Prevention of formation and/or stabilisation of thrombi

FIELD: medicine.

SUBSTANCE: claimed group of inventions relates to medicine, in particular to hematology, and can be applied for prevention of formation and/or stabilisation of pathological thrombi. Claimed is application of, at least, one antibody, which inhibits factor XII. Also claimed is pharmaceutical preparation, which contains, at least, one antibody inhibiting factor XII.

EFFECT: inventions make it possible to prevent growth of three-dimensional intra-luminal thrombus without manifestations of effect of hemostasis.

7 cl, 7 dwg

 

The present invention, considered in its broadest sense, refers to the prevention of the formation and/or stabilization of three-dimensional arterial or venous blood clots.

In particular, the present invention relates to the use of at least one antibody and/or one inhibitor for inhibiting the activity of factor XII and prevent the formation and/or stabilization of blood clots and growth of blood clots. The invention also relates to a pharmaceutical composition and the use of factor XII as antithrombotic agents.

Damage to the walls of blood vessels immediately leads to adhesion and aggregation of platelets, followed by activation of the coagulation system and plasma formation containing fibrin clot, which overlaps the damaged area. These events are critical to limit post-traumatic blood loss, but can also lead to blockage of the affected vessels, leading to ischemia and infarction of vital organs. In the cascade model (waterfall model) coagulation proceeds in a sequence of reactions involving activation of imagenow limited proteolysis, which ultimately leads to a very rapid formation of thrombin, which converts fibrinogen plasma into fibrin and effectively activates platelets. In turn coupled with call the genome or fibrin platelets increase the formation of fibrin by several orders of magnitude by exposing proco-agulant phosphatidylserine (PS) on its outer surface, that speeds up the Assembly and activation protease complexes coagulation, and by direct interaction between receptors of platelets and coagulation factors.

To collapse there are two converging paths that run either external (vessel wall) or internal (educated in the blood) components of the vascular system. "External" path is initiated by a complex factor VII (FVII) plasma and integral membrane protein tissue factor (TF), a key cofactor clotting, which is absent on the surface of the inner side of the vessel, but is expressed intensively in the subendothelial layer of the vessel. TF expressed in micro-cavities in the circulatory system, can also give a contribution to the propagation of the thrombus by supporting the formation of thrombin on the surface of activated platelets.

"Internal" or contact path activation is initiated when factor XII (FXII, the factor of Hageman) is in contact with negatively charged surfaces in the reaction, which involves high kininogen and kallickrein blood plasma. FXII can be activated macromolecular components of the subendothelial matrix, such as glycosaminoglycans and collagens, sulfatides, nucleotides and other soluble polyanion, or non-physiological materials such as glass or polymers. One the of the most effective contact activators is kaolin, and this reaction is the basis of the main clinical test for coagulation, (activated) partial thromboplastin time (PTT, aPTT). In the reaction of stimulated platelets, activated FXII then activates FXI, a FXIa in turn activates factor IX. Regardless of its high efficiency in inducing blood clotting in vitro (Pato)physiological significance of the startup factor FXII inner path of coagulation is put into doubt by the fact that the inherited lack of FXII, and high-molecular-weight kininogen and kallikrein blood plasma is not associated with hemorrhagic complications. In combination with observations, which revealed the fact that humans and mice lacking components of the outer path, such as TF, FVII or factor IX, suffering from severe bleeding, this leads to the currently accepted hypothesis that fibrin formation in vivo is initiated solely by the external cascade (Mackman. N. (2004). Role of tissue factor in hemostasis, thrombosis, and vascular development. Arterioscler. Thromb. Vase. Biol. 24, 1015-1022).

Like any physiological mechanism of the coagulation cascade can be activated incorrectly, which results in the formation of hemostatic barriers in the blood vessels. As a result, the blood vessels can become blocked and the blood supply to distal organs may be reduced. This is the process known as thrombosis and is associated with high mortality. In addition, the use of protesilaus devices that are in contact with blood, is extremely limited due to activation of the coagulation cascade and formation of deposits on the surface of the prosthesis, which often violates its functionality. Examples of such prostheses are devices hemodialysis, cardiopulmonary shunts, vascular stents and permanent catheters. When using such devices to prevent the deposition of fibrin on the surface are used anticoagulants, such as heparin. However, some patients cannot tolerate heparin, which can cause thrombocytopenia (HIT), leading to platelet aggregation and life-threatening thrombosis. In addition, all anticoagulants used in the clinic, are naturally associated with an increased risk of heavy bleeding. Thus, there is a need for new types of anticoagulants that are not associated with these complications and which can be used for patients or for improved therapy to prevent thrombosis without increasing the likelihood of bleeding.

In this regard, is also an obvious need for improved drugs for the treatment or prophylaxis of thrombosis or similar disorders. Thus, the satisfaction of these needs is th is task solved by the present invention. For more than fifty years, it is known that a deficiency of factor coagulation FXII is not associated with increased spontaneous or trauma-related bleeding complications (Ratnoff, O.D. & Colopy, J.E. (1955) A familial hemorrhagic trait associated with a deficiency = MKD of a clot-promoting fraction of plasma. J Clin Invest 34, 602-13). Indeed, although they demonstrate abnormal aPTT (clinical test for coagulation, which refers to the inner path of coagulation), people with deficiency of FXII not suffer from abnormal bleeding even during extensive surgery (Colman, R.W. Hemostasis and Thrombosis. Basic principles &clinical practice (eds. Colman R.W., Hirsch. J., Mader V.J., Clowes A.W., & George J.) 103-122 (Lippincott Williams & Wilkins, Philadelphia, 2001). On the contrary, the FXII deficiency is associated with an increased risk of venous thrombosis (Kuhli, C, Scharrer, I., Koch, F., Ohrloff, C. & Hattenbach, L.O. (2004) Factor XII deficiency = MKD: a thrombophilic risk factor for retinal vein occlusion. Am. J. Ophthalmol. 137, 459-464., Halbmayer, W.M., Mannhalter C, Feichtinger, C, Rubi, K. & Fischer, M. (1993) Factor XII (Hageman factor) deficiency = MKD: a risk factor for development of thromboembolism. Incidence of factor XII deficiency = MKD in patients after recurrent venous or arterial thromboembolism and myocardial infarction. Wien. Med. Wochenschr. 143, 43-50). Research and case histories, confirming this assumption, refer to the index case of deficit factor FXII, the case of John Hageman, who died of a pulmonary embolism. The hypothesis that a deficiency of factor FXII associated with an increased risk of blood clots, questioned the recent who review of several cases, in which it is reported on the relationship of the deficit factor FXII with thrombosis (Girolami, A., Randi, M.L, Gavasso, S., Lombardi, A.M. & Spiezia, F. (2004) The Occasional Venous Thromboses Seen in Patients with Severe (Homozygous) FXII deficiency = MKD are Probably Due to Associated Risk Factors: A Study of Prevalence in 21 Patients and Review of the Literature. J. Thromb. Thrombolysis 17, 139-143). In most cases, the authors in conjunction with deficiency of factor FXII identified related congenital or acquired risk factors for thrombosis, which could be responsible for cases of thrombosis regardless of FXII. The most extensive epidemiological studies involving well-characterized patients (Koster, T., Rosendaal, FR, Briet, E. & Vandenbroucke, J.P. (1994) John Hageman's factor and deep-vein thrombosis: Leiden thrombophilia Study. Br. J. Haematol. 87, 422-424) and families with deficiency of factor FXII (Zeerleder, S. et al. (1999) Reevaluation of the incidence of thromboembolic complications in congenital factor XII deficiency = MKD-a study on 73 subjects from 14 Swiss families. Thromb. Haemost. 82, 1240-1246) revealed no correlation between the deficit factor FXII and the risk of blood clots, or the risk of blood clots.

Unexpectedly and contrary to all the established views of specialists in the applicants have found that the intrinsic coagulation pathway of blood associated with factor XII is essential for clot formation in vivo, but is not necessary for normal tissue-specific hemostasis. These results change long-established concept, sanlucas the Yuexiu is what blood coagulation in vivo is mediated solely by external, and indicate the factor XII as playing a key role in the pathological formation of blood clots.

Accordingly, the first problem to be solved by the present invention, is the use of at least one antibody and/or at least one inhibitor for the inhibition of factor XII and prevent the formation and/or stabilization of three-dimensional arterial or venous blood clots. Anti-FXII antibody or the corresponding inhibitor may function in such a way as to inhibit the activation of FXII and/or to interfere with other parts of the molecule FXII, which are substantially involved in the activation of FXII.

Together with the fact that the internal path is not necessary for hemostasis, it indicates the factor XII as a new target for effective antithrombotic therapy. In addition, these results are important for the development of anti-FXII agents to control others (Pato)mechanisms associated with the contact system, such as inflammation, activation of complement, fibrinolysis, angiogenesis and education cinena.

Thus, the present invention additionally provides the use of such antibodies and/or inhibitors for the treatment or prevention of a condition or disorder associated with obrazovateljnogo clot, i.e. stroke or myocardial infarction, inflammation, activation of complement, fibrinolysis, angiogenesis and/or diseases associated with pathological education kinin, such as hypotonic shock, edema, including hereditary angioedema, bacterial infections, arthritis, pancreatitis or articular gout.

In particular, the use of at least one anti-FXII antibody (for example, F1 antibodies (MoAb F1, Ravon et al., Blood. 1995 Dec 1; 86 (11): 4134-43)) and/or use of at least one protease inhibitor for inhibiting the formation of thrombus, FXII mediated, is also the object of the present invention.

Especially preferred is the protease inhibitor is selected, for example, from the following groups: the inhibitor AT III, angiotensin-converting enzyme, C1 inhibitor, Aprotinin, a protease inhibitor alpha-1, antimaleware tool ([(S)-1-carboxy-2-phenylethyl]-carbarnoyl-L-Arg-L-Val-arginal), Z-Pro-Pro-aldehyde-dimethylacetal, DX88 (Dyax Inc., 300 Technology Square, Cambridge, MA 02139, USA; cited in: A. Williams and Baird LG., Transfus Apheresis Sci. 2003 Dec: 29 (3): 255-8), leupeptin inhibitors polloway lipopeptides, such as Fmoc-Ala-Pyr-CN, trypsin inhibitor from maize mutants of bovine pancreatic trypsin inhibitor, akoten, YAP (anticoagulant protein flounder yellowfin (Yellowfin sole)and inhibitor-V trypsin Curcurbita maxima, including isinhibited Curcurbita maxima.

According to the respectively, the present invention provides the use of such antibodies and/or inhibitor described herein, in medicine, and the use of such antibodies and/or inhibitor for the manufacture of a medicinal product.

Thus, in accordance with other aspect of the present invention provides a pharmaceutical composition containing at least one antibody and/or one inhibitor, which is suitable for the inhibition of factor XII and which prevents the formation and/or stabilization of three-dimensional venous or arterial thrombus.

In particular, the antibody used for the pharmaceutical composition is an anti-FXII antibody (e.g., such as F1 antibody (MoAb F1, Ravon et al., Blood. 1995 Dec 1;86(11):4134-43)), and the inhibitor is a protease inhibitor is selected, for example, without limitation, from the following groups: the inhibitor AT III, angiotensin-converting enzyme, C1 inhibitor, Aprotinin, a protease inhibitor alpha-1, antimaleware tool ([(S)-1-carboxy-2-phenylethyl]-carbarnoyl-L-Arg-L-Val-arginal), Z-Pro-Pro-aldehyde-dimethylacetal, DX88 (Dyax Inc., 300 Technology Square, Cambridge, MA 02139, USA; cited in: A. Williams and Baird LG., Transfus Apheresis Sci. 2003 Dec: 29 (3): 255-8), leupeptin inhibitors proletarisation, such as Fmoc-Ala-Pyr-CN, trypsin inhibitor from maize mutants of bovine pancreatic trypsin inhibitor, akoten, YAP (anticoa plenty protein flounder yellowfin (Yellowfin sole)and inhibitor-V trypsin Curcurbita maxima, including isinhibited Curcurbita maxima.

The antibody may also be a fragment or mimetic retained inhibitory activity, such as analogues of the domain of protease inhibitor type Marten protein-amyloid precursor described in patent US 6,613,890 (see, in particular, columns 4-8). Other suitable inhibitor can be Hamadarin unveiled Harahiko Isawa et al. in The Journal of Biological Chemistry, Vol.277, No.31 (August 2, pp.27651-27658, 2002). Suitable trypsin inhibitor from maize and methods of its production are disclosed in Zhi-Yuan Chen et al., Applied and Environmental Microbiology, March 1999, p.1320-1324 (also see reference 19 specified in this document). The contents of all the above documents are incorporated in this application in full. In conclusion, it should be noted that the small molecule is selected, for example, using the corresponding inhibition of FXIIa in the quality of analysis on which to base your selection, are also part of the invention, and their corresponding uses described above or below. These low molecular weight inhibitors FXIIa can be designed based on the crystal structure of FXII. Thus, multiple domains FXII or light chain can be recombinante expressed in this expression system such as E. coli, yeast, or mammalian cells. Then the protein is purified and crystallized using standard procedures, as description is but for FXI substrate FXII (Jin L, et al. (2005) Crystal structures of the FXIa catalytic domain in complex with ecotin mutants reveal substrate-like interactions. J Biol Chem. 280(6):4704-12). Alternatively can be enabled low-molecular inhibitors of serine proteases for stabilizing the structure of FXII. Such preparations containing low molecular weight inhibitors of protein targets that can be developed, for example with respect to the crystal structure of these target proteins are well known in the art and include pharmaceutical drugs, which can be, for example, introduced the patient systemically, for example parenterally, orally or topically.

The term "parenteral"as used herein includes subcutaneous, intravenous, intramuscular, intraarterial and intratracheal injection, instillation, the introduction in the form of spray and infusion. Parenteral compositions are preferably administered intravenously or in the form of a bolus or by continuous infusion or subcutaneously, according to known procedures. Preferred liquid carriers that are well known for use in parenteral administration include sterile water, saline, aqueous dextrose, solutions of sugars, ethanol, glycols and oils.

Tablets and capsules for oral administration may contain well-known excipients such as binding the e agents, fillers, lubricants, wetting agents, etc. Oral liquid formulations may be in the form of aqueous or oily suspensions, solutions, emulsions, syrups, elixirs, etc. or may be presented as a dry product, the recovered water or other suitable media to use. Such liquid compositions may contain known additives, such as suspendresume agents, emulsifying agents, non-aqueous carriers and preservatives.

Formulations suitable for topical application may be in the form of aqueous or oily suspensions, solutions, emulsions, gels or, preferably, emulsion ointments. Formulations suitable for application as a spray, can be in the form of atomized liquid or dry powder.

In accordance with a third aspect of the present invention provides the use of factor XII as antithrombotic targets by inhibition of factor XII, at least one antibody and/or one inhibitor and thus prevent the formation and/or stabilization of three-dimensional blood clots in the vessels.

The essence of the present invention, provide them with benefits and additional grounds set forth in the following detailed description of the performed experiments and their results, which should be read in conjunction with the accompanying drawings, described below./p>

When analyzing the functions of internal cascade of coagulation in hemostasis and thrombosis have used mice with deficiency of factor XII. Intravital fluorescence microscopy and ultrasonic measurement of flow parameters revealed a strong disturbance in the formation and stabilization of three-dimensional blood clots in various parts of the vascular arterial system. Introduction of mutant mice human factor XII restored the inner path of coagulation in vitro and the formation of arterial thrombi in vivo. From the point of view of the mechanics of the process, the procoagulant activity of internal path substantially mediated by activated platelets. These results indicate the internal cascade of blood coagulation initiated FXII as a key element in the formation of blood clots, linking plasma coagulation with platelet aggregation.

Figure 1 presents the analysis of blood coagulation in mice deficient in FXII: (A) bleeding Time from the tail vein of wild-type mice (n=12) and FXII-/- mice (n=11). Each symbol represents one individual. (B) Measurement of peripheral blood in thousands/ál and the parameters of the global coagulation for wild-type mice and FXII-/- mice. Transcript abbreviation: number of leukocytes (WBC), activated partial thromboplastin time (aPTT) and prothrombin time (PT). Value presented is Aut a mean ±SD of 10 mice of each genotype. (C) Proteins FXII contact system, kallickrein plasma (PK) and high molecular weight kininogen (HK) 0.3 ál plasma of wild-type mice and FXII-/- mice, determined by the method of Western blotting using specific antibodies. Standard molecular weight is shown on the left. (D) the clotting Time when rekaltsifikatsii was determined for plasma without platelets (upper part) and platelet-rich plasma (bottom)obtained from mice C57BL/6 and 129sv wt, FXII-/-, FcRγ-/- and deficient in integrin α2, upon activation by kaolin (dark columns) or collagen (light columns). The effect JON/A were analyzed in the plasma of C57BL/6 with the addition of 50 μg/ml antibody. Are average±STD 6 experiments.

Figure 2. (A) Observed mortality due to thromboembolic complications after intravenous injection of collagen (0.8 mg/kg) and epinephrine (60 µg/kg). Mouse wild-type die within 5 min. Animals surviving after 30 min after injection, were considered survivors. (B) the Number of platelets in the control (n=19), FXII-/- (n=14) and FcRγ-/- (n=5) mice after 2 min after infusion of collagen/epinephrine. (C) Heparinized platelet-rich plasma, obtained from wild-type mice and FXII-/- mice stimulated with collagen (10 μg/ml) or ADP (5 μm) and recorded the amount of light transmission in the standard aggregometry. Presents financial p the tats obtained for groups of six mice. (D) Stained with hematoxylin/eosin sections of the lungs of these mice after 2 min after injection of collagen/epinephrine. The number of blood clots in the field of view was counted at magnification 20×. Columns represent average ±SDT 100 fields of view.

Figure 3 shows the formation in vivo of defective thrombus in mice without factor XII. A blood clot was observed in vivo in mesenteric arterioles in the defeat caused 20% FeCl3. (A) Adhesion of single platelets were detected in all strains of mice after 5 min after damage, while after 7-8 min after damage watched first blood clots in wild-type mice, while in FXII-/-mice first blood clots appeared later 14-35 min after damage, and FXI-/- mice after 5-35 min after damage. (B) thrombus Formation in mesenteric arteries was observed in 100% of cases in wild-type mice, but only in 50% of cases in FXII-/- mice and in 44.4% of cases, the FXI-/- mice. (C) the Clots formed from wild-type mice, corked vessel on average after 25 min after damage, while the clots formed in mice deficient in FXII-/- and FXI-/-, does not cause clogging. Each symbol represents one observed in the arterioles. (D) Representative pictures of one experiment.

Figure 4. (A) wild-type Mice (n=10), FXII-/- (n=10) and FXI-/- (n=11) analizirovat and on the model of clogging arteries. Thrombosis was induced in the aorta through a single dense compression forceps. Blood flow was monitored using a perivascular ultrasonic flow sensor to a complete blockage. The experiment was stopped after 40 minutes Each symbol represents one individual. (B) Mechanical damage to the carotid artery initiated the application of a ligature. After removal of the filament was measured in μm2the area of the thrombus in wild-type mice (n=10) and FXII-/- (n=10). (C) On photomicrography presents representative images after 2 min after the application of the damage.

Figure 5 shows the defect of clotting in animals deficient in FXII, which was introduced human FXII. (A) Formation of a blood clot after injury induced FeCl3observed in mesenteric arteries in 100% of cases, as in wild-type mice, and FXII-/- mice, which were injected human FXII. (B) Forming clots corked vessel on average after 25 min after damage in wild-type mice and later 22,7 min after damage in FXII-/- mice, which were injected human FXII. Each symbol represents one individual. (C) Presents representative pictures. (D) FXII-/- mice received 2 mg/kg hFXII-/-, and in the aorta induced thrombosis through one tight compression forceps. Blood flow was monitored using a perivascular at travelog flow sensor to a complete blockage. The experiment was stopped after 40 minutes Each symbol represents one individual.

Figure 6 shows the in vivo inhibited anti-FXII antibody a blood clot in the mouse. Mouse wild type received 2 mg/kg anti-FXII antibody or inhuman IgG i.v. After 15 min monitored in vivo formation of a blood clot in mesenteric arterioles in the defeat caused 20% FeCl3. (A) Adhesion of single platelets was detected in both groups after 5 min after damage. After 7-8 minutes watched first blood clots in mice of the control group treated with IgG, whereas in mice treated with anti-FXII antibody, the first blood clots appeared later 12-32 minutes after damage. (B) thrombus Formation was observed in mesenteric arteries in 100% of cases in control mice, but only in 60% of cases in mice treated with anti-FXII antibody. (C) Shows the time to complete blockage. Each symbol represents one individual.

7 shows a revised model of the formation of a blood clot. First, in areas of foci of damaged vessels, the formation of thrombin due to exposure of tissue factor (TF) in the subendothelial matrix. TF in complex with FVII initiates the external path of blood clotting. On the site of the damage contribution FXII, mediating internal path through FXI with the formation of thrombin(FII), is insignificant and can be neglected in the case of normal hemostasis. Accordingly, individuals with deficiency of FXII not suffer from bleeding. The formation of thrombin initiates the formation of the clot by the formation of fibrin and activated platelets. The growth of thrombus: on the surface, open to the growing thrombus induced FXII inner path makes a significant contribution to the formation of thrombin. Activated FXII involving FXI additional forms fibrin. Accordingly, the shortage of both FXII and FXI is a serious violation of the process of formation of blood clots.

In the present invention the potential contribution of the inner path of coagulation in pathological thrombus formation in vivo was evaluated using a model of arterial thrombosis, based on intravital microscopy and the measurement of flow parameters, using mice without factor XII. Despite the fact that the initial adhesion of platelets to sites of damage in mutant animals is not changed, the subsequent formation and stabilization of the three-dimensional blood clots accompanied by serious violations. This violation was observed in the various branches of the vascular network and were completely eliminated by using exogenous factor XII man. These facts indicate mediated by factor XII intrinsic coagulation pathway of blood as the primary link, the light is yuusei primary and secondary hemostasis in the revised model of blood clots.

For analysis of functions of FXII in blood coagulation in vivo bred mice with deficiency of FXII. FXII-/- mice were healthy individuals, barren and phenotypically indistinguishable from odnopolnyh wild-type animals. Detailed histological and hemostatic analysis revealed no correlation with increased thrombosis and bleeding in FXII-/- mice, despite increased aPTT, equal to 68±17 sec, and the time rekaltsifikatsii equal to 412±78 sec, plasma selected from retroorbital sine (wild type: 23±4 and 210±31 sec) (Pauer.H.U., et al. (2004). Targeted deletion of murine coagulation factor XII gene is a model for contact phase activation in vivo. Thromb. Haemost. 92, 503-508). As well as people with deficiency of FXII, FXII-/- mice are prone to bleeding, as evidenced by the bleeding time when the incision of the tail, similar to that found in wild-type animals (369.5±201,7 and 355,9±176,1 sec, respectively, n=12 per group, Figa). The number of cells in the peripheral blood in the mutant mice did not differ from control wild-type. It should be noted that the prothrombin time (PT) in FXII-/- mice and wild-type mice was similar (8,9±1,3 and 9.1±1,3 sec), which indicates that the lack of FXII not have a negative impact on the formation of fibrin external blood clotting system (Pigv). To assess potential differences procoagulant activity of FXII between human and mouse plasma of a person with deficiency of FXII (FXII<1%) recovered plasma is Oh wild-type mice, or Vice versa, and determined PTT blends. In each case showed normalization of the clot formation, which confirms the assumption that the function of FXII in the formation of the clot is comparable in humans and mouse.

In humans, as in the case of FXII deficiency, deficiency of proteins of the contact system of plasma kallikrein (PK) and high molecular weight of kininogen (HK), does not lead to an increased risk of bleeding, despite increased aPTT. To confirm that the increase in aPTT in FXII-/- mice is not a consequence of additional defects in the proteins of the contact phase was the analysis of PK and HK plasma of wild-type mice and FXII-/-. According to the Western blot analysis of the levels of HK and PK were equivalent in the mutant mice and wild-type mice (Figs). Functionally, in FXII-/- plasma exposed to collagen or kaolin, processing and formation of thrombin were significantly impaired compared to wild type.

Blood coagulation and platelet activation are complementary and interdependent processes. Platelets interact with multiple coagulation factors and contribute to their activation, and the main product of coagulation, thrombin is a potent activator of platelets. It was therefore conducted a more detailed study of the contribution of platelets and FXII in the formation of a clot. With this goal in what was chiravalle coagulation, using either kaolin, which classically activates FXII, but does not have direct effects on platelets, or collagen, which activates as FXII, and platelets, where it interacts with multiple receptors, the most important of which are the integrin α2β1 and GPVI. In the presence, but not in the absence of platelets, collagen is very well suited for the formation of a clot in the plasma of wild-type (Fig.1D). On the contrary, in a plasma containing defective in activating FcRγ-/- platelets, the relative efficiency Colina and collagen was similar to PFP (plasma without platelets), and a similar effect was observed with PRP (plasma rich in platelets) of integrin α2-/- mice. Procoagulant activity of platelets also now started collapsing in the plasma, and it was shown that fibrin (fibrinogenesis) receptor αllbβ3 plays a key role in this process, although the underlying mechanisms are not well understood. In accordance with these results, the antibody JON/A blocking function αllbβ3, significantly inhibited dependent platelet reducing clotting time (Fig.1D). Together, these results demonstrate that platelet procoagulant state can mediate induced FXII the formation of a clot.

To determine whether induced stake is the Agen activation of FXII functional consequences in vivo, in wild-type mice and FXII-/- mice were implemented model of fatal pulmonary thromboembolism induced by infusion of a mixture of collagen (0.8 mg/kg body weight) and epinephrine (60 µg/kg body weight). All control mice (19/19) died within 5 minutes from extensive thrombosis pulmonary and cardiac arrest, which was accompanied by more than 95% decrease in the number of platelets in the bloodstream after 2 min after impact (Figa, 2B). In these experimental conditions survived to 35.7% (5/14) FXII-/- mice, although the number of peripheral platelets also decreased as that of the control wild-type mice, which indicates that the observed protection is not based on a defect of platelet activation. This assumption was confirmed by in vitro studies showed that FXII-/- platelets Express normal levels of the major surface glycoproteins, including collagen receptors, and that these cells are normally activated by the classical agonists, such as thrombin, adenosine diphosphate (ADP) or GPVI-specific agonist, related to collagen peptide (measured by the activation of expression of αllbβ intergen and P-selectin). In accordance with these results, FXII-/- platelets demonstrate unmodified aggregation response to collagen, ADP (Figs), PMA or thrombin.

In a parallel series of experiments, FcRγ-/- mice which were advergames the effect of collagen/epinephrine. These mice were completely protected from death and the platelet count is not greatly decreased after 2 minutes after exposure, which confirms the binding of activated platelets to ensure death in this model. These data were further confirmed by results of histological analyses of lung slices derived from mice of different groups. Although wild-type mice, the vast number of vessels was clogged, this effect was significantly reduced in FXII-/- mice (survivors and victims). In accordance with previous publications in the lungs FcRγ-/- almost was not detected thrombus (Fig.2D). These results indicate that in vivo collagen starts as activation of platelets and FXII mediated inner path of blood clotting, which in this model act synergistically, creating a pulmonary embolism.

The pathological formation of blood clots often initiated by rupture or sudden destruction of atherosclerotic plaques in the arterial branch of the vascular network, which leads to strong non-physiological platelet activation and procoagulant activity on the surface of the subendothelial layers. To assess the role of FXII in these processes studied thrombus formation in mice wild-type and FXII-/- mice, using different models of arterial the x damage. In the first model induced oxidative damage in mesenteric arterioles (60-100 µm in diameter) and investigated the formation of blood clots using in vivo fluorescence microscopy. Mouse wild-type and FXII-/- mice received labeled with fluorescent-labeled platelets (1×108) of the same genotype, and the damage induced by topical blend for 1 minute filter paper soaked in 20% ferric chloride (FeCl3), which led to the formation of free radicals, leading to the destruction of the endothelium. The interaction of platelets to the damaged vessel wall started very quickly, and five minutes later after the damage amount is securely attached platelets was similar in both groups of mice (Fig. 3A). However, although wild-type mice adherent platelets continuously mobilized additional platelets from the bloodstream, resulting in formed units, this process has been greatly distorted in the mutant mice. In the control vessels in 100% (17/17) stable thrombi with a diameter of >20 μm was formed within 10 minutes after applying damage over time and steadily grew, leading ultimately to a complete blockage of blood vessels in 94.1% (16/17) cases during the observation time of 40 minutes (average time clogging of 25.6±8,9 min) (Figure 3). In contrast, in the mutant mice f is armirovanie of microaggregates or thrombus was completely absent in 50% (7/14) of the vessels. In the remaining 50% (7/14) of the vessels formed clots, which, however, were unstable and rapidly separated from the walls of the vessel. None of the vessels clots with a diameter of >20 μm did not remain attached to the affected area for longer than 1 minute. Accordingly, FXII-/- mice, none of the vessels are not backed up during the observation period (40 minutes). This unexpected result demonstrates that FXII necessary for the emergence and stabilization of platelet-rich thrombi in arterioles, damaged FeCl3and indicates that induced FXII path coagulation makes a significant contribution to the observed thrombotic response. This assumption was confirmed by the analysis of mice deficient in FXI, in the same model. Since FXI is the main substrate for FXII the "internal" cascade, these mice should also be a similar defect in the formation of blood clots. Indeed, practically the same as that of the FXII-/- mice are essentially normal adhesion of platelets at the site of damage was observed within the first three minutes after damage, whereas thrombus formation was completely suppressed in the vessels in 55.6% (5/9) cases. In the rest of the vessels formed microaggregate and clots were unstable and continuously abolitionist. As a result, neither one of the vessels is not backed up during the period of observation (40 minutes). These data indicate that mouse, deficient in FXI, secure in the model induced FeCl3blockage of the carotid artery.

It is known that induced FeCl3the formation of blood clots depends on platelets and the formation of thrombin, but it remains unclear how well this type of damage simulates the environment that occur in the affected blood vessels, for example, when the rupture of atherosclerotic plaques. In this regard, to exclude the possibility that induced massive FeCl3oxidative lesion creates a non-physiological conditions that may artificially favoring the activation of FXII-dependent contact phase, the function of FXII was studied on well-studied model of arterial thrombosis, in which damage was induced in the aorta mechanical, and blood flow was monitored using an ultrasonic flow sensor. After a temporary increase immediately after the damage to the blood flow was continuously decreased for several minutes in all tested mice. All tested wild-type mice (10/10) this reduction led to a complete and irreversible blockage of the vessel over a period of time from 1.6 to 11.1 minutes after damage (average time clogging of 5.3±3.0 minutes, Figa). A different picture was observed in FXII-/- mice, in which the formation of stabil the cases of blood clots has been deformed. Although all animals observed a consistent decrease in blood flow during the first minutes after damage, clogging occurred only in 4 out of 10 mice. Moreover, obstructive thrombi in these mice, all cases were unstable and rapidly abolitionist, so that the blood flow was restored in 10-115 seconds after corking. None of the re-opened vessels was not backed up for the second time. Accordingly, all FXII-/- mice showed essentially normal rate of blood flow through the damaged vessel at the end of the observation period (40 minutes). Very similar results were obtained in FXI-/- mice, where 9 out of 11 mice formed obstructive thrombi during the observation period (30 minutes) (Figa).

A serious defect in the formation of arterial thrombi in FXII-/-mice was confirmed in the third model, where he studied in vivo mobilization of platelets into the injured carotid artery using fluorescence microscopy. Mouse donor received purified platelets were labeled their fluorescent labels, and were injected with mouse-recipient having the same genotype. The vascular damage induced by imposing a strong ligature on the carotid artery, which necessarily causes destruction of the endothelial layer and often leads to rupture of the internal elastic membrane with subsequent rapid adhesion is of robotito, started by collagen and the formation of a blood clot at the site of damage (Gruner et al., Blood 102:12/8/2005 2003). While in wild-type animals were rapidly formed large stable clots (the size of blood clots: 102,821±39,344 μm2; t=5 min), which was not abolitionist, in the mutant mice was formed only a small or mid-size units, which often broke away from the damage site (FIGU, C). Accordingly, in the mutant mice, the area of the thrombus was greatly reduced (8,120±13,900 μm2; t=5 min), although the initial adhesion of platelets to the vessel wall did not look defective.

To test whether severe defect of blood clots in FXII-/- mice is a result of the absence of FXII plasma or FXII platelets, or the result of secondary, unidentified effects of FXII deficiency, such as changes in the vascular system, the formation of blood clots studied in FXII-/- mice after injection of human FXII (2 μg/g body weight). This treatment normalized PTT (27±6 seconds) and completely restored the formation of blood clots. In damaged FeCl3mesenteric arterioles in 100% of cases were formed clots >20 μm for 10 minutes after damage, and all the vessels were fully backed up during the observation period (Figa-C). Even tended faster Zack is oriane have restored FXII-/- mice compared with untreated control wild-type mice (mean time clogging: 22,7±8.2 min, compared with 25.6±8,9 min). Similar result was obtained when the damage induced mechanically on the aorta. At all the tested vessels total and irreversible clogging occurred within 10 minutes after applying damage (Fig.5D), which confirms the fact that the lack of FXII plasma responsible for the defect in thrombus formation observed in FXII-/- mice.

The above studies demonstrated that FXII plays a key role in the formation of blood clots and can therefore be considered as antithrombotic target.

To obtain direct confirmation of this fact, the mice were treated with polyclonal rabbit antibodies against murine FXII or antibodies unimmunized rabbit, and analyzed the mobilization of platelets and thrombus formation in mesenteric arteries after damage induced FeCl3. As shown in Figa, adhesion of platelets at sites of damage was comparable in both groups of mice. However, while in the control vessels in 100% of cases were formed clots >20 μm for 10 minutes after damage, and all the vessels were fully backed up during the observation period (FIGU, C), blood clots >20 μm was observed in the vessels only in 67% of cases, and occlusion of vessels was only 50% of the animals treated with the STI-FXII antibody.

Alternatively, to determine the effect of low molecular weight inhibitors FXII, mouse wild type were subjected to infusion FXII inhibitor-trypsin inhibitor from maize (CTI, 50 µg/g body weight) for 5 minutes before applying the induced FeCl3damage to the carotid artery (Wang et al. (2005) J. Thromb. Heamost. 3: 695-702). Processing inhibitor increased aPTT (62±11 sec, n=4), but does not affect bleeding during surgical procedures. None of the tested animals (0/4) did not develop bridging vessels clots within 30 minutes after application FeCl3.

These results demonstrate that anti-FXII therapeutic agents, such as anti-FXII antibody or small molecule inhibitors FXII, provide effective protection against the formation of blood clots.

Although for more than 50 years of contact activation of FXII is considered as the start point of the internal cascade of blood coagulation, this way was considered irrelevant for blood clotting. In the present invention were used in three different in vivo models for the analysis of the mobilization of platelets and formation of blood clots at sites of damage to the arteries in mice deficient in FXII, using in situ videomicroscopy and ultrasonic measurement of flow parameters, which showed the impossibility of forming a stable three-dimensional blood clots. The OS is ove this defect is the lack of plasma FXII, and no other components, which was fully confirmed by injection of exogenous human FXII (6), thereby also eliminating the possibility of the contribution of the secondary effects of deficiency of FXII in the observed phenotype.

These results are unexpected because FXII was seen as antithrombotic, and not prothrombinase enzyme that was based on short messages, showing the relationship of FXII deficiency with increased likelihood of venous thrombosis (Kuhli, C, Scharrer. l., Koch. F., Ohrloff. C, and Hattenbach. LO. (2004). Factor XII deficiency = MKD: a thrombophilic risk factor for retinal vein occlusion. Am. J. Ophthalmol. 137, 459-464; Halbmayer. W.M., Mannhalter. C, Feichtinger. C, Rubi, K., and Fischer. M. (1993). [Factor XII (Hageman factor) deficiency = MKD: a risk factor for development of thromboembolism. Incidence of factor XII deficiency = MKD in patients after recurrent venous or arterial thromboembolism and myocardial infarction]. Wien. Med. Wochenschr. 143, 43-50).

Mice with deficiency of FXII showed normal coagulation time (Figure 1) and showed no signs of spontaneous or increased post-traumatic (intraoperative) bleeding, which confirmed the insignificance FXII for normal hemostasis. At first glance, these results contradict the Central dogma of hemostasis that only those factors, the lack of which is associated with bleeding or thrombosis, are relevant for blood clotting. However, upon closer examination, these data do not contradict this statement, but open up the interesting possibility, namely, that arterial thrombosis may be mediated by different mechanisms.

Although discussed above, the mechanisms of sustainable blood clots can be essential for the formation of a hemostatic plug, the data show that the formation of a stable blood clot require additional activation inner path of blood coagulation, at least in mice. There is no evidence in favor of the possibility of presence of species-specific differences in the function of FXII or substrate of the enzyme. All parameters of blood coagulation and hemostatic phenotype of mutant mice correspond to human FXII deficiency, and all the differences observed in animals were normalized by restoring human FXII (Figure 5). In addition, excluded the possibility that the defect in thrombus formation is limited to a specific experimental model because it was found in various parts of the vascular arterial system regardless of the type of damage. Certain difficulties may be determining which type of lesion reflects the lesion of the vessel resulting from the rupture of atherosclerotic plaques, which is regarded as the main trigger of acute cardiovascular syndromes. Atherosclerotic lesions of ameny thrombogenic components and most importantly, TF fibrillar collagens. It was shown that in the process of atherogenesis enhanced collagen synthesis intimal smooth muscle cells provides a significant contribution to narrowing of the vessel lumen. Rupture or destruction of platelets leads to the contact of the collagen fibrils with the current blood that runs the adhesion and aggregation of platelets. In addition, they include the activation of FXII, as shown herein, for fibrillar collagen type I, which is the main type of collagen found in the vascular wall. However, collagens most likely are not the only (Pato)physiological activator of FXII in areas of damage. Other candidates can be a substance released from decaying cells or contained in the extracellular matrix (BKM), including HSP90, or soluble and insoluble polyanion, such as the nucleosome or glycosaminoglycans.

Among these activators of FXII the collagens, no doubt, are the most thrombogenic because they effectively activate platelets. The lesions platelets are attached to BKM through a reversible interaction of GPIb-V-IX of platelets with collagen-bound vWf, which reduces the speed of the cells and thereby provides the ability to bind other receptors. Among these receptors key concept what is the role of GPVI, because it activates the integrins α2β1 and αllbβ3, which then mediate stable adhesion and participate in cell-cell activation. In addition, activation of platelets through the complex GPVI/FcRγ-chain induces procoagulant the cells, which is characterized by the exposure of phosphatidylserine (PS) and production (bearing PS) membrane vesicles and microvesicles. Integrin α2β1 facilitates this process directly by signals from outside-in and mediated by enhancing interactions GPVI-collagen. It is established that contains PS membrane greatly accelerate the two main reactions of the coagulation process, the reaction of Tenase and prothrombinase. The present invention has demonstrated that procoagulation platelets facilitate FXII-dependent coagulation in vitro by a mechanism involving both complex GPVI/FcRγ-chain and α2β1 (Figure 2). This may, at least partly, explain why mice with deficiency of α2β1, despite unchanged adhesion of platelets at sites of arterial injury, showed the presence of partial defects during formation of the seal of blood clots. In addition to collagens, procoagulation activity of platelets effectively stimulated collapsing plasma through a mechanism dependent αllbβ3. In the presented experiments, the blockade αllbβ3 almost completely ing what was bated participation of platelets in FXII-dependent clotting, suggesting that a well-known anticoagulant activity of antagonists αllbβ3 can partially be based on the inhibition inner path of coagulation, FXII mediated. Thus, the present invention indicates that FXII mediated contact system and the activation of platelets can be interdependent processes, which together are involved in the pathological formation of blood clots.

On the basis of the presented experimental results was proposed model of pathological formation of blood clots, which is schematically presented in Fig.7. At sites of vascular damage the first layer of platelets come into contact with collagen environment, which is also enriched TF and fibrin. In this regard, it is not surprising that the adhesion of platelets to the damaged vessel wall is not impaired in FXII-/- mice, and it is very likely that these cells are fully activated and are in procoagulation condition. However, in a growing thrombus, the collagens are missing, and the concentration of TF, provided by the microvesicles may be lower in comparison with the wall of the vessel, and their activity may be reduced under the action of TFPI released from activated platelets in large quantities. In such conditions requires additional mechanisms to maintain p is strastveno-temporal formation of thrombin to activate the new mobilized platelets and initiate their coagulants activity through the formation of fibrin. Pronounced inability FXII-/- mice to form stable blood clots clearly demonstrates that FXII mediated intrinsic coagulation pathway is an essential part of this process. Together with the observation that mice with low levels of TF also demonstrate impaired thrombus formation in arteries, these results indicate that both external and internal paths must be in working condition and to act synergistically to initiate the formation of three-dimensional blood clot, which will eventually lead to clogging. On the contrary, the absence of bleeding in FXII-/- mice indicates that the growth of thrombus in three dimensions may be required for closing openings in the vessel wall. This may explain why the external path, which forms a first thin layer of fibrin and activated platelets, is essential for maintaining normal hemostasis. Our results suggest the interesting possibility that the formation of three-dimensional blood clots performs functions other than maintaining hemostasis. These may include stopping blood flow into certain areas of the injured tissue to prevent the spread of pathogens or toxins in the blood stream.

Experimental part

Animals

All experiments and conditions content is approved by the local Committee on the content and use of animals. Classic mutant mice without factor XI (FXI-/-), factor XII (FXII-/-), integrin α2 (α2-/-) were obtained as described (Gailani. D., Lasky. N.M., and Bro-ze. G.J., Jr. (1997). A murine model of factor XI deficiency = MKD. Blood Coagul. Fibrinolysis 8, 134-144; Pauer. H.U., Renne. T., Hemmerlein, B., Legler, T., Fritzlar. S., Adham. I., Muller-Esterl. W., Emons. G., Sancken. U., Engel. W., and Burfeind. P. (2004). Targeted deletion of murine coagulation factor XII gene is a model for contact phase activation in vivo. Thromb. Haemost. 92, 503-508; Holtkotter. O., Nieswandt. B., Smyth. N., Muller, W., Hafner. M., Schulte. V., J. Krieg, and Eckes. B. (2002). Integrin alpha 2-deficient mice develop normally, are fertile, but display partially defective platelet interaction with collagen. J Biol Chem JID - 2985121R 277, 10789-10794). As control was used C57B/6J mice (FXI-/-) or Sv129 (FXII-/-). Mice with deficiency of FcRγ-chain (Takai, T., Li, M., Sylvestre. D., Clynes, R., and Ravetch. J.V. (1994). FcR gamma chain deletion results in pleiotrophic effector cell defects. Cell 76, 519-529) were obtained as described (Taconics, Germantown).

The establishment of an anti-FXII antibody

Total cellular RNA was isolated from liver 129sv wt mice, and carried out the synthesis of FXII-DNA using a kit for carrying out a one-step RT-PCR (one-step RT-PCR Kit") of the company Qiagen according to the manufacturer's instructions. Heavy chain of factor FXII (position 61-1062 corresponding to residues 21-354) modified using 25 pmol each 5 - and 3-primers (ttggatccccaccatggaaagactccaag and ttgaattcgcgcatgaacgaggacag), incorporate the restriction sites BamH I and EcoR I respectively according to the following Protocol: 30 sec at 95°C, 60 s at 58°C and 1 min at 72°C for 30 cycles in a thermocycler (Biometra, Gottingen, Germany). The PCR product was cloned into the BamHI sites and EcoR I, the expression vector pGEX-2T (Pharmacia). Then, after sequencing, protein expressed in E.coli line BL21. Exponentially growing bacteria were stimulated with 0.5 mm isopropyl-β-D-thiogalactopyranoside for 1 hour, collected, resuspendable in 10 mm Tris-HCl, pH of 7.4, containing 1 mm EDTA, 200 mm NaCl, 10 μg/ml benzamidine hydrochloride, 10 μg/ml of phenylmethylsulfonyl and treated with ultrasound for 3 min 15-second pulses. After centrifugation at 15000 g for 20 min at 4°C the supernatant was removed and transferred to clean in a column of GST-separate (Pharmacia). Suirvey protein had a purity >95%, which was determined by analysis of colored Kumasi SDS-PAGE. Education polyclonal antibodies against FXII with GST-heavy chain is stimulated in the body of rabbits according to standard procedures. Antibodies were isolated from hyperimmune serum, using columns with FXII-heavy chain fused with maltose-binding protein (MBP). These fused proteins expressed and purified using the expression system pMAL-c2 and amylose column, in the same way as described for GST-fused construct.

Preparation of platelets

After ether anesthesia in mice the blood was collected from retroorbital venous sinus. Blood was collected in a tube containing 20 units/ml heparin, and platelet-rich plasma (prp) was obtained by centrifugation at 300 g for 10 min at whom atoi temperature (RT). For washing of platelets, prp was centrifuged at 1000 g for 8 min, the precipitate twice resuspendable in modified Tyrodes-Hepes buffer (134 mm NaCl, 0,34 mm Na2HPO4, 2.9 mm KCl, 12 mm NaHCO3, 20 mm Hepes, 5 mm glucose, 0.35% of bovine serum albumin, pH of 6.6) in the presence of prostacyclin (0.1 ág/ml) and apyrase (of 0.02 units/ml). Then platelets resuspendable in the same buffer (pH 7.0, with 0.02 units/ml apyrase), incubated at 37°C for at least 30 min before analysis.

Flow cytometry

Heparinized whole blood was diluted 1:20 modified Tyrode-HEPES buffer (134 mm NaCl, 0,34 mm Na2HPO4, 2.9 mm KCl, 12 mm NaHCO3, 20 mm Hepes [N-2-hydroxyethylpiperazine-N'-2-econsultancy acid], pH 7.0)containing 5 mm glucose, 0.35% of bovine serum albumin (BSA) and 1 mm CaCl2. Samples were incubated with labeled fluorophore antibodies for 15 minutes at room temperature and immediately analyzed using a FACScalibur device (Becton Dickinson, Heidelberg, Germany) (Nieswandt. B., Schulte. V., and Bergmeier. W. (2004). Flow-cytometric analysis of mouse platelet function. Methods Mol. Biol. 272, 255-268).

Aggregometry

To determine the platelet aggregation was measured value of light transmission using prp (200 μl with 0.5×106platelets/µl). The value of permeability was recorded in 4-channel aggregometer Fibrintimer (APACT Laborgerate und Analysensysteme, Hamburg, Germany) for 10 min, which was rajali in arbitrary units with a 100% permeability, installed on the plasma. Platelet aggregation was induced by the addition of collagen (10 μg/ml) and ADP (5 µg/ml).

Study time coagulation

Mice were anestesiologi intraperitoneally injection tribromoethanol (Aldrich) (0.15 ml/10 g body weight), and scalpel cut 3-mm segment of the tail. Followed by bleeding from the tail, while carefully wiping the drops of blood filter paper in such a way as to avoid contact with the damaged site. The time of bleeding was determined by the disappearance of the traces of blood on the paper through a 15-second intervals. If necessary, the bleeding stopped manually after 20 minutes. Where indicated, mice were treated hFXII in the amount of 100 μg/mouse.

Preparation of platelets for intravital microscopy

The blood of mice (1 vol.) took about 0.5. the Hepes buffer containing 20 units/ml heparin. The blood was centrifuged at 250 g for 10 min, and platelet-rich plasma is carefully transferred into a fresh tube. Platelets were labeled with 5-carboxyfluorescein diacetate-N-Succinimidyl ether (DCF) and brought up to a final concentration h6platelets/250 ál (Massberg, S., Sausbier. M., Klatt, P., Bauer. M., Pfeifer A, Siess. W., Fassler. R., Ruth, P., Krombach. F., and Hofmann. F. (1999). Increased adhesion and aggregation of platelets lacking cyclic guanosine S A-monophosphate kinase I.J Exp Med 189, 1255-1264).

Model in vivo thrombus formation when FeCl3-induced p is the harming

Male and female mice at 4-5 weeks of age were anestesiologi intraperitoneally injection of 2,2,2-tribromoethanol and 2-methyl-2-butanol (Sigma) (0.15 ml/10 g body weight at the rate 2.5% solution). Fluorescently labeled platelets were injected intravenously. Mesentery carefully brought to the surface through a midline abdominal incision. Arterioles (35-50 microns in diameter) were visualized using a microscope (Axiovert 200 inverted, Carl Zeiss (×10)equipped with a fluorescent light source 100-W HBO and CCD camera (CV-M300)attached to the S-VHS device video (AG-message 7355, Panasonic, Matsushita Electric, Japan). After local application of FeCl3(20%), inducing damage to the vessel, and the exposure of endothelium condition arterioles was monitored for 40 min or until complete closure (stop blood flow for >1 min). Stable adhesion of platelets was determined as the number of fluorescently labeled platelets, which are deposited on the vessel wall within 5 minutes after damage, thrombus was defined as a unit of platelets with a diameter greater than 20 μm, the time obliteration was defined as the time required to stop the blood flowing for at least 1 minute. In all experiments, mice were chosen to a maximum of two arterioles on the basis of the quality of the exposition. Just was investigated 17 wt, 14 FXII-/- and 9 FXI-/- arterioles.

Intravitally mikros the opium - carotid artery

Intravital microscopy porazhennojj carotid artery was performed essentially as described (Massberg. S., Gawaz. M., Gruner. S., Schulte. V., Konrad. I Zohlnho-fer, D., Heinzmann. U., and Nieswandt. B. (2003). A crucial role of glycoprotein VI for platelet recruitment to the injured arterial wall in vivo. J Exp Med JID - 2985109R 197, 41-49). Stating in brief, mice were anestesiologi intraperitoneally injection of ketamine/xylazine (ketamine 100 mg/kg; Parke-Davis, Karlsruhe, Germany; xylazine 5 mg/kg, Bayer AG, Leverkusen, Germany). Polyethylene catheters (Portex, Hythe, England) implanted in the right jugular vein, and using intravenous infusion was administered fluorescently labeled platelets (200×106/250 μl). Damage to the carotid artery for exposure of the endothelium induced by imposing a strong ligature. Before and after damage to the vessel fluorescently labeled platelets were visualized in situ using in vivo videomicroscopy the right common carotid artery using a microscope (Zeiss Axiotech (20× water-immersion lens, W 20×/0.5 a, Zeiss, Gottingen, Germany) with a 100 W HBO mercury lamp for epi-illumination. Adhesion of platelets and thrombus formation was detected within 5 min after induction of damage, and image, recorded on videotape, was evaluated using a computer program for the analysis of video images (Visitron, Munich, Germany).

Pulmonary thromboembolism

Mice were anestesiologi intraperitoneally injection of 2.2,tribromoethanol and 2-methyl-2-butanol (Aldrich) (0.15 ml/10 g body weight at the rate 2.5% solution). From the shot of mice received a mixture of collagen (0.8 mg/kg), and jugular vein were injected with epinephrine (60 µg/kg). The surviving mice were sewed up the incision, and left them to recover. Conducted Necroscope and histological analysis of the lungs, fixed in 4% formaldehyde and paraffin embedded sections were stained with hematoxylin/eosin.

The platelets count

The platelets count was performed by the method of flow cytometry, using a FACScalibur device (Becton Dickinson, Heidelberg, Germany). The results were expressed as mean values ±S.D or as % of control (wt, n=19; FXII-/-, n=14 and FcRγ-/-, n=5).

Time corking

Abdominal cavity shot of mice were exposed in a longitudinal direction, and analyzed the abdominal aorta. Ultrasonic sensor evaluation of blood flow was placed around the aorta, and induced thrombosis strong compression of the aorta forceps. Blood flow was monitored until complete closure. The experiment was completed manually after 45 minutes. Indicated that immediately before the experiment was intravenously injected human factor XII.

Histological analysis

Mice were killed, quickly took out the lungs and fixed at 4°C for 24 hours in buffered 4% formalin (pH 7,4; Kebo). Tissue was obezvozhivani and poured paraffin (Histolab Products AB), did 4-μm sections and secured. After removal of paraf is on the tissue were stained with hematoxylin Mayer (Mayers) (Histolab Products AB) and eosin (Surgipath Medical Industries, Inc.).

Electrophoresis in SDS-polyacrylamide gel, Western blot analysis and immunocomputing

Plasma (0,3 µl/lane) were separated by 12.5% (wt./about.) electrophoresis in polyacrylamide gel in the presence of 1% (wt./about.) SDS (Laemmli, 1970). Proteins were transferred to nitrocellulose membrane for 30 min at 100 mA. The membrane was blocked with PBS buffer containing 4% (wt./about.) powder milk powder and 0.05% (wt./about.) tween-20, pH of 7.4. Membranes were investigated using 0.5 μg/ml of monoclonal antibodies to MBK3 (Haaseman J. Immunology 1988). Bound antibodies were detected by secondary antibodies to mouse IgG, conjugated with horseradish peroxidase (dilution 1:5000) followed by study method chemiluminescent detection.

The study of coagulation

To determine the clotting time when rekaltsifikatsii 100 µl mouse antikoagulyantnoe citrate plasma (0,38% sodium citrate) were incubated with 100 μl each of: collagen type Horm (Nycomed, Munchen, Germany), ellagic acid, chondroitin sulfate (both firm Sigma), kaolin or buffer (final concentration of 30 μg/ml)for 120 sec at 37°C in coagulometer KC10 "Kugelkoagulometer" (Amelung, Lemgo, Germany). To test the effect of platelet activation on FXII-dependent coagulation washed platelets resuspendable in Tyrode buffer containing 4 mm CA2+and 5 mm CA2+-ionophore A (Sigma) for 10 min before adding PLA is we, does not contain platelets. The clot formation was initiated by recalcification 100 μl of 25 mm solution of CaCl2and the time to clot formation was detected by measuring clotting time KC4 (Amelung).

Analysis of coagulation

Total and single coagulation parameters were determined using an automated system for the study of blood coagulation (BCS, Dade Behring) with reagents Dade Behring, following the Protocol developed by the manufacturer for samples of human blood. The main provisions of the Protocol BCS analysis is shown in the nested statement of the company Dade Behring, which can be found on the website of the manufacturer Dade Behring (http://www.dadebehring.com). D-dimer was measured using ELISA method from Asserachrom (Roche). The counting of peripheral blood cells was performed using a device Sysmex XE 2100, following the standard protocols.

Measurement of thrombin

The formation of thrombin was measured by the method Aronson et al. (Circulation, 1985) with minor modifications. Aliquots (0.5 ml) plasma rich in platelets or free from platelets, were placed in a round-bottom polypropylene tubes, which were covered with a collagen type Horm (100 μg/ml, 24 h, 4°C), and add 20 ál of 1 M Ca2+to initiate blood coagulation. In the wells of microtiter tablet containing 90 μl of 3.8% sodium citrate was added to the samples (10 μl) at intervals of 2.5-10 min for 60 min Staining was performed after 2 min by d is bauleni 50 l 2 mmol/l S-2238 (H-D-Phe-Arg-NH-NO 2-HCl, specific to thrombin substrate; Chromogenix, Molndal, Sweden) in 1 mol/l Tris (pH of 8.1). The absorbance of the released colored product was measured spectrophotometrically at a wavelength of Vmax=405 nm using microplate reader (Easy Reader EAR 340AT, SLT Lab Instruments GmbH, Vienna, Austria). For each time point was performed in three dimensions.

Statistical evaluation

Statistical analysis was performed using non-parametric test t-test.

Although there is essentially illustrated and described only the preferred embodiments of the invention, it is obvious that many possible modifications and changes of the present invention in light of the information here and in the framework of the attached claims without departure from the nature and intended scope of the present invention.

1. The use of at least one antibody that inhibits factor XII, to prevent disorders associated with the formation of venous or arterial blood clots by preventing the pathological formation and/or stabilization of blood clots and, thus, prevent the growth of three-dimensional intraluminal thrombus without affecting hemostasis.

2. The use according to claim 1, in which the indicated antibody is an anti-FXII antibody.

3. The use according to claim 2, in which the indicated antibody is the first inhibitor of the activation of FXII.

4. The use according to any one of claims 1 to 3 for the treatment or prevention of conditions or disorders associated with the formation of venous or arterial thrombus, especially stroke or myocardial infarction.

5. Pharmaceutical preparation containing at least one antibody, an inhibitory factor XII, to prevent disorders associated with the formation of venous or arterial blood clots by preventing the pathological formation and/or stabilization of blood clots and, thus, prevent the growth of three-dimensional intraluminal thrombus.

6. The tool according to claim 5, in which the indicated antibody is an anti-FXII antibody.

7. The tool according to claim 5, in which the indicated antibody inhibits the activation of FXII.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine, particularly to experimental pharmacology, and concerns methods for controlled platelet aggregation decrease in vitro. That is ensured by administering mexidol to plasma containing 200-220 thousand/mcl of platelets immediately after plasma sampling. Mexidol is used in the concentration of 0.1 to 0.8 mg/ml of an incubation mixture. The incubation is conducted for 10-15 minutes at room temperature.

EFFECT: method provides platelet aggregation to a desired value.

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and can be used to produce biologically active collagen peptides from marine hydrobionts. Patiria pectinifera starfish is dehydrated with 96% ethyl alcohol and then demineralised with 1-2 N solution of an inorganic acid with ratio of the raw material to inorganic acid of 1:(3-5) for 1-3 days. The demineralised raw material is washed from traces of acid and water-soluble impurities with distilled water, after which the material is hydrolysed with an alkali solution with ratio of raw material to the alkali solution of 1:(3-5) in order to remove non-collagen proteins and washed with distilled water at temperature of 2-4°C. The obtained starfish collagen shells are homogenised. The homogenate is diluted with distilled water; pH of the suspension is brought to a value equal to 8.0-8.5 with an alkali solution and hydrolysed with 1% collagenase solution with ratio of homogenate to enzyme of (100-200):1 and temperature of 30-40°C for 3-5 hours, pH 8.5-7.0. The enzyme is inactivated at 80-90°C for 10-15 minutes. The hydrolysate solution is filtered to remove non-hydrolysed collagen, subjected to ultra-filtration through a 30 kD membrane filter to remove the inactivated enzyme; the end product, having antitumour, anticoagulant, wound-healing, anti-inflammatory, antioxidant activity, capacity to inhibit collagenase and angiotensin converting enzyme and which is a complex of collagen peptides with a high-molecular weight component weighing 22-23 kD, is concentrated in a vacuum and lyophilised.

EFFECT: obtaining a product, having antitumour, anticoagulant, wound-healing, anti-inflammatory and antioxidant activity.

2 cl, 7 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention relates to medicine, namely to therapy and pulmonology, and can be used for selection of tactics of treating thromboembolism of pulmonary artery. For this purpose computered tomography with bolus enhancement is performed to patient, areas of affection located more distally than thrombotic embolus are examined and number of respiratory movements per minute is taken into account. Presence of occluded vessel or vessels in examined areas is identified. Occlusion of segmental branch of pulmonary artery, located more distally than embolus, is assessed in one point irrespective of degree of vessel occlusion. Occlusion of each of lobar branches in case of affection of right middle lobar, left middle- and upper lobar branches of pulmonary artery is assessed in 2 points. Occlusion of upper lobar branch of pulmonary artery on the right, lower lobar branch of pulmonary artery on the left is assessed in 3 points. Occlusion of right lower lobar branch of pulmonary artery is assessed in 4 points. Occlusion of left main pulmonary artery is assessed in 7 points. Occlusion of right main pulmonary artery is assessed in 9 points. Occlusion of both main pulmonary arteries and/or pulmonary trunk is assessed in 17 points. After that, points are summed up. If the sum of points is from 1 to 6, anticoagulation therapy is performed with heparin. If the sum of points constitutes from 7 to 10 at rate of respiratory movements (RRM) lower than 18, another anticoagulation therapy is performed, at RRM more than 18 - thrombolytic therapy is performed. If the sum of points constitutes from 11 to 17, thrombolytic therapy is performed.

EFFECT: method provides possibility of operative objective assessment of degree of pulmonary bed affection and beginning of required therapy in due time.

5 dwg, 1 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to pharmaceutical industry, namely an agent possessing anticoagulant activity. A method for preparing a dry fucus extract possessing anticoagulant action by the complex treatment of Fucus vesiculosus. The dry fucus extract possessing anticoagulant activity representing a polysaccharide complex containing fucoidan having the following composition: neutral monosaccharides - fucose, xylose, mannose, galacose, glucose, uronic acid; as well as polyphenols and sulphates in specific amount. The anticoagulant ointment containing the dry fucus extract.

EFFECT: agents described above possess pronounced anticoagulant action.

4 cl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention refers to cyclohexyl ammonium salt of 2-[3-methyl-7-(1,1-dioxotiethanyl-3)-1-ethyl xanthenyl-8-tio]acetic acid of the following formula: .

EFFECT: obtaining a new compound that shows antithromboembolic action and can be used in medicine.

2 cl, 2 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention refers to derivatives of oxazolopyrimidine in any of their stereoisomeric forms, or in the form of a mixture of stereoisomeric forms specified in Claim 1.

EFFECT: oxazolopyrimidine derivatives having agonistic activity in relation to Edg-1 receptor.

5 tbl, 319 ex

FIELD: chemistry.

SUBSTANCE: invention relates to N-carb(glutaminyl)oxymethylimidazo[4,5-e]benzo[1,2-c; 3,4-c']difuroxane of formula .

EFFECT: obtaining a novel compound which can be used as a medicinal preparation which inhibits thrombocyte aggregation.

1 dwg, 1 tbl

FIELD: chemistry.

SUBSTANCE: invention relates to compounds of formula (I) and/or stereoisomeric forms thereof and/or mixtures of said forms in any ratio and/or a physiologically tolerant salt of the compound of formula , where: X denotes -C(O)- or -SO2-, U denotes an oxygen atom or -(C0-C4)alkylene, A denotes an oxygen atom, -C(O)-NH-, -NH-C(O)- or -(C0-C4)alkylene, V denotes: 1) -(C2-C9)alkylene, where alkylene is unsubstituted or mono-, di- or tri-substituted, independently of each other, by an -OH group, 2) -(C3-C9)alkenylene, D denotes -(C1-C2)alkylene, Y denotes: 1) a covalent bond, 2) -(C6-C14)arylene-, or 3) Het, where Het denotes pyridyl or imidazolyl, R1 denotes: 1) a hydrogen atom, 2) -(C1-C6)alkyl, R3 denotes: 1) -(C2-C6)alkylene-NH2, 2) -(C1-C4)alkylene-SO2-(C1-C4) alkylene-NH2 or 3) -(C0-C4) alkylene-Het, where Het denotes pyridyl or piperidyl, where Het is unsubstituted or substituted with -NH2, R6 denotes: 1) a hydrogen atom, 2) -(C1-C6) alkyl, where the alkyl is unsubstituted or substituted, independently of each other, by a R16 group, 3) -(C0-C4) alkylene-Het, where Het denotes pyridyl, where -(C0-C4) alkylene and Het are unsubstituted or substituted, independently of each other, by a R16 group, 4) -(C0-C4) alkylene-phenyl, where -(C0-C4) alkylene and phenyl are unsubstituted or substituted, independently of each other, by a R16 group, or 5) -(C0-C4) alkylene-(C3-C8)cycloalkyl, R7 denotes a hydrogen atom, halogen or -(C1-C6)alkyl, R8 denotes a hydrogen atom or -(C1-C6)alkyl, R9 denotes a hydrogen atom, and R16 denotes -NH2, which are inhibitors of the active thrombin-activated fibrinolysis inhibitor, as well as a method for production thereof, a medicinal agent based thereon and use for prevention, secondary prevention and treatment of one or more disorders associated with thrombosis, embolism, hypercoagulation or fibrosis changes.

EFFECT: improved properties of compounds.

7 cl, 1 tbl, 9 ex

FIELD: chemistry.

SUBSTANCE: described are novel triazolopyridazines of general formula , stereoisomeric or tautomeric forms thereof and physiologically acceptable salts thereof, where Q1 denotes H, -C1-6alkyl, optionally substituted with fluorine, or -C3-6cycloalkyl; Q2 and Q3 independently denote H, -C1-6alkyl; R1-R3 independently denote H, -C1-6 alkyl, -C3-6cycloalkyl, -O-C3-6cycloalkyl, -O-C1-8alkyl, a heterocyclic residue etc; R4-R8 independently denote H, -C1-6 alkyl, -OH, -O-C1-8 alkyl, halogen, SF5 etc, a method for production thereof and use as medicinal agents.

EFFECT: compounds have antithrombotic activity and particularly inhibit the protease-activated receptor.

6 cl, 2 tbl, 242 ex

FIELD: medicine.

SUBSTANCE: present invention refers to medicine, particularly to pharmacology, and describes a method for correction of disturbed functional activity of platelets, consisting in using Melaxen as a corrector for the disaggregation and hyperaggregation state of the platelets to be orally administered into white non-linear mature rats in a dose of 1 mg/kg once a day within the 7-day therapeutic course.

EFFECT: invention aims at extending the range of preparations having an ability to control the aggregation properties of platelets depending on the nature of the haemostatic disorders.

4 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The method involves performing multiple substitutions on hydrophilic residues identified by analysis of a database of selected, stable scFv sequences. Also described is a single-chain antibody obtained using said method and a composition containing same. The invention can be used in medicine.

EFFECT: method for analysis of sequences and rational strategies to improve solubility of immunobinders and particularly single-chain antibodies (scFv).

13 cl, 7 dwg, 14 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions relates to methods of obtaining preparation of antibody against IL-18 or its antigen-binding part with reduced content of host cell protein (HCP) from sample of mixture, containing antibody against IL-18 or its antigen-binding part, and, at least, one HCP. Method includes reduction of mixture sample pH from 3.0 to approximately 4.0, bringing pH from 4.5 to approximately 5.5 and conductivity to 9±0.5 mS/cm, application of sample on cation-exchange resin, carrying out chromatography of hydrophobic interaction and sample collection. Version of method includes realisation of anion-exchange chromatography before the stage of cation-exchange chromatography. Version of method also includes sample filtration before anion-exchange chromatography.

EFFECT: group of inventions makes it possible to obtain preparation of antibody with increased output and purity Output constitutes 96±4%, purity 99,51±0,26%.

28 cl, 2 dwg, 9 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to immunology. Described are antibodies against VEGF, one on which contains complementary regions with amino acid sequences SEQ ID NO:1, 2, 3, 4, 6 and 7, another contains complementary regions with amino acid sequences SEQ ID NO:1, 2, 3, 5, 6 and 7, disclosed in description. Also described are polynucleotides, coding said antibodies; espression vectors, containing said polynucleotides, and host cells, intended for obtaining antibodies in accordance with the claimed invention. Claimed is method of obtaining antibodies against VEGF, which includes expression of vector in host cell and separation of antibody. Disclosed is method of obtaining immunocongugate of antibody against VEGF, which includes conjugation of antibody with drug or cytotoxic agent. Described is method of VEGF identification, which includes identification of complex VEGF-antibody against VEGF in biological sample. In addition, described are compositions for treatment of VEGF-associated disease, one of which contains efficient quantity of antibody against VEGF, and another - efficient quantity of polynucleotide, coding said antibody. Also disclosed are methods of: 1) treating tumour, cancer or VEGF-associated cell proliferative disease; 2) inhibition if angiogenesis in subject and 3) inhibition of vascular permeability; consisting in introduction to subject of efficient quantity of antibody against VEGF in accordance with claimed invention.

EFFECT: invention makes it possible to obtain antibodies against VEGF and apply them for treatment of VEGF-associated diseases.

41 cl, 16 dwg, 2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, particularly to paediatrics, allergology and pulmonology, and can be used for treating bronchial asthma (BA) with persistent cytomegalovirus (CMV) in children. For this purpose after the signs of persistent CMV have been detected in bronchi, including its DNA fragments in expectorations, human immunoglobulin titred by CMV antibody count is immediately prescribed according to the scheme of 1.5 ml intramuscularly every third day within the course of 5 injections.

EFFECT: method enables relieving the clinical course of BA with a reduced extent of a baseline therapy.

1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers immunology and medicine. What is presented is an antibody for the recovery of the central nervous system, comprising an antigen-binding site that specifically binds to human Nogo A polypeptide or human NiG described by (SEQ ID NO: 2 and 3, respectively, presented in the description), wherein the antigen-binding site comprises: CDR-H1-6A3 (SEQ ID NO:8), CDR-H2-6A3 (SEQ ID NO:9) and CDR-H3-6A3 (SEQ ID NO:10); and CDR-L1-6A3 (SEQ ID NO:11), CDR-L2-6A3 (SEQ ID NO:12) and CDR-L3-6A3 (SEQ ID NO:13). There are also described a polynucleotide coding the above antibody; an expression vector comprising the above polynucleotide; and a host cell specified in bacterium, yeast or mammalian cell line comprising myeloma, hybridoma, or immortalised B-cell for producing the antibody according to the present invention. A pharmaceutical composition for the CNS recovery comprising an effective amount of the above antibody mixed with at least one acceptable carrier or solvent is also described. Using the polynucleotide, the expression vector or the host cell for the above pharmaceutical composition is also described. The invention enables producing the human Nogo A or NiG antibody effective in treating CNS injuries.

EFFECT: what is presented is a method for producing the above antibody involving the polynucleotide or vector expression in the host cell.

16 cl, 11 dwg, 9 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine and biotechnology, and represents a method for preparing a combined antibacterial preparation for treating acute intestinal infections. The invention is to prepare a biological ingredient biomass representing a complex of immunoglobulins or bifidus bacteria biomass, to mix it with an antibiotic substance in specified proportions, and differs from the known analogues by the fact that mixing the two ingredients of the preparation is preceded by grinding the biological ingredient only to be ground to the greatest maximum bulk density of the ground material.

EFFECT: invention improves the antibacterial activity of the combined preparation, which leads to reducing the length of treating an acute intestinal infection.

2 cl, 1 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: present invention relates to biotechnology and provides humanised synthetic analogues (R6313/G2) of variable domains of the anti-angiotensin II type 1 receptor monoclonal scFv antibody 6313/G2, i.e. which specifically bind the molecule which specifically binds with a peptide, having the amino acid sequence EDGIKRIQDD. The invention also discloses a method of treating cancer, use of specifically binding molecules according to the invention when preparing a drug for treating cancer, a combined preparation and pharmaceutical compositions containing a specifically binding molecule according to the invention and angiotensin II.

EFFECT: present invention enables to block the harmful effect of angiotensin II and use said analogues to treat cancer in humans.

9 cl, 15 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: present group of inventions relates to biotechnology. What is presented is a humanised anti-CD79b antibody and its antigen-binding fragment produced of murine antibody MA79b and CD79b having a substantially analogous binding affinity thereto. A polynucleotide, a vector, a host cell and a method for producing the anti-CD79b antibody according to the invention; immunoconjugates, compositions and methods for cell growth inhibition, a method of treating an individual suffering cancer, a method of treating a proliferative disease and tumour in a mammal, a method for B-cell proliferation inhibition; a method for detecting the presence of CD79b in a sample and method for binding the antibody to the CD79b expressing cell are also disclosed.

EFFECT: given invention can find further application in therapy of the CD79b associated diseases.

86 cl, 20 tbl, 9 ex, 51 dwg

FIELD: medicine.

SUBSTANCE: present invention refers to biotechnology and medicine. What is presented is a method for preventing or treating an inflammatory disease, comprising the stages of producing an NR10 antibody having NR10-neutralising activity, and selecting an antibody inhibiting IL-31-dependent cell line growth, and administering the antibody to a patient with an inflammatory disease that is atopic dermatitis, chronic dermatitis, rheumatism or osteoarthritis.

EFFECT: present invention can find further application in the therapy of the inflammatory diseases.

10 cl, 13 dwg, 10 ex

Anti-mif antibodies // 2509777

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and immunology. Invention discloses a monoclonal antibody and its antigen-binding parts which specifically bind the C-end or central part of the macrophage migration inhibitory factor (MIF). The anti-MIF antibody and its antigen-binding part further inhibit biological function of the human MIF. The invention also describes an isolated heavy and light chain of immunoglobulins obtained from anti-MIF antibodies, and molecules of nucleic acids which encode such immunoglobulins.

EFFECT: disclosed is a method of identifying anti-MIF antibodies, pharmaceutical compositions containing said antibodies and a method of using said antibodies and compositions for treating diseases associated with MIF.

22 cl, 14 dwg, 16 ex

FIELD: genetic engineering, immunology, medicine.

SUBSTANCE: invention relates to new antibodies directed against antigenic complex CD3 and can be used in therapeutic aims. Antibody IgG elicits the affinity binding with respect to antigenic complex CD3 wherein heavy chain comprises skeleton of the human variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 2, 4 and 6 and their corresponding conservatively modified variants. Light chain comprises skeleton of the rodent variable region in common with at least one CD3 taken among amino acid sequences SEQ ID NO 8, 10 and 12 and their corresponding conservatively modified variants. Antibody is prepared by culturing procaryotic or eucaryotic cell co-transformed with vector comprising recombinant nucleic acid that encodes antibody light chain and vector comprising recombinant nucleic acid that encodes antibody heavy chain. Antibody is administrated in the patient suffering with malignant tumor or needing in immunosuppression in the effective dose. Invention provides preparing chimeric antibodies against CD3 that are produced by expression systems of procaryotic and eucaryotic cells with the enhanced yield.

EFFECT: improved preparing methods, valuable medicinal properties of antibody.

33 cl, 5 dwg, 1 ex

Up!