term "random mutagenesis" means that certain position there is no required sequence is the only amino acid (mutation), but that at least two amino acids can be introduced with a certain probability at a given position of the sequence in time is I mutagenesis.

The coding sequence of lipocalin lacrimal fluid of humans (Redl, B. et al. (1992) J. Biol, Chem. 267, 20282-20287) used as a starting point for mutagenesis of peptide segments selected in the present invention. In relation to mutagenesis of these amino acid positions, specialist in the art has at his disposal a variety of standard methods for the site-directed mutagenesis (Sambrook, J. et al. (1989), above). Commonly used method is the introduction of mutations using PCR (polymerase chain reaction), using mixtures of synthetic oligonucleotides, which are the composition of degenerate bases in the desired positions of the sequence. For example, the use of codon NNK or NNS (where M = adenine, guanine or cytosine or thymine; K = guanine or thymine; S = adenine or cytosine) allows you to include all 20 amino acids in addition to the amber stop codon in the process of mutagenesis, whereas the codon WS limits the number of possible included amino acids to 12, as it excludes the amino acids Cys, lie, Leu, Met, Phe, Trp, Tyr, Val of the selected polypeptide sequence; the use of codon HMS (where M = adenine or cytosine), for example limits the number of possible amino acids to 11 in a selected position of the sequence, as it eliminates linakis is the notes Arg, Cys, Gly, lie, Leu, Met, Phe, Trp, Val of the selected position in the sequence. In this regard it should be noted that the codons for other amino acids (in addition to the usual 20 naturally occurring amino acids, such as selenocysteine or pyrrolysine, can also be included in the nucleic acid mutein. It is also possible, as described in Wang, L., et al. (2001) Science 292, 498-500, or Wang, L., and Schultz, P.G. (2002) Chem. Comm. 1, 1-11, use "artificial" codons, such as UAG, which usually recognize the stop codons, to insert other unusual amino acids, such as ortho-methyl-L-tyrosine or para-aminophenylalanine.

The use of nucleotide building blocks with low specificity pairs of bases, such as, for example, inosine, 8-oxo-2'-deoxyguanosine or 6(2-deoxy-β-D-ribofuranosyl)-3,4-dihydro-8H-pyrimido-1,2-oxazin-7-he (Zaccolo et al. (1996) J. Mol. Biol. 255, 589-603), is another possibility of introducing mutations in the selected segment of the sequence.

Another possibility is the so-called triplet-mutagenesis. This method uses a mixture of different nucleotide triplets, each of which encodes one amino acid, for inclusion in the coding sequence (Virnekas In, Ge L, Pluckthun A, Schneider KC, Wellnhofer G, Moroney SE. 1994 Trinucleotide phosphoramidites: ideal reagents for the synthesis of mixed oligonucleotides for random mutagenesis. Nucleic Acids Res 22, 5600-5607).

One possible method of input mu is the situation in selected areas of the respective polypeptides based on the use of four oligonucleotides, each of which is partially made from one of the corresponding segments of the sequence to be matirovanie. When synthesizing such oligonucleotides specialist in the art can use a mixture of nukleinovokisly building blocks for the synthesis of such nucleotide triplets that correspond to amino acid positions to be matirovanie, so that randomly occur codons encoding all natural amino acids, which finally leads to the formation of libraries lipocalin peptides. For example, the first oligonucleotide corresponds to their sequence - except for the mutated provisions - coding strands for peptide segment to be matirovanie, in the M-terminal position lipocalin polypeptide. Accordingly, the second oligonucleotide corresponds to non-coding strands for the second segment sequence of the polypeptide sequence. The third oligonucleotide corresponds, in turn, the coding strands of the respective third segment sequence. Finally, the fourth oligonucleotide corresponds to non-coding strands of the fourth segment of the sequence. Polymerase chain reaction can be carried out with the respective first and second oligonucleotide and separately, PR is necessary, with the respective third and fourth oligonucleotide.

Amplification products of both these interactions can be combined in various known ways one nucleic acid containing a sequence from the first to fourth segments of the sequence, where mutations were introduced in the selected position. To do this, both products can, for example, to expose a new polymerase chain reaction, using flanking oligonucleotides and one or more mediator nukleinovokisly molecules that make up the sequence between the second and third segment of the sequence. In choosing the number and location in the sequence of the oligonucleotides used for mutagenesis, a specialist in the art has at its disposal numerous alternatives.

Molecules of nucleic acids, as defined above, can be joined by ligation with the missing 5'- and 3'-sequences of nucleic acid that encodes lipocalin polypeptide and/or the vector, and can be cloned in a known organism-owner. For stitching and cloning there are many conventional methods (Sambrook, J. et al. (1989), above). For example, the recognized sequences for restriction endonucleases, also present in the sequence of the cloning vector, m is tenderly constructed in a sequence of synthetic oligonucleotides. Thus, after amplification of the corresponding PCR product and the enzyme cleavage, the resulting fragment can be easily cloned using the appropriate recognized sequence.

Longer segments in the sequence of the gene encoding a protein selected for mutagenesis also can be subjected to random mutagenesis by known methods, for example by polymerase chain reaction in an excessive error rate, by chemical mutagenesis or by using bacterial strains of mutators. Such methods can also be used for further optimisation of the target affinity or specificity lipocalin mutein. Mutations probably occur outside segments experimental mutagenesis, often valid, or can even be useful, for example, if they contribute to improved efficiency of the folding or stability of the folding lipocalin mutein,

The term "lipocalin tear fluid of a person" when used in this description of the invention refers to a Mature lipocalin tear fluid of the person who deposited in the data Bank, SWISS-PROT, under the registration number R and amino acid sequence indicated in SEQ ID NO: 36 in this description.

In one embodiment of the invention, the method of the education mutein of lipocalin tear fluid of a person includes a mutation of at least 2, 3, 4, 5, 6, 8, 10, 12, 14, 15, 16 or 17 codons in any of the provisions of the amino acid sequence 26-34, 56-58, 80, 83, 104-106 and 108 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans. In another embodiment motivovany all 18 codons in positions of amino acid sequence 26,27, 28, 29, 30, 31, 32, 33, 34, 56, 57, 58, 80, 83, 104, 105, 106 and 108 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans. Thus, Met-binding mutein according to the invention may contain a mutation in any of the provisions 2, 3, 4, 5, 6, 8, 10, 12, 14, 15, 16, 17 or 18 amino acid sequence 26-34, 56-58, 80, 83, 104-106 and 108 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans. However, the specialist in the art it is clear that the holding in a position sequence mutagenesis does not necessarily mean that the selected possible amino acid substitution will really take place in mateine according to the invention. Because of reverse mutations or structural-functional relationship amino acid residue sequence of the wild-type lipocalin tear fluid can also be stored in mateine according to the invention.

In another aspect of the present invention includes a method of obtaining mutein of lipocalin lacrimal fluid of humans, where mutein binds c-Met as the data is artificial ligand of lipocalin lacrimal fluid of humans with detectable binding ability, including:

(a) the exposure of the nucleic acid molecule that encodes lipocalin lacrimal fluid of humans, mutagenesis in at least one codon of any of the provisions of the amino acid sequence 34, 80, and 104 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans, thus obtaining a population of nucleic acids encoding mutiny of lipocalin tear fluid of man,

(b) expressiona one or more nucleic acid molecules mutein obtained in (a), in the expression system, obtaining thus one or more maleinos, and

(C) enrichment of one or more Malinov obtained in stage (b) and having detectable binding affinity of c-Met as this synthetic ligand of lipocalin lacrimal fluid of humans, through breeding and/or selection.

In one embodiment of the above method optionally at least 2, 3, 4, 5, 6, 8, 10, 12, 14 or 15 codons in any of the provisions of the amino acid sequence 26-33, 56-58, 83, 105-106 and 108 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans motivovany.

In yet another embodiment of the invention, the methods according to the invention include both mutation of codons encoding cysteine at positions 61 and 153 of the linear polypeptide sequence of Mature who pakalin lacrimal fluid of humans. Both provisions may, for example, be motivovany to encode a serine residue.

In another embodiment of the invention, which is described in this description of the invention, the codons encoding the amino acid position of the sequence 111 and/or 114 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans, motivovany to encode, for example, a Proline at position 111 and tryptophan at position 114.

Another embodiment of the methods according to the invention comprises mutagenesis of the codon encoding cysteine at position 101 of the linear polypeptide sequence of Mature lipocalin tear fluid of man, so that this codon encodes any other amino acid. In one embodiment the mutated codon encoding position 101 encodes serine. Thus, in some embodiments, two, or all three cysteine codon at position 61, 101 and 153 are replaced by a codon for another amino acid.

According to the method according to the invention mutein get, starting with a nucleic acid that encodes lipocalin lacrimal fluid of humans. Such nucleic acid is subjected to mutagenesis and placed in a suitable bacterial or eukaryotic organism-host through techniques recombinantively DNA. Obtaining a library of nucleic acids for lipocalin tear fluid can be performed using the use of any suitable way, which is known in the art, to obtain lipocalin of Malinov with antibody-like properties, i.e. Malinov that have affinity for the target. Examples of such combinatorial methods are described in detail in international patent applications WO 99/16873, WO 00/75308, WO 03/029471, WO 03/029462 WO 03/029463, WO 2005/019254, WO 2005/019255, WO 2005/019256, WO 2006/56464, or in international patent application PCT/ER/057971, the description of which, for example, by reference, are fully included in this description of the invention. After expression nukleinovokisly sequences that have been subjected to mutagenesis in a suitable host, from the library you can select clones that carry the genetic information for the totality of the relevant lipocalin of Malinov that bind a given target. For selection of these clones can use well-known methods, such as phage display (reviewed in Kay, B.K. et al. (1996) above; Lowman, H.B. (1997) above or Rodi, D.J., and Makowski, L. (1999) above), the screening of colonies (reviewed in Pini, A. et al. (2002) Comb. Chem. High Throughtput Screen. 5, 503-510), ribosomal display (discussed in Amstutz, P. et al. (2001) Curr. Opin. Biotechnol. 12, 400-405nm) or mRNA display, as reported in Wilson, D.S. et al. (2001) Proc. Natl. Acad. Sci. USA 98, 3750-3755, or methods specifically described in WO 99/16873, WO 00/75308, WO 03/029471, WO 03/029462, WO 03/029463, WO 2005/019254, WO 2005/019255, WO 2005/019256, WO 2006/56464, or in international paten the Noi application PCT/EP 2007/057971, the description of which, for example, fully incorporated by reference into this specification.

In accordance with this description, stage (C) of the method of obtaining c-Met-binding mutein of lipocalin tear fluid further includes, in another embodiment of the above methods:

(1) preparation of c-Met or a domain or fragment as given ligand,

(2) the bringing together of Malinov in contact with the specified ligand to ensure the formation of complexes between the specified ligand and mottainai having binding affinity for this ligand, and

(3) remove Malinov without or with negligible binding affinity.

For the formation of c-Met-binding Malinov of lipocalin tears any part (e.g., a fragment or a single domain) of the extracellular domain of Met receptor tyrosine kinase person (c-Met) or entire extracellular domains, which contain the N-terminal amino acid residues 1 methionine-threonine 932 Mature a receptor (SWISS Prot: P08581) can be brought into contact with mutinae (set), which were obtained from expression libraries (not previously exposed to) the nucleic acids that encode these mutiny. You can use commercially available extracellular domains, which, for example, offer in the form of OST is tcov 1-932, fused with Fc region of human IgG via a polypeptide linker, such as (R&D Systems, USA, catalog number 358-MT). Additional examples of fragments of c-Met, which can be used to obtain Malinov described herein include, without limitation, a fragment consisting of residues Met 25-567, as described in Stamos et al., The EMBO Journal, Vol.23, No. 12, 2004, str-2335, which contain seven domains Sema, or larger fragments, which contain the remains 25-567. Fragments binding domain SEMA, you can use if mutiny according to the invention are intended to compete with the binding of HGF with the Sema domains. Such mutiny may (but need not necessarily, see examples) to be antagonists of HGF. You can also use fragments, such as fragment containing residues 568-932 if you want to avoid binding domains Sema. Screening can also be carried out using fragments or other domains, such as domain PSI (plexin-semaphorin-integrin) or lgG-like domains of c-Met. Can also be used for screening purposes, for example, the homolog of the common chimpanzee (pan troglodytes, 99%identity to human c-Met), a homologue of macaque (tassa mulatta, 98%identity), the ortholog of the dog (cam's familiaris, 88%identity), the ortholog of the mouse (SWISS Prot: AI A597, 87%identity), or ortholog of rat (rattus norvegicus, 86%identity) instead of (extracellular domain) c-et man. This approach can, for example, be used if desired mutiny with cross-reactivity between human and mouse or mouse ortholog (or, for example, the extracellular domains). As is clear from the above, we can obtain in the present invention mutiny of lipocalin tear fluid, which may have an antagonistic effect against HGF. Alternatively, mutiny may have a corresponding non-adversarial nature of the binding (in this respect see Examples).

In one embodiment of the method according to the invention the selection stage (C) perform in a competitive environment. Competitive terms when used in this description means that the selection of Malinov may include at least one stage in which mutiny and this artificial ligand of lipocalin tear fluid of a person (the target) is brought into contact in the presence of an additional ligand, such as HGF, which competes with binding of Malinov with the target. Such additional ligand may be a physiological ligand of c-Met, such as HGF, or any other non-physiological ligand of c-Met, such as anti-c-Met antibody, or small molecule inhibitor of protein-tyrosine kinase that binds at least overlapping or partially overlapping epitope with apico the Ohm, recognizable mottainai according to the invention, and thus prevents the binding of Malinov with the target. Alternatively, such additional ligand can compete with the binding of Malinov by forming a complex with the epitope distinct from the binding site of Malinov with c-Met, through allosteric effects.

The embodiment of the method of phage display (reviewed in Kay, B, K. et al. (1996), above; Lowman, N. C. (1997) above or Rodi, D, J., and Makowski, L. (1999), above) with the use of temperate phage M13 is given as an example of the method of selection, which can be used in the present invention. Another embodiment of the method of phage display, which can be used for breeding Malinov according to the invention (see experimental section), is hyperphagia phage method, which is described Broders et al. (Broders et al. (2003) "Hyperphage. Improving antibody presentation in phage display." Methods MoL Biol. 205: 295 to 302). You can also use other temperate phage, such as f1 or lytic phage, such as T7. For a typical method of selection produce family M13, allowing the expression of the mutated lipocalin nukleinovokisly sequence in the form of a fused protein with a signal sequence at the N-end, preferably the signal sequence, OmpA, and capsid protein pill phage M13 or its fragments, can be included in the AC is led phage-end. C-terminal fragment ΔpIII phage capsid protein, containing amino acids 217-406 sequence of the wild type, is preferably used for the production of fused proteins. Particularly preferred in one embodiment is a C-terminal fragment of pIII in which the cysteine residue at position 201 is missing or replaced by another amino acid.

Thus, another embodiment of the methods according to the invention includes a functional fusion nucleic acid that encodes a set of Malinov of lipocalin tear fluid of man and the resulting mutagenesis at the 3'end of the genome coding for the envelope protein pill filament of the bacteriophage M13 family or a fragment of this protein shell, to select at least one mutein to bind c-Met.

Protein may contain additional components, such as a marker affinity, which makes possible the immobilization, detection and/or purification of fused protein or parts thereof. In addition, a stop codon may be inserted between the regions of the sequence that encodes lipocalin or mutiny, and the genome of phage capsid or its fragments, where a stop codon, preferably an amber stop codon, at least partially translated into the amino acid during translation in a suitable suppressor strain.

For example, Pismenny vector pTLPC2, currently, also known as PT1 on 27, which is described in international patent application PCT/EP 2007/057971, can be used to obtain fahmideh libraries, coding mutiny of lipocalin lacrimal fluid of humans. The nucleic acid molecule of the invention encoding mutiny of lipocalin tear fluid can be inserted into the vector using two BstXI restriction enzymes cut sites. After stitching suitable host strain, such as E. coli XLI-Blue, transform the mixture of nucleic acids to produce a large number of independent clones. If desired, can be obtained the corresponding vector to obtain HyperTerminal library. Alternatively, any other suitable formigny vector, such as, for example, the vector pTLPC59, which is used in the Examples of this application (see Example 1 and Figure 1), can also be used to obtain fahmideh library. Vector pTLPC59 identical to the vector pTLc27 except that gene library construction for phage display is placed under the control of the lac p/o instead of tet p/o and genetically merge in a full-sized gene III phage VCSM13.

The resulting library can then be superinfection in liquid culture appropriate M13 helper phage or hyperfilm for producing functional fahmid. Recombinant fahmida exhibits lipoma the new mutein on its surface in the form of a fused protein with the membrane protein pIII or its fragment, while the N-terminal signal sequence fused protein is normally cleaved. At the same time, it also carries one or more copies of the native capsid protein pill shipped helper phage, and thus capable of infecting a recipient in the General case of a bacterial strain carrying an F or F'-plasmid. If hyperregular display hyperfinite exhibit lipocalin mutiny on its surface in the form of a fused protein with infective envelope protein pIII, but not native capsid protein. During or after infection with helper phage or hyperphagia can induce the expression of a gene fused protein between lipocalin muteena and capsid protein pIII, for example by adding anhydrotetracycline. The indexing terms are chosen so that a significant fraction obtained fahmid exhibited at least one lipocalin mutein on its surface. If hyperregular display conditions induce lead to population hyperthermic carrying from three to five fused protein consisting of lipocalin mutein and capsid protein pIII. There are various ways to highlight fahmid, such as precipitation with polyethylene glycol. The selection usually occurs after an incubation period of 6-8 hours.

Selected phasmida then can be subjected to selection by incubation Culatello target (i.e. the extracellular domain of c-Met or parts or fragments), where the target is presented in a manner that provides at least a temporary immobilization those famed that are mutiny with desired binding activity in the form of a fused protein on the membrane. Among various embodiments, well-known specialist in the art, the target can, for example, konjugierte with protein carrier, such as serum albumin, and link through such a protein carrier with a surface, a binding protein, such as polystyrene. For such immobilization of the target can preferably be used microtiter plates, suitable for methods ELISA (enzyme-linked immunosorbent assay), or the so-called "immunoadhesin". Alternative you can use the conjugates of the target with other linking groups such as Biotin. Then the target can be mobilitat on the surface, which selectively binds this group, such as microtiter tablets or paramagnetic particles coated with streptavidin, neutravidin or Avidya. If the target is fused with the Fc region of immunoglobulin, the immobilization can also be carried out on surfaces, such as microtiter tablets or paramagnetic particles coated with protein a or protein G.

Nonspecific fahmid-binding sites present on the surface may be saturated blocks of the respective solutions, known methods for ELISA. Usually then fahmida lead in contact with the target immobilized on the surface in the presence of physiological buffer. Unbound family removed by repeated washings. Famiglie particles remaining on the surface, then elute. For elution in several different ways. For example, family can be eluted by adding proteases or in the presence of acids, bases, detergents or chaotropic salts or moderately denaturing conditions. The preferred method is elution using buffers with a pH of 2.2, where the eluate is then neutralized. Alternatively, you can add the solution is free of the target (i.e. the extracellular domain of c-Met or part thereof, or fragments) in order to compete with the immobilized target for binding to phasmidae, or target-specific family can be eluted by competition with immunoglobulins or natural ligand proteins that are specifically associated with the chosen target.

Then cells E. coli infect lirovannye phasmidae. Alternatively, nucleic acids can be extracted from buervenich famed and used for sequence analysis, amplification or transformation of cells in a different way. Since the E. coli clones obtained in this way, fresh family or hiperf the foreign ministries again get through superantisypware the phage-helpers M13 or hyperframe according to the method, described above, and family, amplificatoare thus, again subjected to selection on immobilized target. Multiple cycles of selection are often necessary to obtain fahmid with mottainai according to the invention in a sufficiently enriched form. The number of cycles of selection is preferably chosen so that in the subsequent functional analysis of at least 0.1% of the investigated clones were produced mutiny with detectable affinity for the target. Depending on the size, i.e. the complexity of the library used, this will typically require 2 to 8 cycles.

For functional analysis of selected Malinov strain of E. coli can then infect permitame obtained in cycles of selection, and to select the appropriate double-strand fastenau DNA. Since this fastenau DNA, or with single-stranded DNA extracted from fahmid, the nucleic acid sequences selected Malinov according to the invention can be determined by methods known in the art, and based on this you can install the amino acid sequence. The mutated region or the whole sequence mutein of lipocalin tear fluid can be subclinical on another expression vector and Express in a suitable organism, the host. For example, the vector PT1 s described in international patent the th application PCT/EP 2007/057971, can be used for expression in E. coli strains such as E. coli TGI. Thus produced mutiny of lipocalin tear fluid can be cleaned various biochemical methods. Mutiny of lipocalin tear fluid produced, for example, PT1 s, are affine peptide Strep-tag® II (Schmidt et al., above) at its C-end and, therefore, can preferably be purified by streptavidin affinity chromatography.

The selection can be performed in other ways. Many of the relevant embodiments known to the specialist in the art or described in the literature. In addition, you can use a combination of methods. For example, clones, electrovanne or at least enriched by "phage display", can optionally be subjected to a "screening of colonies. The advantage of this method is that individual clones can be directly selected with the view of mutein of lipocalin tear fluid with detectable binding ability against c-Met or, for example, the extracellular domain of c-Met.

In addition to using E. coli as the host body for the "phage display" or in the "screening colonies", for this purpose you can use other bacterial strains, yeast or insect cells or mammalian cells. In addition to breeding mutein pakalin tear fluid from a random (not previously exposed to) libraries, as described above, it is also possible to use evolutionary methods, including limited mutagenesis, for optimization mutein, which already has some binding activity against the target, taking into account the affinity or specificity against the target after repeated cycles of screening.

When selected mutein with affinity to c-Met or a domain or fragment, such mutein can be further subjected to another mutagenesis to select options with even higher affinity variants with improved properties, such as higher thermal stability, improved serum stability, thermodynamic stability, improved solubility, improved properties of the monomer, improved stability against thermal denaturation, chemical denaturation, proteolysis or detergents, and so on. Such additional mutagenesis, which in the case of seeking a higher affinity can be considered as "affinity maturation in vitro, can be achieved by site-specific mutations, based on rational design, or random mutations. Another possible approach to obtaining higher affinity or improved properties is the use of error-prone PCR, which leads to point mutations in the selected interval of the provisions is posledovatelnosti lipocalin mutein. Error-prone PCR can be performed according to any known Protocol such as the Protocol described in Zaccolo et al. (1996) J. MoL Biol. 255, 589-603. Other methods of random mutagenesis, suitable for such purposes include random mutagenesis insertion/deletion (RID), as described in Murakami, H et al. (2002) Nat.Biotechnol. 20, 76-81 or non-homologous random recombination (NRR), as described in Bittker, J. A et al. (2002) Nat. Biotechnol. 20, 1024-1029. If desired, the affinity maturation can also be carried out by the method described in WO 00/75308 or Schlehuber, S. et al., (2000) J. Mol. Biol. 297, 1105-1120, where he received mutiny bilin-binding protein with high affinity to digoxigenin. Another approach to improve the affinity is performing positional saturating mutagenesis. In this approach can be created "small" library of nucleic acids in which the amino acid substitutions/mutations introduced only in a single position within any of the four segments of the loops defined here (see Example 21). Such libraries then directly subjected to the stage of selection (screening affinity) without additional cycles of panning. This approach allows us to identify residues that contribute to improved binding aspirational targets, and identify "hot spots", which are important for binding. This approach is possible, voltage is emer, identification of key residues in the first two segments (position sequence 24-36 or 56-58).

In another aspect of the present invention is directed to mutein of lipocalin lacrimal fluid of humans with detectable binding ability of c-Met or a domain, or part of it, which you can get or get detailed above methods according to the invention.

In one embodiment mutein of lipocalin tear fluid of a person obtained according to the above methods, includes replacing at least one or two cysteine residues found in each of the positions 61 and 153 of the sequences, to another amino acid and the mutation of at least one amino acid residue in any of the provisions of the sequence 26-34, 56-58, 80, 83, 104-106 and 108 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans. Provisions 24-36 included in loop AB, provisions 53-66 included in loop CD, provisions 69-77 included in loop EF and provisions pp. 103 -- 110 included in the GH loop in the binding site on the open end of the β-helical structure of lipocalin tear fluid. The definition of these four loops used in this description of the invention in accordance with a Flower (Flower, D.R. (1996), above, and Flower, D.R. et al. (2000), above). Usually such mutein contains at least 2, 3, 4, 5, 6, 8, 10, 12, 14, 15, 16, 17 or 18 Materov is the R amino acid residue in the provisions of the sequence 26-34, 56-58, 80, 83, 104-106 and 108 of the linear polypeptide sequence of Mature lipocalin lacrimal fluid of humans. In a particular embodiment mutein contains amino acid substitutions Cys 61→Ala, Phe, Lys, Arg, Thr, Asn, Tyr, Met, Ser, Pro, or Trp and Cys 153→Ser or Ala. It was shown that this substitution is useful to prevent the formation of naturally occurring disulfide bridge linking Cys 61 and Cys 153 and, thus, to facilitate processing mutein.

In yet another embodiment mutein contains at least one additional amino acid substitution selected from Arg 111→Pro and Lys 114→Trp. Mutein according to the invention can optionally contain a cysteine at position 101 sequence of native Mature lipocalin lacrimal fluid of humans, has been replaced with another amino acid. This replacement may represent, for example, mutation of Cys 101→Ser or Cys 101→Thr.

Lipocalin mutiny according to the invention may contain (natural) amino acid sequence of wild-type outside mutated provisions amino acid sequence. On the other hand, lipocalin mutiny disclosed in this description of the invention, can also contain amino acid mutations outside of the provisions of the sequence, subjected to mutagenesis, while these mutations do not interfere with binding activity and folding mutein. Such mutations can be very easy to implement on the level of DNA, using standard methods (Sambrook, J. et al. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY). Possible replacement of the amino acid sequence represent insertions or deletions and amino acid substitutions. Such substitutions may be conservative, that is, the amino acid residue is replaced with a chemically similar amino acid residue. Examples of conservative substitutions are the replacements among the members of the following groups: 1) alanine, serine and threonine; 2) aspartic acid and glutamic acid; 3) asparagine and glutamine; 4) arginine and lysine; 5) isoleucine, leucine, methionine and valine; and 6) phenylalanine, tyrosine and tryptophan. On the other hand, you can also enter non-conservative changes in amino acid sequence. In addition, instead of replacing a single amino acid residues, it is also possible either to insert or remove one or more consecutive amino acids of the primary structure of lipocalin tear fluid until such deletions or insertions leading to stably stacked/functional mutein (see, for example, experimental section, which receive mutiny with short N - and C-end).

Such modifications of the amino acid sequences include directed mutagenesis of individual amino acid positions to facilitate sublimirovanny mytrofanov the gene of lipocalin or its parts by the introduction of cleavage sites for certain restriction enzymes. In addition, these mutations can also be included to further improve the affinity lipocalin mutein to this target. In addition, mutations can be introduced to modulate some characteristics mutein, for example, to improve stability, folding, RNA stability, protein stability or solubility in water or, if necessary, to reduce the tendency to aggregation. For example, naturally occurring cysteine residues can be motivovany in other amino acids to prevent formation of a disulfide bridge. However, it is also possible to deliberately mutate another position of the amino acid sequence of the cysteine to enter new reactive groups, such as conjugation with other compounds such as polyethylene glycol (PEG), hydroxyethyloxy starch (HES), Biotin, peptides or proteins, or for education is not occurring disulfide bonds. Typical features of such mutations to enter cysteine residue in the amino acid sequence mutein of lipocalin tear fluid of an individual include the replacement of Thr 40→Cys, Glu 73→Cys, Arg 90→Cys, Asp 95→Cys, Lys 121→Cys, Asn 123→Cys and Glu 131→Cys. Received Tilney group next to any of amino acid positions 40, 73, 90, 95, 121, 123 and/or 131 can be used to PEG or HES mutein, for example, for an increase the value of the half-life of the corresponding mutein of lipocalin lacrimal fluid from the serum. Mutein S244.2-H08, in which the cysteine introduced in any of these provisions of the sequence (see Example 9), is an illustrative example of such Malinov according to the invention. A side chain of any of cysteine residues, of course, can be used not only for conjugation with compounds that increase the half-life of the serum, but also for the conjugation of any required partner for conjugation, such as an organic molecule, an enzyme label, a toxin, a cytostatic agent, pharmaceutically suitable radioactiva label, fluorescent label, a chromogenic label, a fluorescent label, a hapten, digoxigenin, Biotin, complex metal, or colloidal gold, to name only a few illustrative examples. The conjugation can be performed using any conventional method combinations known in the art (see, for example, Example 18, where the cysteine residue can be activated with a reagent such as Tris[2-carboxyethyl]phosphine (TSER) or dithiothreitol (DTT), and then further interacts with a reagent such as 3-N-maleimido-6-hydrazinopyridazine hydrochloride (HYNIC).

The present invention also includes a shortened mutiny (i.e. fragments), as defined above, in which, for example, the first four N-terminal amino acid residue sequence of the Mature lipoma is in the tear fluid of a person (His-His-Leu-Leu; positions 1-4) and/or the last two C-terminal amino acid residue (Ser-Asp; position 157-158) sequence of Mature lipocalin tear fluid of a person have been removed (see also the Examples and the attached sequence listing).

Lipocalin mutiny according to the invention is capable of contact with the desired target, i.e. the c-Met receptor receptor, or a domain or fragment, with detectable affinity, i.e. the dissociation constant of at least 200 nm. Currently, in some preferred embodiments are lipocalin mutiny that are associated with the desired target with a dissociation constant for the target of at least 100, 20, 1 nm or even less. The binding affinity of mutein with the desired target can be measured by many methods, such as fluorescence titration, competitive ELISA or surface plasma resonance (BIAcore).

Specialist it is obvious that the formation of the complex depends on many factors, such as the concentration of the binding partners, the presence of competitors, the ionic strength of the buffer system and so on. Selection and enrichment typically perform in conditions that ensure the allocation of lipocalin of Malinov, having, in combination with the desired target (c-Met or a domain or fragment), the constant of dissociative least 200 nm. However, the stage of washing and elution can be performed with variable stiffness. It is also possible selection taking into account kinetic characteristics. For example, selection can be performed under conditions that contribute to the complexation of the target with mottainai that demonstrate slow dissociation from the target, or, in other words, a low value of koff. Alternatively, selection can be performed under conditions that promote rapid complexation mutein with the target or, in other words, the high value of kon. As an additional illustrative alternatives, the screening can be performed under conditions that select for improved thermostability of Malinov (compared with either lipocalin wild-type lacrimal fluid or muteena, who already has an affinity to pre-selected targets), or pH-stability mutein.

Mutein of lipocalin tear fluid in the invention usually exists as a Monomeric protein. However, it is also possible that lipocalin mutein according to the invention is capable of spontaneous timeresults or to form higher oligomers. Although the use lipocalin of Malinov, which forms a stable monomers may be preferred for some applications, for example due to the faster diffusion and better penetration into the fabric, druginduced may be advantageous to use lipocalin of Malinov, which spontaneously form stable homodimer or multimer as such multimer can provide (optional) increased affinity and/or avidity for the target. In addition, oligomeric forms lipocalin mutein may have a slower rate of dissociation or prolonged half-life in serum. If desired dimerization or multimerization of Malinov to the formation of stable monomers can, for example, be achieved by merging the relevant oligomerization domains, such as domains of jun-fos or "lacinova clasp, with mottainai according to the invention or using "baklinov" (also see below).

Mutein of lipocalin tear fluid according to the invention can be used for the formation of a complex with c-Met or a domain or fragment, for example, in vitro diagnostic purposes, ex vivo or in vivo therapeutic purposes.

In General, the term "fragment" when used in this description of the invention in relation to c-Met, refers to a protein or peptide ligands, shortened at the N-end and/or the end, which retain the ability full-ligand recognized and/or contact muteena according to the invention. The term "domain" in relation to c-Met should be understood in accordance with the usual value used in the art. Example is, the term "domain" includes the Sema domains that are structurally defined in Stamos et al., The EMBO Journal, Vol.23, str-2335, 2004 (see for example, Figa or 4 in Stamos et al.), the domain of the PSI, the IgG-like domains, a transmembrane domain or the domain of the tyrosine kinase that is structurally defined in Schiering et al., Proc. Natl. Acad. Sci USA, Vol.100, No. 22, str-12659, 2003). The term "domain" also includes the entire extracellular site of c-Met, formed by residues from Met 1 to Thr 932 full-receptor protein or truncated fragments formed, for example, residues 2, 3, 4, 5, 6 to residues 920, 925, 930 or 931 full-length receptor. As noted above, by using, for example, the entire extracellular domains, or only some of the extracellular domains, such as domains Sema, you can get either mutiny that are associated with HGF-binding site (and in this case, you may have antagonistic mode of binding against HGF), or also mutiny, which have a non-adversarial mode of binding relative to the binding of HGF.

In this context it should also be noted that the complexation between the relevant muteena and c-Met or a domain or fragment is influenced by many different factors, such as concentration of the respective partners on binding, the presence of competitors, pH and ionic strength used buffer systems and experimental method used to determine the dissociation constants KD(for example, fluorescence titration, competitive ELISA or, for example, surface plasma resonance) or even mathematical algorithm used to evaluate experimental data.

Thus, the specialist is also clear that the values of KD(the dissociation constant of the complex formed by the corresponding muteena and its ligands)that are listed in this work may vary within some experimental range depending on the method and the experimental setup used to determine the affinity of specific lipocalin mutein to this ligand. This means that there can be a slight deviation of the measured values of KDor the permissible ranges, depending on, for example, the determined value of KDusing surface plasma resonance (Biacore) or competitive ELISA.

In a particular embodiment of the invention mutein of lipocalin tear fluid contains relative to the amino acid sequence of Mature lipocalin tear fluid of a person at least 6, 8, 10, 12, 14, 16 or 17 amino acid substitutions relative to the amino acid sequence of Mature lipocalin lacrimal fluid of humans, which is selected from the group consisting of Arg 26→Thr, Val, Pro, Ser,and Gly; Glu 27→Gln, Gly, Val, Ser; Phe 28→Met, Asp; Pro 29→Leu, lie, Ala, Trp; Glu 30→Leu, Gly, Arg, Phe; Met 31→Ser; Asn 32→Leu, Arg, Val, Gin; Leu 33→Tyr3Val, lie, Thr, Phe; Glu 34→Val, Arg, Ala; Leu 56→Asn; lie 57→Gln; Ser 58→Ile, Val; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly.

In one more specific embodiment mutein according to the invention additionally contains at least one amino acid substitution selected from the group consisting of Thr 37→Ser; the Met 39→Ile, Leu; Asn 48→Ser; Lys 52→Thr, Met; Met 55→Leu; Lys 65-^Arg, Leu; Ala 79→Leu, Ser; Ala 86→Thr and Iie 89→Ser, Gin, Thr, His.

In another more specific embodiment mutein contains amino acid substitutions: Arg 26→Thr; Glu 27→Gln; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34ϕ→Val; Leu 56→Asn; lie 57→Gln; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Tip and Lys 108→Gly.

In another more specific embodiment of the invention mutein according to the invention contains amino acid substitutions: Met 31→Ser; Leu 56→Asn; lie 57→Gln; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly.

In other embodiments mutein according to the invention can contain one of the following sets of amino acid substitutions:

(1) Arg 26→Thr; Glu 27→Gln; Phe 28→Met; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; lie 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly;

(2) Arg 26→Thr; Glu 27→Gln; Phe 28→Asp; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; Iie 57→Gln; Ser 58→Val; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly;

(3) Arg 26→Thr; Glu 27→Gln; Phe 28→Asp; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; lie 57→Gln; er 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly;

(4) Arg 26→Val; Glu 27→Gly; Phe 28→Asp; Pro 29→Leu; Glu 30→Gly; Met 31-rSer; Asn 32→Arg; Leu 33→Val; Glu 34→Val; Leu 56→Asn; lie 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly;

(5) Arg 26→Pro; Glu 27→Gly; Phe 28→Asp; Pro 29→Ile; Glu 30→Arg; Met 31→Ser; Asn 32→Leu; Leu 33→Ile; Glu 34→Val; Leu 56→Asn; lie 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly;

(6) Arg 26→Ser; Phe 28→Asp; Pro 29→Ala; Glu 30→Phe; Met 31→Ser; Asn 32→Val; Leu 33→Thr; Glu 34→Val; Leu 56→Asn; lie 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly;

(7) Arg 26→Val; Glu 27→Val; Phe 28→Asp; Pro 29→Trp; Glu 30→Arg; Met 31→Ser; Asn 32→Gln; Leu 33→Val; Glu 34→Arg; Leu 56→Asn; lie 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly and

(8) Arg 26→Gly; Glu 27→Ser; Phe 28→Asp; Pro 29→Trp; Met 31→Ser; Asn 32→Val; Leu 33→Phe; Glu 34→Ala; Leu 56→Asn; lie 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu l04→Asp; Leu 105→Thr; His 106→Trp and Lys 108→Gly.

Mutein of lipocalin lacrimal fluid of humans, binding of c-Met or a domain or fragment can contain, essentially consist of or consist of any of the amino acid sequence represented in any of SEQ ID NO: 1, SEQ ID NO: 4-9, SEQ ID NO: 22-26 or SEQ ID NO: 32-35 and 37-49, or its fragment, or variant. In one embodiment mutein according to the invention contains, essentially consists of or consists of the amino acid sequence represented in SEQ ID NO: 1, 4, 5, 6, 7, 8, 9, 22-26, 32-35 or 42-49, or its fragment, or variant. It should be noted, is all mutiny, disclosed in this description of the invention, can be linked or N-or C-end with affine marker, such as interestignly marker, exegetically label or Streptag® (see, for example, SEQ ID N0: 37-41, where exegetically label merged with the end of Malinov). Thus, the present application also includes everything in detail and in General described mutiny provided by those labels.

The term "fragment" when used in the present invention in relation to muteena the invention relates to proteins or peptides produced from a full-sized Mature lipocalin lacrimal fluid of humans, which is shortened at the N-end and/or the end, that is lacking at least one N-terminal and/or C-terminal amino acid. Such fragments preferably contain at least 10, more preferably 20, most preferably 30 or more consecutive amino acids of the primary sequence of Mature lipocalin lacrimal fluid of humans and are usually detected in the immunoassay Mature lipocalin lacrimal fluid of humans.

The term "variant" when used in the present invention refers to a derivative of a protein or peptide, which contain modifications of the amino acid sequence, such as a substitution, a deletion, insertion or chemical modification. Preferably acientific not reduce the functionality of the protein or peptide. Such variants include proteins, where one or more than one amino acid has been substituted by the corresponding D-stereoisomers or amino acids, non-naturally occurring 20 amino acids, such as, for example, ornithine, hydroxyproline, citrulline, homoserine, hydroxylysine, Norvaline. However, such substitutions can be conservative, that is, the amino acid residue is replaced with a chemically similar amino acid residue. Examples of conservative substitutions are the replacements among the members of the following groups: 1) alanine, serine and threonine; 2) aspartic acid and glutamic acid; 3) asparagine and glutamine; 4) arginine and lysine; 5) isoleucine, leucine, methionine and valine; and b) phenylalanine, tyrosine and tryptophan.

In this context it should be noted that mutiny according to the invention, has been found stable in a large range of pH from about pH 2.5 to about pH to 9.5, for example in the range of pH from about pH 3.0 to about pH of 9.2.

The above mutiny that have been modified with regard to their potential immunogenicity also included in the scope of the present invention.

Cytotoxic T cells recognize peptide antigens on the cell surface of antigen-presenting cells together with the molecules of the major histocompatibility complex (MHC) class I. the ability of the peptides to contact the MHC molecules and is the LEL-specific and correlates with immunogenicity. To reduce the immunogenicity of this protein is a great value, the ability to predict which peptides in the protein have the ability to bind to a specific MHC molecule. Approaches that use the approach of computer processing to identify potential T-cell epitopes, was previously described to predict the binding of a given peptide sequence with molecules MHC class 1 (Altuvia et al. (1995) J. Mol. Biol. 249: 244-250).

This approach can also be used to identify potential T-cell epitopes in muteing according to the invention and to implement depending on its intended use select a specific mutein on the basis of its predicted immunogenicity. You can also expose the region of the peptide, which is forecast to contain T-cell epitopes, additional mutagenesis to reduce or exclude such T-cell epitopes and thus minimizing immunogenicity. Remove amphipatic epitopes from genetically engineered antibody described (Mateo et al. (2000) Hybridoma 19(6); 463-471), and can be adapted to muteena of the present invention.

Mutiny, thus obtained, may have minimized immunogenicity, which is desirable for use in therapy and diagnosis, as described below.

DL is, in some applications it is also useful to use mutiny according to the invention in conjugated form. Accordingly, the invention is also directed to lipocalin mutiny that are conjugated to a partner conjugation, which can be selected from the group consisting of enzyme labels, colored labels, a cytostatic agent, a label, which can be photoactivated and which is suitable for use in photodynamic therapy, haptens, digoxigenin, Biotin, chemotherapeutic metal or chemotherapeutic metal and colloidal gold. Mutein can also be anywhereman organic molecule drugs. The term "organic molecule" as used in this description of the invention preferably means an organic molecule containing at least two carbon atoms, but preferably not more than 7 or 12 rotating carbon bonds, having a molecular weight in the range from 100-2000 Da, preferably 100-1000 Yes, and possibly containing one or two atoms of metal.

In General, you can mark mutein of lipocalin tear fluid described in this description of the invention, using any suitable chemical or enzyme that directly or indirectly generate a detectable compound or a signal in the chemical, physical, optical or enzymatic reaction. An example of a physical reaction and at the same time the optical reactionary is the emission of fluorescence when irradiated. Alkaline phosphatase, horseradish peroxidase or β-galactosidase are examples of enzymatic labels (and at the same time, optical labels), that catalyze the formation of a chromogenic reaction products. In the General case, all labels that are commonly used for antibody (excluding used exclusively with the sugar group in the Fc region of immunoglobulins), can also be used for conjugation with mottainai of the present invention. Mutiny according to the invention can also be conjugated with any suitable therapeutically active agent, such as for targeting the delivery of such agents to a specific cell, tissue or organ or for the selective targeting of cells, for example tumor cells, without affecting the surrounding normal cells. Examples of such therapeutically active agents include radionuclides, toxins, small organic molecules and therapeutic peptides such as peptides, acting as agonists/antagonists of receptors on the cell surface, or peptides that compete for protein-binding site on this cellular targets). Examples of suitable toxins include, without limiting them, pertussis toxin, diphtheria toxin, ricin, saporin, pseudomonades exotoxin, calicheamicin or its derivative, taxoid, maytansinoid, tubulysin or similar dolastatin. Analogousto can be auristatin E, monomethylaniline E, auristatin PYE and auristatin RNU. Examples of cytostatic agent include, without limiting them, cisplatin, carboplatin, oxaliplatin, 5-starwriter, Taxotere (docetaxel), paclitaxel, anthracycline (doxorubicin), methotrexate, vinblastine, vincristine, vindesine, vinorelbine, dacarbazine, cyclophosphamide, etoposide, adriamycin, camptothecin, connection related combretastatin a-4, sulfonamides, oxadiazoline, benzo[b]tiophene, synthetic spirochetal Pirani, monocotyledoneae connection, korazin and derivatives Kuracina, derivatives methoxyestradiol and leucovorin. Lipocalin mutiny according to the invention can also be conjugated to a therapeutically active nucleic acids, such as antisense molecules, nucleic acids, small interfering RNA, micro-RNA or ribozymes. Such conjugates can be obtained by methods well known in the art.

In one embodiment mutiny according to the invention can also be combined with a targeted group that focuses on a specific area of the body with the aim of delivering Malinov according to the invention to the desired area or the area within the body. One example where such modification may be desirable, is overcoming the blood-brain barrier. To overcome hematoencephalic the definition of barrier mutiny according to the invention can be connected with groups to facilitate active transport across this barrier (see Gaillard PJ, et al. Reagent grade-toxin receptor-targeted brain drug delivery. International Congress Series. 2005 1277; 185-198 or Gaillard P J, et al. Targeted delivery across the blood-brain barrier. Expert Opin Drug Deliv. 2005 2(2): 299-309. Such groups are, for example, available under the trademark 2B-Trans™ (BBB technologies BV5Leiden, NL).

As stated above, mutein according to the invention in some embodiments may be anywhereman with grouping, which prolongs the half-life mutein of serum (in this connection see also international patent application PCT/ER/057971 or also PCT publication WO 2006/56464, where such conjugation strategy described with reference to mutiny of lipocalin person connected with neutrophile gelatinases, and the binding ability against CTLA-4 (cytotoxic T-lymphocyte-associated antigen 4)). The group, which increases the half-life of the serum, can be a molecule polyalkyleneglycol, hydroxyethyloxy the starch molecules of fatty acids such as palmitic acid (Vajo & Duckworth 2000, Pharmacol Rev. 52, 1-9), Fc-region immunoglobulin domain snz immunoglobulin, a CH4 domain of an immunoglobulin, albumin, or fragment, the albumin-binding peptide, albumin-binding protein, IgG Fc-binding protein or transferrin (named only some). The albumin-binding protein may represent the manage a bacterial albumin-binding protein, the antibody, antibody fragment, including domain antibodies (see, for example, patent US 6696245), lipocalin mutein or other protein or domain of the protein and the binding activity against albumin. Thus, suitable partners for conjugation to extend the half-life lipocalin mutein according to the invention include albumin (Osborn, .L. et al. (2002) Pharmacokinetic and pharmacodynamic studies of a human serum albumin-interferon-alpha fusion protein in cynomolgus monkeys J. Pharmacol. The Exp Ther, 303, 540-548), or albumin-binding protein, for example a bacterial albumin-binding domain, such as the domain of streptococcal protein G (Konig, T. and Skerra, A. (1998). Use of an albumin-binding domain for the selective immobilisation of recombinant capture antibody fragments on ELISA plates. J. Immunol. Methods 218, 73-83). Other examples of the albumin-binding peptides that can be used as a conjugation partner, represents, for example, peptides with Cys-Xaa1-Xaa2-Xaa3-Xaa4-Cys consensus sequence, where Xaa1represents Asp, Asn, Ser, Thr or Trp; Xaa2represents Asn, Gin, His, lie, Leu, or Lys; Haas represents Ala, Asp, Phe, Trp or Taut; and Xaa4represents Asp, Gly, Leu, Phe, Ser or Thr, as described in patent application U.S. 2003/0069395 or Dennis et al. (Dennis, M. S., Zhang, M., Meng, Y. G., Kadkhodayan, M., Kirchhofer D, Combs, D. & Damico, L. A. (2002). "Albumin binding as a general strategy for improving the pharmacokinetics of proteins". J Biol Chem 277, 35035-35043).

In other embodiments himself al the IOR techniques or a biologically active fragment of albumin can be used as a conjugation partner for lipocalin mutein according to the invention. The term "albumin" includes all mammalian albumins, such as serum albumin human, or bovine serum albumin, or albumin in rats. The albumin or the fragment can produce recombinante, as described in patent US 5728553 or European patent applications EP 0330451 and EP 0361991. Recombinant human albumin (Recombumin®) Novozymes Delta Ltd. (Nottingham, UK) can be anywhereman or merged with lipocalin muteena to prolong the half-life period mutein.

If the albumin-binding protein is a fragment of the antibody, it may be a domain antibody. Domain antibodies (dAbs) provide for accurate control of biophysical properties and half-life in vivo, to create an optimal safety profile and effectiveness of the product. Domain antibodies, for example, are commercially available in Domantis Ltd. (Cambridge, UK and MA, USA).

Using transferrin as a group to increase the half-life of Malinov according to the invention from the serum, mutiny can genetically be merged with the N - or C-end, or both, neglikolizirovannaya transferrin. Neglikolizirovanny transferrin has a half-life period of 14-17 days, and transferrin, fused protein, the same will have an increased half-life. Atransferrinemia media also provides a high b is dostupnost, the biodistribution and stability in the circulation. This technology is available commercially from BioRexis (BioRexis Pharmaceutical Corporation, PA, USA). Recombinant human transferrin (DeltaFerrin™) for use as a protein stabilizer/partner, increasing the half-life, also commercially available from Novozymes Delta Ltd. (Nottingham, UK).

If the Fc-region of an immunoglobulin is used for prolonging the half-life of Malinov according to the invention from the serum, you can use the method SynFusion™, commercially available from Syntonix Pharmaceuticals, Inc. (MA, USA). Using this method, Fc-fusion enables the creation of long-term biopharmaceutical means and may, for example, consist of two copies mutein connected to the Fc-region of an antibody to improve pharmokinetic, solubility and efficiency gain.

Another alternative for prolonging the half-life period mutein according to the invention is a fusion with the N - or C-end mutein according to the invention are long, flat, flexible glycine-rich sequences (for example, polyglycine from about 20-80 consecutive glycine residues). This approach, disclosed in WO 2007/038619, for example, was also named "rPEG" (recombinant PEG).

If the partner conjugation using polyalkyleneglycol, this polyalkyleneglycol can be substituted, unsubstituted linear or branched. It may also be an activated polyalkylene derivative. Examples of suitable compounds are molecules of polyethylene glycol (PEG), as described in WO 99/64016, in patent US 6177074 or patent US 6403564 against interferon, or as described for other proteins, such as PEG-modified asparaginase, PEG-adenosylmethionine (PEG-ADA) or PEG-superoxide dismutase (see, for example, Fuertges et al. (1990) The Clinical Efficacy of Poly(Ethylene Glycol)-Modified Proteins J. Control. Release 11, 139-148). The molecular weight of such polymer, preferably polyethylene glycol, can izmenyatsya about 300 to about 70000 Yes, including, for example, polyethylene glycol with a molecular weight of about 10,000, about 20,000, about or approximately 30000 40000 Yes. In addition, as described in patents US 6500930 or 6620413, carbohydrate, oligo - and polymers, such as starch or hydroxyethyloxy starch (HES), you can konjugierte with muteena according to the invention to increase the half-life of serum.

If one of the above groups conjugated with muteena of lipocalin lacrimal fluid of humans according to the invention may be useful for conjugation with the side chain of amino acids. Suitable side chains of amino acids can occur in nature in the amino acid sequence of lipocalin tear fluid of a human or can be entered through mutah is illegal. When a suitable binding site introduced by mutagenesis, one possibility is the replacement of amino acids in a suitable position by a cysteine residue. In one embodiment of this mutation includes at least one of the substitutions of Thr 40→Cys, Glu 73→Cys, Arg 90→Cys, Asp 95→Cys, Lys 121→Cys, Asn 123→Cys or Glu 131→Cys. Newly formed cysteine residue in any of these positions can then be used for conjugation mutein with grouping, prolonging the half-life mutein of serum, such as PEG or its activated derivative.

In another embodiment for obtaining the appropriate side chains of amino acids for conjugation into one of the above groups with mottainai according to the invention by means of mutagenesis can introduce artificial amino acids. In General, these artificial amino acids construct more reactive, and thus facilitate conjugation with the desired grouping. One example of such a synthetic amino acids that can be entered using the artificial tRNA is para-acetyl-phenylalanine.

For some applications of Malinov disclosed in this description of the invention, it may be advantageous to use them in the form of a fused protein. In some embodiments mutein of lipocalin tear fluid of a person in accordance with the invention is drained via e what about M-end or From the end of the protein, domain protein or peptide, such as a signal sequence and/or affinity tag.

For pharmaceutical applications mutein according to the invention may be fused with a partner on the merger, which prolongs the half-life mutein of serum in vivo (see again the PCT publication WO 2006/56464, where suitable partner in the merger described with reference to mutiny neutrophilic, gelatinase-associated lipocalin the binding ability against CTLA-4). Like the conjugates described above, the merger partner can be a Fc-region of an immunoglobulin domain snz immunoglobulin, a CH4 domain of an immunoglobulin, albumin, albumin-binding peptide or albumin-binding protein, as an example. In addition, the albumin-binding protein may be a bacterial albumin-binding protein or lipocalin mutein with binding activity against albumin. Accordingly, suitable partners for mergers to increase the half-life lipocalin mutein according to the invention include albumin (Osborn, C. L. et A1. (2002) (above) J. Pharmacol. Exp.Ther. 303, 540-548), or albumin-binding protein, for example a bacterial albumin-binding domain, such as the domain of streptococcal protein G (Konig, T. and Skerra, A. (1998) above J. Immunol. Methods 218, 73-83). Albumin-binding peptides described in Dennis et al., above (200), or in the patent application U.S. 2003/0069395 with Cys-Xaa1-Xaa2-Xaa3-Xaa4-Cys consensus sequence, where Xaa1represents Asp, Asn, Ser, Thr or Trp; XAA2represents Asn, Gin, His, lie, Leu, or Lys; XAA3represents Ala, Asp, Phe, Trp or Tyr and XAA4represents Asp, Gly, Leu, Phe, Ser or Thr, can also be used as a partner to merge. You can also use the albumin or a biologically active fragment of albumin as a partner to merge lipocalin mutein according to the invention. The term "albumin" includes all the albumin of a mammal, such as serum albumin human, or bovine serum albumin, or serum albumin in rats. Recombinant production of albumin or fragments are well known in the art and described, for example, in U.S. patent 5728553, European patent application EP 0330451 or EP 0361991.

Partner in the merger may give new features localename mutein according to the invention, such as enzymatic activity or affinity for other molecules. Examples of suitable fused proteins are alkaline phosphatase, horseradish peroxidase, glutathione-6-transferase, albumin-svyazyvayuscyego protein G, protein a, fragments of antibodies, the oligomerization domains, lipocalin mutiny the same is whether different binding specificity (which leads to the formation of "Duocalins", see Schlehuber, S., and Skerra, A. (2001), Duocalins, engineered ligand-binding proteins with dual specificity derived from the lipocalin fold. In/about/. Chem. 382, 1335-1342) or toxins.

In particular, it may be possible merger lipocalin mutein according to the invention with a separate enzyme active site, so that both the "component" derived fused protein together affect this therapeutic target. Binding domain lipocalin mutein attached to the target, which causes the disease, allowing the domain of the enzyme to cancel the biological function of the target.

Markers affinity, such as Strep-tag® or Strep-tag® II (Schmidt, T.G.M. et al. (1996) J. Mol. In/about/. 255, 753-766), myc-tag, FLAG-tag, His6-tag or HA-tag or proteins, such as glutathione-8-transferase, also enable you to easily identify and/or purify recombinant proteins, are additional examples of preferred partners merger. Finally, proteins with chromogenic or fluorescent properties, such as green fluorescent protein (GFP) or yellow fluorescent protein (YFP), are also suitable partners to merge lipocalin mutein according to the invention.

The term "fused protein" when used in this description of the invention also includes lipocalin mutiny according to the invention, containing a signal sequence. The signal sequence at the N end of the polypeptide send this polypep the ID in the specific cell space, for example, periplasm E. coli or endoplasmic network of eukaryotic cells. A large number of signal sequences known in the art. A preferred signal sequence for secretion of the polypeptide in periplasm E. coli is a signal sequence QmpA.

The present invention also relates to molecules of nucleic acids (DNA and RNA)containing the nucleotide sequence encoding mutiny, as described in this description of the invention. Since the degeneration of the genetic code allows for the substitution of some other codons with codons that determine the same amino acid, the invention is not limited to specific nucleic acid molecule that encodes mutein according to the invention, but include all nucleic acid molecule containing a nucleotide sequence encoding a functional mutein.

Thus, the present invention also includes a nucleic acid sequence encoding mutein according to the invention, containing a mutation in at least one codon in any of the provisions of the amino acid sequence 26-34, 56-58, 80, 83, 104-106 and 108 of the linear polypeptide sequence of native Mature lipocalin lacrimal fluid of humans, where the codons encoding at least one of the cysteine residues in the state is x sequence 61 and 153 of the linear polypeptide sequence of Mature lipocalin tear fluid of a person subjected to mutation to encode any amino acid residue.

The invention disclosed in this description of the invention, also includes a nucleic acid molecule encoding mutiny of lipocalin tear fluid, which contain additional mutations outside the specified provisions of the sequence of experimental mutagenesis. Such mutations are often valid, or can even be advantageous, for example, if they contribute to improved efficiency of folding, serum stability, thermal stability, or the ligand-binding affinity mutein.

The nucleic acid molecule disclosed in this application may be "functionally connected" with the regulatory sequence (or regulatory sequences for expression of the nucleic acid molecule.

The molecule of nucleic acid, such as DNA, referred to as "able to Express a nucleic acid molecule" or able to "provide for expression of the nucleotide sequence if it contains elements of sequences that contain information related to the regulation of transcription and/or translation, and such sequences are "functionally linked" to nucleotide sequence that encodes a polypeptide. Online relationship is a relationship in which the elements of the regulatory sequence and the sequence is, be ekspressirovali, connected in a way that makes possible the expression of a gene.

The exact nature of the regulatory regions needed for gene expression may vary between species, but usually contain a promoter that in prokaryotes, contains both the promoter itself, that is, the DNA elements that guide the initiation of transcription, and DNA elements, which upon transcription into RNA will transmit the signal for initiation of translation. Such promoter region usually include 5'-non-coding sequences involved with initiation of transcription and translation, such as the-35/-10 boxes and the item Shine-Dalgarno in prokaryotes or the TATA box, the sequence SAAT and elements 5'-capping in eukaryotes. Such areas may also include enhancer or repressure elements, as well as broadcast signal and leader sequences for targeting native polypeptide to a specific compartment of the host cell.

In addition, the 3'non-coding sequence may contain regulatory elements involved in termination of transcription, polyadenylation, or the like. If, however, such termination sequences are not sufficiently functional in a specific cell host, they can be replaced with signals functional in this CL is TCE.

Thus, the nucleic acid molecule according to the invention may include a regulatory sequence, preferably a promoter sequence. In another preferred embodiment the nucleic acid molecule according to the invention contains a promoter sequence and a transcription termination sequence. Suitable prokaryotic promoters are, for example, the tet promoter, the promoter /acUV5 or the T7 promoter. Examples of promoters useful for expression in eukaryotic cells are the SV40 promoter or the CMV promoter.

Molecules of nucleic acids according to the invention can also be part of a vector or clone of any other media type, such as a plasmid, fahmida, phage, baculovirus, cosmid or artificial chromosome.

In one embodiment, the nucleic acid molecule is contained in phasmida. Fasmily vector means a vector coding intergenic area of temperate phage, such as M13 or f1, or its functional part, merged with cDNA of interest. After superantisypware bacterial host cells such fahmuddin vector and a suitable phage helper (for example MC, VCS-M13 or R408) produced the whole phage particles, and thus, the physical connection encodes a heterologous cDNA with its corresponding polypeptide, exp is nirvanam on the surface of phage (considered for example, in Kay, B. K. et al. (1996) Phage Display of Peptides and Proteins - A Laboratory Manual, 1st Ed., Academic Press, New York NY; Lowman, H. B. (1997) Annu. Rev. Biophys, Biomol. Struct. 26, 401-424, or Rodi, DJ, and Makowski, L. (1999) Curr. Opin. Biotechnol. 10, 87-93).

Such cloning media may include, in addition to the regulatory sequences described above and nucleic acid sequence that encodes lipocalin mutein according to the invention, the replication and control sequences derived from species compatible with the host-cell, which is used for expression, as well as breeding markers, giving breeding phenotype of transformed or transfitsirovannykh cells. In the art it is known and commercially available a large number of suitable cloning vectors.

The DNA molecule encoding lipocalin mutiny according to the invention, and, in particular, the cloning vector containing the coding sequence such lipocalin mutein, can be transformed into cell-host, able to Express the gene. The transformation can be performed using standard methods (Sambrook, J. et al. (1989), above). Thus, this invention also is directed to the cell host containing a nucleic acid molecule, as it is disclosed in this specification.

The transformed host cell is cultivated under conditions suitable for e is cpressey nucleotide sequence, encodes a protein according to the invention. Suitable host cells can be prokaryotic, such as Escherichia coli (E. coli or Bacillus subtilis, or eukaryotic, such as Saccharomyces cerevisiae, Pichia pastoris, insect cells SF9 or High5 immobilized mammalian cell lines (e.g., HeLa cells or cells Cho) or human embryonic mammalian cells.

The invention also relates to a method for mutein according to the invention, where mutein, fragment mutein or protein mutein and another polypeptide get, starting with a nucleic acid that encodes mutein, using genetic engineering methods. The method can be performed in vivo, mutein can be obtained, for example, in a bacterial or eukaryotic organism, the host, and then isolated from this organism the host or its culture. It is also possible to obtain the protein in vitro, for example using the translation system in vitro.

Upon receipt mutein in vivo nucleic acid encoding mutein according to the invention, introduced into a suitable bacterial or eukaryotic organism is the master of using recombinant DNA technology (as outlined above). With this purpose, the cell host, using standard methods (Sambrook, J. et al. (1989), above), first transform the cloning vector containing a nucleic acid molecule encoding mutein invented by the Y. Then the cell host is cultivated under conditions that allow expression of heterologous DNA and, thus, the synthesis of the corresponding polypeptide. Then polypeptide or ejected from the cells or from the medium for cultivation.

In some muteing of lipocalin tear fluid according to the invention is broken naturally occurring disulfide bonds between Cys 61 and Cys 153. Accordingly such mutiny (or any other mutein of lipocalin tear fluid that does not contain intramolecular disulfide bonds) can be obtained in a cellular compartment, with regenerating the redox environment, for example, in the cytoplasm of gram-negative bacteria. When lipocalin mutein according to the invention contains an intramolecular disulfide bond, can be preferably formed to direct the polypeptide into the cell compartment with oxidizing redox environment, using suitable signal sequences. Such oxidizing environment can be provided by periplasmic gram-negative bacteria, such as E. coli, in the extracellular environment of gram-positive bacteria or in the lumen of the endoplasmic reticulum of eukaryotic cells and usually promotes the formation of structural disulfide bonds. It is also possible, however, is to alocate mutein according to the invention in the cytosol of the host cell, preferably E. coli. In this case, the polypeptide can either directly be obtained in a soluble and folded or extract in the form of Taurus enable subsequent denaturaciei in vitro. Another option is the use of specific strains of the owners having an oxidizing intracellular environment, which can, thus, to ensure formation of disulfide bonds in the cytosol (Venturi M, Seifert S, Hunte C.(2002) "High level production of functional antibody Fab fragment in an oxidizing bacterial cytoplasm. "J. Mol. Biol. 315, 1-8).

However mutein according to the invention may not necessarily be formed or obtained only with the use of genetic engineering. Preferably lipocalin mutein can also be obtained by chemical synthesis such as solid phase polypeptide synthesis, Merrifield, or by transcription and translation in vitro. For example, it is possible to identify promising mutations using molecular modeling, and then to synthesize the required (design) polypeptide in vitro and to study the activity of binding to the target. Methods of solid-phase synthesis of proteins and/or synthesis in solution phase are well known in the art (reviewed, for example, in Lloyd-Williams, P. et al. (1997) Chemical Approaches to the Synthesis of Peptides and Proteins. CRC Press, Boca Raton, Fields, G.B., and Colowick, S.P. (1997) Solid-Phase Peptide Sunthesis. Academic Press, San Diego, or Bruckdorfer,T. et al. (2004) Curr. Pharm. Biotechnol. 5, 29-43).

In another embodiment mutiny according to the invention can be obtained by transcription/translation in vitro, using conventional methods known to the person skilled in the technical field.

The invention also relates to pharmaceutical compositions containing at least one mutein of lipocalin tear fluid of a person in accordance with the invention, or a protein or conjugate, and a pharmaceutically acceptable excipient.

Lipocalin mutiny according to the invention can be entered via any parenteral or apparentering (enteral) path, which is therapeutically effective for protein drugs. Methods of parenteral administration include, for example, intradermal, subcutaneous, intramuscular, intratracheal, intranasal, intravitreal or intravenous injection and infusion methods, for example in the form of injection solutions, infusion solutions or tinctures, as well as aerosol installation and inhalation, for example in the form of aerosol mixtures, sprays or powders. Understanding the delivery of drugs to the lungs, either through inhalation of aerosols (which can also be used in intra)or intratracheal installation, given, for example, in J. S. Patton et al. The lungs as aportal o entry for systemic drug delivery. Proc. Amer. Thoracic Soc. 2004 Vol.1 pages 338-344). How aparentally delivery represents, for example, orally, for example in the form of pills, tablets, capsules, solutions or suspensions, or rectally, for example in the form of suppositories. Mutiny according to the invention it is possible to enter the systemic or topical compositions containing conventional non-toxic pharmaceutically acceptable excipients or carriers, additives and fillers as desired.

In one embodiment of the present invention the pharmaceutical agent is administered parenterally to a mammal and, in particular, people. Appropriate routes of administration include, without limitation to, for example, intradermal, subcutaneous, intramuscular, intratracheal, or intravenous injection and infusion methods, for example in the form of injection solutions, infusion solutions or tinctures, as well as aerosol installation and inhalation, for example in the form of aerosol mixtures, sprays or powders. The combination of intravenous and subcutaneous infusions and/or injections may be the most convenient in the case of compounds with relatively short half-life in serum. The pharmaceutical composition can be an aqueous solution, emulsion, oil-in-water or emulsion water-in-oil.

It should be noted that the methods of transdermal delivery, such as iontophoresis, sonophoresis, or Lucena shipping microglia, described in Meidan VM and Michniak BB 2004 Am. J. Ther. 11(4): 312-316, can also be used for transdermal delivery of Malinov described in this description of the invention. How aparentally delivery represents, for example, orally, for example in the form of pills, tablets, capsules, solutions or suspensions, or rectal administration, for example in the form of suppositories. Mutiny according to the invention can be introduced systemically or topically in compositions containing a number of conventional non-toxic pharmaceutically acceptable excipients or carriers, additives and carriers.

The dosage used mutein can be varied within wide limits to achieve the desired prophylactic or therapeutic effect of the response. It will depend, for example, from the affinity of the compounds in the selected ligand, and the half-life of the complex mutein and ligand in vivo. In addition, the optimal dosage will depend on bearsdley mutein, or its fused protein, or its conjugate, the method of administration, the severity of the disease/disorder to be treated, and medical condition of the patient. For example, when used in ointments for local applications, you can use a high concentration mutein of lipocalin tear fluid. However, if you want, mutein can also be given in combination with medlennym release, for example in liposomal dispersions or polymer microspheres based hydrogel, such PolyActive™ or OctoDEX™ (see Bos et al., Business Briefing: Pharmatech 2003: 1-6). Other available compositions with delayed release represents, for example, polymers based on PLGA (copolymer of lactic and glycolic acids) (PR pharmaceuticals), hydrogels based on PLA-PEG (polylactic acid-polyethylene glycol) (Medincell) and polymers based on PEA (palifermin) (Medivas).

Thus, mutiny of the present invention can be prepared in the form of compositions, using pharmaceutically acceptable ingredients, as well as conventional methods of obtaining (Gennaro, A.L. and Gennaro, A.R. (2000) Remington: The Science and Practice of Pharmacy, 20th Ed., Lippincott Williams & Wilkins, Philadelphia, PA). To obtain pharmaceutical compositions can be used pharmaceutically inert inorganic or organic excipients. To obtain, for example, pills, powders, gelatin capsules or suppositories can be used, for example, lactose, talc, stearic acid and its salts, fats, waxes, solid or liquid polyols, natural and solid oil. Suitable excipients to obtain solutions, suspensions, emulsions, aerosol mixtures or powders for recovery in solvents or aerosol mixture before use include water, alcohols, glycerol, polyols and their appropriate sm is si, and vegetable oil.

The pharmaceutical composition may also contain additives such as, for example, fillers, binders, moisturizing agents, slip agents, stabilizers, preservatives, emulsifiers and, in addition, solvents or soljubilizatory or agents to achieve a depot. The latest is that the fused proteins can be included in system slow or slow release or targeted delivery, such as liposomes and microcapsules.

The composition can be sterilized in a variety of ways, including filtration through inhibiting bacteria filter, or by introducing a sterilizing agents in the form of sterile solid compositions which can be dissolved or dispersed in sterile water or other sterile environment immediately before use.

Another aspect of the present invention relates to a method of treating diseases or disorders in a subject in need thereof. Such diseases may include or may not include the binding/interaction of c-Met receptor tyrosine kinase. The disease may be a disease, the development of which involved the way HGF/c-Met. Such disease or disorder may be a cellular proliferative disorder. An example of a cellular proliferative the disease is cancer. Examples of cancers to be treated include, without limitation, liver cancer, colon cancer (e.g., primary colon cancer, see, for example, Clin Cancer Res.2003, 9(4), pages 1480-1488), colorectal cancer (see Zeng et al., Clin. Exp.Metastasis, 200004, 21 (5), pages 409-417), hepatocarcinoma, papillary kidney cancer, squamous cell carcinoma of the head and neck (HNSC), metastases of the lymph nodes in squamous cell cancer of the head and neck, for example (see, for example, Schiering et al., PNAS, Vol.100, No. 22, pages 12654-12559,2003 or reviews Trusolino & Comoglio, (2002), Nat. Rev. Cancer, 289-300 or Maulik et al. (2002) Cytokine Growth FaktorRev. 13, 41-59). For such therapeutic purposes, you can use mutiny of lipocalin tear fluid which counteract the path of HGF/c-Met and/or mergers of toxins or conjugates mutein of lipocalin tear fluid or conjugates mutein of lipocalin tear fluid with a cytotoxic agent, as described above.

The subject in need of such treatment, can be a mammal, such as human, dog, mouse, rat, pig, Primate, such as Cymologous, are just a few illustrative examples.

From the above description it is obvious that mutein of the present invention, or protein, or conjugate can be used in many applications. In General this mutein can be used in all applications where the use of antibodies, except concretionary on the glycosylation of the Fc region.

Thus, in another aspect of the invention mutiny of lipocalin tear fluid of a person in accordance with the invention can be used for the detection in vitro of this ligand, i.e. receptor C-Met or a domain or fragment. Such use may include the stage of interaction mutein sample, which is assumed to contain the ligand, in suitable conditions, thus ensuring the formation of the complex mutein and this ligand, and detecting associated mutein using an appropriate signal.

The detected signal may be caused by the label, as explained above, or by change of physical properties due to binding, i.e. the formation of the complex itself. One example is the plasma surface resonance, the value of which changes during binding of the binding partners, one of which is immobilized on a surface, such as gold foil.

Mutiny of lipocalin lacrimal fluid of humans disclosed in this description of the invention, can also be used to highlight this in vitro ligand of lipocalin lacrimal fluid of humans. Such use may include the stage of interaction mutein with a sample that contains, as expected, the specified ligand, in suitable conditions, thus ensuring the formation of the complex mutein is given ligand, and selection of complex mutein/ligand from a sample.

In both layers, the application mutein for detection of the ligand, as well as for selecting this ligand, lutein and/or the target can be immobilized on a suitable solid phase.

Mutiny of lipocalin tear fluid of a person in accordance with the invention can also be used to target compounds at a pre-selected area. In one such embodiment mutein of lipocalin tear fluid of a man used to target a pharmaceutically active compound to a pre-selected site in an organism or tissue, including:

a) conjugation mutein with the specified connection, and

b) delivery of complex mutein/connection in a pre-selected area, the Pharmaceutically active compound may be selected from the group consisting of a toxin, a cytostatic agent or antagonist to c-Met. Examples of antagonists of c-Met include monoclonal antibody (which binds to the extracellular domain of c-Met), or inhibitors that target the intracellular domains (in particular, the tyrosine kinase domain). Examples of low molecular weight inhibitors include, without limiting them, a derivative of 1,3,5-triazine-2,4-diamine, which is described in WO 2004/031184 derived 2-(2,6-dichlorophenyl)imidazole, bicyclic nitrogen-containing derivative, 5-benzylmethyl the sulfonamide-substituted pyrrole of indolin (for example, connection RNA-665752 developed by Sugen and described in Christenson J.G. AACR, Abst 4963 and 6200, 2003, or Sattler M et al, AACR, Abst 1005,2003).

To this end mutein lead in the interaction with c-Met receptor receptor or domain, with the aim of providing education complex. Then the complex containing lutein and of interest to the Union, delivered in a pre-selected area. Such use is particularly suitable, but not restricted to them, for delivery of a drug (selectively) in a pre-selected site in the body, such as the infected area of the body, tissue or organ, which suggest treating this drug. In addition to the formation of complex mutein and interesting connections, mutein may also interact with this connection with obtaining conjugate mutein and connections. Like the above complex, such a conjugate may be appropriate for delivery of the compounds in a pre-selected target site. Such conjugate mutein and connections may also include a linker that covalently binds mutein and connection with each other. Perhaps this linker is stable in the bloodstream, but split in the cellular environment.

Mutiny disclosed in this description of the invention, and their derivatives can thus be used in many fields, like antibodies or the x fragments. In addition to their use for binding to the substrate, allowing mobilitat or to separate the target of this mutein, or conjugate, or a fused protein of this target, mutiny can be used for labelling enzyme, antibody, radioactive substance or any other group with biochemical activity or specific binding characteristics. While their respective targets, or their conjugates, or fused proteins can be detected or brought into contact with them. For example, mutiny according to the invention can serve for the determination of chemical structures using conventional analytical methods (e.g., ELISA or Western blot) or by microscopy or immunosensoric substances. When this detection signal can be generated directly using a suitable conjugate mutein or fused protein, or indirectly, by immunochemical determination of associated mutein using antibodies.

Numerous possible applications of the inventive Malinov also available in medicine. In addition to the use in in vitro diagnostic tools and means of drug delivery, can be formed mutant polypeptide according to the invention, which binds, for example, with Dane or ofwholesale molecules on the cell surface.

sabreena additionally illustrated by the following non-limiting examples and the accompanying graphic materials.

Figure 1 shows the map Pismenovo vector pTLPC59 where Figa shown a schematic representation of the regulatory elements of the vector, and Figb presents a schematic increase gene construct of Malinov of lipocalin tear fluid, which is used to ekspressirovali not previously exposed to the library.

Figure 2 shows a map of the expression vector pTLPC 10.

Figure 3 shows the polypeptide sequence of Malinov of lipocalin tear fluid S225.4-K24 (SEQ ID NO: 1), aligned with a polypeptide sequence of lipocalin tear fluid of wild type.

Figure 4 shows how the affinity screening using ELISA and the results obtained for Malinov with affinity to c-Met.

Figure 5 shows an alignment of the polypeptide sequences Malinov of lipocalin tear fluid S225.4-K24 (SEQ ID NO; 1), and S244.2-N, S244.2-L01, S244.4-N05, S244.5-J05, S244.8-I20, S244.8-I07 (SEQ ID NO: 4-9).

Figure 6 shows measurements on a BIAcore binding mutein of lipocalin tear fluid of a person in accordance with the invention (S244.2-H08; SEQ ID N0:4) with c-Met.

7 shows the result of estimating the affinity of c-Met-binding Malinov S244.2-H08, S244.2-L01, S244.4-N05, S244.5-J05, S244.8-I20, S244.8-I07 (SEQ ID NO: 4-9) in the cellular environment on the cells HT-29.

On Fig shows how the affinity screening using ELISA and the results obtained for Malinov with affinity to c-Met./p>

Figure 9 shows the alignment of polypeptide sequences Malinov S225.4-K24 (SEQ ID NO: 1), S244.2-H08 (SEQ ID NO: 4), S261.1-L12, S261.1-J01, and S261.1-L17 (SEQ ID NO: 32-34) lipocalin tears.

Figure 10 shows the map of the expression vector pTLPC 47.

Figure 11 shows the result of estimating the affinity of c-Met-binding Malinov S261.1-L12, S261.1-J01, and S261.1-L17 (SEQ ID N0:32-34) in the cellular environment on the cells HT-29.

On Fig shows the measurement of binding mutein according to the invention (S261.1-L17; SEQ ID N0:34) lipocalin lacrimal fluid of humans with c-Met by competitive ELISA.

On Fig shows the result of estimating the affinity of c-Met-binding mutein S261.1-L12_C123 (SEQ ID N0:35) kletochnoi environment naklejka HT-29.

On Fig shows the results of tests for pH stability mutein S261.1-J01 (SEQ ID N0;33) of lipocalin tears.

On Fig shows an alignment of the polypeptide sequences of additional Malinov of lipocalin tear fluid according to the invention (in which two single mutations), together with their value kd in respect of binding to c-Met.

On Fig shows the result of estimating the affinity of c-Met-binding Malinov S318.1-C10, S318.1-L13, S318.1-A16, S318.2-I24, and S318.1-012 (SEQ ID N0:42, 44, 45, 46 and 49) in the cellular environment on the cells HT-29.

Examples

Unless otherwise noted, used conventional methods of recombinant gene technology, for example as described in Sambrook etal.

(above).

Example 1: getting a library 1.6×1010independent Malinov Tic

A random library of lipocalin lacrimal fluid (Tic) with high complexity were obtained essentially as described in Example 1 of PCT application PCT/ER/057971, the description of which is fully incorporated by reference into this description of the invention except that the design library of the gene for phage display pTLPC59 (Figa and 1B) is placed under the control of the lac R/o instead of tet R/o and genetically fused with full-size gene III phage VCSM 13.

Phage production mutein of lipocalin tear fluid in the format of multivalent phage display was performed using hypertag MK (Progen) to infect E. Li according to standard methods described in the literature (M. Kirsch et al. / Journal of Immunological Methods 301 (2005) 173-185).

Example 2: Fahmida presentation and selection of Malinov Tic with affinity to c-Met receptor

Formigny display and selection was performed using fahmida obtained in Example 1, essentially as described in Example 3 of WO 2005/019256 with the following modifications: protein-target (receptor c-Met-Fc, R&D systems) was used at a concentration of 200 nm and was made its presentation to the library in the form Fc-fused protein with the subsequent capture of complex phage-target using pellet protein G (Dynal). To select binding substances, which are not antagonistically to the natural ligand HGF, have introduced additional stage wash using 200 nm of soluble HGF (R&D systems), then c-Met library phages were suirable in alkaline conditions. Performed four cycles of selection.

Example 3: Identification of Malinov specific to the receptor C-Met, using a high-ELISA-screening

Screening Malinov chosen according to Example 2 was performed essentially as described in Example 3 of WO 2006/56464. Modification of the Protocol described below: the expression vector was a pTLPC 10 (Figure 2). Used protein-target represented receptor c-Met-Fc (R&D Systems) at a concentration of 1 μg/ml, and 3%milk was used as an unrelated control target instead serum albumin human.

Screening 2880 clones selected as described in Example 2 resulted in the identification 342 primary hits, indicating that it was successful selection of Malinov from the library. Using this approach identified a clone S225.4-K24 (SEQ ID NO: 1). Sequence S225.4-K24 also presented in Figure 3.

Example 4: affinity Maturation mutein S225.4-K24 using error-prone PCR

Obtaining a library of variants based on mutein S225.4-K24 (SEQ ID N0: 1) was performed essentially as described in Example 5 of WO 2006/56464 using oligonucleotides TL50 bio: TATCTGAAGGCCATGACGGTGGAC (SEQ ID NO: 2) and TL51 bio: TGCCCACGAGCCACACCCCTGGGA (SEQ ID NO: 3)that on the Valo in the library with an average of 5 substitutions on the structural gene.

Selection famed performed as described in Example 2, but using a limited target concentration (2 nm, 0.5 nm and 0.1 nm) receptor c-Met-Fc, and capturing the target and formigny complex using a mAb specific for IgG-Fc human, immobilized on a polystyrene plate. Additional selection was performed in identical conditions, but with the restriction of the combined target (1 nm) and short incubation period (5 minutes) or limitation targets (5 nm, 0.5 nm and 0.1 nm) with incubation fahmid at pH 3, 60°C for 15 min or pH 10, room temperature, for 30 minutes was Performed four cycles of selection.

Example 5: Screening of affinity of Malinov linking the c-Met receptor using a high-EUSA-screening

Screening was performed as described in Example 3, with the modification consisting in the use concentration of the receptor c-Met-Fc (R&D Systems) 2.5 µg/ml or 0.6 μg/ml Just spent screening 2880 clones, getting 1510 hits, indicating that it was successful enrichment ripe Malinov from the library. Advanced alternative of screening monoclonal anti-T7 antibody was applied to polystyrene tablet, and espressione mutiny captured using a marker T7 before incubation with reduced concentrations of the receptor c-Met-Fc (60 nm, 15 nm and 2.5 nm). Linking the recipe is RA c-Met-Fc was determined, using polyclonal conjugated with HRP antibody against human IgG - Fc domain.

The result of this screening are presented in figure 4. Identified a large number of Malinov selected, as described in Examples 4 and 5, has an improved affinity towards the receptor C-Met compared with muteena S225.4-K24 (SEQ ID NO: 1), which served as the basis for affinity maturation. Using this approach identified mutiny S244.2-H08, S244.2-L01, S244.4-N05, S244.5-J05, S244.8-I20, S244.8-I07 (SEQ ID NO: 4-9). Sequence S244.2 - N, S244.2-L01, S244.4-N05, S244.5-J05, S244.8-I20, S244.8-107 also depicted in Figure 5.

Example 6: Getting Malinov that communicates with the c-Met receptor

For preparative get Malinov specific to the receptor C-Met, a strain of E. coli JM83 KI 2 containing the corresponding mutein encoded in the expression vector pTLPCIO (Figure 2), were grown in 2 l shake flask was cultured in LB medium (Luria-Bertani)-ampicillin according to the Protocol described in Schlehuber, S. et al. (J. Mot. In/about/. (2000), 297, 1105-1120). When you have a need for a more significant amount of protein, strain W3110 E. coli containing the appropriate expression vector, used for periplasmatic production by cultivation in a desktop fermenter in 1 l or 10 l vessel-based Protocol described in Schiweck, W., and Skerra, A, Proteins (1995) 23, 561-565).

Mutiny was purified from perip akmaticheskoy faction in one stage using streptavidin affinity chromatography, using a column with a suitable volume of the layer according to the method described in Skerra, A. & Schmidt, T. G. M. (2000) (Use of the Strep-tag and streptovidin for detection and purification of recombinant proteins. Methods Enzymol. 326A. 271-304). To achieve higher cleaning and to remove any aggregated recombinant protein, in conclusion, performed gel filtration Malinov on a column of Superdex 75 HR 10/30 (24 ml volume of the layer, Amersham Pharmacia Biotech) in the presence of PBS buffer (phosphate buffer saline). The fraction of Monomeric protein were pooled and checked for purity using SDS-PAGE (electrophoresis in polyacrylamide gel with sodium dodecyl sulfate) and used for further biochemical characteristics.

Example 7: Measurement of the affinity of using spectroscopy of surface plasma resonance (SPR)

Measurement of the affinity was performed mainly as described in Example 9 of WO 2006/56464 with modifications, namely, that approximately 9000 RU (relative units) receptor c-Met-Fc (R&D Systems) were directly immobilized on the chip surface SM (instead of 2000 EN CTLA-4 human or CTLA-4-Fc mouse, used as a target in WO 2006/56464), and 80 μl mutein were injected with in a concentration of 0.2-0.5 µm (instead of 40 μl of the sample treated lipocalin of Malinov in concentrations 5-0,3 μm, used in WO 2006/56464). Chip surface was regenerated between measurements using the nycli 5-10 ál of 50 mm NaOH, pH 10, 2.5 M NaCI. Maintained a constant flow rate of 10 ál/min

The results of measurements of the affinity of using S244.2-H08, S244.2-L01, S244.4-N05, S244.5-J05, S244.8-I20, S244.8-I07 are summarized in Table I and evaluation sensogram typical S244.2-H08 presented on Fig.6.

MuteinKon(1/Ms × 104)Koff(1/s 10-4)KD [nm]
S244.2-H081,511,59,9
S244.2-L011,241,9615,8
S244.4-N051,12,6424
S244.8-I200,92,0923
S244.8-I070,874,147
S244.8-J050,931,4515,5

Table I. the affinity of the selected Malinov according to the invention to the receptor C-Met in definition wide-angle is by SPR. The average values calculated on the basis of at least 3 independent measurements.

Example 8: Ranking the affinity of lipocalin of Malinov on intact cells using flow cytometry

Lipocalin mutiny was titrated on cells HT-29 (ATSS), which show endogenous expression of HGFR/c-Met. Lipocalin mutiny tested in 24 dilutions 1:2, starting with a concentration of 10 μm in a total volume of 30 µl. For each binding assays 100,000 cells were incubated in PBS containing 2% fetal calf serum (FCS)for 2 h at 4°C. Cells were washed twice in PBS, 2% FCS, and incubated with 375 ng biotinylated, affinity-purified goat antisera against lipocalin tear fluid at the reaction for 30 minutes After washing and another 30 min incubation with streptavidin-phycoerythrin was completed definition. Cells were washed, and the fluorescence was analyzed on a flow cytometer FACS Calibur. The mean fluorescence intensity (MFI) was applied to the chart against the concentration lipocalin mutein and approximatively to a sigmoidal curve dose-effect, and values AS was determined using the software GraphPad Prism.

Curves titration of which was determined values AS for S244.2-N, S244.2-L01, S244.4-N05, S244.5-J05, S244.8-I20, S244.8-I07 presented on Fig.7, and the calculated values AS are summarized in Table II.

CloneES [nm]STD (standard deviation)S244.2-H0813,21,3S244.2-L0116,81,7S244.4-N0518,218,2S244.8-I0744,85,9S244.8-I2028,14S244.8-J05of 37.85,5

Table II. Values ES and standard deviation electrovanne of Malinov according to the invention for the c-Met receptor, in the determination by FACS titration cells HT-29.

Example 9: Screening s-options lipocalin mutein

With the purpose of obtaining a reactive group for the site-directed combination, for example with activated PEG or pharmaceutically suitable label, via site-directed mutagenesis was introduced unpaired cysteine residue. Recombinant mutein carrying a free Cys residue, then was produced in E. coli as described in Example 6, was determined output expr the hurt, and the affinity was measured using SPR, essentially as described in Example 7.

Cysteine was introduced instead of any of the amino acids Thr 40, Asp 95, Arg 90, Lys 121, Asn 123 or Val 93 using pairs of oligonucleotides

NTS direct CGTCTCGGTAACACCCATATGCCTCACGACCCTGGAAGGG(SEQ ID NO: 10), and

H08JT40C reverse CCCTTCCAGGGTCGTGAGGCATATGGGTGTTACCGAGACG (SEQ ID NO; 11), or H08JD95C direct

CAGGTCGCACGTGAAGTGCCACTACATCTTTTACTCTGAGGG (SEQ ID NO: 12) and H08_D95C reverse

CCCTCAGAGTAAAAGATGMAPKEPTGGCACTTCACGTGCGACCTG (SEQ ID NO: 13), or N R90C direct CGTGGCATACATCAGCTGCTCGCACGTGAAGGATCAC (SEQ ID NO: 14), and

H08_ R90C GTGATCCTTCACGTGCGAGCAGCTGATGTATGCCACG (SEQ ID NO:15, or

A22JC121C direct GGCAGAGACCCCTGCAACAACCTGGAAGCCTTG (SEQ ID NO: 16), and

A22JC121C reverse CAAGGCTTCCAGGTTGTTGCAGGGGTCTCTGCC (SEQ ID NO: 17), or

A22_N123C direct GGCAGAGACCCCAAGAACTGCCTGGAAGCCTTGGAG (SEQ ID NO; 18) and

A22_N123C direct GGCAGAGACCCCAAGAACTGCCTGGAAGCCTTGGAG (SEQ ID NO: 19), or H08_V93C direct

CATCAGCAGGTCGCACTGCAAGGATCACTACATCTTTTAC (SEQID NO: 20) and H08_V93C reverse GTAAAAGATGMAPKEPTGATCCTTGCAGTGCGACCTGCTGATG (SEQ ID NO: 21), respectively.

As an example, the results of Cys-screening mutein S244.2-H08 (SEQ ID NO: 4)specific to the receptor c-Met are shown in Table III below.

CloneOutput [µg/l]The affinity of [nm]
NS311,3
S244.2-H08N123C511,7
S24.4-H08D95C 1518,2
S244.8-H08R90C555,9
S244.8-H08T40C634
S244.8-H08V93C315,5

Table III. SPR-affinity receptor c-Met mutein S244.2-H08 and its mutants containing amino acid substitutions Thr 40→Cys (SEQ ID NO: 22), Asn 123→Cys (SEQ ID NO: 23), Asp 95→Cys (SEQ ID NO: 24), Arg 90→Cys (SEQ IDNO: 25), nLys 121→Cys (SEQID NO:26).

Example 10: Affinity maturation mutein S225.4-K24 using site-directed random approach

A library of variants based on mutein S225.4-K24 (SEQ ID NO: 1) was constructed by randomly selecting the position of the balance 28, 39, 52, 5, 58, 65, and 89 to account for all 20 amino acids at these positions. The library was created essentially as described in Example 1 with the modification consists in the fact that I had received three randomized PCR fragment using pairs deoxynucleotide C

GCCATGACGGTGGACACGCAGNNSCCGCTGAGCCTCTAC (SEQ N0: 27) (covering position 28) and K24_2:

CAGGGTCGTGAGGGTSNNGGGTGTCACCGAGAC (SEQ NO: 28) (covering position 39), K24_3:

GGGGGCAACCTGGAAGCCNNSGTCACCNNSAACCAGNNSGGCCGGTCCCAGG AGGTG, (SEQ NO: 29) (covering position 52, 55 and 58) and K24_4:

GTATTTTCCCGGCTCATCAGTTTTCTCCAGGACGGCSNNCACCTCCTGGGACCG GCC (SEQ NO: 30) (covering position 65), K24_5:

GTGCTCACGTGGCATACTCNNSAGGTCGCACGTGAAGGAC (SEQ NO: 31) (covering position 89) and TL51bio (SEQNO: 3) instead TL46, TL47, TL48 and TL49, respectively. Formigny display and selection was performed using family essentially as described in Example 2, with the following modifications: protein target was a Monomeric receptor C-Met without Fc-plot (R&D systems) in biotinylated form, which allows the capture target: fahmideh complex using neutravidin (Pierce), immobilized on a polystyrene plate. Selection was performed using either a limited concentration target (1.5 nm and 0.5 nm and 0.1 nm of the biotinylated c-Met receptor) or a limited concentration target (3 μg/ml, 1 μg/ml and 0.3 μg/ml) together with a shorter incubation time (10 min) or competitive approach, using a considerable excess (10 μm) of purified c-Met-specific mutein S244.2-H08 (SEQ N0: 4), the resulting flawed ripening, as described in Example 5. Performed three cycles of selection.

Example 11: Screening of affinity of Malinov linking the c-Met receptor, using high-throughput screening EUSA

Screening was performed essentially as described in Example 5 of an alternative screening with the following modifications;

1) monoclonal anti-T7 antibody was applied to polystyrene tablet, and expressed mutiny captured using a marker T7 before incubation with limited what koncentracije Monomeric receptor c-Met-bio (50 nm, 10 nm and 2.5 nm). Binding of the target was determined using HRP (horseradish peroxidase), conjugate with extravaginal.

2) Biotinylated c-Met receptor (1 μg/ml) was captured on neutravidin microplates. Binding expressed Malinov specific to c-Met, was determined using HRP conjugate with anti-T7 antibody mAb (Novagen) or after unlimited (60 min) or limited (5 min) incubation period.

3) Extract containing c-Met-binding mutiny, was heated to 70°C for 1 hour.

4) Biotinylated c-Met receptor (R&D Systems, 2.5 µg/ml) was captured on neutravidin tablets. Extracts mutein pre-incubated with a significant excess (1 μm), peeled, specific for c-Met mutein S244.2-H08 (SEQ N0: 4) of Example 5, as a competitor for binding to the target. Binding expressed Malinov specific to c-Met, was determined using conjugated with HRP anti-T7 mAb (Novagen).

The result of this screening are presented in Fig. Identified a large number of Malinov selected, as described in Examples 12 and 13, having improved affinity to c-Met receptor in comparison with muteena S225.4-K24 (SEQ ID NO: 1), which served as the basis for affinity maturation. Using this approach identified mutiny S261.1-L12, S261.1-J01, S261.1-L17 (SEQ ID NO:32-34). Sequence S261.1-L12, S261.1-J01, S261.1-L17 also is redstavleny figure 9 together with sequences S225.4-K24 (SEQ N0: 1) and S244.2-H08 (SEQ NO: 4), which are mutein resulting from flawed ripening, as described in Example 5.

Example 12: Getting Malinov linking the c-Met receptor, in His-labeled format

Periplasmatic getting by culturing in the fermenter the fermenter 0.75 l, was performed essentially according to Example 6 with the modification consists in the fact that the corresponding mutein encode expression vector pTLPC47 (Figure 10) instead pTLPCIO. Vector elements pTLPC47 identical pTLPCIO with the modification consists in the fact that pTLPC47 encodes mutein Tic, which is the end attached to the marker Hexa-His, and marker T7, merged with M-end has been removed.

Mutein was purified from periplasmic faction in chromatographic Protocol with a single stage using sepharose (GE) Ni-NTA, using a column with a suitable volume of the layer and the right equipment according to manufacturer's recommendations.

To achieve higher purity and to remove any aggregated recombinant protein, in conclusion, performed gel filtration Malinov on a column of Superdex 75 HR 10/30 (24 ml volume of the layer, Amersham Pharmacia Biotech) in the presence of PBS buffer. The fraction of Monomeric protein were pooled and checked for purity using SDS-PAGE and used for further biochemical characteristics.

Example 13: Measurement of the affinity of using spectroscopy p. the surface plasma resonance (SPR)

Measuring the affinity was performed essentially as described in Example 7.

The results of measurements of the affinity of using S261.1-L12, S261.1-J01, S261.1-L17 (SEQ ID N0;32-34) and S244.2-H08 (SEQ NO: 4), which are mutein resulting from flawed maturation described in Examples 4 and 5, are summarized in Table IV.

Name cloneKon(1/M-1 s-1×104)Koff(10-4c-1)KD [nm]
S261.1-L175,381,392,6
S261.1-L122,70,662,4
S261.1-J012,860,652,3
S244.2-J081,82,5814

Table IV. Improving the affinity of the selected Malinov from the second affinity maturation as described in Examples 10 and 11, compared with muteena S244.2-H08 from the first cycle of maturing affinity determined using SPR.

Example 14: Ranking afpinscription of Malinov on intact cells using flow cytometry

Lipocalin mutiny was titrated on HT-29 cells (ATSC), essentially as described in Example 8.

Curves titration of which was determined values AS for S261.1-L12, S261.1-J01, S261.1-L17 (SEQ ID NO: 32-34), represented at 11, and the calculated values AS are summarized in Table V.

CloneES [nm]
S261.1-L122,3
S261.1-J018,5
S261.1-L172,8

Table V. Values IS selected Malinov according to the invention in respect of the c-Met receptor, in the determination by FACS titration cells HT-29.

Example 15: Identification of non-adversarial nature of the binding mutein specific to the c-Met receptor using HGF-KOHKVpeHTHoro ELISA

The nature of the interaction between HGF (factor p,OST hepatocytes, R&D Systems) and its receptor c-Met using the selected Malinov specific to c-Met, has been evaluated in a competitive ELISA. Thus, a constant concentration of the receptor c-Met-Fc (R&D Systems) 2.5 µg/ml was recorded using anti-human lgG Fc-specific mAb (Jackson Measurement Research), which previously was immobilized on the surface of the polystyrene plate. Then the target were incubated for 1 cha is and at room temperature with serial dilutions muteena, specific for c-Met, starting with 100 nm in two-stage serial dilutions, and the binding occurs either in the absence or in the presence of 300 nm HGF as a competitor. Associated mutein specific to the c-Met receptor was detected using biotinylated polyclonal antibody against lipocalin 1 (R&D Systems), and associated HGF was detected using polyclonal anti-HGF-bio antibody (R&D Systems). In both cases, as a secondary reagent to detect used HRP-conjugated extrawide (Sigma).

The measurement result using mutein S261.1-L7 (SEQ N0: 34) serves as an example and represented in Fig. Values of KDdetermined from titration curves muteena, are summarized in Table VI.

CloneKD [nm]-HGFKD [nm]+HGF
S261.1-L171,92,5

Table VI. Non-adversarial capacity and affinity of the selected mutein of lipocalin tear fluid S261.1-L17 according to the invention in respect of the c-Met receptor in the determination by competitive ELISA.

Example 16: Determination of thermal denaturation for Malinov that bind c-Met, using CD spectroscopy

Measuring circular dicristofano, essentially as described in Example 14 international patent application WO 2006/056464, with modification, namely, that the used wavelength was 230 nm, and the concentration mutein was 250 µg/ml melting point of THL Malinov S261.1-L12, S261.1-J01, S261.1-L17 (SEQ ID NO: 32-34) and S244.2-H08 (SEQ ID NO: 4) of lipocalin tear fluid are summarized in Table VII.

CloneTm [°C]
S261.1-L1263,2
S261.1-J0159
S261.1-L1764,7
S244.2-H0865,5

Table VII. The melting temperature of the selected Malinov according to the invention for the c-Met receptor in the determination by measurement of circular dichroism.

Example 17: getting a c-Met-specific mutein 5261.1-W2 S with an unpaired cysteine at position 123

Preparative obtaining c-Met-specific mutein S261.1-L12_C123 (SEQ NO: 35) was performed essentially as described in Example 6 with the modification consists in the fact that the amino acid Asn 123 was replaced by cysteine to introduce the unpaired cysteine for subsequent site-directed conjugacy. Cysteine 123 was chosen according to the transfer of results is of chininga cysteine, described in Example 9, which shows a good way of expression and a good affinity compared with the primary muteena S261.1-L12 (SEQ N0: 32) in the absence of unpaired cysteine.

Example 18: a Site-directed conjugation HYNIC with c-Met-specific muteena S261.1-L12 S

Purified mutein S262.1-112_C123 (SEQ NO: 35) from Example 17 was used at a concentration of 0.8 mg/ml in PBS buffer pH 7.4, and unpaired cysteine activated by addition of 100 mm TSER (Sigma) to a final concentration of 1 mm. After 2 hours incubation at room temperature, the unreacted excess TSAR was removed by gel-filtration using a column NAP-5 (GE)according to the manufacturer's recommendations. Added 10-molar excess of HYNIC (3-N-maleimido-6-hydrazino-pyridine hydrochloride, purchased from SoluLink) and incubated for 2 h at room temperature. To separate unreacted HYNIC from conjugated mutein the reaction mixture was concentrated in Ultracentricon (Amicon) and washed at least 5 times, using appropriate volumes of PBS buffer.

Example 19: measuring the affinity of HYNIC-conjugated c-Met-specific mutein S261.1-L12 S on intact cells by flow cytometry

c-Met-specific mutein S261.1-L12_C123 (SEQ N0: 35) in the presence and in the absence of conjugated HYNIC was titrated on cells HT-29 (ATSS), essentially as described in Example 8.

Curves m is I, of which determine the values of IS presented on Fig, and calculated values AS are summarized in Table VII.

CloneES [nm]
S261.1-L12C1238,6
S261.1-L12C123HYNIG8,3

Table VII. Values ES and standard deviations of selected Malinov according to the invention for the c-Met receptor in the determination by FACS titration cells HT-29.

Example 20: pH stability of c-Met-specific Malinov

Purified mutein S261.1-J01 from Example 12 were incubated for 60 min at different pH values in the range from pH 3 to pH of 9.2. After neutralization to pH 7.4 mutein analyzed by exclusion chromatography using an analytical column Superdex 75 (GE) according to the manufacturers ' recommendations.

It was impossible to detect any changes mutein during the incubation period when measured by HPLC-SEC, with the exception of pH 5-6, which represent the interval around P1 muteena, where to some extent took place dimerization, as shown in Fig.

Example 21: Positional saturating mutagenesis

Site-specific mutagenesis was performed in clauses 26, 27 and 29 of the sequence of affine-with trevlig of Malinov L17, 024, m, K, A22, K15, L03, 007 and C of lipocalin tears to assess whether a significant impact on the binding affinity of. As shown in Fig, all generated mutants show essentially the same affinity.

Example 22: the affinity maturation mutein S261.1-L17 when using site-directed random approach

The library from 8×108variants based on mutein S261.1-LI-7 (SEQ ID NO: 34) was designed randomly in the provisions 26, 27, 29,30, 32, 33, 34 and 79, allowing all 20 amino acids in these positions. The library was created essentially as described in Example 1 of international patent application PCT/EP 2007/057971, published as WO 2008/015239, with the modification consists in the fact that randomization was used deoxynucleotide L12-1:

GAAGGCCATGACGGTGGACNNKNNKGACNNKNNKAGCNNKNNKNNKTCGGTGA CASCADAS (SEQ ID NO: 50); L12-2:

CACGTGAGCACCTCCGTAMNNCGTGTATTTTCCCGGCTC (SEQ ID NO: 51) and L12-3: ACGGAGGTGCTCACGTGGCATACATCCAGAGG (SEQ ID NO: 52) instead disclosed in PCT/EP 2007/057971. Formigny display and selection was performed using family essentially as described in Example 3 of international patent publication WO 2005/019256, with the following modifications:

protein-target (c-Met receptor Fc, R&D systems) was used or in limited concentrations (40 PM, and 6 PM, and 1 PM) and carried out the presentation of the library in the form Fc-fused protein with the subsequent capture of complex phage-target using pellet protein G (Dynl), or first target was captured with limited concentrations (50 ng/ml, and 10 ng/ml, and 1 ng/ml) on pellet protein G, then carried out the presentation of complex target-granules library fahmida. C-Met-associated phage library was suirable in acid and then in basic conditions. Performed three cycles of selection.

Example 23: the Screening of affinity of Malinov linking the c-Met receptor, using high-throughput screening ELISA

Screening was performed essentially as described in Example 5 of an alternative screening with the following modifications:

1) monoclonal anti-T7 antibody was applied at a concentration of 5 µg/ml for polystyrene tablet and expressed mutiny captured using a marker T7 before incubation with reduced concentrations of the receptor c-Met-Fc (1 nm, 0.2 nm and 0.1 nm). Binding of the target was detected using HRP (horseradish peroxidase), conjugate with anti-human lgG Fc-specific antibody goat;

2) extract containing c-Met-binding mutiny, was heated to 70°C for 1 hour before the formation of a complex with the target c-Met receptor-Fc. Such organization of the c-Met receptor-Fc was captured using a mouse anti-lgG-Fc human-specific monoclonal antibody which is immobilized on polystyrene plates at a concentration of 5 µg/ml

Have identified a number of moutai is s, selected, as described above, having improved affinity to c-Met receptor in comparison with muteena S261.1-L17 (SEQ ID NO: 34), which served as the basis for affinity maturation. Using this approach were identified mutiny S318.1-C10, S318.1-N21, S318.1-L13, S318.1-A16, S318.2-I24, S318.4-M11, S318.1-G18, and S318.1-012 (SEQ ID N0:42-49).

Example 24: measuring the affinity of c-Met-specific Malinov on intact cells using flow cytometry

After expression and purification of Malinov using affinity chromatography using Strep-Tag fused with the end of the relevant mutein (see Example 6), c-Met-specific mutiny S318.1-C10, S318.1-L13, S318.1-A16, S318.2-I24 and S318.1-012 (SEQ IDNO: 42, 44,45, 46 and 49) was titrated on cells HT-29 (ATSS), essentially as described in Example 8, and the affinity of binding was compared with the affinity of muteena S261.1-L17 (SEQ ID NO: 34)carrying the marker His6 at its C-end.

Curves titration of which was determined values AS presented on Fig, and calculated values AS are summarized in Table VIII.

CloneES [nm]
S318.1-C105
S318.1-L1325
S318.2-A1610
S318.2-I24 5
S318.1-0127
S261.1-L17His17

Table VIII. Values ES and standard deviation of selected Malinov according to the invention with respect to the c-Met receptor in the determination by FACS titration cells HT-29.

Example 25: Determination of thermal denaturation for c-Met-binding Malinov when using CD spectroscopy

Measurement of circular dichroism was performed essentially as described in Example 14 international patent application WO 2006/056464, with modification, namely, that the used wavelength was 230 nm and the concentration mutein was 250 μg/ml of the melting Temperature TmMalinov S318.1-C10 (SEQ ID NO: 42) and S318.1-012 (SEQ ID NO: 49) of lipocalin tear fluid are summarized in Table IX and compared with the melting temperature mutein S261.1-LI-7 (SEQ ID NO: 34) (token His6), from which they occur.

CloneTm [°C]
S318.1-C1070
S318.1-01265
S261.1-L17his665 (rounded)

Table IX. Temperature the tours melting selected Malinov according to the invention for the c-Met receptor in the determination by measurement of circular dichroism.

The results of Examples 24 and 25 showed that mutein S318.1-C10 has essentially the same binding affinity of that and mutein S261.1-L17, which served as the basis for its reception, but at the same time mutein S138.1-C 10 has a higher stability than mutein S261.1-L17.

The invention illustratively described in this description of the invention, it is possible to appropriately put into practice in the absence of any element or any of the elements, limitation or limitations, not specifically disclosed in this description of the invention. Thus, for example, the terms "comprising", "including", "containing" and so forth should be read broadly and without limitation. In addition, the terms and expressions used in this description of the invention, were used as terms of description and not of limitation, and without intent to use such terms and expressions, of excluding any equivalents shown and described signs or portions thereof, but it should be noted that the scope of the claimed invention, various modifications are possible. Thus, it should be understood that although the present invention has been specifically disclosed with the aid of preferred embodiments and features, expert in the art may apply to the modification and variant embodied in this description of the invention disclosed in this is the description of the invention, and that such modifications and variations are considered as being within the scope of this invention. This invention has been described in this description of the invention broadly and generically. Each of the more narrow and subgeneric groups get into the General description, also forms part of the invention. It includes a General description of the invention with the proviso or negative limitation removing any object from the genus, regardless of whether stated or not specifically in this description of the invention exclude the material. In addition, when the characteristics or aspects of the invention are described in terms of Markush groups, specialist in the art it is obvious that in this way the invention is also described in terms of any individual member or subgroup of members of the Markush group. Additional embodiments of the invention will become apparent from the attached claims.

1. Mutein of lipocalin lacrimal fluid of humans (hTLc)having detectable binding affinity of specified synthetic ligand of lipocalin lacrimal fluid of humans, where specified artificial ligand is a receptor tyrosinekinase Met (c-Met) of a person or a domain or fragment of the c-Met person, and where specified mutein contains from 6 to 18 amino acid substitutions relative to the amino acid sequence of Mature lipocalin tear fluid che is ovecka (SWISSPROT DATABANK ENTRY P31025; SEQ ID NO:36), which is selected from the group consisting of Arg 26→Thr, Val, Pro, Ser, Gly; Glu 27→Gln, Gly, Val, Ser; Phe 28→Met, Asp; Pro 29→Leu, Ile, Ala, Trp; Glu 30→Leu, Gly, Arg, Phe; Met 31→Ser; Asn 32→Leu, Arg, Val, Gln; Leu 33→Tyr, Val, Ile, Thr, Phe; Glu 34→Val, Arg, Ala; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile, Val; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly,
and may contains at least one additional amino acid substitution selected from Cys 61→Ser; Cys 101→Ser; Cys 153→Ser; Arg 111→Pro; Lys 114→Trp; Thr 37→Ser; the Met 39→Ile, Leu; Asn 48→Ser; Lys 52→Thr, Met; Met 55→Leu; Lys 65→Arg, Leu; Ala 79→Leu, Ser; Ala 86→Thr; Ile 89→Ser, Gln, Thr, His; Thr 40→Cys; Glu 73→Cys; Arg 90→Cys; Asp 95→Cys; Lys 121→Cys; Asn 123→Cys and Glu 131→Cys.

2. Mutein according to claim 1, where the artificial ligand is an extracellular region or domain of the receptor tyrosine kinase Met the man.

3. Mutein according to claim 1, which does not act as an antagonist of the growth factor of human hepatocytes (HGF) or the scattering of the human factor (SF).

4. Mutein according to claim 1, which binds to the extracellular region or domain of the Met receptor with KDequal to 200 nm or less.

5. Mutein according to claim 4, which binds to the extracellular region or domain of the Met receptor with KDequal to 100 nm or less.

6. Mutein according to claim 5, which binds to the extracellular region or domain of the Met receptor with KDequal to 20 nm or less.

7. Mutein according to claim 6, which binds to the extracellular region or domain of the Met receptor with KDequal to 1 nm or less.

8. Mut is N. according to claim 1, which contains amino acid substitutions: Arg 26→Thr; Glu 27→Gln; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly.

9. Mutein according to claim 1, which contains amino acid substitutions: Met 31→Ser; Leu 56→Asn; Ile 57→Gln; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly.

10. Mutein according to claim 1, which contains amino acid substitutions: Cys 61→Ser; Cys 101→Ser; Arg 111→Pro; Lys 114→Trp; and Cys 153→Ser.

11. Mutein according to claim 1, which contains one of the following sets of amino acid substitutions:
(1) Arg 26→Thr; Glu 27→Gln; Phe 28→Met; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly;
(2) Arg 26→Thr; Glu 27→Gln; Phe 28→Asp; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Ser 58→Val; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly;
(3) Arg 26→Thr; Glu 27→Gln; Phe 28→Asp; Glu 30→Leu; Met 31→Ser; Asn 32→Leu; Leu 33→Tyr; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly;
(4) Arg 26→Val; Glu 27→Gly; Phe 28→Asp; Pro 29→Leu; Glu 30→Gly; Met 31→Ser; Asn 32→Arg; Leu 33→Val; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly;
(5) Arg 26→Pro; Glu 27→Gly; Phe 28→Asp; Pro 29→Ile; Glu 30→Arg; Met 31→Ser; Asn 32→Leu; Leu 33→Ile; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly;
(6) Arg 26→Ser; Phe 28→Asp; Pro 29→Ala; Glu 30→Phe; Met 31→Ser; Asn 32→Val; Leu 33→Thr; Glu 34→Val; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; Hs 106→Trp; and Lys 108→Gly;
(7) Arg 26→Val; Glu 27→Val; Phe 28→Asp; Pro 29→Trp; Glu 30→Arg; Met 31→Ser; Asn 32→Gln; Leu 33→Val; Glu 34→Arg; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly; and
(8) Arg 26→Gly; Glu 27→Ser; Phe 28→Asp; Pro 29→Trp; Met 31→Ser; Asn 32→Val; Leu 33→Phe; Glu 34→Ala; Leu 56→Asn; Ile 57→Gln; Ser 58→Ile; Asp 80→Tyr; Lys 83→Ala; Glu 104→Asp; Leu 105→Thr; His 106→Trp; and Lys 108→Gly.

12. Mutein according to claim 1, which has the amino acid sequence represented in any of SEQ ID NO:1, SEQ ID NO:4-9, SEQ ID NO:22-26, SEQ ID NO:32-35 or SEQ ID NO:42-49.

13. Mutein according to any one of claims 1 to 12, which is stable in the pH range from about 2.5 to about a 9.5.

14. Mutein according to item 13, which is stable in the pH range from about 3.0 to about 9,3.

15. Protein having detectable binding affinity of receptor with receptor Met man (c-Met) or a domain or fragment of the c-Met person containing mutein according to any one of claims 1 to 14, where mutein at its N-end or C-end is functionally merged with the enzyme, the protein or domain of a protein, a peptide, a signal sequence and/or affinity marker.

16. Protein indicated in paragraph 15, which is stable in the pH range from about 2.5 to about a 9.5.

17. Protein according to clause 16, which is stable in the pH range from about 3.0 to about 9,3.

18. Protein indicated in paragraph 15, where mutein has the amino acid sequence represented in any of SEQ ID nos:37-41.

19. Conjugate mu is eine according to any one of claims 1 to 14, having detectable binding affinity of receptor with receptor Met man (c-Met) or a domain or fragment of c-Met, where mutein anywhereman partner conjugation selected from the group consisting of organic molecules medicines, enzyme label, a toxin, a cytostatic agent, a label, which can be photoactivation and fit in photodynamic therapy, a pharmaceutically acceptable radioactive label, hapten, digoxigenin, Biotin, chemotherapeutic complex metal or metal colloidal gold and grouping, which increases the half-life mutein of serum.

20. Conygar according to claim 19, where the grouping, which increases the half-life of serum selected from the group consisting of molecules polyalkyleneglycol, hydroxyethylamide starch, palmitic acid or other fatty acid molecules, Fc-region of an immunoglobulin, a CH3 domain of an immunoglobulin, a CH4 domain of an immunoglobulin, albumin, or fragment of albumin, albumin-binding peptide, albumin-binding protein and transferrin.

21. Conygar according to claim 20, where the albumin-binding protein is a bacterial albumin-binding protein, antibody or antibody fragment directed against albumin, or lipocalin mutein with spezialmaschinenbau in relation to albumin.

22. The conjugate according to item 21, where bacterial albumen domain is an albumin-binding domain of streptococcal protein G.

23. The conjugate according to claim 20, where the albumin-binding peptide has the formula Cys-Xaa1-Xaa2-Xaa3-Xaa4-Cys, where Xaa1represents Asp, Asn, Ser, Thr or Trp; Xaa2represents Asn, Gln, His, Ile, Leu, or Lys; Xaa3represents Ala, Asp, Phe, Trp or Tyr; Xaa4represents Asp, Gly, Leu, Phe, Ser or Thr.

24. The conjugate according to claim 20, where polyalkyleneglycol is a polyethylene glycol (PEG) or its activated derivative.

25. The conjugate according to claim 19, where the toxin is selected from the group consisting of pertussis toxin, diphtheria toxin, ricin, saporin, pseudomonades of exotoxin, calicheamicin or its derivative, taxoid, maytansinoid, tubulysin and analog dolastatin.

26. Conjugate on A.25, where the analogue of dolastatin selected from the group consisting of auristatin E, monomethylaniline E, auristatin PYE and auristatin PHE.

27. The conjugate according to claim 19, where the cytotoxic agent is selected from the group consisting of cisplatin, carboplatin, oxaliplatin, 5-fluorouracil, Taxotere (docetaxel, paclitaxel, anthracycline (doxorubicin), methotrexate, vinblastine, vincristine, vindesine, vinorelbine, dacarbazine, cyclophosphamide, etoposide, adriamycin, camptothecin, compounds related combretastatin A-4, sulfonamides, oxadiazolyl, benzo[b]teofanov, synthetic spirochetal pyrans, anotheraggravating compounds, Kuracina and derivatives Kuracina, derived methoxyestradiol and leucovorin.

28. The conjugate according to claim 19, where mutein contains at least one amino acid substitution selected from the group consisting of Thr 40→Cys, Glu 73→Cys, Arg 90→Cys, Asp 95→Cys, Lys 121→Cys, Asn 123→Cys and Glu 131→Cys and partner conjugation attached to mutein through any one of the Cys residues at position 40, 73, 90, 95, 121, 123 or 131 sequence.

29. Conjugate on p, where partner conjugation selected from the group consisting of organic molecules, enzyme label, a toxin, a cytostatic agent, a pharmaceutically acceptable radioactive labels, fluorescent labels, chromogenic labels, luminescent labels, hapten, digoxigenin, Biotin, metal, metal, colloidal gold and grouping, which increases the half-life mutein of serum.

30. The conjugate according to any one of p-29, which is stable in the pH range from about 2.5 to about a 9.5.

31. The conjugate according to item 30, which is stable in the pH range from about 3.0 to about 9,3.

32. The nucleic acid molecule encoding mutein according to any one of claims 1 to 14.

33. The vector for the expression of mutein according to any one of claims 1 to 14.

34. Vector on p representing pagedn the th vector.

35. A host cell for expression mutein according to any one of claims 1 to 14, containing a nucleic acid molecule according p or vector according to any one of p-34.

36. Pharmaceutical composition having binding activity of c-Met person, containing an effective amount mutein of lipocalin tear fluid of a person as defined in any one of claims 1 to 14, fused protein according to any one of p-18 or conjugate according to any one of p-31 and pharmaceutically acceptable excipient.

37. The method of obtaining mutein of lipocalin tear fluid of a person as defined in any one of claims 1 to 14, including
(a) culturing the host cell according p under conditions suitable for the expression of mutein(s), and
(b) removing downregulation(s) mutein(s) from the host cell or its culture.

38. A method of treating diseases or disorders that involve the way HGF/c-Met, including the introduction of a pharmaceutical composition for p to a subject in need of it.

39. The method according to § 38, where the disease or disorder is a cell proliferative disorder.

40. The method according to § 38 or 39, where the disease or disorder is a cancer.

41. The method according to p where specified cancer is a liver cancer, rectal cancer, colorectal cancer, hepatocellular carcinoma, papillary renal carcinoma, squamous cell of carcino the head and neck (HNSC) or metastatic squamous cell carcinoma of the head and neck lymph nodes.

42. Application mutein of lipocalin lacrimal fluid of humans according to any one of claims 1 to 14, fused protein according to any one of p-18 or conjugate according to any one of p-31 for detecting in vitro receptor tyrosine kinase Met man (c-Met) or a domain or fragment of c-Met person, which includes stages:
bring mutein, fused protein or conjugate in contact with the sample, which assumes the presence of the receptor tyrosine kinase Met man (c-Met) or a domain or fragment of c-Met person, in suitable conditions, thereby ensuring the formation of a complex between muteena, fused protein or conjugate and receptor receptor Met man (c-Met) or a domain or fragment of the c-Met man and
detection associated mutein, fused protein or conjugate with an appropriate signal.

43. Application mutein of lipocalin lacrimal fluid of humans according to any one of claims 1 to 14, fused protein according to any one of p-18 or conjugate according to any one of p-31 for selection in vitro receptor tyrosine kinase Met man (c-Met) or a domain or fragment of c-Met person, including:
bringing mutein, fused protein or conjugate in contact with the sample, which assumes the presence of the receptor tyrosine kinase Met man (c-Met) or a domain or fragment of c-Met person, in suitable conditions, thereby providing images of the of the complex between muteena, fused protein or conjugate and receptor receptor Met man (c-Met) or a domain or fragment of the c-Met man and
the selection of the specified complex from the sample.

44. The application of § 42 or 43, where this complex is associated with a solid carrier.

45. Application mutein of lipocalin lacrimal fluid of humans according to any one of claims 1 to 14 for targeting pharmaceutically active compound to a pre-selected site which should be treated in this connection, in the organism or tissue, comprising the steps:
conjugation mutein with the specified connection and
delivery of complex mutein/link to pre-selected area.

46. The application of § 45, where the pharmaceutically active compound selected from the group consisting of a toxin, a cytostatic agent or antagonist to c-Met.

47. The application of § 46, where the toxin is selected from the group consisting of pertussis toxin, diphtheria toxin, ricin, saporin, pseudomonades of exotoxin, calicheamicin or its derivative, taxoid, maytansinoid, tubulysin and analog dolastatin.

48. Use p, where the analogue of dolastatin selected from the group consisting of auristatin E, monomethylaniline E, auristatin PYE and auristatin PHE.

49. The application of § 46, where the cytotoxic agent is selected from the group consisting of cisplatin, carboplatin, oxaliplatin is on, 5-fluorouracil, Taxotere (docetaxel, paclitaxel, anthracycline (doxorubicin), methotrexate, vinblastine, vincristine, vindesine, vinorelbine, dacarbazine, cyclophosphamide, etoposide, adriamycin, camptothecin, compounds related combretastatin A-4, sulfonamides, oxadiazolyl, benzo[b]teofanov, synthetic spirochetal pyrans, anotheraggravating compounds, Kuracina and derivatives Kuracina, derived methoxyestradiol and leucovorin.

50. The application of § 46, where the antagonist to c-Met is selected from the group consisting of a monoclonal antibody, a derivative of 1,3,5-triazine-2,4-diamine derivative of 2-(2,6-dichlorophenyl)imidazole, nitrogen-containing bicyclic derivative, 5-benzylchloride and pyrrolidine, substituted sulfonamide.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to laboratory diagnostic techniques for a negative impact of formaldehyde on the conjugation and elimination dysfunction of the glutathione system in children living on the territory with the high content of this compound in the atmospheric air. The technique implies as follows: blood is sampled from the children to determine whole blood formaldehyde and to determine a serum activity of the following laboratory parameters: glutathione peroxidase, glutathione-S-transferase and glucoso-6-phosphate dehydrogenase. The blood formaldehyde value and the above laboratory values are correlated. If the following certain dependences are simultaneously provided: high formaldehyde - low glutathione peroxidase, glucoso-6-phosphate dehydrogenase activities and high glutathione-S-transferase activity, the negative impact of formaldehyde on the conjugation and elimination dysfunction of the glutathione system of a child's body.

EFFECT: enabled early prediction of the conjugation and elimination dysfunction of the glutathione system.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: blood serum lipoprotein-associated phospholipase A2 (Lp-PLA2) biomarker is measured in a patient with progressive cerebral atherosclerosis after carotid angioplasties no more than 6 months later using immunoenzyme method; if the derived value is 360 ng/ml and more, developing neointimal hyperplasia and carotid restenosis are stated.

EFFECT: method provides high-accuracy detection of developing neointimal hyperplasia and carotid restenosis in the patients suffering progressive cerebral atherosclerosis following carotid angioplasties.

FIELD: medicine.

SUBSTANCE: invention refers to medicine. The substance of the technique consists in adding 10% tezit 25 mcl to chloroform extract of lipids 10 mil with the mixture simultaneously stirring with using a shaker at 20°C and a vibration frequency of a platform 120 a minute for 30 minutes to prepare a transparent solution of lipids for enzymatic triacylglyceride test.

EFFECT: method enables providing higher effectiveness and accuracy of the tissue lipid test.

FIELD: medicine.

SUBSTANCE: invention refers biotechnology and medicine. What is presented is a method based on measuring interleukin IL1B, IL8, IL10 and IL18 gene iRNA expression in vaginal smears in relation to the presence of iRNA of the reference genes B2M, GUS, TBP or HPRT; the derived expressions are used to calculate canonical linear discriminant function (CLDF) as follows: Y=1.09*IL1B-0.61*IL8+0.21*IL10-0.11*IL18-0.91 (formula 1), wherein IL1B is relative IL1B expression, IL8 is relative IL8 expression, IL10 is relative IL10 expression, IL18 is relative IL18 expression; IL=2^(Cpmin-Cpil)/NF (formula) wherein IL is relative interleukin gene expression, Cpmin is a coefficient of minimum expression, for IL1B Cpmin=17.9; IL8 Cpmin=16.6; IL10 Cpmin=28.8; IL18 Cpmin=23.3; Cpil is a threshold cycle of related IL in a sample determined automatically; NF is a rate setting factor calculated by formula 3: NF=4NFgus*NFhprt*NFb2m*NFtbp (formula 3) wherein NF is a rate setting factor calculated as a geometrical mean of 4 rate setting factors for reference genes (see formula 4); NFref=2^(Cpmin-Cpref) (formula 4), wherein NFref is a rate setting factor for the reference gene, Cpmin is a coefficient for minimum expression of the reference gene, Cpref is the threshold readings in the sample; Cpmin for the reference genes are as follows: GUS Cpmin=26.5; HPRT Cpmin=26.8; B2M Cpmin=18.9; TBP Cpmin=28.4; if CLDF≤0.1, the absence of vaginitis is stated; CLDF>0.1 stands for vaginistis.

EFFECT: invention enables the objective detection of the presence of vaginitis in a pregnant woman.

2 cl, 1 dwg, 3 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: DNA is recovered from patient's peripheral venous blood lymphocytes. That is followed by genetic typing of polymorphic versions of rs7216389 gasdermin B (GSDMB) gene, rsl2342831 beta 1,4-galactosyl trabsferase 1 (B4GALT1) gene and rsl496499 binding insulin-like growth factor protein 3 (IGFBP3) gene. If observing one of the combinations of genotypes by three polymorphous loci of the genes; GSDMB*rs7216389C/T B4GALTl*rsl2342831T/T - lGFBP3*rsl496499T/G; GSDMB*rs7216389T/T -B4GALTl*rsl2342831T/T - IGFBP3*rsl496499T/G\ GSDMB*rs72J6389T/T -B4GALT1*rsl234283 JT/T - IGFBP3*rsl496499T/T, a risk of developing bronchial asthma in individuals of various ethnicities is predicted.

EFFECT: effective method for prediction the risk of developing bronchial asthma and promotes the working out of preventive measures considering the patient's traits.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: differential diagnostic of the variants of a disturbed myocardial conduction system in the children is ensured by a patient's clinical and laboratory examinations. That is followed by an electrocardiographic examination. The blood is examined for anti-cardiolipin antibodies ACAT to individual cardiac structure antigens; an increase of titres thereof with respect to the norm shows the presence of an inflammatory process in the respective myocardial structures. If the ECG shows a rhythm disturbance with underlying increase of the ACAT titre to the myocardial conduction system, the version of the disturbed myocardial conduction system in the form of the rhythm disturbance is diagnosed. If the ECG shows a conductance disturbance with underlying increase of the cardiomyocyte ACAT titre to the myocardial conduction system, the version of the disturbed myocardial conduction system in the form of the conductance disturbance is diagnosed. According to the ECG findings, a ST-T line's position above or below an isoline, and the increase of cardiomyocyte ACAT titre enables diagnosing the version of the disturbed myocardial conduction system in the form of a disturbed ventricular repolarisation.

EFFECT: invention provides the early adequate therapy and prevents the developing life-threatening complications.

3 ex

FIELD: medicine.

SUBSTANCE: what is being studied is the pure S. areus culture in the concentration of 1 bln/ml. There are at least 25 erythrocytes examined to determine an average microbial count adhered onto one erythrocyte. An adhesion substrate is presented by sheep erythrocytes in the concentration of 100 mln/ml pre-washed in 50% formaline.

EFFECT: qualitative and quantitative instant diagnosing of an intensity of the S areus adhesion properties.

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and a method of detecting O-glycosylated proteins in cell homogenates that are prepared for proteomic and phosphoproteomic analysis. The disclosed invention can be used to perform proteomic and phosphoproteomic analysis. The method involves performing two-dimensional electrophoresis, followed by identification of spots using MALDI-TOF spectroscopy and phosphoproteomic techniques. The cell homogenates are desalinated by gel-penetrating chromatography or dialysis. The cell homogenates are subjected to glycosylation based on a β-elimination principle in a 0.05 M NaOH solution which contains 38 mg/ml NaBH4 for 16 hours at +45°C, followed by addition of cyanine dye JC-1 in concentration of 10-6 M. The cell homogenates are incubated for 15 minutes at room temperature. The homogenates are concentrated by precipitation with 50% acetone, subjected to two-dimensional electrophoresis to form electrophoregrams which are analysed for fluorescence when illuminated on a blue light transilluminator with an amber light filter, which visually appears in form of strips which are fluorescent in the dark. Said strips are extracted from the gel and used to perform proteomic or phosphoproteomic analysis. Further analysis of intensity and arrangement of the extracted strips is performed by comparing silver nitrate-coloured electrophoregrams of homogenates before and after a deglycosylation procedure.

EFFECT: disclosed invention enables to identify proteins which change their composition or degree of O-glycosylation as a result of any physiological action on the cell.

5 dwg

FIELD: medicine.

SUBSTANCE: method for the prediction of the length of abscess formation accompanying a sequestration phase of acute pancreatitis involves the DNA recovery from peripheral venous blood, the polymorphism analysis of +250 A/G Ltα, and if observing the genotypes +250 GG or +250 AG Ltα, a risk of early abscess formation accompanying the sequestration phase of acute pancreatitis is predicted.

EFFECT: higher prediction accuracy.

1 tbl, 2 dwg

FIELD: medicine.

SUBSTANCE: predicting in vitro an ability of a cartilage cell population to produce a stable hyaline cartilage in vivo of the cell population ensures determining an expression of a number of marker genes comprising a positive marker FRZB (Frizzled-like protein I), a negative marker ALK1 (Activine A Receptor, Type II-Like Kinase) and one or more markers specified in a group consisting of a negative marker PEDF (Pigment epithelium derived factor), a positive marker COL11 (Collagen, Type XI AI), a positive marker COL2 (Collagen, Type II. Alpha I) and a positive marker FGFR3 (Fibroblast growth factor receptor 3). The expression levels of each specific marker are presented by a numerical value. The numerical values are combined into a cumulative value, wherein the cumulative value shows an ability to produce the stable cartilage.

EFFECT: effective prediction of the ability of the cartilage cell population to produce the stable hyaline cartilage in vivo.

6 cl, 4 dwg, 11 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: claimed invention relates to field of microbiology and deals with method of obtaining RTX-toxin ApxI. Claimed method is realised by cultivation of bacteria Actinobacillus pleuropneumoniae in culture medium, which provides growth of bacteria, and said culture medium contains borogluconate in concentration lower than 60 mmol/l in order to form in medium calcium-bologluconate complex.

EFFECT: invention makes it possible to increase output of RTX-toxin ApxI, which can be applied in production of vaccines.

5 cl, 4 tbl

FIELD: biotechnologies.

SUBSTANCE: invention refers to a method for obtaining an antibody, the pharmacokinetic properties of which have been changed at maintaining antigen-binding activity of a variable area, which provides for the following stages: (a) obtaining antibodies in which there has been modified a charge of amino-acid residues chosen from amino-acid residues in positions 31, 61, 62, 64 and 65 of the variable area of a heavy chain and in positions 24, 27, 53, 54 and 55 of the variable area of a light chain in compliance with numbering as per Kabat system, where modification of the charge of amino-acid residues leads to the change of 1.0 or more at a theoretical isoelectric point of the variable area of the antibody, and (b) extracting an antibody with stored antigen-binding activity from antibodies obtained at stage (a).

EFFECT: invention allows effective change in pharmacokinetic properties of an antibody, thus maintaining its antigen-binding activity.

FIELD: biotechnologies.

SUBSTANCE: invention relates to method for obtaining of RTX-toxins Apxl or ApxIII by culturing of Actinobacillus pleuropneumoniae bacteria in liquid culture media. Characterised method consists in the following: during exponential growth phase of bacteria and production of RTX-toxins air passes through the medium, carbon dioxide content in air is above normal atmospheric level and is up to 10 % vol.

EFFECT: invention allows increasing Apxl or ApxIII toxins output, this may be used during vaccines production.

7 cl, 4 tbl

FIELD: biotechnologies.

SUBSTANCE: physiologically active protein or polypeptide are fused with version of alpha-1-antitrypsin, which has at least one mutated aminoacid residue. Mutations are performed in the following positions: asparagine residue instead of proline residue in position 357; or asparagine residue instead of proline residue in position 357 and threonine residue instead of serine in position 359; or asparagine residue instead of proline residue in position 357 and serine residue instead of cysteine in position 232; or asparagine residue instead of proline residue in position 357, threonine residue instead of serine in position 359 and serine residue instead of cysteine in position 232.

EFFECT: invention allows increasing half lifetime of physiologically active protein or polypeptide in vivo by maintaining its stable circulation in blood.

7 cl, 13 dwg, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method involves cultivation in the appropriate conditions of yeast Saccharomyces cerevisiae and release of target protein; besides, release is directed with leader polypeptide, which has amino acid sequence SEQ ID NO1 and representing a variant of a pro-area of leader polypeptide of protein PpPIRl Pichia pastoris.

EFFECT: invention enlarges the range of methods for obtaining target protein in yeast Saccharomyces cerevisiae and increases possibilities for effective synthesis of such proteins.

2 dwg, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant human blood coagulability factor VIII with deletion of B-domain (hFVIII-BDD). Recombinant plasmid DNA pAP227 coding polypeptide with sequence hFVIII-BDD also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 2H5 producing recombinant hFVIII-BDD with highly stable yield at the level of about 20 IU/ml/24 h. Cultivation of cells-producers is performed in medium DME/F12 containing 2-4% of Fetal Bovine Serum, 1% of dimethylsulphoxide and 50 IU/l of insulin.

EFFECT: improvement of the method.

4 cl, 5 dwg, 9 ex

FIELD: biotechnologies.

SUBSTANCE: recombinant plasmid DNA pBK415 coding polypeptide with sequence of tissular activator of human plasminogen, also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 1F8 producing recombinant protein of tissular activator of plasminogen with highly stable yield at the level of up to 190 mg/l. Cultivation of cells-producers is performed under perfusion conditions in presence of a mixture consisting of additive CHO Bioreactor supplement and sodium butyrate or dimethylsulphoxide with further separation of a target product.

EFFECT: improvement of the method.

5 cl, 5 dwg, 3 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant blood coagulability factor IX of human being (hFIX). Recombinant plasmid DNA pAK380 containing gene of protein rhFIX, MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transcription enhancer CMV and an internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase for stability to geneticin (Neo), a cassette for expression in bacteria cells of gene β-lactamase for stability to ampicillin, is used for obtaining recombinant factor hFIX in cells of line Cricetulus griseus CHO 1E6. By transformation of cell line C. griseus CHO DHFR - recombinant plasmid DNA pAK380 there obtained is cell line C. griseus CHO 1E6 producing recombinant hFIX with stable high yield at the level of 50 mg/l/24 h. After cultivation of cells-producers there extracted is hFIX by pseudoaffine chromatography on Q Sepharose with elution of 10mM CaCl2; then, on Heparin-Sepharose FF with elution of 600 mM NaCl, and chromatography on hydroxyapatite of type I with elution of 600 mM K3PO3 and chromatography on Source 30Q with elution of 600 mM with ammonium acetate.

EFFECT: improvement of the method.

4 cl, 5 dwg, 7 ex, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: method involves introduction to a plant, some part of the plant or a plant cell of nucleotide sequence for 80-100% of identical nucleotide sequence determined in SEQ ID NO: 17, and coding a composite protein containing a cytoplasmic end segment, a transmembrane domain, a steam area (CTS domain) of N-acetylglucosaminyl transferase (GNT1), which is merged with catalytic domain of beta-1,4-galactosyl transferase (GalT); with that, the above first nucleotide sequence is functionally connected to the first regulatory area being active in the plant; and the second nucleotide sequence for coding of a target protein; with that, the above second nucleotide sequence is functionally connected to the second regulatory area being active in the plant, as well as transient co-expression of the first and the second nucleotide sequences with synthesis of the target protein containing glycans, with reduced xylosylation, reduced fucosylation or their combination at comparison to the same target protein obtained from a wild plant. The invention described nucleic acid coding the protein that modifies glycosylation of target protein, a composite protein for modification of glycosylation of target protein; nucleic acid that codes it, as well as a plant, a plant cell and a seed, which contain the above nucleic acid or the above composite protein.

EFFECT: invention allows effective production of a target protein with reduced xylosylation, reduced fucosylation or their combination.

20 cl, 7 dwg, 9 ex

Vns-met-histones // 2498997

FIELD: biotechnologies.

SUBSTANCE: nucleic acid molecule codes a polypeptide consisting of two residues of methionine as the first and the second N-end amino-acid residues connected through a peptide link to a mature eucariotic histone. Polypeptide is obtained by cultivation of a host cell transformed by an expression vector including the above molecule of nucleic acid. Polypeptide is used as part of pharmaceutical composition for therapy of cancer, bacterial, virus or fusarium infections. Besides, polypeptide is used as part of composition for diagnostics of a patient in relation to response to pharmaceutical composition containing the above polypeptide, or in relation to curability using it.

EFFECT: invention allows improving efficiency of recombinant expression and simplifying determination of the above polypeptide in presence of endogenic histones at preservation of biologic activity of mature eucariotic histone.

17 cl, 3 dwg, 6 tbl, 7 ex

FIELD: biotechnology.

SUBSTANCE: viable lymphocytes are obtained from the walls of the small intestine (lamina propria) of CBA mice while using biological material of three mice. The source biological material is a part of intestine, which is washed with phosphate-buffered solution, and the Peyer's glands are removed. It is milled in the presence of phosphate-saline solution containing dithiothreitol under stirring at room temperature. It is washed with the buffer solution through a nylon mesh. The material is incubated in the buffered solution containing bovine serum albumin with stirring under the specified conditions. The supernatant liquor is removed. The precipitate is washed with phosphate-saline buffer. The precipitate of the biological material is incubated in the cellular medium RPMI-1640 comprising fetal calf serum, HEPES and collagenase with stirring under the specified conditions, and the resulting suspension is filtered. The suspension is washed from the residues of collagenase, and the lymphocyte cells are precipitated in the cellular medium RPMI-1640 comprising fetal calf serum and HEPES using centrifugation under specified conditions, followed by determination of yield of viable cells using the Goryaev chamber.

EFFECT: invention enables to increase the yield of viable cells from the small intestine of a mouse.

1 ex

Up!