Recombinant plasmid dna pyp2 coding fermentative-active part of lipase polypeptide, protein of bee pyralid digestive tract

FIELD: biotechnologies.

SUBSTANCE: recombinant plasmid DNA contains BamHI/Hindlll - fragment of pQE30 plasmid DNA; BamHI/Hindlll - fragment of gene Yp2 Galleria mellonella, coding fermentative-active part of lipase polypeptide, protein of pyralid bee digestive tract; as genetic marker - bla gene of B-lactamase; nucleotide sequence, coding polyhistidin tract within Yp2 gene reading frame.

EFFECT: invention may be used for creation of pollution decomposer preparation containing hard alkanes.

4 dwg, 2 tbl, 2 ex

 

The invention relates to biotechnology, in particular genetic engineering, and is designed in vitro recombinant plasmid DNA containing the gene fragment Yp2 Galleria mellonella (BEE OGNEVKA)encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee the liquidation length 504 S.A. Design provides in cells of E. coli bacteria, the biosynthesis of the polypeptide in the form of a fragment of a lipase with polyhistidine (6*His) tract for affinity purification, having lipase activity for full or partial cleavage of the molecules of solid alkanes. This purified using affinity chromatography recombinant protein can be used as drug-destructor dirt containing solid alkanes.

Lipase Galleria mellonella is a water-soluble protein encoded by the gene Yp2, is a protein with a molecular mass of 60 kDa.

This protein has lipase activity, which catalyzes the hydrolysis of insoluble esters and lipid substrates, helping to digest, dissolve and to fractionate fats, including solid alkanes.

The main producers of lipases are strains of fungi Rhizopus [AC USSR 1726513 A1, publ. 15.04.92], Fusarium [P. Rapp. Production, regulation and some properties of lipase activity from Fusarium oxysporum f. sp.vasinfectum. // Enzyme and Microbial Technology. - 1995. - V.17. - P.832-838.], some yeast (Jarowia) [AC USSR 1454852 A1, publ. 30.01.89].

However, these lipases have low activity against solid paraffins, tars.

A known method of separation of wax moths drug lipase (RF patent No. 2038086, IPC A61K 35/04, publ. 27.06.1998 g), which are enzymes of the insect, which break down the wax into simpler compounds. For this, the larvae of wax moths collected in the beehive, powdered and dried by the method of Willstatter, then the extraction is carried out lipases of the resulting powder emulsifying a mixture containing 50% glycerol and 1.5% of carboxyla, then lipase precipitated with acetone and subjected to lyophilization.

The disadvantage of this method is the use of a large number of larvae that need to be cultivated, which is rather time-consuming and costly.

Unknown ways to obtain lipase Galleria mellonella microbiological synthesis, showing its biochemical activity.

The closest technical solution (prototype) is a plasmid pZ-ura3d4-hp4d-LIP2, obtained on the basis of the vector pUC19 containing the defective token ura3d4 contributing to the selection of clones with multiple integration of the vector into the chromosome of land for non-homologous integration Zeta, different transcription elements, including a strong synthetic constitutive hp4d promoter, and the gene lipase Yarrowia lipolytica LIP2 (RF patent No. 2355754, IPC C12N 15/55, SDA is L. 20.05.2012,). Increased chopinot LIP2 gene and its amended regulation determine the ability of the proposed strain to accumulate higher amounts of lipase, a strain of Yarrowia lipolytica Polf auxotrophic for Latino has complementarily using the integrative vector pNB268 (ATCC 69355) and then transformed integrative plasmid pZ-ura3d4-hp4d-LIP2.

However, this plasmid produces a lipase having a low activity against solid paraffins, tars.

The technical result of the claimed invention to provide a recombinant plasmid DNA, providing the expression of the gene fragment Yp2 Galleria mellonella encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee the liquidation length 504 S.A., in the composition of the bacterial plasmid vector encoding a 6*His-target for affinity purification of the protein. The design should provide a higher level of biosynthesis of recombinant lipase Galleria mellonella in E. coli cells and the level of treatment using a 6*His-target not less than 95-98% of the recombinant protein.

The technical result is achieved by constructing recombinant plasmid DNA pYP2, coding IPTG - induced biosynthesis of the polypeptide having lipase activity in E. coli cells in the form of protein (504 S.A.) with a molecular mass of 60 kDa, with a 6*His N-end DL the affinity purification.

Recombinant plasmid DNA pYP2 encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee of long liquidation in 504 amino acid residues, characterized in that it has a molecular weight of 3,212 megadalton (4,942 etc., O.); consists of a BamHI/HindIII - fragment DNA plasmid pQE30 (3,424 etc., O.) [1] and BamHI/HindIII - fragment gene Yp2 Galleria mellonella encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee the liquidation (1,551 etc., O.), presented in figure 2, contains the genetic marker gene bla, β-lactamase, which determines the stability of the transformed plasmid pYP2 cells to ampicillin; nucleotide sequence encoding polyhistidine tract in the reading frame of the gene Yp2, consisting of 6 molecules of the amino acid histidine, for further purification using affinity chromatography sorbent Ni-NTA-agarose; unique recognition sites of restriction endonucleases, with the following coordinates: XhoI - 2; EcoRI - 89; BamHI - 148; SmaI - 914; HindIII - 1670; NheI - 1789.

The LIST of GRAPHICAL MATERIALS

Figure 1. Physical map of recombinant plasmid pYP2.

Figure 2. The nucleotide sequence of the gene Yp2, with affine target 6xHis.

Figure 3. Amino acid sequence of the recombinant protein lipase gene Yp2, with affine target 6xHis.

Figure 4. E is extraparenchymal lysates of cells of E. coli (strain TG-1), transformed with plasmid pYP2, synthesizing recombinant protein lipase gene Yp2, with affine target 6xHis (lane 1); the recipient strain, the (track 3); recombinant protein lipase gene Yp2, with affine target 6xHis, purified by affinity chromatography on Ni-NTA-agarose (lane 2).

The invention is illustrated by the following examples.

Example 1. Construction of recombinant plasmid DNA pYP2.

10 μg of DNA from the reaction mixture after polymerase chain reaction (primers: cacggatccaggagagtctctgcaatac and aataagcttttaagaggagctattcatag) with cDNA obtained from the reverse transcription reaction with the statistical priming with total messenger RNA, cells Galleria mellonella in accordance with the methodology described in [2], is treated with restrictase BamHI and HinIII and from the resulting hydrolysate is isolated in a 4% polyacrylamide gel fragment length 1,510 KBP

10 μg of plasmid DNA pQE30 treated with restrictase BamHI and HinIII in accordance with the methodology described in [1], and from the resulting hydrolysate is isolated in a 4% polyacrylamide gel vector fragment length 3,424 KBP

The ends of the received fragment and the vector connecting using a ligase reaction in 30 μl of buffer for ligation. 5-10 μl of the reaction mixture used to transform competent cells of TG-1 [3] (supE thi-1 Δ(lac-proAB) Δ(mcrB-hsdSM)5(rK- mK-) [F' traD36 proAB lacIqZΔM15]) one hundred the standard method [2]. Transformants plated on LB-agar containing 100 μg/ml ampicillin. From grown clones secrete plasmid DNA pYP2 and analyze it by processing a set of restriction endonucleases SmaI, HinIII, BamHI, followed by electrophoretic analysis of the lengths of restriction fragments in a 4% polyacrylamide gel. Of the 10 analyzed clones 10 showed the desired set of restriction fragments. The target plasmid pYP2 contains a unique recognition sites of restriction endonucleases, with the following coordinates:

XhoI - 2; EcoRI - 89; BamHI - 148; SmaI - 914; HindIII - 1670; NheI - 1789.

The final structure of recombinant DNA pYP2 confirmed by determining the nucleotide sequence in the region of the embedded fragment containing the gene fragment YP2 (1,551 KBP) (BamHI and HinIII fragment length 1,510 KBP obtained in the PCR, plus the sequence included in plasmid pQE30 encoding affine target 6xHis) (Figure 2).

The expression of the target gene YP2 check for the presence of recombinant protein 60 kilodaltons (figure 3. - amino acid sequence of the recombinant protein lipase gene Yp2, with affine target 6xHis)allocated using affinity chromatography on Ni-NTA-agarose, after IPTG induction of the transformed target plasmid pYP2 cells E. coli TG-1 (Figure 4).

Thus, the claimed technical solution allows you to get expressing plasmids the Yu DNA pYP2, encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee the liquidation length 504 S.A.

Transformed by this plasmid is widely known cell culture E. coli TG-1 [3] after induction of IPTG provides biosynthesis polypeptide size of 60 kilodaltons, consisting of a fragment of a protein having lipase activity, and 6*His N-end for affinity purification. This recombinant protein after affinity chromatography (at least 95-98% of the recombinant protein can be used as drug-destructor dirt containing solid alkanes.

Example 2. The results of the evaluation of the use of recombinant protein as a destructor of solid alkanes.

Based on the drug for treatment of soil and water from oil and petroleum products produced by JSC "Biooil" (Patent RF №RU 2337069), to which was added the enzyme produced by the claimed design. An experiment was conducted to evaluate the extent of influence of addition of E. coli (TG1) with built recombinant plasmid DNA pYP2 to the drug for treatment of soil and water from oil and oil products. As a pollutant was taken prior fraction paraffin gas condensate (the composition of the fractions is presented in table 1) in an amount of 5% (0.5 g/10 ml) in a liquid nutrient medium with the constant maintenance of concentration And the TG 2 mmol (add IPTG every 48 hours). The temperature of the experiment, 35 degrees Celsius. The amount of oil in water was determined after 5 days using IR-spectrometric measurement method (GOST R 51797-2001).

Table 1
The percentage of saturated hydrocarbons in the selected fraction of gas condensate
The number of fractionsChain length of saturated hydrocarbons
C15C16C17C18C19C20C21C22C23
O1-50,0160,0770,210,4611,1983,3929,26417,17320,832
The number of fractionsChain length of saturated hydrocarbons
C24C25SOn 27SSC30A31C32)C33
O1-517,82812,3167,0784,5622,3781,6020,9530,4990,1130,048

In the result, it was shown that the joint cultivation of the drug for treatment of soil and water from oil and oil products from E. coli (TG1) with built recombinant plasmid DNA pYP2 allows you to increase the amount of degradation of selected fractions of paraffins gas condensate (table 2) to 70,6% (35 g/l). Adding E. coli (TG1) without integrated plasmid DNA does not affect the degree of degradation of selected fractions of paraffins gas condensate. The amount of degradation in this case is 50% (24.8 g/l).

SOURCES of INFORMATION

1. The QIAexpressionist. Hilden: QIA GEN, Summer 1992. P.70.

2. Maniatis T., Fritsch, Sambuc J. (1984) Molecular cloning. TRANS. from English., M. The World. With 241.

3. Sambrook J. Molecular cloning: a laboratory manual. Vol.3 / J. Sambrook, D.W. Russell. - 3rd ed. - New York: Cold Spring Harbor Laboratory, 2001. - xxvii, P.15.1-18.136 (various pagings): ill. - Incl. bibl. ref. and index. - ISBN 978-087969577-4, page A3.9.

Recombinant plasmid DNA pYP2 encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee the liquidation length 504 amino acid residues, characterized in that it has a molecular weight of 3,212 megadalton (4,942 KBP)consists of a BamHI/HindIII - fragment DNA plasmid pQE30 (3,424 KBP) and BamHI/HindIII - fragment gene Yp2 Galleria mellonella encoding enzymatically active portion of the polypeptide lipase, protein digestive tract bee the liquidation (1,551 KBP), presented in figure 2, contains the as a genetic marker gene bla b-lactamase, determining the stability of the transformed plasmid pYP2 cells to ampicillin; nucleotide sequence encoding polyhistidine tract in the reading frame of the gene Yp2, consisting of 6 molecules of the amino acid histidine, for further purification using affinity chromatography sorbent Ni-NTA-agarose; unique recognition sites of restriction endonucleases, with the following coordinates: Xhol - 2; EcoRI - 89; BamHI - 148; SmaI - 914; HindIII - 1670; NheI - 1789.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention represents Bacillus licheniformis bacteria strain All-Russian collection of industrial microorganisms B-11302 - producer of heat-resistant lipase. At fermentation of the obtained strain in 3 l of a laboratory fermenter the ferment activity in culture liquid reaches the level of 500 U/ml.

EFFECT: invention allows obtaining heat-resistant lipase with high efficiency degree.

3 dwg, 5 ex

FIELD: biotechnology.

SUBSTANCE: culture fluid obtained after growth of the mixture of strains Lactobacillus acidophilus NKI, 100ash, K3"Ш"24, is frozen, the fat layer is removed, the defatted part is thawed and the cells are separated by centrifugation. The obtained supernatant is sterilised by membrane vacuum filtration, is concentrated with membrane ultrafiltration in the process of centrifugation, the concentrate of supernatant is treated with the components more than 30 KDa with fivefold excess of ice acetone. The resulting precipitate is diluted with 20 mM NaCl at a ratio of 2:1 by volume and is mixed with 10% Tween-80 to a final concentration of 1% Tween. Purification and isolation of the target product is carried by the method of horizontal isoelectrophoresis in a plate of 5% polyacrylamide gel with 7-8 M urea and 5% sucrose in gradient pH 4-8 at a temperature 8-12°C for 8 hours When isolation of the target product after electrophoresis the gel stripes are cut on isopoints, frozen at a temperature (-20°C) for 2 hours, thawed and dispersed, the solid parts are separated by centrifugation, concentrated by centrifugation at 5500 rev/min for 60 min at room temperature, low molecular weight impurities are removed, and the concentrate is mixed with phosphate buffer in 100-fold volume The gel stripes are cut on isopoints with pl (4.0-4.3) with the isolation of acid lectins and pl (7.6-8.0) with the isolation of alkaline pectins.

EFFECT: obtaining of lectins having anti-candidal activity is provided

5 cl, 1 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biochemistry. An aqueous mixture containing phospholipid in an amount of 2 to 50 wt % and a surfactant in an amount of 0.1 to 25 wt % is prepared. The aqueous mixture of phospholipid and surfactant is mixed with serine in an amount of 50 to 80 wt %. The reaction mixture is added with carrot phospholipase D in an amount of 5 to 25 wt %. A reaction of phospholipid and serine is enabled in the presence of water, metal ions and phospholipase D, and at least one surfactant, at temperature 21 - 25° C and at pH ranging from 7 to 10. Phosphatidylserine is recovered from the reaction mixture by filtration.

EFFECT: invention enables producing phosphatidylserine in an amount of 20 - 25 %.

3 ex

FIELD: chemistry.

SUBSTANCE: invention describes a lipolytic polypeptide and a method for production thereof, involving: 1) collecting parent lipase with an amino acid sequence which is at least 80% identical to the sequence SEQ ID NO:1, which is given the description; 2) collecting at least one amino acid residue in the sequence; 3) altering the amino acid sequence, where the alteration includes one or more of the following: N74Q, P143S, A281S, P38S, N292Q, L1QGPL, L1QL, I285E, L147F, L147N, N292C, L140E, P143L, A146T, P280V, A283K, A284N, T103G + A148P, W104H + A148P, N74Q + A281S, V190A, L199P, T256K, T42N, R242A, V2151, T164V, L163F + T164V, D265P, P303K, R168D, A25G, V315I, T244P, K13Q, L277I, Y91S + A92S + N96S + N97* + L99V or D223G; 4) obtaining the altered polypeptide with the altered amino acid sequence; 5) determining specific activity of the lipolytic enzyme; and 6) collecting the altered polypeptide, having higher specific activity of the lipolytic enzyme than the parent polypeptide. The invention also discloses methods of conducting reactions which are catalysed by the described lipase, which involve reaction of reactants with said polypeptide, where the reaction is: hydrolysis of a carboxylic ester, synthesis of a carboxylic ester, alcoholysis of a carboxylic ester or acidolysis of a carboxylic ester.

EFFECT: invention enables to obtain lipase with higher specific activity than the parent lipase.

9 cl, 5 tbl, 1 dwg, 8 ex

FIELD: food industry.

SUBSTANCE: one performs the reaction of interesterification between one or several a) compounds chosen from the group containing saturated C16-22 fatty acids with a straight chain and their compound ethers with lower alcohols and b) triglyceride containing an oleoyl or linoleoyl group in the second position. One mixes vegetable oil and triglyceride (ethylstearate). One adds an enzyme represented by granulated powdered lipase extracted from Rhizopus oryzae and/or Rhizopus delemar and soya bean powder with fat content equal to 5 - 25 wt %. One performs reaction (while stirring) during 7 hours at a temperature of 40°C. The produced solution is filtered for removal of granulated powdered lipase after interesterification. The produced product is distilled, fractioned and purified.

EFFECT: invention allows to improve efficiency and selectiveness of the interesterification reaction and produce solid butter having good crystalline properties, the butter applicable as an equivalent cocoa butter substitute and chocolate solidity modifier.

13 tbl, 9 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for reduction of re-esterification activity of lipase prepared of Thermomyces sp. and immobilised on a carrier, or a lypase powder mixture which contains a filter excipient and lypase prepared of Thermomyces sp. immobilised on the carrier. The lipase powder mixture is ground to average particle size 1 mcm to 300 mcm. The method is implemented by washing said lypase or lypase powder mixture in triacylglycerol. What is also presented is a method for re-esterification. It involves conducting a re-esterification reaction with the use of said lypase or lypase powder mixture. Then lypase or lypase powder mixture is separated from the reaction system and washed in triacylglycerol for reduction of re-esterification activity. One more re-esterification reaction is conducted with the use of reduced lypase or lypase powder mixture.

EFFECT: method provides effective reduction of low re-esterification activity of lypase or lypase powder mixture to be re-used in the re-esterification reaction.

10 cl, 3 dwg, 1 tbl, 3 ex

FIELD: medicine.

SUBSTANCE: what is prepared is a recombinant yeast strain Yarrowia lipolytica Russian National Collection of Industrial Microorganisms Y-3323 - an enzyme lipase producer. The strain is engineered of the strain W29 by means of URA3 gene inactivation that is followed by using the integrative plasmid pZ-lox-ura3d4-hp4d-LIP2 to transform the prepared transformant. The strain is able to synthesise lipase of activity 9000 Units/ml of a culture fluid.

EFFECT: invention may be used in food industry, household care and cosmetics.

3 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: method for reesterification of oil which contains one or more of citric and/or phosphoric acid as agents which form chelates with metals, involves steps for bringing oil into contact with a base and reacting the said oil with lipase. The enzymatic composition contains lipase with an incorporated base.

EFFECT: invention increases efficiency of the enzymatic composition and increases average output of the product of the enzymatic composition in one passage per unit time.

21 cl, 2 dwg, 2 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to chemical-pharmaceutical industry, namely to creation of medication for reduction of fat absorption form food, containing pectin or its salts, inhibitor of gastrointestinal lipase, auxiliary components.

EFFECT: medication is used for treatment or prevention of syndrome of anal oil leks, which can take place after administration of gastrointestinal lipase inhibitor of orlistat type, with further application for treatment of obesity and hyperlipemia.

6 cl, 4 dwg, 8 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: claimed is powder composition, possessing lipase activity. Composition contains filtering auxiliary material(s) and product, obtained by fine grinding of lipase, originating from Thermomyces sp., immobilised on silicon carrier(s), to average particle size 1 mcm or larger to smaller than 300 mcm. Also claimed are methods for re-etherification of fats and oils and for etherification with application of obtained lipase powder composition.

EFFECT: powder composition by the invention possesses improved lipase activity.

10 cl, 1 dwg, 2 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: peroxy hydrolase ferment is described, which may hydrolyze n-nitrophenylcaproate (pNC6) or n-nitrophenyloctanoate (pNC8) in presence of peroxide, where the specified ferment includes one of the following combinations of amino acid substitutes: Ala in the position 154 and Met in the position 194; Gly in the position 154 and Val in the position 194; or Gly in the position 12 and Met in the position 194, where the specified positions of amino acids are positionally equivalent to positions 12, 154 and 194 in the sequence SEQ ID NO: 2 of peroxy hydrolase M. smegmatis, and where the specified ferment produces peroxy acid. The following components are disclosed: produced nucleic acid, which codes the specified peroxy hydrolase ferment; recombinant nucleic acid, which expresses the peroxy hydrolase ferment, including a promotor and the specified produced nucleic acid; a vector of expression, including the specified recombinant nucleic acid; a host cell containing the recombinant nucleic acid and producing the peroxy hydrolase ferment. Compositions are described for washing, bleaching and disinfection, including effective amount of peroxy hydrolase ferment and source of hydrogen peroxide. Methods of washing, bleaching and disinfection are proposed, which include maintenance of a substrate in presence of the specified compositions for washing, bleaching or disinfection of the specified substrate, accordingly. Besides, it is suggested to use the specified produced peroxy hydrolase ferment for hydrolysis of an acyl ether substrate containing up to 8 atoms of carbon, in presence of hydrogen peroxide.

EFFECT: invention makes it possible to perform a reaction of hydrolysis of the specified compound in presence of hydrogen peroxide with formation of peroxy acids.

19 cl, 5 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention relates to the field of microbiology and genetic engineering. A new yeast strain Yarrowia lipolytica RNCIM Y-3600 has been produced - a producer of cell-bound lipase.

EFFECT: higher activity.

3 ex

FIELD: medicine.

SUBSTANCE: producing protein is ensured by bacterial host cell culture containing a recombinant nucleic acid in a medium containing crude glycerol as a carbon source, and protein recovery expressed by the cell. Crude glycerol represents a side product of bio fuel or soap which is found in the medium in the concentration of 0.1% to 75% (vol./vol.). The culture process is performed in an enclosed volume, injection or continuous fermentation. The bacterial cell is specified in Streptomyces Hvidans, Bacillus subtilis and Streptomyces rubiginosis.

EFFECT: higher accumulation of cell biomass and protein production in the culture.

11 cl, 14 dwg, 8 ex

FIELD: chemistry.

SUBSTANCE: cellobiohydrolase polypeptide is selected from a group consisting of: a polypeptide containing an amino acid sequence having at least 95% identity to SEQ ID NO:6 and having cellobiohydrolase activity and an fragment a), having cellobiohydrolase activity. Such polypeptides can be obtained using a recombinant technique using suitable polynucleotides, expression vectors and host cells.

EFFECT: invention can be used in production of fermentable sugars and bioethanol from lignocellulose material via enzymatic conversion.

32 cl,15 dwg, 31 tbl, 32 ex

FIELD: chemistry.

SUBSTANCE: disclosed is a plasmid which determines synthesis of alkaline phosphatase CmAP, containing a NcoI/SacI-fragment of plasmid pET-40b(+) (Novagen) and a DNA fragment of 1530 base pairs, which contains a chimeric gene consisting of a CmAP gene structural part which is adapted at the N-end for expression in E.coli cells, and a nucleotide which codes a specific sequence for TEV protease. Described is an E.coli Rosetta(DE3) strain which is transformed by said plasmid, and is a producer of chimeric protein, which contains an amino acid sequence of recombinant alkaline phosphatase CmAP. Disclosed is a method of obtaining recombinant alkaline phosphatase CmAP, comprising steps for: incubating said producer strain in a liquid broth LB for 12 hours at 20°C, depositing bacterial cells by centrifuging, disintegration of the cell suspension in a buffer, centrifuging the extract, chromatography of the supernatant fluid on a column with a metal affinity resin, elution of the protein, concentrating active fractions by ultrafiltration, incubation with protease TEV, concentrating the protein solution and extracting the end product by gel filtration.

EFFECT: improved method.

3 cl, 1 dwg, 3 ex

FIELD: biotechnology.

SUBSTANCE: invention relates to the area of biotechnology and genetic engineering. A recombinant plasmid DNA pACYC-LANS(KM) was constructed to be expressed in the cells of Escherichia coli of the polypeptide of recombinant L-asparaginase of Erwinia carotovora (rec-ASP-ECAR), was proposed producer strain rec-ASP-ECAR that is obtained from transformation of competent cells of Escherichia coli BL21(DE3) using the constructed recombinant plasmid DNA pACYC-LANS(KM), a method for growing the strain with its splitting from the obtained biomass and purification of recombinant L-asparaginase from Erwinia carotovora was developed.

EFFECT: enhanced biosynthesis of rec-ASP-ECAR polypeptide and high output and purity of the target product which is achieved by the implementation of a simple method for producing recombinant asparaginase.

4 cl, 4 dwg, 2 tbl, 5 ex

FIELD: biochemistry.

SUBSTANCE: present invention relates to a β-galactosidase with transgalactosylating activity with the sequence provided in the description and the relative coding DNC. A recombinant vector incorporating the DNA sequence and a host cell comprising the DNA sequence or the vector are also disclosed. The enzyme with transgalactosylating activity is proposed for producing a mixture of oligosaccharides comprising disaccharides, trisaccharides, tetrasaccharides and pentasacchrides. Method for producing a mixture of oligosaccharides including bringing the enzyme or the host-cell in contact with the lactose-containing material.

EFFECT: invention enables the production of a mixture of oligosaccharides by enzymic lactose transformation.

17 cl, 4 dwg, 3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: what is offered is a DNA molecule recovered from Bifidobacterium bifidum, with a sequence presented in the description, and its degenerate derivative coding β-galactosidase. Also, what is presented is a p-galactosidase enzyme having a sequence presented in the description. What is offered is an expression vector containing said DNA, and a bacterial host cell containing said vector. What is offered is application of the enzyme or the host cell for preparing a mixture of oligosaccharides which can be used for preparation of foodstuff, forages for animals and medicines. What is described is a method for producing the enzyme involving cultivation of said host cell in an appropriate culture medium under conditions supposing expression of said enzyme and recovery of the prepared enzyme from the culture.

EFFECT: invention allows transforming lactose into a mixture of oligosaccharides.

12 cl, 5 dwg, 3 tbl, 2 ex

FIELD: agriculture.

SUBSTANCE: ferments have improved characteristics compared to a ferment of wild type selected from high thermal stability, activity in wide pH range, high specific activity, wide substrate specificity and proteolytic stability. Besides, nucleic acids are proposed, which code these ferments, a vector containing these nucleic acids, a hostcell, which carries the vector, and a method to produce proposed phytase ferments from hostcells. This invention also relates to a food product or an animal fodder and to the method to make food product or fodder for animals, which includes addition of phytase ferment according to this invention to one or several ingredients of the prepared product or fodder.

EFFECT: using phytase ferments according to this invention as additives to animal fodders makes it possible to improve availability of organic phosphorus and to reduce contamination of environment with a phosphate.

28 cl, 3 dwg, 2 tbl, 11 ex

FIELD: chemistry.

SUBSTANCE: described is a polypeptide, having phytase activity, selected from: a polypeptide with an amino acid sequence given in the description of the invention, a fragment of that polypeptide, and a polypeptide which exhibits at least 90% identity with the said polypeptide. Described also is a polynucleotide which codes the said polypeptide. An expression cassette and an expression vector which contain the described polynucleotides are disclosed. A host organism producing the described polypeptide is disclosed. Furthermore, a feed additive and animal feed containing the said polypeptide, host organism or metabolites thereof is obtained. The invention discloses use of the said polypeptide to prepare a feed additive or animal feed and for hydrolysis of myoinositol hexakisphosphate to inorganic monophosphate, to myoinositol with lower degree of phosphorylation and to free myoinositol.

EFFECT: invention enables to obtain inorganic monophosphate, myoinositol with lower degree of phosphorylation or free myoinositol from a complex compound of myoinositol hexakisphosphate and vary the ration of domestic animals.

14 cl, 11 dwg, 9 tbl, 2 ex

FIELD: biotechnologies.

SUBSTANCE: characterised is recombinant pseudo adenoviral particle based on human being adenovirus genome of the 5-th serotype and method of its use. Provided particle contains expressing cassette with haemagglutinin gene of influenza virus being included. As a haemagglutinin gene of influenza virus, haemagglutinin gene of A/Perth/16/2009(H3N2) strain with pre-optimised for expression in human being cells nucleotide sequence presented in SEQ ID NO:2. The specified haemagglutinin gene of influenza virus of A/Perth/16/2009(H3N2) strain is cloned in expressing cassette containing polyadenylation signal SV40 under control of cytomegalovirus promoter. Presented invention may be used for induction of specific immunity to influenza virus A of H3N2 subtype during injection in efficient quantity.

EFFECT: providing intense expression of recombinant haemagglutinin of the specified influenza virus.

6 cl, 9 dwg, 1 tbl, 4 ex

Up!
Table 2
The oil content in the liquid nutrient medium after (g/l)
ControlPreparation for cleanup of soil and water from oil and oil products
+E. coli (TG1)+E. coli (TG1-pYP2)
The oil content49,6±1,6825±224,8±1,4414,6±1,52