Anti-axl antibodies

FIELD: chemistry.

SUBSTANCE: present invention relates to immunology. Disclosed are monoclonal antibodies which bind to the extracellular domain of receptor tyrosine kinase AXL and which at least partially inhibit AXL activity, as well as antigen-binding fragments. Also provided is an isolated nucleic acid molecule, a host cell and a method of producing a monoclonal antibody and an antigen-binding fragment thereof, as well as use of the monoclonal antibody or antigen-binding fragment thereof to produce a drug, pharmaceutical compositions, a method of diagnosing and a method of preventing or treating a condition associated with expression, overexpression and/or hyperactivity of AXL.

EFFECT: invention can be used in therapy and diagnosis of diseases associated with AXL.

23 cl, 20 dwg, 24 ex, 3 tbl

 

The technical field to which the invention relates.

The present invention relates to antibodies, in particular monoclonal antibodies that bind to the extracellular domain of the receptor tyrosine kinase AXL and which at least partially inhibit the activity of AXL.

Prior art

AXL (Ark, UFO, Tyro-7) receptor tyrosinekinase is a member of the family kinase Tyro-3, together with the other members, which are Mer (Eyk, Nyk, Tyro-12) and Sky (Rse, Tyro-3, Dtk, Etk, Brt, Tif). It is activated by attaching a heterophilic ligand Gas6, 70-kDa protein homologue to the anticoagulation factor protein s In contrast to other receptor tyrosinekinase, AXL is the tyrosine phosphorylation can also be caused by homophiles accession. Activation of AXL leads to signaling through PI-3-kinase/Akt (Franke et al., Oncogene 22:8983-8998, 2003) and other ways, the type of Ras/Erk and β-catenin/TCF (Goruppi et al., Mol. Cell Biol. 21:902-915, 2001).

AXL weakly expressed in many normal tissues, including the brain, heart, skeletal muscle, organ capsules and connective tissue of some other organs, and monocytes, but not lymphocytes. Akt-phosphorylation induced AXL described for populations of fibroblasts (Goruppi et al., Mol Cell Biol 17:4442-4453 1997), endothelial cells (Hasanbasic et al., Am J Physiol Heart Circ Physiol, 2004), vascular smooth muscle cells (Melaragno et al. J. Mol. Cell Cardiol. 37:881-887, 2004) and neurons (Alien et al., Mol. Endocrinol. 13:191-201 1999). In addition, AXL is involved in cell adhesion and chemotaxis. Knockouts on AXL lead to a slowdown in the stabilization of platelet aggregation and thrombus formation, resulting in reduced activation of the platelet integrin Ilb3.

Overexpression of AXL is observed in many types of cancer, e.g., in tumors of the breast (Meric et al., Clin. Cancer Res. 8:361-367, 2002; Berclaz et al., Ann. Oncol. 12:819-824, 2001), colon cancer (Chen et al., Int. J. Cancer 83:579-584, 1999; Craven et al., Int. J. Cancer 60:791-797, 1995), prostate (Jacob et al., Cancer Detect. Prev. 23:325-332, 1999), lung (Wimmel et al., Eur J Cancer 37:2264-2274, 2001), stomach (Wu et al., Anticancer Res 22:1071-1078, 2002), ovarian cancer (Sun et al., Oncology 66:450-457, 2004), endometrium (Sun et al., Ann. Oncol. 14:898-906, 2003), kidney (Chung et al., DNA Cell Biol. 22:533-540, 2003), hepatocellular (Tsou et al., Genomics 50:331-340, 1998), thyroid cancer (Ito et al., Thyroid 12:971-975, 2002; Ito et al., Thyroid 9:563-567, 1999) and carcinoma of the esophagus (Nemoto et al., 1997), and chronic myelogenous leukemia - CML (Janssen et al., A novel putative tyrosine kinase receptor with oncogenic potential. Oncogene, 6:2113-2120, 1991; Braunger et al., Oncogene 14:2619-2631 1997; O Bryan et al., Mol Cell Biol 11:5016-5031, 1991), acute malacitana leukemia - AML (Rochlitz et al., Leukemia 13:1352-1358, 1999), osteosarcoma (Nakano et al., J. Biol. Chem. 270:5702-5705, 2003), melanoma (van Ginkel et al., Cancer Res 64:128-134, 2004) and in squamous cell head and neck cancer (Green et al., Br J Cancer. 2006 94:1446-5, 2006).

In addition, AXL identified as associated with metastasis gene, which is aktiviruetsya cell lines aggressive forms of breast cancer, compared to non-invasive cells. In vitro, it was found that the migration and invasion necessary AXL activity, and this activity can be inhibit by treatment with antibodies (WO04008147). Similarly, neutralization of AXL activity in vivo, either through expression of a dominant negative variant AXL (Vajkoczy, P., et al., Proc. Natl. Acad. Science USA 103:5799-5804. 2005)or by siRNA-mediated deactivation AXL (Holland et al., Cancer Res. 65:9294-9303, 2005), prevented subcutaneous and orthotopic cell growth in experiments on mice with xenografts.

Still described two antibodies that bind to AXL and possess the biological activity. One antibody is capable of reducing AXL-mediated invasion of cells (WO04008147), while another antibody, reportedly reduces the interaction of AXL/Ligand. However, both antibodies are polyclonal, which makes them unsuitable for therapeutic applications.

Thus, in view of therapeutic potential of AXL there is an urgent need for AXL monoclonal antibodies, fragments of antibodies or their derivatives, which are effective and specific would block AXL-mediated signal transduction and which would be suitable for treatment.

Disclosure of inventions

Accordingly, the first aspect of the present invention relates to a monoclonal antibody, including fra the COP and its derivative, which binds to the extracellular domain of AXL, especially AXL person, and at least partially inhibits the activity of AXL.

Preferably the antibody of the present invention additionally has at least one or more of the following properties: the ability to reduce or block AXL-mediated signal transduction, the ability to reduce or block AXL-phosphorylation, the ability to reduce or block cell proliferation, the ability to reduce or inhibit angiogenesis, the ability to reduce or block the migration of cells, the ability to reduce or block tumour metastasis, the ability to reduce or block AXL-mediated PI3K-signaling pathway and the ability to reduce or block AXL-mediated antiapoptosis processes, resulting in increasing, for example, the sensitivity of cells to treatment antineoplastics agent. In addition, antibodies of the present invention can exhibit a high specificity to AXL, especially AXL person, and largely do not recognize other family members Tyro-3, e.g., MER, and/or SKY, and/or AXL mammals, non-primates, such as AXL mice. The specificity of the antibody can be determined by measuring cross-reactivity, as described in the Examples.

The term "activity" refers to biological function AXL, to whom I affect the phenotype of the cells, in particular, but not limited to, cancer phenotypes, such as, for example, avoidance of apoptosis, autonomy in growth signals, cell proliferation, tissue invasion and/or metastasis, the intensity of the signals antirust (antiapoptosis processes) and/or persistent angiogenesis.

The term "AXL-mediated signal transduction" means the activation of secondary information paths that run through direct or indirect interaction with AXL secondary molecule messenger.

The term "AXL-phosphorylation" refers to the phosphorylation of amino acid residues, preferably tyrosine residues, or by using a second AXL protein (transphosphorylation), or other protein having the activity of protein kinases.

The term "cell proliferation" refers to all AXL-including the processes underlying the reproduction of human cells, in particular, but not limited to, cancerous human cells. They participate in or lead to the replication of cellular DNA, separation of duplicated DNA in two equal-size groups of chromosomes and physical division (called cytokines) holistic cells must be stimulated or oposredovanie non-catalytic or catalytic activities AXL, preferably including AXL-phosphorylation and/or AXL-mediated signal transduction.

The term "shall migenes" refers to all AXL-including processes, to promote the growth of new blood vessels from pre-existing vessels, such as, but not limited to, new supply, the tumor blood vessels. These processes include a variety of cellular events such as proliferation, survival, migration and sprouting (germination) of the endothelial cells of the vascular wall, the attraction and migration of pericytes, as well as the formation of the basal membrane to stabilize vessels, perfusion of blood vessels or the secretion of angiogenic factors by stromal cells or neoplastic cells, and should be stimulated or indirect non-catalytic or catalytic activity AXL, preferably including AXL-phosphorylation and/or AXL-mediated signal transduction.

The term "metastasis" refers to all AXL-including processes that contribute to the distribution of cancer cells from the primary tumor, penetrate into lymphatic and/or blood vessels, circulate through the bloodstream and growth in an isolated lesion (metastasis) in normal tissues throughout the body. In particular, this refers to the cellular processes in tumor cells, such as proliferation, migration, bezyatiny growth, evasion of apoptosis, or the secretion of angiogenic factors, which show metastasis and stimulated or mediated by non-catalytic or catalytic Akti is, however, AXL, preferably including AXL-phosphorylation and/or AXL-mediated signal transduction.

The term "AXL-mediated antiapoptosis processes" refers to all AXL-including processes that protect human cells, preferably but not limited to, human cancer cells from programmed cell death (apoptosis). In particular, it refers to processes that protect human cells, preferably but not limited to, human cancer cells, induction of apoptosis through the termination of the growth factor, hypoxia, exposure to chemotherapeutic agents or radiation or initiation of the Fas/Apo-1 receptor-mediated signal transduction and stimulated or mediated by non-catalytic or catalytic activities AXL, preferably including AXL-phosphorylation and/or AXL-mediated signal transduction.

In addition, the present invention includes antibodies whose binding activity with AXL are KD=10-5M or less, preferably KD=10-7M or less, and most preferably KD=10-9M or less. Does the binding activity of AXL antibodies of the present invention KD=10-5M or less, can be determined using methods known from the prior art. For example, activity may be determined using the method of surface-what about the plasma resonance Biacore and/or by using ELISA (enzyme-linked immunosorbent assay), EIA (enzyme immunoassay), RIA (radioimmunoassay analysis) or method of fluorescent antibodies, e.g., FACS.

In the second aspect, the antibody can have at least one antigennegative site, e.g., one or two antigenspecific site. Additionally, the antibody preferably contains at least one heavy chain immunoglobulin and at least one light chain immunoglobulin. Immunoglobulin chain contains a variable domain, and optionally, a constant domain. Variable domain can include defining complementarity plots (CDR), e.g. CDR1, CDR2 and/or CDR3 plot, and frame areas. The term "complementarity determining plot" (CDR) are clearly defined in the level of technology (see, for example, Harlow and Lane "Antibodies, a Laboratory Manual", CSH Press, Cold Spring Harbour, 1988) and refers to the movements of amino acids in the variable area of the antibodies, which is in direct contact with the antigen.

An additional aspect of the present invention relates to an antibody, including a fragment or derivative that binds to the extracellular domain of AXL, which contains at least one amino acid sequence of the heavy chain comprising at least one CDR chosen from the group consisting of:

(a) CDRH1 as shown in SEQ ID NO:16, 22, 28, or CDRH1 sequence which differs by 1 is 2 amino acid residues,

(b) CDRH2 as shown in SEQ ID NO:17, 23, 29, or a CDRH2 sequence which differs by 1 or 2 amino acid residues, and

(c) CDRH3 as shown in SEQ ID NO:18, 24, 30, or CDRH3 sequence which differs by 1 or 2 amino acid residues,

and/or at least:

one amino acid sequence of light chain comprising at least one CDR chosen from the group consisting of:

(d) CDRL1 as shown in SEQ ID NO:13, 19, 25 or CDRL1 sequence which differs by 1 or 2 amino acid residues,

(e) CDRL2 as shown in SEQ ID NO:14, 20, 26 or a CDRL2 sequence which differs by 1 or 2 amino acid residues, and

(f) CDRL3 as shown in SEQ ID NO:15, 21, 27 or CDRL3 sequence which differs by 1 or 2 amino acid residues,

or monoclonal antibodies that recognize the same epitope on the extracellular domain of AXL.

In the preferred embodiment, the antibody contains a heavy chain containing at least one CDR selected from the group consisting of:

(a) CDRH1 as shown in SEQ ID NO:16, or CDRH1 sequence which differs by 1 or 2 amino acid residues,

(b) CDRH2 as shown in SEQ ID NO:17, or a CDRH2 sequence which differs by 1 or 2 amino acid residues, and

(c) CDRH3 as shown in SEQ ID NO:18, or a CDRH3 sequence which differs by 1 and the 2 amino acid residues,

and/or light chain containing at least one CDR selected from the group consisting of:

(d) CDRL1 as shown in SEQ ID NO:13, or CDRL1 sequence which differs by 1 or 2 amino acid residues,

(e) CDRL2 as shown in SEQ ID NO:14, or a CDRL2 sequence which differs by 1 or 2 amino acid residues, and

(f) CDRL3 as shown in SEQ ID NO:15, or a CDRL3 sequence which differs by 1 or 2 amino acid residues,

or a monoclonal antibody that recognizes the same epitope on the extracellular domain of AXL.

In an additional preferred embodiment, the antibody contains a heavy chain containing at least one CDR selected from the group consisting of:

(a) CDRH1 as shown in SEQ ID NO:22, or CDRH1 sequence which differs by 1 or 2 amino acid residues,

(b) CDRH2 as shown in SEQ ID NO:23, or a CDRH2 sequence which differs by 1 or 2 amino acid residues, and

(c) CDRH3 as shown in SEQ ID NO:24, or a CDRH3 sequence which differs by 1 or 2 amino acid residues,

and/or light chain containing at least one CDR selected from the group consisting of

(d) CDRL1 as shown in SEQ ID NO:19, or CDRL1 sequence which differs by 1 or 2 amino acid residues,

(e) CDRL2 as shown in SEQ ID NO:20, or a CDRL2 sequence which is while in 1 or 2 amino acid residues, and

(f) CDRL3 as shown in SEQ ID NO:21, or a CDRL3 sequence which differs by 1 or 2 amino acid residues,

or a monoclonal antibody that recognizes the same epitope on the extracellular domain of AXL.

In another more preferred embodiment the antibody contains a heavy chain containing at least one CDR selected from the group consisting of:

(a) CDRH1 as shown in SEQ ID NO:28, or CDRH1 sequence which differs by 1 or 2 amino acid residues,

(b) CDRH2 as shown in SEQ ID NO:29, or a CDRH2 sequence which differs by 1 or 2 amino acid residues, and

(c) CDRH3 as shown in SEQ ID NO:30, or a CDRH3 sequence which differs by 1 or 2 amino acid residues, and/or light chain containing at least one CDR selected from the group consisting of:

(d) CDRL1 as shown in SEQ ID NO:25, or CDRL1 sequence which differs by 1 or 2 amino acid residues,

(e) CDRL2 as shown in SEQ ID NO:26, or a CDRL2 sequence which differs by 1 or 2 amino acid residues, and

(f) CDRL3 as shown in SEQ ID NO:27, or a CDRL3 sequence which differs by 1 or 2 amino acid residues,

or a monoclonal antibody that recognizes the same epitope on the extracellular domain of AXL.

In another embodiment the present invention relates to the antibody, the soda is containing the amino acid sequence of the heavy chain, selected from the group consisting of SEQ ID NO:8, 10, 12, or at least its variable domain or an amino acid sequence having her identity sequence at least 90%, and/or amino acid sequence of the light chain selected from the group consisting of SEQ ID NO:7, 9, 11, or at least its variable domain or an amino acid sequence having her identity sequence at least 90%, or invention relates to an antibody that recognizes the same epitope on the extracellular domain of AXL.

Used here has the meaning of "sequence identity" between two polypeptide sequences shows the percentage of amino acids that are identical between the sequences. Preferred polypeptide sequence of the invention have a sequence identity constituting at least 90%.

In a particularly preferred embodiment the antibody selected from the group consisting of V, 11D5, 10D12, or antibodies that recognize the same epitope on the extracellular domain of AXL.

The antibody can be any antibody of natural and/or synthetic origin, e.g. the antibody of a mammal. Preferably, the constant domain - if present - is a constant domain of a human. Constant domain site which preferably is a constant domain of a mammal, e.g. humanized, or a constant domain of a human. More preferably, the antibody is a chimeric, humanized or human antibody.

The antibody of the invention may be IgA, IgD-, IgE, IgG - or IgM-type, preferably IgG - or IgM-type, including, but not limited to, IgG1-, IgG2-, IgG3-, IgG4-, IgM1 and IgM2-type. In the most preferred embodiments the antibody is an IgG1-, IgG2 or IgG4-type.

As discussed above, there are many isotypes of antibodies. You must understand that antibodies, which are formed, at first, does not have this isotype, but sometimes the antibody, as formed, can have any isotype, and that the antibody can be an antibody with switched isotype using molecularly cloned gene V-region or cloned genes const plots or cDNA in the relevant expressing vectors using conventional biomolecular technologies, which are well known in the prior art, and then expressed antibodies in the cells of the host, using techniques known from the prior art.

The term antibody includes "fragments" or "derivatives", which have at least one antigennegative plot antibodies. Antibody fragments include Fab fragments, Fab' fragments, F(ab')2 fragments, and Fv fragments. Derived antibodies include single strand of antic the La, nanotesla and diately. Derived antibodies should also include frame proteins with antibody-like binding activity that are associated with AXL.

In the context of the present invention, the term "frame protein" used herein is meant a polypeptide or protein with the exposed surface area, which with a high degree of acceptable amino acid insertions, substitutions or deletions. Examples of frame proteins, which can be used in accordance with the present invention are protein a from Staphylococcus aureus, bilin-binding protein of Pieris brassicae or other lipocalin protein with ancyranum repeat and fibronectin person (shown in Binz and Pluckthun, Curr Opin Biotechnol, 16:459-69, 2005). Creating a frame of a protein can be considered as transplantirovali or integration of affine functions on or in the structural frame firmly Packed protein. Affine function means the affinity for binding proteins in accordance with the present invention. The frame may be structurally separated from the amino acid sequence, giving binding specificity. In General, proteins that are presumably relevant to the development of such synthetic affinity reagents can be obtained by rational, or most common, Raman methods of protein engineering, is aka as panning against AXL, either purified protein or protein present on the cell surface for binding agents in synthetic library frame proteins presents in vitro, this protein can be obtained by a person skilled in the art (Skerra, J. Mol. Recog., Biochim Biophys Acta, 1482:337-350, 2000; Binz and Pluckthun, Curr Opin Biotechnol, 16:459-69, 2005). In addition, frame protein having antitelephone binding activity can be obtained from the acceptor polypeptide containing frame domain, which can be connected with linking the donor domains of the polypeptide to give binding specificity of the donor polypeptide frame domain-containing acceptor polypeptide. Introduced binding domains may include, for example, at least one CDR of an anti-AXL antibodies, preferably, at least one that is chosen from the group of SEQ ID NO:13-30. Inserts can be done in different ways, known to experts in the art, including, for example, with the help of polypeptide synthesis, synthesis of nucleic acids and encoded amino acids, and also with the help of various recombinant techniques well known in the art from the prior art.

As was defined above, the specificity of the antibody, antibody fragment or derivative is aminosilanes sequence of CDR. onstantly domain (heavy chain VH and light chain VL) of the antibody preferably comprises three complementarity determining section, sometimes called hypervariable sites, flanked by four relatively conservative frame sections or "FR". Often the specificity of the antibody is determined, or to a greater extent determined by the CDR, such as the CDR of the VH chain, or the number of CDR. The person skilled in the art will easily appreciate how the constant domain of the antibody, antibody fragment or derivative having the above-described CDR can be used for design of antibodies with additionally improved specificity and biological function. Therefore the present invention encompasses antibodies, antibody fragments or derivatives thereof, containing at least one CDR of the above-described constant domains and mainly have practically the same, similar or improved properties as the antibody described in the accompanying examples. Starting with an antibody that contains at least one CDR that is specified in the attached sequence listing and provided by the embodiments of the invention, the expert can combine additional CDR of the original identified by monoclonal antibodies or different antibodies to increase the specificity and/or affinity. CDR-grafting is well known in the art and can also be used to accurately customize specific affinity, etc the other properties of the antibody, fragment or derivative of the invention, as it remains natural specificity. Mainly, the antibody, fragment or derivative contains at least two, more preferably at least three, even more preferably at least four or at least five, and particularly preferably all six CDRs from the nature of the donor antibody. Additional alternatives of the invention CDR from different natural monoclonal antibodies can be combined in a new unit of antibodies. In this case, it is preferable that the three CDRs of the heavy chain was from the same antibody, whereas the three light chain CDR came from the other (but not all in one) antibodies. Antibodies of the present invention or their corresponding immunoglobulin chain(s) can be further modified using conventional techniques known from the prior art, for example, by using amino acid deletion(s), insertion(s), replace(n), addition(s), and/or recombination(s), and/or any other modification(s), known from the prior art, either individually or in combination. Ways of introducing such modifications in the DNA sequence underlying the amino acid sequences of immunoglobulin chains, well-known specialist in the art; see, e.g., Sambroo, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (1989) N.Y.

Antibodies, fragments of antibodies or their derivatives, if necessary, deimmunized for therapeutic purposes. Neimmunizirovannah antibody is a protein, devoid, or with a small number of epitopes that can be recognized by T-helper lymphocytes. An example of how to identify these epitopes shown in Tangri et al. (J Immunol. 174:3187-96, 2005). Production of fragments neimmunizirovannah antibodies or derivatives thereof may be made as described in U.S. patent No. 6054297, 5886152 and 5877293.

In one embodiment antibodies specific include "chimeric" antibodies (immunoglobulins)in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequences in antibodies derived from a particular species or belonging to a particular class or subclass of antibody, while the remainder of the chain(s) is identical with or homologous to corresponding sequences in antibodies derived from another species or belonging to another class or subclass antibodies as well as fragments of such antibodies, as they exhibit the desired biological activity (U.S. patent No. 4816567; Morrison et al., Proc. Natl. Acad. Sci. USA, 81:6851-6855 (1984)). Obtaining chimeric antibodies are described, for example, in WO 89/09622.

Preferably, the present invention relates to chemerisov nomu antibody, containing the amino acid sequence of the heavy chain selected from the group consisting of SEQ ID nos:38, 39, 41, 42, or, at least, her constant domain or an amino acid sequence having her identity sequence at least 90%, and/or amino acid sequence of the light chain which is selected from the group consisting of SEQ ID NO:37, 40, or at least its constant domain or an amino acid sequence having her identity sequence at least 90%, or the invention relates to an antibody that recognizes the same epitope on the extracellular domain of AXL.

In an additional embodiment, the antibody of the present invention are humanitarianism or fully human antibodies. Humanized forms of the antibodies may be generated in accordance with the methods known from the prior art, such as chimerization or CDR grafting. Alternative methods of obtaining humanized antibodies are well known in the art and described, e.g., in EP-A1 0239400 and W090/07861. Usually humanitariannet antibody has one or more amino acid residues introduced into it from a source that is not a person. These inhuman amino acid residues are often referred to as "import" residues, which are typically taken from an "import" constant domain. Humans the of the can, for example, be performed using the method described by Winter and his co-authors (Jones et al., Nature, 321:522-525 (1986); Riechmann et al., Nature, 332:323-327 (1988); Verhoeyen et al., Science, 239:1534-1536 (1988)), by replacing the CDR or CDR sequences of nonhuman origin for the corresponding sequences of human antibodies. Therefore, such "humanized" antibodies are chimeric antibodies (U.S. patent No. 4816567), which is almost less than an intact human constant domain is substituted by the corresponding sequence from species that are not relevant to humans. In practice, humanized antibodies are typically human antibodies in which some CDR residues and possibly some FR residues substituted residues similar sites from a nonhuman antibody.

Preferably, the present invention relates to humanitarianlaw the antibody containing the amino acid sequence of the heavy chain selected from the group consisting of SEQ ID NO:44, 46, or, at least, her constant domain or an amino acid sequence having her identity sequence at least 90%, and/or amino acid sequence of the light chain which is selected from the group consisting of SEQ ID nos:43, 45, or, at least, her constant domain or an amino acid sequence having her identity is the selected, at least 90%, or invention relates to an antibody that recognizes the same epitope on the extracellular domain of AXL.

One way to create a fully human antibody includes the use of mouse strains XenoMouse®, which contain fragments of embryonic type of heavy chain locus of a human and locus Kappa light-chain size not less than 1000 KB. See, Mendez et al. (Nature Genetics 15:146-156 1997), and Green and Jakobovits (J. Exp. Med. 188:483-495, 1998). Strains XenoMouse® available from AMGEN, Inc. (formerly ABGENIX, Fremont, CA).

Obtaining strains of mice XenoMouse® discussed and defined in patent applications U.S. No. 07/466,008, filed 12.01.1990; No. 07/610,515, filed 08.11.1990; No. 07/919,297, filed 24.07.1992; No. 07/922,649, filed 30.07.1992; No. 08/031,801, filed 15.03.1993; No. 08/112,848, filed 27.08.1993; No. 08/234,145, filed 28.04.1994; No. 08/376,279, filed 20.01.1995; No. 08/430, 938, filed 27.04.1995, No. 08/464,584, filed 05.06.1995, No. 08/464,582, filed 05.06.1995, No. 08/463,191, filed 05. 06.1995, No. 08/462,837, filed 05.06.1995, No. 08/486,853, filed 05.06.1995, No. 08/486,857, filed 05.06.1995. No. 08/486,859, filed 05.06.1995, No. 08/462,513, filed 05.06.1995, No. 08/724,752, filed 02.10.1996, No. 08/759,620, filed 03.12.1996; in the publication U.S. 2003/0093820 filed 30.11.2001, and in U.S. patent No. 6162963, 6150584, 6114598, 6075181 and 5939598 and Japanese patent No. 3068180 B2, 3068506 B2 and 3068507 B2. Cm. also European patent EP 0463151 B1, published 12.06.1996, international patent application WO 9402602 published 03.02.1994, international patent application WO 9634096 published 31.1.1996, WO 9824893 published 11.06.1998, WO 0076310 published 21.12.2000. A description of each cited above patents, applications, and references are given here in full by reference.

In an alternative method, other researchers, including researchers GenPharm International, Inc. used "mini-loci". This approach mini-loci is that was simulated locus exogenous Ig by incorporating fragments (individual genes) of the Ig locus. Thus, one or more genes VHone or more genes DHone or more genes JH, constant mu-region and a second constant region (preferably constant gamma region) created the design for the introduction of the animal. This method is described in U.S. patent No. 5545807, Surani et al., and in the U.S. patents№№5545806, 5625825, 5625126, 5633425, 5661,016, 5770429, 5789650, 5814318, 5877397, 5874299 and 6255458, Lonberg, and in U.S. patent No. 5591669 and 6023010, Krimpenfort & Berns, U.S. patent No. 5612205, 5721367 and 5789215, Bems et al., and in U.S. patent No. 5643763, Choi & Dunn, and in International patent applications U.S.; GenPharm: reg. No. 07/574748, filed August 29, 1990, 07/575962, filed August 31, 1990, 07/810279, filed on December 17, 1991, 07/853408 filed March 18, 1992, 07/904068, filed June 23, 1992, 07/990860, filed December 16, 1992, 08/053131 filed April 26, 1993, 08/096762 filed July 22, 1993, 08/155301, filed November 18, 1993, 08/161739, filed December 3, 1993, 08/16569, filed December 10, 1993, and 08/209741 filed March 9, 1994, the descriptions of which are incorporated here by reference. Cm. also Europatent No. 546073 B1, International patent application no WO 92/03918, WO 92/22645, WO 92/22647, WO 92/22670, WO 93/12227, WO 94/00569, WO 94/25585, WO 96/14436, WO 97/13852 and WO 98/24884, and U.S. patent No. 5981175, descriptions of which are incorporated here by reference in full.

Kirin also demonstrated the generation of human antibodies in mice, which by the merger of microclear have introduced large fragments of chromosomes or whole chromosomes. Cm. European patent application No. 773288 and 843961, descriptions of which are incorporated here by reference. Additionally, were generated KMTM-mice, which are the result of cross-breeding mice Those (Kirin) and mice with minilogue (Medarex) (Humab). These mice have human transhumanity IgH Kirin mice and transgene Kappa-chain Genpharm mice (Ishida et al.,, Cloning Stem Cells 4:91-102, 2002).

Human antibodies can also be obtained by in vitro methods. Suitable examples include, but are not limited to phage display (CAT, Morphosys, Dyax, Biosite/Medarex, Xoma, Symphogen, Alexion (former Proliferon), (Affimed) ribosomal display (CAT), yeast display, and the like.

For therapeutic purposes the antibody can be konjugierte with treatment-effector group, e.g. radioactive group or cytotoxic group.

For diagnostic purposes, the antibody can be marked. Coming up what their labels include radioactive labels, fluorescent label or an enzyme label.

Additionally used in accordance with the present invention antibodies are the so-called xenogenic antibodies. The General principle of obtaining xenogenic antibodies, such as human antibodies in mice are described, e.g., in WO 9110741, WO 9402602, WO 9634096 and WO 9633735.

As discussed above, the antibody of the invention can exist in various forms, in addition to full of antibodies, including for example, Fv, Fab' and F(ab')2, and single chain, see, e.g., WO 8809344.

Optionally, the antibodies of the invention can be motivovany in the constant domains of the heavy and/or light chains to change the binding properties of antibodies. For example, the mutation can be performed in one or more CDR-sections to increase or decrease the Kd of the antibody for AXL or to change the binding specificity of the antibody. Techniques of site-directed mutagenesis is well known in the prior art. See, e.g., Sambrook et al. and Ausubel et al., supra. In addition, the mutation may be made in the amino acid residue that is known, what is changed in comparison with embryonic variable in the plot AXL antibodies. In another aspect, mutations can be introduced into one or more frame sections. The mutation can be performed in the solid phase or constant domain to increase the half-life AXL antibodies. See, e.g., WO 0009560. Muta is the I frame in the plot or the constant domain may also be performed to modify the immunogenicity of the antibody with the provision of a site for covalent or non-covalent binding to another molecule or to change properties such as the binding of complement. Mutations can be performed in each of the frame sections, a constant domain and a variable sites in a single mutated antibody. Alternatively, mutations can be performed in only one of the frame sections, variable regions or the constant domain in the same mutated antibody.

In an additional aspect, the antibody can have a constant domain effector functions, on the basis of which expressing AXL cells that bind the antibody, antibody fragment or derivative on the cell surface may be exposed to the immune system. For example, the antibody may be capable of fixing complement and participating in complementability cytotoxicity (CDC). In addition, the antibody may be capable of binding Fc receptors on effector cells, such as monocytes and natural killer cells (NK), and participate in antibody-dependent cellular cytotoxicity (ADCC).

In another additional aspect, the antibodies of the invention are suitable for therapeutic treatment, preferably for the treatment of hyperproliferative diseases, cardiovascular diseases, in particular atherosclerosis and thrombosis, diabetes-related diseases, in particular glomerular hypertrophy or diabetic nephropathy, and in particular violations associated with providusaa or caused by the expression, the overexpression or hyperactivity AXL. Hyperproliferative diseases, preferably selected from disorders associated with, accompanied by or caused by the expression, overexpression or hyperactivity AXL, such as cancer, e.g., breast cancer, colon cancer, lung cancer, kidney cancer, follicular lymphoma, myeloid leukemia, skin cancer/melanoma, glioblastoma, ovarian cancer, prostate cancer, pancreatic cancer, Barrett's esophagus and esophageal cancer, stomach cancer, bladder cancer, cervical cancer, liver cancer, thyroid cancer, and head and neck cancer or hyperplastic and neoplastic diseases or other hyperproliferative disease associated with expression or overexpression of AXL.

In another aspect, antibodies of the present invention can be used to introduce, together with the antineoplastic agent for treatment of one of the above violations.

The joint introduction of value used here includes the introduction of antibodies of the present invention together with antineoplastics agent, preferably antineoplastics agent, inducing apoptosis. The term co-administration also includes the introduction of the antibodies of the present invention and antineoplastic agent, preferably antineoplastic agent, inducing apoptosis in the form of a single composition or as two or more separate compositions. Joint introduction includes the introduction of antibodies of the present invention together with antineoplastics agent, preferably antineoplastic agent, inducing apoptosis, at the same time (i.e. at the same time) or sequentially (i.e., intervals).

The invention additionally relates to a nucleic acid molecule that encodes the antibody, antibody fragment or derivative of the invention. The nucleic acid molecule of the invention encoding the above antibody, antibody fragment or derivative, may be, e.g., DNA, cDNA, RNA, or synthetically derived DNA or RNA, or recombinante obtained chimeric molecule is a nucleic acid that contains any of these nucleic acid molecules either in isolation or in combination. The molecule of nucleic acid can be genomic DNA, related to the complete gene or the greater part thereof, or to fragments and its derivatives. The nucleotide sequence may relate to the natural nucleotide sequence or may contain single or multiple nucleotide substitutions, deletions or additions. In a particularly preferred embodiment of the present invention the nucleic acid molecule is a cDNA molecule.

Preferably, the invention relates to an isolated nucleic acid molecule selected from the gr is PPI, consisting of:

(a) a nucleic acid sequence that encodes a polypeptide SEQ ID NO:7-12, 13-30, 37-42, 43-46;

(b) a nucleic acid sequence as shown in SEQ ID NO:1-6, 31-36;

(c) a nucleic acid complementary to any sequences in (a) or (b); and

(d) a nucleic acid sequence capable of hybridization with (a), (b) or (C) under strict conditions.

The term "hybridization under stringent conditions" means that two fragments of the nucleic acids hybridize to each other under standard hybridization conditions, as described, for example, in Sambrook et al., "Expression of cloned genes in E. coli" Molecular Cloning: A laboratory manual (1989), Cold Spring Harbor Laboratory Press, New York, USA. Such conditions are, for example, hybridization in 6.0×SSC at about 45°C followed by a stage of washing with 2.0×SSC at 50°C, preferably of 2.0×SSC at 65°C., or 0.2×SSC at 50°C, preferably of 0.2×SSC at 65°C.

The invention also relates to a vector containing the nucleic acid molecule of the invention. The specified vector can be, for example, a phage, plasmid, viral or retroviral vector. Retroviral vectors can be replication competent or replication defective. In the latter case, the reproduction of the virus can usually only occur in complementary cells of the host.

Molecules of nucleic acids of the invention can be combined with the vector of the m, containing breeding markers for reproduction in the host. Typically, the plasmid vector is introduced in a precipitate, such as a precipitate of calcium phosphate or precipitate of chloride of rubidium, or in a complex with a charged lipid, or in clusters with carbon basis, such as fullerenes. If the vector is a virus, it is possible to complete in vitro, using an appropriate cell line with a defect in the packaging, before introduction into the cell of the host.

Preferably, the vector of the invention is an expressing vector in which the nucleic acid molecule is functionally linked to one or more control sequences allowing transcription and, optionally, the expression in prokaryotic and/or eukaryotic cells-hosts. Expression of the indicated molecules of nucleic acid includes transcription of the nucleic acid molecule, preferably in broadcast mRNA. Regulatory elements ensuring expression in eukaryotic cells, preferably mammalian cells, are well known to a person skilled in the art. They typically contain regulatory sequences that allow initiation of transcription and optionally poly-A signals ensuring termination of transcription and stabilization of the transcript. Additional reg is attornye elements include transcription, as well as translational enhancers. Possible regulatory elements ensuring expression in prokaryotic cells-owners, contain, e.g., lac, trp or tac-promoter in E. coli, and examples for regulatory elements ensuring expression in eukaryotic cells-the owners are the AOXI promoter or GAL1 in yeast or the CMV-, SV40-, RSV-promoter (rous sarcoma virus), CMV-enhancer, SV40-enhancer or intron globin gene in mammalian cells or other animals. Among the elements that are responsible for the initiation of transcription, such regulatory elements may also contain signals termination of transcription, such as the site of the SV40-poly-a or site tk-poly-A, down from polynucleotide. In this case, expressing suitable vectors are known in the prior art, such as cDNA expressing vector pcDV1 Okayama-Berg (Pharmacia), pCDM8, pRc/CMV, pcDNAI, pcDNA3 (Invitrogen) or pSPORTI (GIBCO BRL). Preferably, the specified vector is expressing vector and/or vector for gene transfer or sighting vector. Expressing the vector, which is derived from viruses such as retroviruses, the vaccine virus, adenovirus, herpes virus or human papilloma virus of cattle, can be used to deliver polynucleotides or vector of the invention in micheneau cell population. Methods which are well known in the art, can promenadesanta construct recombinant viral vectors; see, for example, the techniques described in Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001, Third Edition) N.Y. and Ausubel, Current Protocols in Molecular Biology, Green Publishing Associates and Wiley Interscience, N.Y. (1994). Alternatively, the nucleic acid molecule of the invention can be dissolved in liposomes for delivery to target cells.

The invention additionally relates to the host containing the vector of the invention. The specified host can be prokaryotic or eukaryotic cell or transgenic animal, non-human. Polynucleotide or vector of the invention, which is present in the host, can either be integrated into the host genome, or may be supported extrachromosomal. In this connection it is necessary to understand that the nucleic acid molecule of the invention can be used for "targeted impact on the gene(s)" and/or "replacement gene(s)"to restore the mutant gene or to create a mutant gene via homologous recombination; see, for example Mouellic, Proc. Natl. Acad. Sci. USA, 87 (1990), 4712-4716; Joyner, Gene Targeting, A Practical Approach, Oxford University Press.

The host may be any prokaryotic or eukaryotic cell, such as cell bacteria, fungus, plant, animal, mammal, or, preferably, human. Preferred fungal cells are, for example, the cells of the kind of yeast fungi (Saccharomyces), in particular species S. crevisiae. The term "prokaryotic" include all bacteria which can be transformed or transliterate polynucleotides for expression of the variant polypeptide of the invention. Prokaryotic hosts may include gram-negative and gram-positive bacteria, such as E. coli, S. typhimurium, Serratia marcescens and Bacillus subtilis. Polynucleotide encoding the mutant form of the variant polypeptides of the invention may be transformed or transfirieran into the host using any methods known to a person skilled in the art. Methods of cooking merged, functionally related genes and their expression in bacterial or animal cells are well known in the art (Sambrook, Molecular Cloning A Laboratory Manual, Cold Spring Harbor Laboratory (2001, Third Edition)). The genetic constructs and methods described herein may be used for expression of variant antibodies, fragments of antibodies of the invention or derivatives thereof, e.g., in prokaryotic hosts. In General, expressing vectors containing promoter sequences which facilitate the efficient transcription of the introduced nucleic acid molecule, used in conjunction with the owner. Expressing the vector typically contains an origin of replication, a promoter and terminator, as well as specific genes which are capable of selecting the phenotype tra is formed cells. Transformed prokaryotic cells can be grown in fermenters and cultivate in accordance with the methods known from the prior art, to achieve optimal cell growth. Antibodies of the invention, antibody fragments or derivatives thereof can then be isolated from the culture medium, cell lysates or fractions of cell membranes. Isolation and purification of the antibodies of the invention, expressed in bacteria or other types, fragments of antibodies or their derivatives can be performed using any conventional methods, such as preparatory chromatographic separations and immunological separations, which include the use of monoclonal or polyclonal antibodies.

In the preferred embodiment of the invention the host cell is a bacteria, fungus, plants, amphibians or animal. Preferred animal cells include, but are not limited to, cells of the Chinese hamster ovary (Cho)cells, kidney dwarf hamster (BHK)cells, monkey kidney (COS), T cells, NSO cells and other cell lines, including human cells, for example Regs. In another preferred embodiment of the specified cell of an animal is an insect cell. Preferred insect cells include, but are not limited to, cells, cell lines SF9.

More predpochtite the flax embodiment of the invention, the specified host is a human cell or cell line of human rights. These cells include, but are not limited to, cells of embryonic human kidney (HEK293, T, 293 freestyle). In addition, these cell lines human include, but are not limited to, HeLa cells, cells of hepatocarcinoma person (e.g., Hep G2), A cells.

The invention also provides transgenic animals, non-human, containing one or more nucleic acid molecules of the invention, which can be used to generate antibodies of the invention. Antibodies can be obtained or extracted from tissues or biological fluids, such as milk, blood or urine, from goats, cows, horses, pigs, rats, mice, rabbits, hamsters or other mammals. See, e.g., U.S. patent No. 5827690; 5756687; 5750172 and 5741957. As described above, transgenic animals, non-human and which contain the loci of human immunoglobulins can be obtained by immunization AXL or her part.

The invention additionally relates to a method of making an antibody, comprising culturing the host of the invention under conditions which allow to synthesize the specified antibody, and removing the specified antibodies from the specified culture.

Transformed hosts can be grown in fermenters and cultivate in accordance with the methods known from the prior art, for Costigan the I optimal cell growth. As soon as expressibility, all antibodies, their dimers, individual light and heavy chains, or other forms of immunoglobulins of the present invention can be purified according to standard procedures known from the prior art, including fractionation with ammonium sulfate, affinity columns, column chromatography, gel electrophoresis and the like; see Scopes, "Protein Purification", Springer-Verlag, N.Y. (1982). The antibody or the corresponding immunoglobulin chain(s) of the invention can then be isolated from the culture medium, cell lysates or fractions of cell membranes. Isolation and purification, e.g., antibodies expressed in bacteria, or immunoglobulin chains of the invention can be performed by any conventional means, such as, for example, preparatory chromatographic separations and immunological separations, which include the use of monoclonal or polyclonal antibodies, directed, e.g., against the constant section of the antibodies of the invention.

To a person skilled in the art understand that antibodies of the invention can additionally communicate with other agents, e.g., for targeting drugs and image visualization. This connection can be carried out chemically after expression of the antibodies or antigen at the site of attachment, or prod the CT accession can be constructed in the antibody or the antigen of the invention at the DNA level. The DNA is then expressed in a suitable system is the master, and expressed proteins are collected and denatured, if necessary.

In the preferred embodiment of the present invention the antibody is linked to an effector, such as a radioisotope or toxic chemotherapeutic agent. Preferably, these conjugates antibodies can be used in the target cells, e.g. cancer cells expressing AXL, for elimination. Connection antibodies/fragments of the antigen of the invention with radioisotopes, e.g., provides benefits for the treatment of tumors. Unlike chemotherapy and other forms of cancer therapy, radioimmunotherapy, or the introduction of a combination of a radioisotope-antibody directly affects the cancer cells with minimal damage to surrounding normal, healthy tissue. Preferred radioisotopes include, e.g.,3H,14C, 15N,35S90Y99Tc111In1251,131I.

In addition, antibodies of the invention can be used to treat cancer, if they konjugierte with toxic chemotherapeutic drugs, such as geldanamycin (Mandler et al., J. Natl. Cancer Inst., 92(19), 1549-51, 2000), maytansine, for example maytansinoid drug DM1 (Liu et al., Proc. Natl. Acad. Sci. U.S.A. 93:8618-8623, 1996) and auristatin-E, or monomethylaniline-E (Doronina et al., Nat. Biotechnol. 21:778-784, 2003), or the stool is himazin. Various linkers, which release the drug at acidic or reductive conditions or under the action of specific proteases, are used with these technologies. Antibodies of the invention can be konjugierte, as described in the prior art.

The invention additionally relates to a pharmaceutical composition comprising the antibody molecule of nucleic acid, vector, host of the invention or the antibody obtained by the method of the invention.

The term "composition" used here is the value contains at least one compound of the invention. Preferably, the composition is a pharmaceutical or diagnostic composition.

Preferably, the specified pharmaceutical composition contained pharmaceutically suitable carrier and/or diluent. Described herein, the pharmaceutical composition may be partially suitable for treating disorders that are accompanied or caused by the expression associated with overexpression or hyperactivity AXL, e.g., hyperproliferative diseases, cardiovascular diseases, in particular atherosclerosis and thrombosis, diabetes-related diseases, in particular glomerular hypertrophy or diabetic nephropathy. These violations include, but are not limited to, cancer, e.g. breast cancer, colon cancer, the AK lungs, kidney cancer, follicular lymphoma, myeloid leukemia, skin cancer/melanoma, glioblastoma, ovarian cancer, prostate cancer, pancreatic cancer, Barrett's esophagus and esophageal cancer, stomach cancer, bladder cancer, cervical cancer, liver cancer, thyroid cancer, and head and neck cancer, or other hyperplastic or neoplastic disease or other disease associated with expression or overexpression of AXL.

The term "hyperactivity" in this invention refers to uncontrolled AXL activation, which may be caused by a deficiency and/or dysfunction of negative regulation. As an example, negative regulation involves the dephosphorylation of proteins, degradation and/or endocytosis. In addition, uncontrolled AXL activation may be the result of genetic changes, or somatic or germ, which lead to changes in the amino acid sequence of AXL.

Examples of suitable pharmaceutical carriers, excipients and/or diluents are well known in the art and include phosphate-saline buffer solutions, water, emulsions such as oil-in-water emulsions, various types of humidifiers, sterile solutions, and other Compositions containing such carriers can be formulated by well known conventional methods. These pharmaceutical compositions the AI, you can enter the subject in the proper dosage. Introduction of suitable compositions may be effected in various ways, e.g. intravenously administered intraperitoneally, subcutaneously, intramuscularly, topically, intradermally, intranasally or intrabronchial. Compositions of the invention can also be entered directly in the desired area, e.g., by balistically delivery in the external or internal stretch target, for example in the brain. The mode of administration of the medicine will be determined by the attending physician and depending on clinical factors. As is known, the dosage for each individual patient depends on many factors, including the size of the patient, the surface area, age, entered a particular connection, sex, time and route of administration, General health condition and other medications that the patient is taking at the same time. Belovodskoe pharmaceutically active substance may be present in an amount of from 1 μg to 100 mg/kg body weight per dose; however, doses below or above this exemplary range are also provided, in particular taking into account the above factors. If the mode is a continuous infusion, the active substance must be present in the range from 1 PG to 100 mg per kilogram of body weight per minute.

The dynamics can be checked through periodic evaluation. Compositions of the invention can be type double is or systemically. Preparations for parenteral administration include sterile aqueous or nonaqueous solutions, suspensions and emulsions. Examples of non-aqueous solvents are propylene glycol, polyethylene glycol, vegetable oils such as olive oil, and injectable organic esters, such as etiloleat. Aqueous carriers include water, alcoholic/aqueous solutions, emulsions or suspensions, including saline and buffered environment. Injecting fillers include sodium chloride, dextrose and ringer, dextrose and sodium chloride, ringer's lactate or fatty oil. Intravenous fillers include fluid and nutrient fillers, electrolyte fillers (such that based on dextrose ringer's) and the like. Preservatives and other additives may also be included in, for example, such as antimicrobial agents, antioxidants, hepatoblastoma agents and inert gases and the like. In addition, the pharmaceutical composition of the invention may contain additional agents depending on the purpose of the pharmaceutical composition. Particularly preferably, the pharmaceutical composition further comprises an active agent, such as, e.g., additional antineoplastic agent, a small molecule inhibitor, an anticancer agent or chemotherapeutic agent.

From Britanie also relates to pharmaceutical compositions, contains anti-AXL-antibody, which is preferably an antibody of the invention in combination with at least one additional antineoplastic agent. This combination is effective, for example, for inhibiting abnormal cell growth.

Many antineoplastic agents currently known from the prior art. In General, the term includes all agents that can prevent, reduce and/or treat hyperproliferative diseases. In one embodiment the antineoplastic agent is selected from the group of therapeutic proteins, including, but not limited to, antibodies or immune modulating proteins. In another embodiment of the antineoplastic agent selected from the group of low molecular weight inhibitors or chemotherapeutic agents, consisting of inhibitors of mitosis, alkylating agents, antimetabolites, intercalating antibiotics, inhibitors of growth factors, inhibitors of the cell cycle, enzymes, topoisomerase inhibitors, inhibitors discontiuation, "agent aktivirovaniya", modifiers biologic response, antihormones, e.g. anti-androgens, and agents antiangiogenesis.

Specific examples of antineoplastic agents that can be used in combination with antibodies that are provided here include, for example, gefinitib, lapatinib, sunitinib, Padme is rexed, bevacizumab, cetuximab, imatinib, trastuzumab, alemtuzumab, rituximab, erlotinib, bortezomib and the like. Other specific antineoplastic agents for use in the compositions described and claimed here include, for example, chemotherapeutic agents such as capecitabine, daunorubicin, daunomycin, dactinomycin, doxorubicin, epirubicin, idarubitsin, zorubicin, bleomycin, mafosfamide, ifosfamide, cytosine arabinoside, bis-chloroethylnitrosourea, busulfan, mitomycin C, actinomycin D, mithramycin, prednisone, hydroxyprogesterone, testosterone, tamoxifen, dacarbazine, procarbazine, altretamin, pentametilmelamina, mitoxantrone, amsacrine, chlorambucil, methylcyclohexylamine, nitrogen mustard, melphalan, cyclophosphamide, 6-mercaptopurine, 6-tioguanin, cytarabine (CA), 5-azacytidine, hydroxyurea, deoxycoformycin, 4-hydroxyprogesterone, 5-fluorouracil (5-FU), 5-ftordezoksiuridin (5-FUdR), methotrexate (MTX), colchicine, Taxol, vincristine, vinblastine, etoposide, trimetrexate, teniposide, cisplatin and diethylstilbestrol (DES). See, basically, The Merck Manual of Diagnosis and Therapy, 15th Ed. 1987, p.1206-1228, Berkow et al., eds., Rahway, N.J. particularly preferred are such antineoplastic agents that induce apoptosis.

When used in conjunction with the described AXL-antibody such antineoplastic agents can and is be used individually (e.g., 5-FU and antibody), sequentially (e.g., 5-FU and antibody over a period of time with subsequent use of MTX and antibodies) or in combination with one or more antineoplastic agents (e.g., 5-FU, MTX and the antibody or 5-FU, radiotherapy and antibody).

The term antineoplastic agent may also include therapeutic treatments, such as radiation or radiotherapy.

The pharmaceutical composition of the invention can be applied in clinical medicine and can also be used in veterinary purposes.

Additionally, the invention relates to the use of the antibodies of the invention, the nucleic acid molecule, vector, host of the invention or antibodies obtained by the method of the invention for the preparation of pharmaceutical compositions for the diagnosis, prevention or treatment of hyperproliferative diseases, cardiovascular diseases, in particular atherosclerosis and thrombosis, diabetes-related diseases, in particular glomerular hypertrophy or diabetic nephropathy, and in particular diseases involving or caused by the expression associated with overexpression or hyperactivity AXL.

Hyperproliferative disease that described above, includes neoplasia, i.e. any pathological and/or uncontrolled tumor tissue. The term "uncontrolled growth " TKA " and" used here, the value may depend on dysfunction and/or violation of the regulation of growth. Hyperproliferative disease includes tumors and/or cancer, such as metastatic or invasive malignant tumors.

In the preferred embodiment application of the invention specified hyperproliferative disease is, in particular, breast cancer, colon cancer, lung cancer, kidney cancer, follicular lymphoma, myeloid leukemia, skin cancer/melanoma, glioblastoma, ovarian cancer, prostate cancer, pancreatic cancer, Barrett's esophagus and esophageal cancer, stomach cancer, bladder cancer, cervical cancer, liver cancer, thyroid cancer, and head and neck cancer or hyperplastic or neoplastic disease or other hyperproliferative diseases associated with expressionism or sverkhekspressiya AXL.

In still another embodiment the present invention relates to the use of anti-AXL antibodies, preferably antibodies of the present invention for the manufacture of a medicine for joint injection with antineoplastic agent for treatment of one of the above violations.

In accordance with the following preferred embodiment of the present invention relates to the use of anti-AXL antibodies for the manufacture of pharmaceutical compositions for the treatment of cancer, drug-resistant. In a particularly p is edocfile the embodiment of the anti-AXL-antibody is a monoclonal antibody, as specified in claims 1 to 22 of the claims.

Additionally, the present invention relates to compositions for the diagnosis, containing the antibody of the invention, the nucleic acid molecule, vector, host of the invention or the antibody obtained by the method of the invention, and, optionally, pharmaceutically suitable carrier.

The diagnostic composition of the invention is suitable in detecting unwanted expression, overexpression or hyperactivity AXL mammals in various cells, tissues, or other suitable sample, and the method of detection comprises contacting the sample with the antibody of the invention and determining the presence of AXL in the sample. Thus, the diagnostic composition of the invention can be used to estimate the beginning or the state of hyperproliferative diseases.

In addition, malignant cells, such as cancer cells expressing AXL, can be targeted to the antibody of the invention. Cells that bind the antibody of the invention may be attacked by the immune complexes by the system, such as system compliments, or by cell-mediated cytotoxicity, thereby reducing the number or eradication of cancer cells. These principles apply equally in the treatment of metastatic and recurrent tumors.

In d the natives aspect of the present invention, the antibody of the invention are connected with labeled groups. Such antibodies are particularly useful for diagnostic applications. In the value used here, the term "labeled the group" refers to detectivemisa marker, e.g. radiolucency amino acid, or biotinylated agents that can be detected by using labeled avidin. Various methods of labeling polypeptides and glycoproteins, such as antibodies, are known in the art and can be used in implementing the present invention. Examples of suitable labeled groups include, but are not limited to, the following: radioisotopes or radionuclides (e.g.,3H,14C,15N35S90Y99Tc11In125I131I), fluorescent groups (e.g., FITC, rhodamine, lanthanoide y matter), enzymatic groups (e.g., horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase), chemiluminescent groups, biotinylated groups, or predetermined polypeptide epitopes recognized secondary reporter groups (e.g., paired sequence lacinova "lightning", binding sites for secondary antibodies, the binding domains of metals, epitope tags).

In some aspects it may be desirable that the labeled group attached via a spacer elements groups of various lengths to reduce potential steric nesiotes the via.

In another embodiment the present invention relates to a method for evaluating the presence AXL-expressing cell, comprising contacting the antibody of the invention with cells or tissues, potentially containing AXL on their surface. Suitable methods of detecting the expression of AXL in the sample can be solid-phase enzyme-linked immunosorbent assay (ELISA) or immunohistochemistry (IHC).

The ELISA can be performed in titration microplate, where, e.g., in the wells of the microplate adsorbed AXL-antibody. The wells are washed and treated with a blocking agent such as milk protein or albumin, to prevent nonspecific adsorption of the analyte. Then the wells treated with the test sample. After washing, the test sample or standard, the wells treated with the second AXL-antibody, which is labeled, e.g., by binding with Biotin. After washing the excess secondary antibody label is detected, e.g., together with avidin-conjugated horseradish peroxidase (HRP) and a suitable chromogenic substrate. The concentration of AXL-antigen in test samples is determined by comparison with a standard curve developed on the basis of standard samples.

For IHC can be used paraffin tissue, with tissue, e.g., first deparaffinized in xylene and then dehydrate the comfort, e.g., ethanol and washed in distilled water. Antigenic epitopes that are hidden by fixation in formalin and fill in paraffin, can be accessed by opening epitopes, enzymatic cleavage or saponin. To open epitopes paraffin sections can be heated in a steam chamber, a water bath or microwave oven for 20-40 min in solution to restore epitopes, such as, for example, 2N HCl solution (pH of 1.0). In the case of enzymatic degradation of the tissue section can be incubated at 37°C for 10-30 minutes in different enzyme solutions, such as proteinase K, trypsin, pronase, pepsin and other

After flushing solution to restore epitopes or excess enzymes, tissue section treated with a blocking buffer to prevent nonspecific interactions. Add primary AXL-antibody in appropriate concentrations. Excess primary antibody is washed and slices incubated in peroxidase blocking solution for 10 min at room temperature. After another washing step, the tissue section is incubated with a second labeled antibody, e.g. labeled group that can serve as "anchors" for the enzyme. Therefore, examples are Biotin-labeled secondary antibodies that are detected with horseradish peroxidase conjugated with streptavidin. Discovery is complex antibody/enzyme is achieved by incubating with an appropriate chromogenic substrate.

In an additional embodiment the present invention relates to a method of blocking functions AXL, comprising contacting the antibody of the invention with cells or tissue, potentially containing(s) AXL on their/its surface under conditions in which the antibody is able to block the function of AXL. The contacting can be performed in vitro or in vivo.

The invention also relates to a method of treatment of hyperproliferative diseases, cardiovascular diseases, in particular atherosclerosis and thrombosis, diabetes-related diseases, in particular glomerular hypertrophy or diabetic nephropathy, the method comprises administration to a patient in need of treatment, the appropriate dosage of the antibody, or antibody fragment, or its derivative of the present invention. Hyperproliferative disease is preferably selected from disorders involving or caused by the expression associated with overexpression or hyperactivity AXL, such as cancer, e.g. breast cancer, colon cancer, lung cancer, kidney cancer, follicular lymphoma, myeloid leukemia, skin cancer/melanoma, glioblastoma, ovarian cancer, prostate cancer, pancreatic cancer, Barrett's esophagus and esophageal cancer, stomach cancer, bladder cancer, cervical cancer, liver cancer, thyroid cancer, and head and neck cancer, or hyperpl the political and neoplastic diseases or other hyperproliferative disease, associated with expression or overexpression of AXL.

In accordance with another preferred embodiment of the invention the cancer, which is subjected to the treatment is a drug resistant cancer.

The invention additionally relates to a method of treatment of a disease in which an antibody of the invention is administered to the mammal in which the disease directly or indirectly related to pathological expression level or activity of AXL.

As a result, the invention relates to a kit containing anti-AXL-antibody, preferably an antibody, antibody fragment or derivative of the invention, the nucleic acid molecule encoding the specified components and/or vector of the invention.

All embodiments involving compounds described here can be used as individual compounds and in combination for the preparation of medicines.

Brief description of figures

Figure 1. Analysis of flow cytometry AXL on the cell surface in fibroblasts Ratl-Mock and Ratl-AXL cl.2. Polyclonal cells Ratl-Mock and clonal cells Ratl-AXL cl.2 obtained by infection Ratl-fibroblasts ectropium virus pLXSN and pLXSN-hAXL, respectively, were collected and marked mouse control antibody A (left panel) or mouse primary antibody anti-AXL MAB (right panel) at a concentration of 3 µg/m and PE-conjugated artemisinin secondary antibody. For more information, see the text. Tagging Ratl-AXL cl-2 cells has led to a shift by three orders of magnitude and demonstrates AXL-overexpression on the surface of these cells.

Figure 2. Analysis of flow cytometry AXL on the cell surface in fibroblasts NIH3T3-Mock and NIH3T3-AXL cl.7. Polyclonal cells NIH3T3-Mock and clonal cells NIH3T3-AXL cl.7 obtained by infection of NIH3T3-fibroblasts ectropium virus pLXSN and pLXSN-AXL, respectively, were collected and marked mouse control antibody A (left panel) or mouse primary antibody anti-AXL MAB (right panel) at a concentration of 3 μg/ml PE-conjugated artemisinin secondary antibody. For more information, see the text. Tagging NIH3T3-AXL cl.7 cells has led to a shift by two orders of magnitude and demonstrates AXL-overexpression on the surface of these cells.

Figure 3. Analysis of flow cytometry cross-autochemistry rat anti-AXL-AXL antibodies of mice and macaques-Griboedov and human Mer and Sky. HEK293T-fibroblasts were randomly transfusional pcDNA3, pcDNA3-hAXL, pcDNA3mAXL, pcDNA3-cyAXL, pcDNA3-hMer or pcDNA3 - hSky. The cells were collected and marked 10 µg/ml anti-AXL-primary antibody 1D5, 11D5, V, 10D12, E, A, 11D7 or W and/or PE-conjugated donkey Anticriminal secondary antibody or PE-conjugated donkey artemisinin secondary antibody-only control. For more information, see the text. Except 12B7, which showed an average cross otvechai the beard with mouse AXL, and human Mer and Sky, no anti-AXL antibodies did not give cross-react with these molecules. In contrast, all tested anti-AXL antibodies gave cross-react with AXL macaques-Griboedov.

Figure 4. ELISA experiments to study the effects of rat anti-AXL-AXL antibodies on receptor phosphorylation. NIH3T3-AXL cl.7 fibroblasts (a) and NCI-H292 lung cancer cells (b) Abagnale, pre-incubated with 10 µg/ml mouse control antibody A, as well as with rat anti-AXL antibodies A, 11D7, 11D5, V, E or 10D12, treated or not treated with 400 ng/ml mGas6 and literally. The lysate was transferred into wells MAXL-Sorp 96, coated with anti-phospho-tyrosine antibody 4G10, which are then washed and incubated with 0.5 μg/ml biotinylated mouse anti-AXL-antibody 12B7, AR-conjugated-streptavidin and substrate solution AttoPhos in order to capture the intensity of fluorescence. For more information, see the text. Rat anti-AXL antibodies V, 11D5, E and 10D12 provided block or reduce ligand-mediated AXL activation, as shown by a decrease in the phosphorylation and, therefore, was seen as antagonistic anti-AXL antibodies. In contrast, rat anti-AXL antibodies A and 11D7 stimulated basal activation of AXL, indicated by increased phosphorylation, with slightly reduced ligand-TNA is radovanu activation of AXL and consequently was seen as agonistic anti-AXL antibodies.

Figure 5. ELISA experiments to study the effects of rat anti-AXL antibodies on the phosphorylation R42 cable line/R MAR-Kinase. Cell cervical cancer CaSki was Abagnale, pre-incubated with 10 µg/ml ezotericheskim control antibody 1D5, as well as with rat anti-AXL-antibody 11D5, V or A, treated or not treated with 400 ng/ml mGas6 and were fixed with formaldehyde. Cells were washed, blocked and incubated with primary antibody anti-phospho-R/R42 cable line MAR-Kinase (Thr202/Tyr204), HRP-conjugated anti-rabbit secondary antibody and a solution of tetramethylbenzidine for measuring the intensity of absorption. For more information, see the text. Rat anti-AXL antibodies V and 11D5 ensured a decline in the ligand-mediated activation R42 cable line/R MAR-Kinase, indicated by a decrease in phosphorylation, and consequently was seen as antagonistic anti-AXL antibodies. In contrast, rat anti-AXL-antibody A stimulated basal activation R42 cable line/R MAR-Kinase, as shown by increased phosphorylation, it did not reduce ligand-mediated activation R42 cable line/R MAR-Kinase and thus was seen as agonistic anti-AXL-antibody.

Figure 6. ELISA experiments to study the effects of rat anti-AXL antibodies on the phosphorylation of Akt Kinase. NIH3T3-AXL cl.7 fibroblasts (a) and CaLu-1 lung cancer cells (b) Abagnale, pre-incubated with 10 m is g/ml ezotericheskim control antibody 1D5, and with rat anti-AXL-antibody 11D5, V or A, treated or not treated with 400 ng/ml mGas6 and were fixed with formaldehyde. Cells were washed, blocked and incubated with anti-phospho-Akt (Ser473) primary antibody, HRP-conjugated anti-rabbit secondary antibody and a solution of tetramethylbenzidine for measuring the intensity of absorption. For more information, see the text. Rat anti-AXL antibodies V and 11D5 provided blocking and reduce ligand-mediated activation of Akt Kinase, which is evident by reduced phosphorylation and, thus, was seen as antagonistic anti-AXL antibodies. In contrast, rat anti-AXL-antibody A stimulated basal activation of Akt Kinase, as shown by increased phosphorylation, it did not reduce ligand-mediated activation of Akt Kinase and consequently was seen as agonistic anti-AXL-antibody.

Figure 7. ELISA experiments compared the effects of rat and chimeric anti-AXL antibodies on the phosphorylation of Akt Kinase. Fibroblasts NIH3T3-AXL cl.7 was Abagnale, pre-incubated with 50 ng/ml, 100 ng/ml, 300 ng/ml 500 ng/ml and 1 μg/ml mouse anti-AXL-antibody 11 V7 or chimeric anti-AXL-antibody ch11B7, together with 50 ng/ml, 100 ng/ml, 300 ng/ml 500 ng/ml, 1 μg/ml, 5 μg/ml and 10 μg/ml mouse anti-AXL-antibody 11D5 or chimeric anti-AXL-antibody ch11D5, processed or not probatively 400 ng/ml mGas6 and fixed with formalin. Cells were washed, blocked and incubated with primary antibody anti-phospho-Akt (Ser473), HRP-conjugated anti-rabbit secondary antibody and a solution of tetramethylbenzidine for measuring the intensity of absorption. For more information, see the text. Rat anti-AXL-antibody V and chimeric anti-AXL-antibody ch11B7, and rat anti-AXL-antibody 11D5 or chimeric anti-AXL-antibody ch11D5 provided inhibition of ligand-mediated activation of Akt Kinase to a similar level as seen by reduced phosphorylation. Thus, compared to their rat counterparts chimeric anti-AXL antibodies ch11B7 and ch11D5 supported activity.

Figure 8. Competitive ELISA experiments to study the properties of the binding of rat anti-AXL antibodies. 96-well tablets MAXL-Sorp was covered with 1 µg/ml AXL-ECD of human and pre-incubated with 10 µg/ml abioterrorism ezotericheskim control antibody 1D5 or rat anti-AXL-antibody W, 11D5, E, 10D12, 11D7 or A. After incubation with 0.5 μg/ml biotinylated ezotericheskim control antibody 1D5 or biotinylating rat anti-AXL-antibody W, 11D5, E, 10D12, 11D7 or A and the addition of AP-conjugated streptavidin and substrate solution AttoPhos, collected fluorescence signal to determine the corresponding biotinylated antibodies. For more information, see the text. Control antibody D5 not joined AXL-ECD. Antagonistic anti-AXL antibodies V, 11D5, E and 10D12 competed with each other for identical or structurally related epitopes. Agonistic antibodies 11D7 and A recognize different epitopes were not competing with antagonistic antibodies to join AXL-ECD.

Figure 9. Analysis of the healing of wounds/scratches to study the effects of rat and chimeric anti-AXL antibodies on cell migration and proliferation. Before reaching the cells of confluently cell lung cancer NCI-H292 was Abagnale and put it on the wound with the tip of a pipette. In the presence of 10 μg/ml izotopicheskogo control antibody 1D5, antagonistic rat anti-AXL antibodies 11D5, V, E or 10D12, chimeric anti-AXL antibodies chn11D5 lgG2 and chn11B7 lgG2, agonistic rat anti-AXL antibodies A and 11D7 and 10 μg/ml Erbitux or 5 μm Sutent cells provided the possibility of secondary settling the vacant lot. After 24 h the cells were fixed and stained and photographed the wound. For more information, see the text. Compared to ezotericheskim control antibody 1D5 antagonistic rat anti-AXL antibodies 11D5, V, E and 10D12, as well as chimeric anti-AXL antibodies chn11D5 lgG2 and chn11B7 lgG2 reduced secondary settling the vacant lot, whereas agonistic rat anti-AXL antibodies A and 11D7 led to a complete closure of the wound.

Figure 10. Analysis using cameras of Boyden/cameras IU the loom "transwell" for studying the effects of rat anti-AXL antibodies on directed cell migration. In serum-free medium fibroblasts NIH3T3-AXL cl.7 pre-incubated with 10 μg/ml rat anti-AXL-antibody A, V or A, were cultivated top-coated with collagen 1 liners FluoreBlock and were subjected to serum-free medium with or without Gas6 in the lower chamber. After 7 h, the migrated cells were stained with kalayna AM and measured the fluorescence of each cell. For more information, see the Text. Antagonistic anti-AXL-antibody V reduced both basal and Gas6-induced migration of fibroblasts NIH3T3-AXL cl.7, whereas agonistic rat anti-AXL-antibody A increased ligand-induced and, in particular, the basal migration of cells NIH3T3-AXL cl.7. Antibody I had no action on directed cell migration.

Figure 11. Analysis using AlamarBlue™ to examine the functioning of the rat anti-AXL antibodies on CA$6-induced cell proliferation. In serum-free medium fibroblasts NIH3T3-AXL cl.7 pre-incubated with 20 μg/ml mouse control antibody A, antagonistic rat anti-AXL-antibody 11D5 and V and agonistic anti-AXL-antibody A and were grown in the absence or in the presence of 400 ng/ml Gas6. After 4 days, the cells were added AlamarBlue™ and measured adsorption. For more information, see the text. Antagonistic anti-AXL antibodies 11D5 and V inhibited Gas6-induced proliferation of fibroblast the s NIH3T3-AXL cl.7, while agonistic rat anti-AXL-antibody A increased ligand-induced and, in particular, basal cell proliferation NIH3T3-AXL cl.7.

Figure 12. Analysis determination of Caspase-3/7 to examine the functioning of the rat anti-AXL antibodies on Cas6-mediated antiapoptosis processes. In serum-free medium fibroblasts NIH3T3-AXL cl.7 pre-incubated with 10 µg/ml ezotericheskim control antibody 1D5, antagonistic rat anti-AXL-antibody V and 11D5 or agonistic rat anti-AXL-antibody 11D7 and A and treated or not treated with Gas6. Added the substrate solution Apo-ONE and collected fluorescence signal for measuring the activity of caspase-3/7. For more information, see the text. Compared with the isotope control antibody antagonistic rat anti-AXL antibodies V and 11D5 reduced Cas6-mediated antiapoptosis processes fibroblasts NIH3T3-AXL cl.7 in serum-free medium and, consequently, induced apoptosis. In contrast, agonistic rat anti-AXL antibodies A and 11D7 induced antiapoptosis processes of cells NIH3T3-AXL cl.7 in serum-free environment regardless of the presence or absence of Gas6 and, therefore, inhibited apoptosis.

Figure 13. Analysis of cell angiogenesis, based on the formation of spheroids, to examine the functioning of the rat anti-AXL antibodies on VEGF-A-induced endotheliocytes sprouting. HUVEC with erode immersed in a 3D collagen gel, stimulated with 25 ng/ml VEGF-A and was treated with specified concentrations of the antagonistic rat anti-AXL antibodies V (a) and 11D5 (C) for 24 hours were Analyzed by mean ± SEM total length of shoots from 10 randomly selected spheroids on the point on the graph (left panel) and determined the corresponding inhibition by antibodies (right panel). The approximation image curves IC50and the count values of the IC50was performed using GraphPad Prism 4.03. For more information, see the text. The antagonistic rat anti-AXL antibodies V and 11D5 inhibited VEGF-A-stimulirovany HUVEC-sprouting in the analysis of spheroid-based angiogenesis dose-dependent manner. Whereas higher concentrations V reduced HUVEC-sprouting to basal levels, while inhibition at higher concentrations 11D5 was not effective (left panel). HUVEC-sprouting was Engibarov values IC50of 9.8×10-8M and 7.0×10-7M for V and 11D5 respectively (right panel).

Figure 14. Model of orthotopic xenograft to examine the functioning of the rat anti-AXL antibodies on the growth of prostate cancer man in Nude mice. Cell carcinoma of the prostate PC-3-LN orthotopic implanted into the prostate of mice NMRI-nu/nu. Animals randomly selected into 4 groups and they were given 25 mg/kg isotypic is who control antibody 1D5 or antagonistic rat anti-AXL antibodies V, and 40 mg/kg Sutent or 12.5 mg/kg Taxotere. During the treatment period growth orthotopic growing tumor PC-3-LN and peripheral metastases were monitored once a week in the image of bioluminescence in vivo on day 15, day 23, day 29 and day 34. For more information, see the text. Compared to ezotericheskim control antibody 1D5 antagonistic rat anti-AXL-antibody V reduced the overall growth of the tumour prostate PC-3-LN in Nude mice.

Figure 15. Model of orthotopic xenograft to examine the functioning of the rat anti-AXL antibodies for metastatic carcinoma of the prostate of Nude mice. Cell carcinoma of the prostate PC-3-LN orthotopic implanted into the prostate of mice NMRI-nu/nu. Animals randomly selected into 4 groups and they were given 25 mg/kg izotopicheskogo control antibody 1D5 or antagonistic rat anti-AXL antibodies V, and 40 mg/kg Sutent or 12.5 mg/kg Taxotere. After the necropsy was extracted selected organs (liver, spleen, lungs, thigh and part of the lumbar spine) and analyzed for the presence of metastases in the image of bioluminescence. For more information, see the text. Compared to ezotericheskim control antibody 1D5 antagonistic rat anti-AXL-antibody V invention reduces the occurrence of metastases in the spleen. Notably, antimetastatic effects in this experiment was stronger than Sutent.

Figure 16. Immunohistochemical analysis of the expression of AXL in a variety of malignant human tumors. 17 types of solid human tumors, each of which presents pairwise - tumor tissue and corresponding non-cancerous tissue, analyzed the relative expression of AXL using immunohistochemical analysis. For more information, see the text. The results are summarized (A), resulting in an intensity value "1" refers to weak staining in more than 25% of tested cells. Examples of the most intense staining observed in mammary tumors and signet ring cell gastric cancer, shown in (B).

Figure 17. ELISA experiments to compare the actions of the rat and chimeric anti-AXL antibodies on AXL-phosphorylation. Cell cervical cancer CaSki was Abagnale, pre-incubated with 50 ng/ml, 100 ng/ml, 300 ng/ml, 750 ng/ml, 1 μg/ml and 10 μg/ml mouse anti-AXL-antibody 11 V7 (A) or chimeric anti-AXL-antibody ch11B7 (In), treated or not treated with 400 ng/ml mGas6 and literally. The lysate was transferred into a 96-well tablets MAXL-Sorp, coated with anti-phospho-tyrosine antibody and 4G10. Then the tablets were washed and incubated with 0.5 μg/ml biotinylated mouse anti-AXL-antibody W, AR-conjugated-streptavidin and substrate solution AttoPhos to collect the fluorescence signal. Under obree see text. As demonstrated by dependent on the concentration of reducing the relative AXL-phosphorylation in cell lines of cervical cancer CaSki, rat anti-AXL-antibody V (a) and chimeric anti-AXL-antibody ch11B7 (C) of the invention was provided by blocking ligand-induced activation of the receptor tyrosine kinase AXL in a similar degree.

Figure 18. ELISA experiments to compare the effects of rat and chimeric anti-AXL antibodies on AXL-phosphorylation. Cell cervical cancer CaSki was Abagnale, pre innumerous together with 50 ng/ml, 100 ng/ml, 300 ng/ml, 750 ng/ml, 1 μg/ml and 10 μg/ml mouse anti-AXL-antibody 11 V7 (A) or chimeric anti-AXL-antibody ch11B7 (In), treated or not treated with 400 ng/ml mGas6 and fixed with formalin. Cells were washed, blocked and incubated with anti-phospho-R/R42 cable line MAP Kinase (Thr202/Tyr204) primary antibody, HRP-conjugated anti-rabbit secondary antibody and a solution of tetramethylbenzidine for measuring the intensity of absorption. For more information, see the text. Rat anti-AXL-antibody V (a) and chimeric anti-AXL-antibody ch11B7 (C) of the invention provided blocking Gas6-induced activation R42 cable line/R MAR-Kinase in cells of cervical cancer CaSki in similar extent as shown dependent on the concentration decrease of relative R42 cable line/R MAR-Kinase phosphorylation.

Figure 19. TUNEL-staining for the treatment of combinatorial actions of the rat anti-AXL antibodies and chemotherapeutic agents with overcoming drug resistance in cancer cells of human ovarian. Ovarian cancer cells human NCI/ADR-RES pre-incubated with 10 μg/ml control antibody or antagonistic anti-AXL-antibody V and incubated with doxorubicin in final concentrations of 100 μm, 150 μm or 200 μm. Using a commercially available kit, performed TUNEL staining for visualization and determination of apoptosis. For more information, see the text. Not observed TUNEL-staining, and hence apoptosis in ovarian cancer cells NCI/ADR-RES, which were treated with 100 μm of doxorubicin, regardless incubated whether cells together with control antibody or antagonistic anti-AXL-antibody V (top). However, at a concentration of 150 μm doxorubicin was recorded very weak apoptosis in cells treated together with the control antibody, whereas incubation with antagonistic anti-AXL-antibody V led to persistent induction of apoptosis (average). In the presence of 200 μm of doxorubicin incubation of the cells together with V significantly increased the level of apoptosis compared to cells incubated with control IgG-antibody (bottom), showing that joint processing of tumor cells, even resistant to medicines, both chemotherapeutic agents and antagonistic anti-AXL-antibody of the invention may be suitable for overcoming the Oia drug resistance.

Figure 20. Analysis on soft agar to study the combinatorial actions of the rat anti-AXL antibodies and chemotherapeutic agents on bezyatiny growth of human melanoma cells. Cells of a human melanoma-8161 were either left untreated or incubated with mouse antagonistic anti-AXL-antibody V at a final concentration of 2.5 µg/ml in Combination with cisplatin at the indicated concentrations, immersed in agar cells were grown on top 0.7 percent of the base layer of agar for 5 days. Were stained with MTT and then measured the area of the colonies. For more information, see the text. Presents the absolute number reflecting the total area of colonies (A)and relative growth inhibition (B), calculated on the basis of these data. Compared with untreated control cells incubation with cisplatin resulted in slower growth of colonies in a dose-dependent manner. In accordance with the inhibitory effect of one V within 30% in combination with antagonistic anti-AXL-antibody V resulted in significant potentiated the inhibitory effect of cisplatin on the growth of melanoma cells With-8161 on soft agar, particularly at low concentrations of cisplatin.

Additionally, the present invention is illustrated by the following examples and accompanied by figures.

Information confirming the possibility of carrying out the invention

The following examples, including the experiments conducted and the results obtained are given only for illustration and do not limit the scope of the present invention.

Example 1. Education AXL-sverkhekspressiya Ratl-fibroblasts as immunogen and AXL-sverkhekspressiya NIH3T3-fibroblasts as an experimental model system

Full coding sequence for AXL-transcriptase option 1 receptor tyrosine kinase person in accordance with National Center for Biotechnology Information (NCBI), the control sequence (NM_021913), was subcloned into pLXSN by flanking recognition elements for restriction endonucleases EcoR1 and SamHI that resulted in the receipt of expressing retroviral vector pLXSN-hAXL.

For the formation of antibodies that are specific are attached to the AXL receptor tyrosine kinase person, Ratl fibroblasts, constantly sverkhekspressiya human AXL, were established by retroviral gene transfer. Briefly, 3×105Phoenix-E cells were cultivated in 60 mm Petri dishes and were transfusional 2 μg/ml vector pLXSN or pLXSN-hAXL, using the calcium-phosphate precipitation. After 24 h the medium was replaced with fresh medium, in which Phoenix-E cells were incubated for 4 hours Supernatant Phoenix-E cells, releasing pLXSN or pLXSN-hAXL-ecotropic virus was collected and used for incubation su is confluent Ratl cells (2×10 5cells in 6 cm Cup) for 3 h in the presence of Polybrene (Polybrene, 4 mg/ml; Aldrich). Simultaneously Phoenix-E cells re-incubated with fresh medium and over the following 3 h was used for the second infection Ratl-fibroblasts in the presence of Polybrene (4 mg/ml; Aldrich). Similarly exercised the third cycle of infection. After the change of environment, began breeding Ratl cells using G418. Usually resistant clones were chosen through a selection period of 21 days.

The panel resistant clones were developed and calculated relative to the expression localized in the membrane AXL person using FACS analysis. More, 1×105cells were harvested with 10 mm EDTA in PBS, once washed with FACS-buffer (PBS, 13% FCS, 0.4% of azide) and were cultivated in 96-well plate with a round bottom. Cells were rolled for 3 min at 1000 rpm to remove supernatant and re-suspended with mouse anti-AXL primary antibody MAB (R&D Systems, 3 μg/ml). Cell suspension was incubated in ice for 1 hour, washed twice in FACS buffer and resuspendable 100 μl/well D-kongugirovannom ass antimachine secondary antibody (Jackson)diluted at a ratio of 1:50 in FACS buffer. Kladochnye suspensions were incubated in ice and in the dark for 30 min, twice washed with FACS buffer and analyzed using flow cytometer Epics XL-MCL (Beckman Coulter).

Figure 1 show the characteristic FACS-analysis of polyclonal populations Ratl-Mock, steadfastly infected with empty virus pLXSN, and Ratl-AXL cl.2, steadfastly infected with pLXSN-hAXL, and shows AXL-overexpression on the cell surface of this his representative clone.

Additionally, to obtain a suitable cellular model system for experimental purposes NIH3T3 fibroblasts, steadfastly sverkhekspressiya AXL, was obtained in a similar manner as described for Ratl. Briefly, 3×105Phoenix-E cells were cultivated in 60 mm Petri dishes and were transfusional 2 μg/ml vector pLXSN or pLXSN-AXL cDNA, using the calcium-phosphate precipitation. After 24 h the medium was replaced with fresh medium, in which Phoenix-E cells were inkubirovali within 4 hours Supernatant Phoenix-E cells, releasing pLXSN or pLXSN-hAXL ecotropic virus was collected and used for incubation subconfluent NIH3T3 cells (2×105cells in 6 cm Cup) for 3 h in the presence of Polybrene (4 mg/ml; Aldrich). Simultaneously Phoenix-E cells re-incubated with fresh medium, after 3 h was used for secondary infection NIH33-fibroblasts in the presence of Polybrene (4 mg/ml; Aldrich). Similarly performed the third cycle of infection. After the change of environment has begun the process of selection of NIH3T3 cells using G418. Usually resistant clones were collected through the breeding period of 21 days.

The panel resistant clones were developed and calculated relative to the expression lokalizovannogo membrane AXL person using FACS analysis. More, 1×105cells were harvested with 10 mm EDTA in PBS, once washed with FACS-buffer (PBS, 13% FCS, 0.4% of azide) and were cultivated in 96-well plate with a round bottom. Cells were rolled for 3 min at 1000 rpm to remove supernatant and re-suspended with mouse anti-AXL primary antibody MAB (R&D Systems, 3 μg/ml). Cell suspension was incubated in ice for 1 hour, washed twice in FACS buffer and resuspendable 100 μl/well D-kongugirovannom ass antimachine secondary antibody (Jackson)diluted at a ratio of 1:50 in FACS buffer. Kladochnye suspensions were incubated in ice and in the dark for 30 min, twice washed with FACS buffer and analyzed using flow cytometer Epics XL-MCL (Beckman Coulter).

Figure 2 shows FACS analysis of polyclonal NIH3T3-Mock-population, steadfastly infected with empty virus pLXSN, and NIH3T3-AXL cl.7 firmly infected with pLXSN-hAXL, and shows AXL-overexpression on the cell surface of a representative clone.

Example 2. Getting the rat monoclonal anti-AXL antibodies

Monoclonal rat anti-AXL antibodies induced by the introduction of about 10×106frozen cells Ratl-AXL cl.2 both intraperitoneally (I.P.) and subcutaneous routes rats Lou/C or Long Evans. Through an 8-week interval did end I.P. injection and subcutaneous injection for 3 days before fusion. Merge Milano the cell line RH - Ag8.653 with rat immunocompetence by splenocytes was performed in accordance with standard methods and received 105 hybrid. After 2 weeks the first supernatant from the hybridomas were collected and tested primary FACS-screening relative to binding to NIH3T3-AXL cl.7 fibroblasts in contrast to NIH3T3-Mock control cells. Clones positive for AXL-binding, additionally cultivated. 50 ml of the supernatants of these clones antibodies were purified and re-analyzed for specific binding to AXL in NIH3T3-AXL cl.7 fibroblasts in contrast to NIH3T3-Mock control cells. Purified antibodies which are specifically related to NIH3T3-AXL cl.7 fibroblasts, but not with NIH3T3-Mock control cells were additionally tested using Akt-Kinase-phosphorylation-ELISA and performed the ELISA assays to determine the isotype. For purification of rat antibody supernatant played for 20 minutes at 5000g and then filtered under sterile conditions. Added 500 μl of protein G conjugated to separate FF, and incubated at 4°C for at least 1 h on a rotating wheel. Separate scroll, removing the supernatant and the matrix of protein G twice washed with PBS before elution of the protein using citrate buffer (100 mm) pH of 2.1. Erwerbende faction immediately re-superserial to neutral pH by adding 1 M Tris pH 8.0 and spent dialysis against PBS.

Of those tested, oligoclonal antibodies 91 specifically connected with NIH3T3-AXL cl.7 fibroblasts, but not with NIH3T3-Mock control glue the kami, 9 inhibited Gas6-induced Akt-phosphorylation in the same cells, whereas 71 stimulated Akt-phosphorylation. Four antagonistic antibodies (I11B7, I10D12, I6E7 and III11D5, the following examples are marked as V, 10D12, E and 11D5 respectively), two agonistic antibodies (I11D7 and III2A1; the following examples are marked as 11D7 and E) and one control antibody (III1D5; the following examples are marked as 1D5) were frozen and subcloned.

74,0
No.CloneSubclassFACS-migration of NIH3T3-pLXSN controlFACS migration of NIH3T3-hAXL-C18
1I1B112a0,853,8
2I1C8IgM/2a0,955,0
3I2F32a0,852,4
I6E72a1,862,3
5I7E62a0,847,1
6I7G1G10,732,0
7I7G11G13,58,8
8I8E5G1133,0
9I9H3G10,540,4
10I10A10lgM/2a0,532,6
11I10D92a0,747,4
12I10D12G10,5 37,5
13I11B7lgM/G1/2c0,636,2
14I11D7lgM/2a0,79,6
15I12B72a/2c0,843,6
16II2B8lgM/G10,62,5
17II2D42a0,846,5
18II6A5G10,613,1
19II8A82a0,634,6
20III1A102a1,454,5
21III1B1 2a7,524,6
22III1B3lgM/2a1,153,3
23III1B62b1,115,3
24III1B112b1,111,1
25III1C32b1,024,2
26III1C10-1,122,1
27III1D2lgM/2b3,026,6
28III11D52a1,58,9
29III1D72b1,0the 17.3
III1D11-1,110,9
31III1D122b1,07,7
32III1E7-1,181,4
33III1E11G1/2a1,244,0
34III1F2G11,242,2
35III1F32b1,19,0
36III1G2-1,030,5
37III1G92a1,389,2
38III1G11-1,1 54,7
39III1G12-1,1to 59.4
40III1H4lgM/2b1,020,0
41III1H82a/2b1,0the 10.1
42III1H92b0,913,6
43III2A12a1,036,0
44III2A22b1,010,5
45III2A42b1,211,8
46III2B12b0,916,0
47III2B6 2a/2b1,039,7
48III2B82a1,053,3
49III2B102b1,110,6
50III2C122a/2b1,011,2
51III2D12a/2b1,042,0
52III2D32b0,917,8
53III2D82a1,4109,7
54III2D122b1,816,0
55III2E112b1,014,8
56III2G4-1,08,5
57III2H7-1,091,2
58III3A12a1,582,5
59III3A22b1,07,4
60III3A3IgM/G12,049,6
61III3B2-1,011,3
62III3B32b0,812,4
63III3B4IgM1,298,0
64III3B5IgM/2b1,6
65III3B72b1,8the 13.4
66III3B102a1,170,6
67III3C3-1,3of 45.7
68III3C4-1,415,2
69III3C102a15,283,3
70III3C122b1,241,8
71III3D22b0,911,8
72III3D32a1,054,5
73III3E1-/td> 1,249,7
74III3E32a/2b1,316,0
75III3E52a1,1of 56.4
76III3F12b1,09,8
77III3G12a1,257,8
78III3G32a1,1of 45.7

III4F12
79III3G62a1,155,9
80III3H42b1,043,3
81III3H52b1,2 11,8
82III4A4IgM1,38,5
83III4A52a1,932,8
84III4A62a2,510,4
85III4B12b1,910,2
86III4B52b1,66,4
87III4B62a1,956,8
88III4B9IqM/2b/2c1,716,6
89III4B112a1,2to 58.1
90III4C2 -1,67,4
91III4C82a12,821,3
92III4D1-1,67,9
93III4D9-1,131,2
94III4D102athe 3.87,5
95III4E112b1,57,6
96III4F6-1,25,5
97III4F82a1,251,3
98III4F11IgM1,212,9
992a1,152,6
100III4G22a1,052,4
101III4G11IgM/2b1,18,9
102III4H42b3,161,3
103III4H52a2,720,0
104III4H10IgM/2a1,349,2
105III4H11IgM3,3124,0

Example 3. Rat anti-AXL antibodies of the invention do not give cross-react with mouse AXL or other family members AXL man, Mer and Sky.

This example considers the cross-reaction of the rat anti-AXL antibodies of the invention with AXL mice and macaques-Griboedov, as well as with other members of the AX-family person human Mer and human Sky. After sublimirovanny mouse and monkey AXL-coding sequences, as well as human Mer and Sky, pcDNA3, each expressing the design was transfusional in NEXT fibroblasts. The ability of rat anti-AXL antibodies of the invention bind these proteins was tested using FACS analysis.

3A. Cloning of mouse AXL

In the present study was obtained mouse AXL-expressing the construct pcDNA3-mAXL. Full coding sequence of mouse AXL was amplified using polymerase chain reaction (PCR) using mouse heart cDNA (Ambion) as a template and appropriate primers in accordance with the National Center for Biotechnology Information (NCBI) reference sequence (NM_009465) mouse AXL. Full sequence encoding a mouse AXL was covered with two overlapping PCR fragments, the 5'-portion and 3'-fragment. Used the following primers for the amplification of these fragments.

Direct MOUSE primer 1 5'-fragment, carrying the sequence recognition EcoRl:

5'-GCGAATTCGCCACCATGGGCAGGGTCCCGCTGGCCTG-3'

Reverse MOUSE primer 2 5'-fragment:

5'-CAGCCGAGGTATAGGCTGTCACAGACACAGTCAG-3'

Direct primer MOUSE 3 for 3'-fragment:

5'-GCACCCTGTTAGGGTACCGGCTGGCATATC-3'

Reverse primer MOUSE 4 for 3'-fragment, carrying the sequence detected is of Notl:

5'-ATAAGAATGCGGCCGCTCAGGCTCCGTCCTCCTGCCCTG-3'

5'-fragment was cleaved EcoRl and BstEII, 3'-fragment was cleaved BstEII and NotI, and pcDNA3 was split EcoRI and NotI. Performed a three-factor leading isolated and purified fragments and transformed in DH5α bacterial cells. Selected colony of cells of the same line and were grown in the presence of ampicillin. Using a commercially available kit for purification of plasmids (Qiagen), was purified mouse AXL-expressing vector pcDNA3-mAXL and checked the sequence for subsequent transient transfection in HEK293T cells.

3V. Cloning AXL macaques-Griboedov

This study was received expressing AXL macaques-Griboedov design pcDNA3-cyAXL. The coding sequence of the full-sized AXL macaques-Griboedov was amplified by the PCR using cDNA derived from brain tissue macaques-Griboedov as a matrix. Since the nucleotide sequence AXL macaques-Griboedov was not available, the corresponding primers were designed assuming a significant homology with AXL person. Full sequence encoding AXL macaques-Griboedov, was covered with two overlapping PCR fragments, the 5'-portion and 3'-fragment. Primers for the amplification of these fragments were as follows:

Direct primer CYNO1 for the 5'fragment, carrying the sequence of races is osnovaniya EcoRl:

5'-CGGAATTCGCCACCATGGCGTGGCGGTGCCCCAG-3'

Reverse primer CYNO2 for 5'-fragment:

5'-CTCTGACCTCGTGCAGATGGCAATCTTCATC-3'

Direct primer CYNO3 for the 3'fragment:

5'-GTGGCCGGTGCCTGTGTCCTCATC-3'

Reverse primer CYNO4 for the 3'fragment, carrying the sequence recognition Notl:

5'-ATAAGAATGCGGCCGCTCAGGCACCATCCTCCTGCCCTG-3'

5'-fragment was cleaved EcoRl and Dralll, 3'-fragment was cleaved Dralll and Notl, and pcDNA3 was split EcoRl and Notl. Performed a three-factor ligation of the isolated and purified fragments and transformed in DH5α bacterial cells. Selected colony of cells of the same line and were grown in the presence of ampicillin. Using a commercially available kit for purification of plasmids (Qiagen), was purified vector pcDNA3-cyAXL expressing AXL macaques-Griboedov, and checked the sequence for subsequent transient transfection in HEK293T cells. Nucleotide and amino acid sequences of macaque-Griboedov are the following:

The nucleotide sequence:

Amino acid sequence:

3C. Blocking Mer man

In this study, was obtained design pcDNA3-hMer, expressing Mer man. The coding sequence of the full-sized Mer man was obtained through rossalini the vector pCMV6-XL4-Mer man (Origene #TS) by EcoRl and Xbal. After splitting pcDNA3 the same restriction endonuclease both fragments were legirovanyh obtaining pcDNA3-hMer. For the introduction of a consensus Kozak sequence 5'-part of the coding sequence Mer man in pcDNA3-hMer was amplified by the PCR using the appropriate primers in accordance with the NCBI reference sequence (NM_006343) Mer man. Primers for the amplification of this fragment were as follows:

Direct primer MER1, carrying the sequence recognition EcoRl and a consensus Kozak sequence:

5'-CGGAATTCGCCACCATGGGGCCGGCCCCGCTGCCGC-3'

Reverse primer MER2 for 5'-fragment:

5'-TCGGCTGCCATTCTGGCCAACTTCC-3'

The PCR product and pcDNA3-hMer were cleaved with EcoRl and EcoRV and legirovanyh obtaining pcDNA3-Kozak-hMer, in which the coding sequence of full-Mer man was preceded by a consensus Kozak sequence.

Transforming into DH5α bacterial cells, took a colony of cells of the same line and were grown in the presence of ampicillin. Using a commercially available kit for purification of plasmids (Qiagen), was purified pcDNA3-Kozak-hMer expressing vector and checked the sequence for subsequent transient transfection in HEK293T cells.

3D. Cloning Sky man

In this study, was obtained design pcDNA3-hSky, expressing Sky man. Full code is regulating the sequence of the Sky man was amplified using PCR, using the vector pCMV6-XL4-Sky man (Origene #MG1044_A02) as template and appropriate primers according to NCBI reference sequence (NM_006293) Sky man.

Primers for amplification were as follows:

Direct primer SKY1, carrying the sequence recognition EcoRl:

5'-CGGAATTCGCCACCATGGCGCTGAGGCGGAGC-3'

Reverse primer SKY2 bearing sequence recognition Xhol:

5'-GCCCTCGAGCTAACAGCTACTGTGTGGCAGTAG-3'

The PCR product and pcDNA3 was digested with EcoRl and Xhol and ligated with obtaining expressing vector pcDNA3-hSky. Transforming into DH5α bacterial cells, took a colony of cells of the same line and were grown in the presence of ampicillin. Using a commercially available kit for purification of plasmids (Qiagen), was purified expressing vector pcDNA3-hSky and checked the sequence for subsequent transient transfection in HEK293T cells.

3E. Transferowania and expression of AXL mice, AXL macaques-Griboedov, Mer man and Sky man

For transient expression of AXL mice, AXL macaques-Griboedov, Mer man or Sky human HEK293T cells were randomly transfusional or empty vector pcDNA3, pcDNA3-hAXL, pcDNA3mAXL, pcDNA3-cyAXL, pcDNA3-hMer, or pcDNA3-hSky, using the calcium-phosphate precipitation. Briefly, prior to transfection 3×106of HEK293T cells in 16 ml of medium were sown in 15 cm layer of cells in Petri dishes and were grown at 7% CO2and 37°C for 30 is. 32 µg DNA expressing the corresponding constructs or empty vector in 720 μl of double-distilled H2About mixed with 2.5 M CaCl2and 2xBBS (pH of 6.96) and kept at room temperature for 10 minutes the Solution was gently added to the cell cultures and incubated at 3% CO2and 37°C for 8 h and Then the medium was replaced with fresh culture medium and cells were cultured with 7% CO2and 37°C for 24 hours

3F. FACS-analysis for studies of rat anti-AXL antibodies to cross-react

For FACS analysis of 2×105cells were collected together C10 mm EDTA in PBS once were washed in FACS buffer (PBS, 3% FCS, 0.4% of azide) and were cultivated in 96-well plate with a round bottom. Removal of the supernatant tablets played for 3 min at 1000 rpm and the cells resuspendable 10 μg/ml satiricheskom control antibody 1D5, as well as in solutions of anti-AXL 11D5, V, 10D12, E, A, 11D7 and V primary antibody (100 µl/well). After incubation in ice for 1 h, cells were washed twice in chilled FACS-buffer and resuspendable with PE-conjugated donkey Anticriminal (Jackson) secondary antibody diluted in the ratio of 1:50 in FACS-buffer (100 µl/well) or PE-conjugated donkey artemisinin secondary antibody for monitoring. Protect from light, cells were incubated in ice for 30 min, twice washed with FACS buffer and analyzed, the using flow cytometer Epics XL-MCL (Beckman Coulter).

Figure 3 shows representative results of this experiment. Except V, which showed the average cross-reactivity with AXL mice, as well as Mer and Sky man none of the other anti-AXL antibodies of the invention did not give cross-reactions with these molecules. In contrast, all tested rat anti-AXL antibodies of the invention gave cross-react with AXL macaques-Griboedov.

Example 4. Rat anti-AXL antibodies of the invention inhibit ligand-induced AXL-phosphorylation in vitro

Performed ELISA experiments to study whether the rat anti-AXL antibodies of the invention block the activation of the AXL-mediated ligand Gas6. Gas6-mediated activation. AXL was found by increasing phosphorylation of the receptor tyrosine kinase. Briefly, on day 1 3×104cells per well were cultivated in normal growth medium in 96-well tablets with a round bottom. The next day, growth medium was replaced with serum-free medium and Abagnale cells with a PM within 24 hours Also at night, black 96-well tablets MAXL-Sorp (Nunc) were coated mouse anti-phospho-tyrosine antibody 4G10 at 2 µg/ml of PBS and 4°C. On day 3 solution 4G10 antibody was removed and wells MAXL-Sorp blocked PBS with 0.5% BSA for at least 4 h at room temperature. In parallel, the cells were pre-incubated with 10 m is g/ml mouse control antibody A, and rat anti-AXL-antibody A, 11D7, 11D5, V, E and 10D12 for 1 h at 37°C and then treated or not treated with 400 ng/ml Gas6 (R&D Systems) for 10 min at 37°C. the Medium is then poured out and the cells were literally in lyse buffer (50 mm HEPES, pH 7.5, 150 mm NaCl, 1 mm EDTA, 10% glycerol and 1% Triton X-100)supplemented with inhibitors positas and protease (10 mm Na4P2O7, 1 mm phenylmethylsulfonyl, 1 mm orthovanadate, 1 mm NaF, and 0.5% Aprotinin) for 30 min in ice. However, before the lysates transferred and incubated overnight at 4°C. the blocking buffer was removed and tablets MAXL-Sorp was washed 6 times with wash buffer (PBS, 0.05% of Tween 20). After the tablets were washed 6 times with wash buffer on the 4th day, the wells were incubated with biotinylated mouse anti-AXL-antibody 12 V7 in 0.5 μg/ml in PBS for 2 h at room temperature. The tablets were washed 6 times with wash buffer to each well was added AP-conjugated streptavidin (Chemicon #SA110), diluted in the ratio of 1:4000 in PBS, and incubated for 30 min at room temperature. Then the wells were washed 6 times with wash buffer and added the substrate solution AttoPhos (Roche #11681982). Using the tablet reader Victor (Perkin Elmer), collected fluorescence signal from each well at a wavelength of excitation 430 nm and emission wavelength of 580 nm.

Figure 4 is a representative result is you this experiment for fibroblasts NIH3T3-AXL cl.7 (a) and NC1-N-cell lung cancer (). Rat anti-AXL antibodies V, 11D5, E and 10D12 invention provided a block or reduce ligand-mediated AXL activation, as shown by attenuation of phosphorylation, and thus they were seen as antagonistic anti-AXL antibodies. In contrast, rat anti-AXL antibodies A and 11D7 invention stimulated basal activation of AXL, as shown by increased phosphorylation, with slightly reduced ligand-mediated activation of AXL and consequently was seen as agonistic anti-AXL antibodies. Similar actions with the same panel of antibodies was observed for cell lines of lung cancer CaLu-1 and CaLu-6 cell lines breast cancer Hs578T and MDA-MB-231 cell line prostate cancer PC-3 cell lines pancreatic cancer PANC-1 cell lines melanoma With-8161, cell lines of ovarian cancer SkOV-3 and SkOV-8, cell lines of glioblastoma SF-126, cell lines of cervical cancer CaSki, as well as cell lines of gastric cancer Hs746T and MKN-1.

Example 5. Rat anti-AXL antibodies of the invention inhibit ligand-induced phosphorylation R42 cable line/R MAR-Kinase in vitro

Then performed ELISA experiments to study whether the rat anti-AXL antibodies of the invention block the activation R42 cable line/R MAR-Kinase-mediated ligand Gas6. Gas6-mediated activation R42 cable line/R MAR-Kinase is found, aivali through increased phosphorylation of the protein (Thr202/Tyr204). Briefly, on the first day of 2×104cells per well were cultivated in 96-well tablets with a round bottom. The next day, normal growth medium was replaced with serum-free medium for depletion of cells at 36 hours After that, the cells were pre-incubated with 10 µg/ml ezotericheskim control antibody 1D5, as well as with rat anti-AXL-antibody 11D5, V and A for 1 h at 37°C and then treated or not treated with 400 ng/ml Gas6 (R&D Systems) for 10 min at 37°C. the Medium was poured and the cells were fixed with 4% formaldehyde in PBS (pH 7.5) for 30 min at the room temperature. Formaldehyde solution was removed and cells were washed twice in wash buffer (PBS with 0.1% Tween 20). Cells were blocked with 1% H2O2, with 0.1% NaN3in wash buffer and incubated for 20 min at room temperature. Then the blocking solution was removed and cells were washed twice in wash buffer and blocked PBS with 0.5% BSA for 4 h at 4°C. was Added anti-phospho-R42 cable line/R MAP Kinase (Thr202/Tyr204) primary antibody (rabbit polyclonal; Cell Signaling #9101), diluted in the ratio 1:500 in PBS with 0.5% BSA, 5 mm EDTA, was left overnight at 4°C. On day 4, the antibody solution was removed and the plate washed 3 times with wash solution. Then to each well was added HRP-conjugated anti-rabbit secondary antibody (Dianova #111-036-045), diluted in the ratio 1:2500 in PB, 0,5% BSA, and incubated for 1.5 h at room temperature. The plate was washed 3 times with wash buffer and twice in PBS for 5 min each. Added tetramethylbenzidine (TMB, Calbiochem) and was measured at a wavelength of 620 nm. The reaction was stopped by adding 100 µl of HCl 250 nm and measured the optical density at a wavelength of 450 nm with a reference wavelength of 620 nm using a tablet reader Vmax (Thermo Lab Systems).

Figure 5 shows representative results of this experiment for cell lines of cervical cancer CaSki. Rat anti-AXL antibodies V and 11D5 of the invention provided for a reduction in ligand-mediated activation R42 cable line/R MAR-Kinase, which is shown by weakening phosphorylation, and consequently was seen as antagonistic anti-AXL antibodies. In contrast, rat anti-AXL-antibody A invention stimulated basal activation R42 cable line/R MAR-Kinase, as shown by increased phosphorylation, it did not reduce ligand-mediated activation R42 cable line/R MAR-Kinase and consequently was seen as agonistic anti-AXL-antibody. Similar effects of the same panel of antibodies was observed in cell lines breast cancer Hs578T and cell lines of lung cancer NCI-H292.

Example 6. Rat anti-AXL antibodies of the invention inhibit ligand-induced Akt-phosphorylation in vitro

In addition, he performed ELISA-ek the experiments for studying, can the rat anti-AXL antibodies of the invention block the activation of Akt-Kinase-mediated ligand Gas6. Gas6-mediated activation of Akt-Kinase was determined by increased protein phosphorylation (Ser473). Briefly, on day 1 2×104cells per well were cultivated in 96-well tablets with a round bottom. The next day, normal growth medium was replaced by medium with low serum (DMEM, 0.5% of FCS for fibroblasts NIH3T3-AXL cl.7) or serum-free (cancer cell lines) environment for the depletion of cells within 36 hours After the cells were pre-incubated with 10 µg/ml ezotericheskim control antibody 1D5, and rat anti-AXL-antibody 11D5, V and A for 1 h at 37°C and then treated or not treated with 400 ng/ml Gas6 (R&D Systems) for 10 min at 37°C. the Medium was poured and the cells were fixed in 4% formaldehyde in PBS (pH 7.5) for 30 min at room temperature. Formaldehyde solution was removed and cells were washed twice in wash buffer (PBS with 0.1% Tween 20). Cells were blocked with 1% H2O2, with 0.1% NaN3in wash buffer and incubated for 20 min at room temperature. Then the blocking solution was removed and cells were washed twice in wash buffer and blocked PBS with 0.5% BSA for 4 h at 4°C. was Added anti-phospho-Akt (Ser473) primary antibody (rabbit polyclonal; Cell Signaling #9271), unless the military in the ratio of 1:500 in PBS, 0,5% BSA, 5 mm EDTA, and left overnight at 4°C. On day 4, the antibody solution was removed and the plate washed 3 times with wash solution. Then to each well was added HRP-conjugated anti-rabbit secondary antibody (Dianova #111-036-045), diluted in the ratio of 1:2,500 in PBS with 0.5% BSA, and incubated for 1.5 h at room temperature. The plate was washed 3 times with wash buffer and twice in PBS for 5 min each. Added tetramethylbenzidine (TMB, Calbiochem) and was measured at a wavelength of 620 nm. The reaction was stopped by adding 100 µl of HCl 250 nm and measured the optical density at a wavelength of 450 nm with a reference wavelength of 620 nm using a tablet reader Vmax (Thermo Lab Systems).

Figure 6 shows representative results of this experiment for fibroblasts NIH3T3-AXL cl.7 (a) and lung cancer cells CaLa-1 (B). Rat anti-AXL antibodies V and 11D5 invention provided a block or reduce ligand-mediated activation of Akt-Kinase, which is shown by weakening phosphorylation, and consequently was seen as antagonistic anti-AXL antibodies. In contrast, rat anti-AXL-antibody A invention stimulated basal activation of Akt-Kinase, as shown by increased phosphorylation, it did not reduce ligand-mediated activation of Akt-Kinase, and, therefore, was seen as agonistic anti-AXL-antibody. Oppo is ary effects with the same panel of antibodies was observed in cell lines of lung cancer NCI-H292, cell lines breast cancer Hs578T and MDA-MB-231 cell line prostate cancer PC-3 cell lines pancreatic cancer PANC-1 cell lines melanoma With-8161, cell lines of ovarian cancer SkOV-3 and SkOV-8, cell line cancer of the urinary bladder TCC-Sup, a cell line fibrosarcoma NT.

Example 7. Rat and chimeric anti-AXL antibodies of the invention inhibit ligand-induced Akt-phosphorylation in vitro in a similar degree

Chimeric derivatives of rat anti-AXL antibodies V and 11D5 were obtained as part of this invention (see below). To study whether the rat anti-AXL antibodies of the invention and the corresponding chimeric anti-AXL antibodies of the invention block the ligand Gas6-mediated activation of Akt-Kinase in fibroblasts NIH3T3-AXL cl.7 in similar degree, performed ELISA experiments. Antibody-mediated inhibition of Akt-Kinase was determined by the attenuation of protein phosphorylation (Ser473). Briefly, on day 1 2×104cells per well were cultivated in 96-well tablets with a round bottom. The next day, normal growth medium was replaced by medium with low serum (DMEM, 0.5% of FCS) for depletion of cells at 36 hours After that, the cells were pre-incubated with 50 ng/ml, 100 ng/ml, 300 ng/ml 500 ng/ml and 1 μg/ml mouse anti-AXL-antibody V or chimeric anti-AXL-antibody ch11B7, and t is the train 50 ng/ml, 100 ng/ml, 300 ng/ml 500 ng/ml, 1 μg/ml, 5 μg/ml and 10 μg/ml mouse anti-AXL-antibody 11D5 or chimeric anti-AXL-antibody ch11D5 for 1 h at 37°C and then treated or not treated with 400 ng/ml Gas6 (R&D Systems) for 10 min at 37°C. the Medium was poured and the cells were fixed in 4% formaldehyde in PBS (pH 7.5) for 30 min at room temperature. Formaldehyde solution was removed and cells were washed twice in wash buffer (PBS with 0.1% Tween 20). Cells were blocked with 1% H2O2, with 0.1% NaN3a wash buffer, and incubated for 20 min at room temperature. Then the blocking solution was removed and the cells were twice washed in wash buffer and blocked PBS with 0.5% BSA for 4 h at 4°C. was Added anti-phospho-Akt (Ser473) primary antibody (rabbit polyclonal; Cell Signaling #9271), diluted in the ratio 1:500 in PBS with 0.5% BSA, 5 mm EDTA, overnight at 4°C. On day 4, the antibody solution was removed and the plate washed 3 times with wash solution. Then to each well was added HRP-conjugated anti-rabbit secondary antibody (Dianova #111-036-045), diluted in the ratio 1:2500 in PBS with 0.5% BSA and incubated for 1.5 h at room temperature. The plate was washed 3 times with wash buffer and twice in PBS for 5 min each. Added tetramethylbenzidine (TMB, Calbiochem) and was measured at a wavelength of 620 nm. The reaction was stopped by adding 100 µl of HCl and 250 nm were measured on the optical density at 450 nm with a reference wavelength of 620 nm, using the tablet-Vmax reader (Thermo Lab Systems).

Figure 7 demonstrates that the rat anti-AXL-antibody V and chimeric anti-AXL-antibody ch11B7 of the invention, and rat anti-AXL-antibody 11D5 and chimeric anti-AXL-antibody ch11D5 of the invention, provided the inhibition of ligand-mediated activation of Akt-Kinase in similar extent as shown by attenuation of phosphorylation. As a result, compared with their respective rat variants, chimeric anti-AXL antibodies ch11B7 and ch11D5 remained active.

Example 8. The antagonistic rat anti-AXL antibodies of the invention compete with each other for identical or structurally related epitopes and do not share binding sites with agonistic rat anti-AXL-antibody inventions

Anti-AXL antibodies of the invention were investigated, compete, whether they are with each other for the same binding epitopes on domain AXL-ECD. Therefore the binding of biotinylated anti-AXL antibodies covered by the domain of the AXL-ECD tablets, pre-incubated with anti-AXL-antibody was determined in a competitive ELISA. Briefly, 30 µg izotopicheskogo control antibody 1D5, and rat anti-AXL antibodies V, 11D5, E, 10D12, 11D7 and I was biotinilated with Sulfo-NHS-Biotin (Pierce #21217) according to the manufacturer's instructions and purified using column SSC Micro-BioSpin P6 (BIO-RAD #732-6200). 1 day black 96-well p is anxiety MAXL-Sorp (Nunc) were coated with 100 µl/well of 1 μg/ml AXL-ECD person (R& D Systems #154-AL) in PBS overnight at 4°C. On day 2 coated tablets MAXL-Sorp blocked with the blocking buffer (PBS, 1% BSA, 0.05% of TWEEN-20) for 2 h at room temperature (250 ál/well) and then incubated with PBS or abioterrorism ezotericheskim control antibody 1D5, and abioterrorism rat anti-AXL-antibody W, 11D5, E, 10D12, 11D7 or A at 10 μg/ml in blocking buffer (100 μl/well) in for 1 h at room temperature. Solutions of antibodies poured out without washing and added 100 μl/well PBS or biotinylated isotope control antibody 1D5, and biotinylated rat anti-AXL antibodies V, 11D5, E, 10D12, 11D7 or A at a concentration of 0.5 μg/ml in blocking buffer and incubated for 15 min at room temperature. After 6 washes wash buffer (PBS with 0.1% TWEEN-20)was added to 80 μl/well of AP-conjugated streptavidin (Chemicon #SA110), diluted in the ratio of 1:4000 in blocking buffer, incubated for 20 min at room temperature, and again washed 6 times with wash buffer and was last washed in PBS. Detection was added 100 μl/well of substrate solution Attophos (Roche # 11681982). Using the tablet reader Victor (Perkin Elmer), was measured fluorescence signal from each well at a wavelength of excitation 430 nm and emission wavelength of 580 nm.

Figure 8 shows a representative result of the ATA this analysis. Antagonistic anti-ache antibodies V, 11D5, E and 10D12 of the invention compete with each other for identical or structurally related epitopes. Two agonistic antibodies 11D7 and A invention recognize different epitopes and, therefore, are not incompatible. In addition, 11D7 and A not compete with antagonistic antibodies for binding to AXL-ECD. Control antibody 1D5 not associated with AXL-ECD.

Example 9. Rat and chimeric anti-AXL antibodies of the invention inhibit the migration and proliferation of lung cancer cells in vitro

To study the speed of migration and proliferation of different cell types and culture conditions for many years performed the analyses healing of wounds/scratches in vitro. These tests usually include the cultivation of a confluent monolayer of cells in the first place. Then a small section break and the group of cells is destroyed or displaced by scratching a line through the layer, for example, the tip of the pipette. Outdoor gap then studied under the microscope over time regarding how cells occupy and fill the damaged area ("healing"). Briefly, a 1.5×106NCI-H292 lung cancer cells were inoculated per well of a 12-hole Cup and cultured in normal culture medium (RPMI, 10% FCS). After 8 h, cells were washed in PBS and Abagnale in an environment with low containing the receiving serum (RPMI, 0,5% FCS) overnight for 24 hours Using a sterile 200 μl pipette tips for pipettes, protsarapyvanie through confluent NCI-N cell monolayers three separate identical wounds to the hole. Cells were carefully washed in PBS and incubated with medium containing low levels of serum (RPMI, 0,5% FCS)containing no additives, 10 μg/ml ezotericheskim control antibody 1D5, antagonistic rat anti-AXL-antibody 11D5, V, E or 10D12, chimeric anti-AXL-antibody chn11D5 lgG2 and chn11B7 lgG2, agonistic rat anti-AXL-antibody A and 11D7 and 10 μg/ml Erbitux or 5 μm Sutent for comparison. Left for 24 h for cell migration in free sites, once washed with PBS and fixed with ice cold Methanol (100%) at -20°C. Then the cells were stained with crystal violet (0.5% in 20% Methanol), washed with water and dried overnight, photographed the wounds.

Figure 9 shows representative results of this experiment for NCI-N-cell lung cancer. Compared to ezotericheskim control antibody antagonistic rat anti-AXL antibodies 11D5, V, E and 10D12 of the invention, as well as chimeric anti-AXL antibodies chn11D5 lgG2 and chn11B7 lgG2 invention reduced the secondary settling the vacant lot, whereas agonistic rat anti-AXL antibodies A and 11D7 of the invention resulted in a complete closure of the wound. Similar results with the same panel of antibodies n is bluedale for cell lines of ovarian cancer SkOv-3 cell lines of gastric cancer MKN-1.

Example 10. Rat anti-AXL antibodies of the invention inhibit ligand-induced migration of fibroblasts NIH3T3-AXL cl.7 in vitro

Transmigration experiments were performed to study the block whether the antibodies of the invention the migration of cells. This morning the first day of the cells NIH3T3-AXL cl.7 were sown in 15 cm Cup in normal culture medium, which in the evening was replaced by medium with low serum (DMEM, 0.5% of FCS) for depletion of cells at 36 hours the next day 96-well plate FluoroBlock (Becton Dickinson #351164, 8 μm pore size) were covered with 10 μg of collagen 1/ml of 0.1 M acetic acid overnight at 37°C. On day 3, the medium with low serum (DMEM, 0.5% of FCS) was replaced with serum-free medium (DMEM, 0% FCS, 0.1% of BSA) and left for the next 4 hours the Cells were harvested with 10 mm EDTA PBS and pre-incubated with rat anti-AXL-antibody A, V or A at a density of cells 4×105cells/ml and the antibody concentration 10 ug/ml for 45 minutes 50 ál of cell suspension (20,000 cells) per well was then placed in the upper chamber 96-well tablets FluoroBlock, used 225 ál environment (DMEM1 0%FCS, 0.1%of BSA) with or without 400 ng/ml murine Gas6 (R&D Systems) per well in the lower chamber. The cells were left to migrate for 7 h at 37°C and then stained to 4.2 μm Calcein-AM (Molecular Probes #S) in PBS, 1 mm CaCl2, 1 mm MgCl2for 1 h at 37°C. Using a tablet reader Victor (erkin Elmer), the fluorescence of each well was measured at a wavelength of 530 nm.

Figure 10 shows that the antagonistic anti-AXL-antibody V of the invention has reduced both basal and Gas6-induced migration of fibroblasts NIH3T3-AXL cl.7, whereas agonistic rat anti-AXL-antibody A inventions increased the ligand-induced and, in particular, the basal migration of cells NIH3T3-AXL s. Antibody A had no effect on the migration of cells.

Example 11. Rat anti-AXL antibodies of the invention inhibit ligand-induced proliferation of fibroblasts NIH3T3-AXL s in vitro

In vitro experiments were performed to determine the ability of the rat anti-AXL antibodies of the invention inhibit Gas6-induced cell proliferation. For this 2500 fibroblasts NIH3T3-AXL cl.7 per well were cultivated in FCS-containing medium on 96-well plates at night. The next day cells were Abagnale in an environment with a low content of serum (DMEM and 0.5% FCS) for 10 h and then pre-incubated with 20 μg/ml mouse control antibody A, the antagonistic rat anti-AXL-antibody 11D5 and V and agonistic antibody A in DMEM and 0.5% FCS for 1 h at 37°C. Cells were treated or not treated with 400 ng/ml murine Gas6 (R&D Systems) by adding the ligand directly to the antibody solution and there they were left to grow on 96 hours add the Yali AlamarBlue™ (BIOSOURCE #DAL1100) and incubated at 37°C in the dark. The optical density was measured at 590 nm every 30 min Data were collected after 4 h after addition of AlamarBlue™.

Figure 11 shows representative results of this experiment. Antagonistic anti-AXL antibodies 11D5 and V invention blocked Gas6-induced proliferation of fibroblasts NIH3T3-AXL s, whereas agonistic rat anti-AXL-antibody A inventions increased the ligand-induced and, in particular, basal cell proliferation NIH3T3-AXL cl.7.

Example 12. Rat anti-AXL antibodies of the invention inhibit ligand-mediated antiapoptosis processes serum-free fibroblast NIH3T3-AXL cl.7 in vitro

The apoptosis and activation of caspase can occur due to various incentives, including the failure of growth factors, exposure to chemotherapeutic agents or radiation or start the process of cell death, mediated by receptor Fas/Apo-1. It is shown that the interaction of the Gas6-AXL involved in the process of securing different types of cells from apoptosis, including serum-free fibroblast NIH3T3 (Goruppi et al., 1996, Oncogene 12, 471-480) or pulmonary endothelial cells (Healy et al., 2001, Am. J. Physiol., 280, 1273-1281). In this example we studied, do the rat anti-AXL antibodies of the invention the impact on Gas6-mediated antiapoptosis processes serum-free NIH3T3-AXL cl-7-fibroblasts and consequently induce whether apoptosis. The degree of apoptosis was determined by serenityactual caspase-3/7 in the cells. For this NIH3T3-AXL cl.7 cells were cultivated with a density of 1.5×103cells per well in a black 96-well tablets with a round bottom (100 µl/well). Through a day of normal growth medium was replaced by medium with low serum (DMEM, 0.5% of FCS) for depletion of cells on all night for 24 hours of the next day to prepare solutions izotopicheskogo control antibody 1D5, antagonistic rat anti-AXL antibodies V and 11D5 and agonistic rat anti-AXL antibodies 11D7 and A at 80 mcg/ml in DMEM, 0% FCS, 0.01% of BSA. Cells were washed in PBS, covered with 60 μl of DMEM, 0% FCS, 0.01% of BSA was added 10 μl of each antibody solution. After 1 h incubation at 37°C, was added 10 μl DMEM, 0% FCS, 0.01% of BSA with or without a 3.2 µg/ml murine Gas6 (R&D Systems) (final concentration of antibodies and Gas6 was 10 μg/ml and 400 ng/ml, respectively) and the cells were incubated at 37°C in the next 5 hours Following stages refer to technical Bulletin for the analysis of Apo-ONE Homogenwous Caspase-3/7 (Promega, G7791). Briefly, the culture, the tablets were removed from the incubator and Abagnale at room temperature for 20 minutes was Unfrozen 60 μl of substrate Apo-ONE and 6 ml of buffer were mixed and added to the samples (75 µl/well). The contents of the wells were carefully shaken for 30 sec and protecting from light, incubated at room temperature for 1 h Using a tablet reader Victor (Perkin Elmer), measured fluore is Cencio each well at a wavelength of excitation 485 nm and emission wavelength of 530 nm.

Figure 12 shows representative results of this experiment. Compared to ezotericheskim control antibody antagonistic rat anti-AXL antibodies V and 11D5 invention reduced the Gas6-mediated antiapoptosis processes serum-free NIH3T3-AXL cl.7 fibroblasts and resulting induced apoptosis. In contrast, agonistic rat anti-AXL antibodies A and 11D7 invention strictly induced antiapoptosis processes serum-free NIH3T3-AXL cl.7 cells regardless of the absence or presence of Gas6 and thereby inhibited apoptosis.

Example 13. Rat anti-AXL antibodies of the invention inhibit angiogenesis of cells, based on the formation of spheroids in vitro

AXL is a key regulator of numerous angiogenic processes, including endothelial cell migration, proliferation and the formation of tubules in vitro (Holland et al., Cancer Res: 65, 9294-9303, 2005). Consequently the rat anti-AXL monoclonal antibodies V and 11D5 of the invention was tested relative to the inhibitory effect on VEGF-A-induced vascular sprouting (overgrowth) HUVEC-spheroids. The experiments were performed with a modification of the original published Protocol (Korff and 08.in: J Cell Sci 112:3249-58, 1999). Briefly, the spheroids were obtained as described (Korff and 08.in: J Cell Biol 143:1341-52, 1998), by pipetting 500 endothelial cells of the umbilical vein of a person (HUVEC) in hanging the drop of a plastic Cup and left it on all night for the aggregation of spheroids. 50 HUVEC-spheroids were then inoculated in 0.9 ml of the collagen solution (2 mg/ml) and pietravalle in individual wells of 24-well plates to polymerization. Reducing the concentration of rat anti-AXL antibodies V and 11D5 (1×10-6M, 1×10-7M, 1×10-8M, 1×10-9M, 1×10-10M) was mixed directly in the solution of collagen before polymerization, whereas the growth factor VEGF-A (final concentration 25 ng/ml) was added after 30 min by pipetting 100 ál of 10-fold concentrated working solution on top of the polymerized gel. The plates were incubated at 37°C for 24 hours and were fixed by adding 4% paraformaldehyde. The intensity of sprouting HUVEC-spheroids was determined using the system of image analysis, which determines the total length of the "spikes" on the spheroid, using an inverted microscope and software for digital image Analysis 3.2 (Soft imaging system, Munster, Germany). Analyzed the average total length of the "spikes" from 10 randomly selected spheroids as an individual reference point.

Figure 13 shows the results of this experiment. The antagonistic rat anti-AXL antibodies V (a) and 1D5 (C) of the invention inhibited VEGF-A-stimulated HUVEC-sprouting in the analysis of angiogenesis based on spheroids, depending on the dose. While processing a higher concentration is the Nations W reduced HUVEC-sprouting to basal levels, inhibition with higher concentrations 11D5 was ineffective (left panel). HUVEC-sprouting was Engibarov when values of the IC50of 9.8×10-8M and 7.0×10-7M for V and 11D5 respectively (right panel).

Example 14. Rat anti-AXL antibodies of the invention reduced the growth of prostate carcinoma in man in Nude mice

Antitumor efficacy of therapeutic antibodies is often assessed in studies in xenografts of human tumors. In these experimental models of human tumor grow as xenografts in mice with immune deficiency and therapeutic effectiveness is measured by the degree of inhibition of tumor growth. The purpose of this study was to assess, prevent, whether the antagonistic rat anti-AXL-antibody V invention of tumor cell growth in prostate cancer man in Nude mice. Briefly, on day 0 7-8 weeks of male mice NMRI-nu/nu(approximate weight: 30 g after acclimatization) was anestesiologi from 1.5 to 2.0 vol.% by isoflurane at a rate of flow of oxygen 2 l/min and 1×106RS-3-LN cells in 25 μl of PBS orthotopic implanted into the prostate. RS-3-LN cells were obtained from cell lines of prostate carcinoma PC-3, which was infected by the retrovirus encoded fused protein luciferase-neomycin. The beginning of tumor growth and program the mechanisms of tumor growth was measured by bioluminescent in vivo imaging. To do this, luciferin was injected with administered intraperitoneally (I.P.) in mice and optical radiation was measured 10 minutes after the injection on the system bioluminescent display NightOWL LB 981 (Berthold Technologies, Germany). Before the first treatment of mice randomized and performed statistical tests to ensure uniformity of the initial tumor parameters (probable, average and standard deviation) among the groups consisting of 10 animals each. On day 8 started treatment and continued until 34 days followed by necropsia 35 day. 25 mg/kg izotopicheskogo control antibody 1D5 and antagonistic rat anti-AXL antibodies V was administered to the animals of groups 1 and 2 administered intraperitoneally (I.P.) 3 times a week (mon, Wed, Fri), respectively. Animals from group 3 oral (P.O.) received 40 mg/kg Sutent once a day. Animals from group 4 received three intravenous (I.V) injection of 12.5 mg/kg Taxotere for 4 days independently from each other. Overview of the treatment groups are presented below.

GroupProcessingIntroductionQty animals
PathScheme
1 1D525 mg/kgI.P.3 times a week (mon, Wed, Fri), starting from the first day after randomization2)10
2W25 mg/kgI.P.3 times a week (mon, Wed, Fri), starting from the first day after randomization2)10
5Sutent40 mg/kgBPevery day starting from the first day after randomization2)10
6Taxotere12.5 mg/kgVV3 dose 4 are given separately, starting with the first day after randomization10

Figure 14 shows the results of this experiment. Compared to ezotericheskim control antibody 1D5 antagonistic rat anti-AXL-antibody V invention reduced the overall growth of the tumour prostate PC-3-LN in Nude mice.

Example 15. Rat anti-AXL antibodies of the invention inhibit the metastasis of prostate carcinoma in persons the century

In a similar experiment, which is described under the name "the rat anti-AXL antibodies of the invention reduced the growth of prostate carcinoma in man in Nude mice", the movement of cancer cells PC-3-LN to other organs (metastasis) were analyzed after the autopsy for the evaluation of antimetastatic effects of rat anti-AXL antibodies V invention. For this purpose, selected organs (liver, spleen, lungs, the thigh, part of the lumbar spine) after the autopsy was removed, homogenized and added luciferin. Then measured the optical radiation using bioluminescent system NightOWL LB 981 (Berthold Technologies, Germany).

Figure 15 shows the results of this experiment for the analysis of spleens. Compared to ezotericheskim control antibody 1D5 antagonistic rat anti-AXL-antibody V invention reduces the occurrence of metastases in the spleen. Notably, antimetastatic effect V in this experiment was greater than from the use of Sutent. Similar observations were obtained for liver metastasis, lung, and lumbar spine.

Example 16. AXL is expressed predominantly in tumors than in adjacent normal tissue

In this study, AXL, expressed in 17 different malignant human tumors, immunohistochemistry were analyzed fixed nnoi in formalin and embedded in paraffin tissue in the format of tissue microarrays. For each tumor type examined pairs of tumor tissue and corresponding non-cancerous tissue. Briefly, the tissue was fixed for 16-20 h in 4% buffered formalin and embedded in paraffin. To construct a 60-nuclear tissue matrix (TMA), a pathologist chose one array of healthy tissue and one array of the corresponding tumor tissue. 96-nuclear TMA with arrays of normal control tissues (three from each type of tissue) was obtained in accordance with the recommendations of the FDA. Each array was 1.5 mm in diameter.

With the help of microtome did 2-4 μm sections of tissue blocks were fixed on silanizing slides (Sigma) and dried at 60°C for 30 min and at 38°C during the night. Slices were deparaffinization by incubation in kelloway bath for 5 min twice in acetone for 5 min twice, and finally in distilled water for 5 min. Pre-heating of the sections were carried out in 10 mm citrate buffer, pH 6.0, in a steam chamber for 30 min followed by washing in distilled water. Endogenous peroxidase was blocked by incubation with freshly prepared solution of 0.3% H2O2in methanol for 20 min at room temperature followed by washing with distilled water and PBS for 5 min each. Sections were incubated with polyclonal goat and tchelovetcheskimi AXL-antibody (Santa Cruz SC-1096) for 60 min (1:20 dilution in TBST) at room temperature. After three rinses in TBST, the sections were incubated with biotinylated rabbit antionline secondary antibody (Dianova, 1:200 dilution in TBST) for 45 min at room temperature. After washing, the sections were incubated with streptavidin/HRP (DAKO, 1:300 dilution in TBST) for 30 min at room temperature followed by washing as before. Staining was performed using DAB solution (DAKO; 1:50 dilution in substrate buffer) for 10 min at room temperature. Finally, the slides were rinsed with water, they finished painting areas with hematoxylin Harris and covered the slide. Control sections were incubated with goat IgG control antibody (R&D) instead of anti-AXL primary antibodies.

Figure 16 summarizes the results of this analysis regarding the expression of AXL in 17 different solid human tumors and corresponding non-cancerous tissues (A). Among all surveyed cases for each dimension not found significant expression in follicular lymphoma, prostate cancer (excluding isolated cells) and kidney cancer. Melanoma and the tumor cells Merkel showed very low expression of AXL. Weak expression was observed in some tumors of the lung, mainly adenocarcinomas. Tumors of the esophagus and Beret, ovarian cancer, colon and pancreas, as well as tumor pécs is no (hepatocellular carcinoma) showed weak staining in 30% of cases. Tumors of the head and neck showed a weak to medium staining in 40% of tumors. From weak to medium staining was detected in 60% to 100% of the analyzed tumors of the breast, cervix, bladder, thyroid and stomach. The most intense staining was observed in tumors of the breast and signet ring cell gastric cancer (). Non-cancerous tissues showed no specific staining, excluding renal tubules, which in some cases showed weak staining in the background.

Example 17: the Structure and characteristics of the anti-AXL antibodies

17A. Nucleotide sequence of the constant domains of rat antibodies

The constant domains of rat anti-AXL antibodies cloned from hybridoma cells. RNA was obtained using the kit for the extraction RNeasy RNA (RNeasy midi kit, Qiagen). cDNA encoding genes of the antibody was prepared using a set of 5'RACE (Invitrogen) according to manufacturer's instructions.

Briefly, the first chain cDNA was synthesized from total or RNA using gene-specific GSP1 primers and reverse transcriptase Superscript™ II. After synthesis of the first chain cDNA of the original matrix mRNA was removed by treatment with RNase Mix. Then to the 3'-end of cDNA was added homopolymer tail. PCR amplification was carried out using DNA polymerase Taq, nested, GE is-specific primer (GSP2), which is connected with the site, located in the cDNA molecule, and the anchor primer contained in the kit. After amplification of cloned products 5' RACE in vector pLXSN-ESK for sequencing. To facilitate cloning anchor Primer (AR) included a recognition sequence for Sal I, GSP2 primers contained the Xhol site.

GSP1 primer:

kappa_GSP1: GATGGATGCATTGGTGCAGC

new_kappa_GSP1: ATAGATACAGTTGGTGCAGC

heavy_GSP1: CAGGGTCACCATGGAGTTA

GSP2 primer:

Xhol-hGSP2: CCGCTCGAGCGGGCCAGTGGATAGACAGATGG

Xhol-kGSP2: CCGCTCGAGCGGCCGTTTCAGCTCCAGCTTGG

The use of GSP primers for cloning of the rat anti-AXL Mab:

V: kappa GSP1; Xhol-kGSP2

heavy GSP1; Xhol-hGSP2

10D12: kappa_GSP1, new_kappa_GSP1; Xhol-kGSP2

heavy GSP1; Xhol-hGSP2

11D5: new_kappa_GSP1; Xhol-kGSP2

heavy GSP1; Xhol-hGSP2

17V. Amino acid sequence of the constant domains of rat anti-AXL antibodies

Sequence constant domains of rat anti-AXL antibodies were translated from the sequenced genes cloned in the vector pLXSN-ESK. The amino-acid sequence was started in the position of one of the constant domain. Defining complementary sites (CDR)required for specific binding of the antibody to its target, which is determined according to Kabat (Kabat et al. Sequences of Proteins of Immunological Interest, Fifth Edition. NIH Publication No. 91-3242, 1991). Kabat-definition is based on the variability of the sequences in the constant domains. Anti-AXL-specific CD-areas of the antibodies listed in SEQ ID NO:13-30. Specific CDRs include the following provisions:

CDR-L1: 24-34

CDR-L2: 50-56

CDR-L3: 89-97

CDR-H1:31-35b

CDR-H2: 50-65

CDR-H3: 95-102

17C. Expression and purification of rat antibodies:

Hybridoma cultured in bioreactors Celline CL 1000 (Integra Biosciences) at 37°C, 5-7% CO2using DMEM , containing 4.5 g/l glucose; 1% glutamine, 1% pyruvate, 1% Pen/Strep. FCS-additive was 1% FCS for nutrient camera and 5% FCS IgG to the cell chamber. The collection and replacement of the medium was carried out twice a week. Splitting cells 1/1->1/3 depending on cell growth. Productivity was tested once a day through analysis of polyacrylamide gel electrophoresis (SDS-PAGE). Supernatant was frozen at -20°C until purification. Test for Mycoplasma growing cultures were performed once a week.

Antibodies were purified using Protein a or G Sepharose FF (GE Healthcare), using the system Akta Explorer 100 (GE Healthcare). Column individually Packed for each cleaning process. The column size was regulated under the expected yield and the size of each batch (typically 50-500 mg). Protein-containing solutions were stored in ice or at 4°C as possible. Sterile buffers and double-distilled water was used to complete the process.

Supernatant was unfrozen, butaritari with 50 mm TRIS pH 8.5, centrifuged, filtered through 0.22 μm membrane and loaded into the column. PEFC is flush with 8 column volumes (CV) of 50 mm PO 4, pH 8.5, antibody was suirable 10 CV of 100 mm Glycine, pH of 3.3. Faction eluates were nebuferizirovannoj directly to neutral pH by adding 1/5 of 1M Tris pH 8.0 (1 ml Tris 4 ml fractions of the eluate) and then analyzed using rSDS-PAG. The fractions containing pure antibody, combined, spent dialysis against PBS at 4°C and sterile filtered.

Conditions of the buffer system configured in accordance with the individual properties of each antibody. In particular, the antibody 11D5 RatlgG2a associated with the matrix ProteinG 4 FF (GE Healthcare) and washed in high salt conditions (2M NaCI). Rat IgG1 antibody 11B7 was purified by rProteinA (GE-Healthcare) in high salt conditions according 11D5. The elution of antibodies was carried out at pH 5.5. The flow rate of purification of rat antibodies were kept at a low level to increase the efficiency of the binding.

As a second stage of purification can be performed either ion exchange chromatography (individually suitable conditions), or gel chromatography.

A standard Protocol for quality control of purified antibodies includes:

analysis rSDS-PAGE gels; Staining Kumasi or silver

- ICA-test (Pierce #23227 - set of reagents ICA for the analysis of protein; sample rat IgG #31233)

Analytical gel chromatography (Superdex 200 Tricom 10/300 GL, ~250 mg in 250 μl; 0.5 ml/min, Akta Explorer 100)

- Endotoxin test (LAL, Cambrex QCL1000® chromogenic analysis LAL # US50-648U)

- Analyses of cellular activity (FACS binding; pAkt; pAXL)

Purified antibodies were stored in PBS, pH 7.4, under sterile conditions at 4°C or -20°C, depending on their stability.

17D. Determination of affinity of antibodies by using Scatchard analysis FACS

NIH3T3 cells, sverkhekspressiya AXL person, collected by incubation with 10 mm EDTA in PBS and resuspendable in the amount of 6 million cells / ml in FACS-buffer (PBS pH 7.4, 3% FCS, 0.1% of NaN3)in the microtiter plate with a round bottom, was added 100 μl of cell suspension to 100 μl of the antibody solution containing an antibody V, 11D5, ch11B7-lgG2 or ch11D5-lgG2 in concentrations between 40 and 0,002 mg/ml (266 and 0.01 nm) in FACS-buffer. Antibody binding proceeded for 2 hours in ice. Then cells were washed twice with 250 μl FACS buffer per well and resuspendable in 200 μl of secondary antibody (anti-rat-RE; Jackson)diluted at a ratio of 1:50 in FACS buffer. After 45 minutes incubation, the cells are again washed twice in FACS buffer and resuspendable in 500 ml PBS for FACS analysis. The analysis was performed on the Beckman-Coulter FACS FC500. To determine the constants of the apparent affinity (KDappthe average value of the fluorescence was plotted against the ratio of the average fluorescence and concentration of the appropriate antibodies ([M]). Calculated KDappobtained from the inverse slope of the straight line below:

CloneThe value of KD(nm)
W0,38
ch11B7-lgG20,6
11D50,81
ch11D5-lgG20,9

18. Chimerization rat anti-AXL antibodies:

Human genes Kappa light-chain and heavy chain lgG1/2 cloned from mononuclear cells of peripheral blood (RVMS) volunteers, as described below:

RVMS were prepared from whole blood. The blood was diluted in the ratio of 1/2,5 in PBS/2 mm EDTA with 10 Units/ml heparin at RT, overlaid on 15 ml Biocoll, covered by a diaphragm (35 ml/tube) [Biocoll from Biochrom # L6115]. Samples were centrifuged at RT for 30 min at 400 g and the serum was decanted (-15 ml). The surface boundary phase containing RVMS, carefully removed using a Pasteur pipette. RVMS washed twice in PBS/2 mm EDTA (first wash 100 ml, the second wash 50 ml) and replayed at 300 g for 10 min. the Cell pellets resuspendable in RPMI/10% FCS (25 ml) and received 5.5×107RUMS.

RNAS were prepared from RPMS using the RNeasy kit from Qiagen (# 75142) according to the manufacturer's instructions. Purified RNA (30 µg) were frozen in aliquot at -80°C.

cDNA for the antibodies of class IgG gamma 1 and 2, and Kappa-chains were prepared from isolated RNA using RT-PCR, using reverse transcriptase Superskript III (invitrogen # 18080-93) according to the manufacturer's instructions using the following primers:

1) RT-gamma: GCGTGTAGTGGTTGTGCAGAG

2) RT-gamma: GGGCTTGCCGGCCGTG

3) RT-Kappa: TGGAACTGAGGAGCAGGTGG

4) 5'BIp: AGATAAGCTTTGCTCAGCGTCCACCAAGGGCCCATCGGT

5) 3'Bam(GAG): AGATGGATCCTCATTTACCCGGAGACAGGGAGAG

6) 5'Bsi: AGATAAGCTTCGTACGGTGGCTGCACCATCTGTCTTCAT

7) 3'Bam(CTT): AGATGGATCCCTAACACTCTCCCCTGTTGAAGCTCT

The primers were dissolved at 100 μm. The reaction RT-PCR was performed using 2 pmol oligo RTγ and PTKaccordingly, by adding 1 μg of RNA was mixed with 10 mm dNTP and heated for 5 min to 65°C. was Added 4 μl of buffer for the synthesis of the first chain, 1 ál 0.1 M DTT, 1 μl RNase inhibitor (40 Units/ál Fermentas # E00311) and 2 μl of Superscript III RT, stirred and incubated at 50°C for 1 h followed by stage heat inactivation for 15 min at 70°C.

2 μl of the buffer for the synthesis of the first circuit used for carrying out the second stage PCR using Taq polymerase (Eurochrom # EME010001) to obtain double-stranded DNA constant domains of antibodies. Primer 5'BIp and 3'Bam(GAG) was used for amplification of γ-chain and 5'Bsi and 3'Bam(CTT) was used for amplification constant plots κ-chain, using the following settings PCR:

Amplification κ-chain:

94°C 120 sec

94°C 30 sec

55°C 30 sec

72°C 45 sec cycle 35 times

72°C 10 min

Amplification γ-chain:

94°C 20 sec

94°C 30 sec

45°C 30 sec

72°C 60 sec cycle 5 times.

94°C 30 sec

50°C 30 sec

72°C 60 sec cycle 35 times

72°C 10 min

The PCR products were analyzed on a TAE-buffered 2% agarose gel. Detected a single band of ~350 BP for Kappa light-chain and a single band of ~1000 BP for heavy chain γ1 and γ2. The PCR products were purified using the kit for extraction from Qiagen gel (QIAGEN1 #28784) according to the manufacturer's instructions. For cloning PCR fragments into the multiple cloning sites of the vector NA3 (Invitrogen), pcDNA3-vector and PCR fragments were digested with restriction endonucleases HindIII (5') and BamHI (3'). Restriction sites coded PCR primers. Splintered fragments were purified using the kit for purification of PCR products Qiagen (QIAGEN, 28104), and DNA encoding γ1, γ2 and κ-chain, ligated into the vector pcDNA3, facilitating T4 DNA ligase at 16°C. the DNA throughout the night. The ligase iactiveaware for 10 min at 65°C. Legirovannye DNA plasmids immediately transformed into CaCl2-competent E.coli cells using a standard Protocol, and inflicted on containing ampicillin LB-tablets. After incubation at 37°C overnight were selected single colonies suspended in 10 µl of N2About and protected from the appropriate plasmids carrying chain antibodies by PCR (5 µl of suspended cells, Taq polymerase, primer 5BIp and 3Bam(GAG) γ/γ2 and 5Bsi and 3Bam(CTT) for κ-colonies:

94°C 120 sec

94°C 30 sec

55°C 30 sec

72°C 60 sec cycle 35 times

72°C 10 min

Samples were analyzed by 1.5% agarose gel for the presence of PCR products. Colonies containing antibody genes were selected for insulinopenia 5 ml of medium LB/Ampicillin. After incubation at 37°C overnight E. coli were collected and DNA prepared using a set of Qiagen miniprep (QIAGEN, # 12123). Control the splitting (HindIII, BamHI) showed that all genes κ - and γ-chains inserted at the expected size, and the sequences were confirmed by DNA sequencing on Medigenomix.

Rat constant domains amplified by the PCR from the vector pLXSN-ESK and cloned into the vectors g1/g2 and k pcDNA3 obtaining chimeric full-length antibodies. The variable domains VL amplified with the following primers containing HindIII and BsmI site at the 5'-end and a BsiWI site at the 3'-end:

VL-11B7-5': AGATAAGCTTGTGCATTCCGACATCCAGATGACCCAGGCTCC

VL-11B7-3': AGATCGTACGTTTCAGCTCCAGCTTGGTGCCTC

VL-11D5-5': AGATAAGCTTGTGCATTCCGACATCCAGATGACCCAGTCTCCATC

VL-11D5-3': AGATCGTACGTTTCAGCTTGGTCCCAG

The variable domains VH amplified with the following primers containing HindIII and BsmI site at the 5'-end and BIpI site on the 3'-end:

VH-11B7/11D5-5': AGATAAGCTTGTGCATTCCGAGGTGCAGCTTCAGGAGTCAGG

VH-11B7/11D5-3': AGATGCTGAGCTGACAGTGACCATGACTCCTTGGCC

BsiWI for the light chain and BIpI for the heavy chain are single sites on the 5' end of the constant sections and providing an immediate merger with the 3' end of genes with constant house is AMI,

Merged with the leader sequence of SEQ ID No: 69, obtained from the vector pLNOH2 (Norderhaug et. al. J. Immunol. Methods 204, 1997; Neuberger EMBO J. 1983; 2 (8): 1373-8,1983), the genes encoding the chains of the chimeric antibodies were cloned in the vector system rser for recombinant expression. Light chain genes Nhel (5') and Xhol (3') cloned in rser (Invitrogen), the genes for the heavy chain Kpnl (5') and Xhol (3') in the pCEP-Pu (Kohfeld FEBS Vol 414; (3) 557ff, 1997).

HEK 293 cells, which were cultivated in 20×20 cm plates, was transfusional together with 1 μg/ml of each plasmid encoding the genes for the light and heavy chains, using the standard method CaPO4-transliterowany for transient expression. The cultivation conditions were included 37°C, 5% CO2in a medium with high glucose DMEM/F12 containing 5% low IgG FCS, 1% pyruvate, 1% glutamine, 1% penicillin/streptomycin. After 24 h, transfection medium was replaced with fresh medium. Supernatant collected every 2-3 days for about 3 weeks. The chimeric antibody was purified from approximately 600 ml of supernatant, using a 1 ml column Hitrap rProtein A (GE-Healthcare) under conditions of standard buffer (load: 50 mm Tris; pH 8.5, washing: 50 mm PO4; pH 8.5, elution: 100 mm Glycin; pH 3,3), as described for the purification of rat antibodies.

Example 19. Humanization constant domains of the rat anti-AXL antibodies

Rat variable plots chimeric antibodies was compared with the sequences of human the antibody embryonic type at the protein level by conducting BLAST search for domains of immunoglobulins. Identified the closest human analogue in the V-genes, which in addition had the same length of the CDR loop. Related D and J segments were selected from the database V-BASE (http://vbase.mrc-cpe.cam.ac.uk/) according to their homology to the mouse sequence in the same way.

For the rat constant domains V and 11D5 antibodies were found to have the following optimal human embryonic sequence (V, D and J segments) and is defined as the human skeleton:

VL11B7hum: Vκ1-ø12+1

VH11B7hum: VH4-59+D4-4 (reading frame 3) + JH4

VL11D5hum: Vκ1-L1+Jκ4

VH11D5hum: VH4-59+D4-4 (reading frame 3) + JH4

Leader sequences for humanized constant domain selected from corresponding embryonic V-gene sequences, as selected. CDR residues of the rat anti-AXL antibodies that are defined according to Kabat (Rabat et al., Sequences of Proteins of Immunological Interest, Fifth Edition. NIH Publication No. 91-3242, 1991) was transplanted into human embryonic frame sequence for anti-AXL-specificity with obtaining final humanized versions of anti-AXL antibodies hum11B7 and hum11D5.

Protein sequences of humanized anti-AXL antibodies hum11B7 and hum11D5 was following.

Protein sequence aired back in DNA sequence. DNA sequence CODON-optimized for recombinant exp is Essie in mammalian cells, using database Kazusa-Codon-Usage. The resulting DNA sequences for humanized anti-AXL antibodies were as follows.

Optimized DNA sequence encoding the humanized anti-AXL antibodies, synthesized using a PCR method based on overlapping oligonucleotides.

VL-genes cloned in the vector rser using plasmid construction of chimeric antibodies pCEP4_ch11B7k1. Plots klonirovania were Nhel (5') and BsiWI (3')that were already included in the synthesized genes humanized antibodies. VH genes were cloned into the corresponding heavy chain chimeric vector pCEP-PU_ch11B7g1 using Kpnl (5') and BIpI (3') restriction sites. DNA optimized gene synthesis, cloning and confirmation of the sequences was performed by Eurofins Medigenomix GmbH, Martinsried, Germany.

Example 20. Rat and chimeric anti-AXL antibodies of the invention inhibit ligand-induced AXL-phosphorylation in vitro in a similar degree

Chimeric derivatives of rat anti-AXL antibodies V and 11D5 were obtained as part of this invention (see below). To study whether the rat anti-AXL antibodies of the invention and the corresponding chimeric anti-AXL antibodies of the invention inhibit ligand Gas6-mediated AXL activation in vitro in a similar degree, performed ELISA experiments on cells of cervical cancer CaSki. Gas6-oborudova the ing AXL activation in consequence of which was detected by enhanced tyrosine phosphorylation. Briefly, on day 1 was inoculated 3×104cells per well in normal growth medium in 96-well tablets with a round bottom. The next day, growth medium was replaced with serum-free medium for the depletion of the cells and left on all night for 24 hours of the next day, black 96-well tablets MAXL-Sorp (Nunc) were coated mouse anti-phospho-tyrosine antibody 4G10 at 2 µg/ml of PBS and 4°C. On day 3, the solution of antibodies 4G105 was removed and the wells MAXL-Sorp blocked PBS with 0.5% BSA for at least 4 h at room temperature. In parallel, the cells were pre-incubated with 50 ng/ml, 100 ng/ml, 300 ng/ml, 750 ng/ml, 1 μg/ml and 10 μg/ml mouse anti-AXL-antibody 11 V7 or chimeric anti-AXL-antibody ch11B7 for 1 h at 37°C and then treated or not treated with 400 ng/ml Gas6 (R&DO Systems) for 10 min at 37°C. the Medium is then poured out and the cells were literally in lyse buffer (50 mm HEPES, pH 7.5, 150 mm NaCl, 1 mm EDTA, 10% glycerol and 1% Triton X-100)supplemented with phosphatase inhibitors and protease (10 mm Na4P2O7, 1 mm phenylmethylsulfonyl, 1 mm orthovanadate, 1 mm NaF, and 0.5% Aprotinin) for 30 min in ice. Meanwhile, the blocking buffer was removed and tablets MAXL-Sorp was washed 6 times with wash buffer (PBS, 0.05% of Tween 20), before the lysates transferred and incubated overnight at 4°C. Then the tablets were washed 6 times with wash buffer. On the 4th day, the wells were incubated with bi is tenaliraman mouse anti-AXL-antibody V at 0.5 mg/ml in PBS for 2 h at room temperature. The tablets were washed 6 times with wash buffer and AP-conjugated streptavidin (Chemicon #SA110), diluted in the ratio of 1:4000 in PBS, was added to each well and incubated for 30 min at room temperature. Then the wells were washed 6x wash buffer was added to the substrate solution AttoPhos (Roche #11681982). Using the tablet reader Victor (Perkin Elmer), collected fluorescence signal from each well at a wavelength of excitation 430 nm and emission wavelength of 580 nm.

Figure 17 shows representative results of this experiment for cell lines of cervical cancer CaSki. As demonstrated by the reduction depending on the concentration of the corresponding AXL-phosphorylation, rat anti-AXL-antibody V (a) and chimeric anti-AXL-antibody ch11B7 (C) of the invention was provided by blocking ligand-induced activation of the receptor tyrosine kinase AXL in a similar degree. Comparable effects similar experimental conditions was observed for cell lines of melanoma With-8161.

Example 21. Rat and chimeric anti-AXL antibodies of the invention inhibit ligand-induced R42 cable line/R MAR-Kinase phosphorylation in vitro in a similar degree

For additional confirmation of whether the rat anti-AXL antibodies of the invention and the corresponding chimeric anti-AXL antibodies of the invention inhibit Gas6-induced asset is of R42 cable line/R MAR-Kinase in CaSki cells of cervical cancer in the same degree, performed ELISA experiments. Here, Gas6-induced R42 cable line/R MAR-Kinase activation was determined by amplification of protein (Thr202/Tyr204) phosphorylation. Briefly, on the first day in 96-well tablets with a round bottom was inoculated with 2×104cells per well. The next day, normal growth medium was replaced with serum-free medium for depletion of cells within 24 hours After the cells were pre-incubated with 50 ng/ml, 100 ng/ml, 300 ng/ml, 750 ng/ml, 1 μg/ml and 10 μg/ml mouse anti-AXL-antibody 11 V7 or chimeric anti-AXL-antibody ch11B7 for 1 h at 37°C and then treated or not treated with 400 ng/ml Gas6 (R&D Systems) for 10 min at 37°C. the Medium was poured and the cells were fixed in 4% formaldehyde in PBS (pH 7.5) for 30 min at room temperature. Formaldehyde solution was removed and cells were washed twice in wash buffer (PBS with 0.1% Tween 20). Cells were blocked with 1% H2O2, with 0.1% NaN3in wash buffer and incubated for 20 min at room temperature. Then the blocking solution was removed and cells were washed twice in wash buffer and blocked PBS with 0.5% BSA for 4 h at room temperature. Anti-phospho-R42 cable line/R MAP Kinase (Thr202/Tyr204) primary antibody (rabbit polyclonal; Cell Signaling #9101) was diluted in the ratio 1:1000 in PBS with 0.5% BSA, 0.05% of Tween 20, was added 5 mm EDTA and left overnight at 4°C. On day 4 the solution of the antibodies is and was removed and the plate was washed 3x a wash solution. HRP-conjugated anti-rabbit secondary antibody (Dianova #111-036-045) was diluted in the ratio 1:2500 in PBS with 0.5% BSA, 0.05% of Tween 20, and then to each well was added 5 mm EDTA, and incubated for 1.5 h at room temperature. The plate was washed 3x wash buffer for 5 min each. Added tetramethylbenzidine (TMB, Calbiochem) and was measured at a wavelength of 620 nm. The reaction was stopped by adding 100 µl of HCL 250 nm and measured the optical density at 450 nm with a reference wavelength of 620 nm using a tablet reader Vmax (Thermo Lab Systems).

Figure 18 shows representative results of this experiment. Rat anti-AXL-antibody V (a) and chimeric anti-AXL-antibody ch11B7 (C) of the invention provided blocking Gas6-induced activation of p42/p44 MAP-Kinase in cells CaSki cervical cancer in a similar extent, as shown by a reduction in dependence on concentration of the corresponding p42/p44 MAP-Kinase phosphorylation.

Example 22. Rat anti-AXL antibodies of the invention synergistically with chemotherapeutic agents for the elimination of drug resistance in vitro

As soon as it was discovered that the rat anti-AXL antibodies of the invention prevent Gas6-mediated antiapoptosis processes serum-free fibroblast NIH3T3-Axl cl.7, the question arose, whether synergistic, antagonistic anti-AXL antibodies with chemotherapeutic agents in the induction of apopt is for, what contributes to the elimination of drug resistance. In this example, NCI/ADR-RES (the original called MCF-7/AdrR cells - cell line of ovarian cancer (Liscovitch and Ravid, 2007, Cancer Letters, 245, 350-352), showing high resistance to some agents, including doxorubicin (Fairchild et al., 1987, Cancer Research, 47, 5141-5148; Xu et al., 2002, The Journal of Pharmacology and Experimantal Therapeutics, 302, 963-971), is incubated with antagonistic anti-AXL-antibody V and/or doxorubicin and the level of apoptosis was determined using TUNEL-staining. Briefly, 3×104NCI/ADR-RES cells were inoculated per well in normal growth medium on 8-chamber glass slide for crops (BD Falcon, cat# 354118)that were pre-incubated with the same medium for 1 h at 37°C. the next morning, normal growth medium was removed and cells were washed and cultured in medium with low serum (0.5% of FCS). Tonight was added izotopicheskie control antibody 1D5 or antagonistic anti-AXL-antibody V at a final concentration of 10 μg/ml each. On the morning of 3 days was added to doxorubicin in final concentrations of 100 μm, 150 μm or 200 μm and cells were incubated at 37°C. After 24 h the cells were washed once in PBS, fixed in 4% formaldehyde in PBS (pH 7.5) for 20 min at room temperature, dried in air for 5 min and stored at -20°C. Using a commercially available set the Fluorescein-FragEL(TM) (Oncogene, cat# QIA39, previously supplied by Merck-Calbiochem)was performed TUNEL-staining according to the manufacturer's instructions (head "Fluorescein-FragEL™ of cell preparations fixed on slides", c.10). Using fluorescence microscopy, cells were analyzed and photographed.

Figure 19 shows representative results of this experiment. Not observed TUNEL-staining and, therefore, apoptosis in cells NCI/ADR-RES ovarian cancer, which was treated with 100 μm of doxorubicin, regardless of incubated cells with a control antibody or antagonistic anti-AXL-antibody V (top). However, at a concentration of 150 μm doxorubicin showed a weak apoptosis in cells treated together with the control antibody, whereas incubation with antagonistic anti-AXL-antibody V resulted in the sustained induction of apoptosis (average). In the presence of 200 μm of doxorubicin, incubation of cells with V significantly increased the level of apoptosis compared to cells that were incubated with control IgG-antibody (bottom), showing that joint processing even multisteady to medicines cells both chemotherapeutic agents and antagonistic anti-AXL-antibody of the invention may be suitable for the elimination of drug resistance.

Example 23. Rat anti-AXL antibodies of the invention synergistically with hamiter the non-therapeutic agents in reducing jarzevskaja colony growth in vitro

Assays in soft agar was performed to study the ability of anti-AXL antibodies of the invention inhibit jarzebski cell growth either by itself or in combination with chemotherapeutic agents. Analysis of the formation of colonies in soft agar is a standard in vitro assays for testing of transformed cells, if only transformed cells are able to grow on soft agar. Briefly, melanoma cells 750 C-8161 were either left untreated or pre-incubated with antagonistic mouse anti-AXL-antibody V at a concentration of 15 μg/ml in IMDM medium (Gibco) for 30 min at 37°C. the cells are Then combined with a solution of purified agar Difco that resulted in 50 µl of cell suspension on top of the agar in the ratio of Agar, FCS and W of 0.35%, 0.2% and 7,5 µg/ml, respectively. This cell suspension was placed on top of 50 µl of 0.7% agarose lower layer containing 20% FCS, and in the end covered other nutrient solution in a quantity of 50 μl, which contains 0.2% FCS, and cisplatin in appropriate concentrations. In General, 150 µl per sample final concentration V and cisplatin was 2.5 μg/ml and 1.5 μm, and 1.0 μm to 0.75 μm, and 0.5 μm or 0.25 μm, respectively. Left to form colonies within 5 days and then stained with 50 μl of MTT (Sigma, 1 mg/ml in PBS) for 3 hours at 37°C. Using the system display Scanalyzer HTS combined with software to determine the formation of colonies HTS Bonit (Lemnatec, Wuerselen), were analyzed by a three-fold effect of the antagonistic rat anti-AXL antibodies V in the absence or presence of cisplatin.

Figure 20 shows representative results of this experiment. The data presented refer to the entire area of the colonies and reflect both the absolute measured quantity (a) and relative growth inhibition (In)caused by cisplatin and/or antagonistic mouse anti-AXL-antibody V. Compared with untreated control cells incubation with cisplatin resulted in slower growth of colonies depending on the dose of cisplatin. In contrast to the inhibitory effect of V itself at the level of 30% in combination with antagonistic anti-AXL-antibody V resulted in a significant potentiation of inhibitory effect of cisplatin on the growth in soft agar of melanoma cells With-8161, especially at low concentrations of cisplatin.

Example 24. Rat anti-AXL antibodies of the invention synergistically with antineoplastics agents in the relief of symptoms associated with tumor

In the previous examples, the synergistic effects of antagonistic anti-AXL antibodies of the invention, is introduced together with doxorubicin was observed in relation to induction of apoptosis and overcome the problems associated with drug resistance in multidrug resistant to the drug is Tuam cancer cells, such as the cell line of ovarian cancer NCI/ADR-RES. In addition, Raman effects, antagonistic anti-AXL antibodies of the invention and cisplatin in reducing jarzevskaja growth of colonies was determined against cell lines of melanoma With-8161. Therefore, if the cancer cells or patients suffering from cancer, treated with antagonistic anti-AXL-antibody in combination with radiation and/or one or more additional antineoplastic agent, are expected synergetic effects: induction of apoptosis in tumor cells and/or overcoming drug resistance of tumor cells, inhibition of survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis. In particular, synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor. cells, suppressing the survival of tumor cells, inhibition of growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis expected, if melanoma cells or patients suffering from melanoma is th, treated with antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, cisplatin, dacarbazine, temozolomide/Temodal, muroran/fotemustine, paclitaxel or docetaxel. In addition, synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis expected, if ovarian cancer cells or patients suffering from ovarian cancer, treated with antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which preferably represents, but not limited to, doxorubicin, cisplatin, carboplatin, paclitaxel, docetaxel, melphalan, altretamin, topotecan, ifosfamide, etoposide or 5-fluorouracil. Additionally, synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, ingibirovaniya tumor cells and/or proliferation, the reduction of tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis expected if cancer cells prostate cancer or patients with prostate cancer, treated with antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, mitozantrone, doxorubicin, paclitaxel, docetaxel, or vinblastine. Also synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis expected if stomach cancer cells or patients suffering from gastric cancer, treated with antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, 5-fluorouracil, mitomycin C, cisplatin, doxorubicin, methotrexate, etoposide, leucovorin, epirubicin, paclitaxel, docetaxel, or irinotecan. Also synergistically effective what s in the induction of apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis are expected, if the breast cancer cells or patients suffering from breast cancer, treated with antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, doxorubicin, epirubicin, paclitaxel, docetaxel, cyclophosphamide, 5-fluorouracil, gemcitabine, capecitabine, vinorelbine or trastuzumab. In addition, synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis are expected, if the cells of cervical cancer or patients suffering from cervical cancer, antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, cisplatin,ifosfamide, irinotecan, 5-fluorouracil, paclitaxel, docetaxel, gemcitabine or topotecan. In addition, synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis expected if cancer cells of the pancreas or patients suffering from pancreatic cancer, antagonistic anti-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, gemcitabine, capecitabine or 5-fluorouracil. And finally, but not excluding other types of cancer, synergistic effects in inducing apoptosis in tumor cells and/or overcoming the drug resistance of tumor cells, the suppression of the survival of tumor cells, inhibiting the growth of tumor cells and/or proliferation, reducing tumor cells migration, proliferation and metastasis or weakening of tumor angiogenesis expected if cell lung cancer or patients suffering from lung cancer, antagonistic ant what-AXL-antibody in combination with radiation and/or any additional antineoplastic agent, which is preferably, but not limited to, cisplatin, carboplatin, doxorubicin, paclitaxel, docetaxel, etoposide, vinorelbine, vincristine, ifosfamide, gemcitabine, methotrexate, cyclophosphamide, lomustin, or topotecan.

1. Monoclonal antibody or its antigennegative fragment, which binds to the extracellular domain of AXL and at least partially inhibits the activity of AXL in which the heavy chain contains
(a) CDRH1, presented in SEQ ID NO: 16, 22 or 28,
(b) CDRH2 presented in SEQ ID NO: 17, 23 or 29, and
(c) CDRH3 presented in SEQ ID NO: 18, 24 or 30,
and in which the light chain contains
(d) CDRL1, presented in SEQ ID NO: 13, 19 or 25,
(e) CDRL2 presented in SEQ ID NO: 14, 20 or 26, and
(f) CDRL3 presented in SEQ ID NO: 15, 21 or 27.

2. Monoclonal antibody or its antigennegative fragment according to claim 1, which reduces and/or blocks AXL-mediated signal transmission, reduces and/or blocks the phosphorylation of AXL, reduces and/or blocks cell proliferation, reduces and/or blocks angiogenesis, reduces and/or blocks the migration of cells, reduces and/or inhibits the metastasis of the tumor, reduces and/or blocks AXL-mediated antiapoptosis processes, reduces and/or blocks AXL-mediated signaling through RK.

3. Monoclonal antibody or its antigennegative fragment according to claim 1, which is the recombinant antibody humanized antibody, chimeric antibody, multispecific antibody or antigennegative fragment.

4. Monoclonal antibody or its antigennegative fragment according to claim 1, which is a chimeric antibody and contains the amino acid sequence of the heavy chain selected from the group consisting of SEQ ID nos: 38, 39, 41, 42, or, at least, its variable domain or an amino acid sequence identical in sequence at least 90%, and/or amino acid sequence of the light chain selected from the group consisting of SEQ ID NO: 37, 40, or at least its constant domain or an amino acid sequence identical to her sequence at least 90%.

5. Monoclonal antibody or its antigennegative fragment according to claim 1, which is a humanized antibody and contains the amino acid sequence of the heavy chain selected from the group consisting of SEQ ID nos: 44, 45, or, at least, its variable domain or an amino acid sequence identical in sequence at least 90%, and/or amino acid sequence of the light chain selected from the group consisting of SEQ ID NO: 43, 46, or, at least, its variable domain or an amino acid sequence identical in sequence, what about the least 90%.

6. Monoclonal antibody or its antigennegative fragment according to claim 1, which is a Fab fragment, Fab'fragment, F(AB')fragment, an Fv fragment, ditelo or single-stranded molecule of the antibody.

7. Monoclonal antibody according to claim 1, which is connected with detektivami marker, a radioactive group, or cytotoxic group.

8. Monoclonal antibody or its antigennegative fragment according to claim 1, which contains a heavy chain that contains:
(a) CDRH1, presented in SEQ ID NO: 16,
(b) CDRH2 presented in SEQ ID NO: 17, and
(c) CDRH3 presented in SEQ ID NO: 18,
and light chain containing
(d) CDRL1, presented in SEQ ID NO: 13,
(e) CDRL2 presented in SEQ ID NO: 14, and
(f) CDRL3 presented in SEQ ID NO: 15.

9. Monoclonal antibody or its antigennegative fragment according to claim 1, which contains a heavy chain that contains:
(a) CDRH1, presented in SEQ ID NO: 22,
(b) CDRH2 presented in SEQ ID NO: 23, and
(c) CDRH3 presented in SEQ ID NO: 24,
and light chain containing
(d) CDRL1, presented in SEQ ID NO: 19,
(e) CDRL2 presented in SEQ ID NO: 20, and
(f) CDRL3 presented in SEQ ID NO: 21.

10. Monoclonal antibody or its antigennegative fragment according to claim 1, which contains a heavy chain that contains:
(a) CDRH1, presented in SEQ ID NO: 28,
(b) CDRH2 presented in SEQ ID NO: 29, and
(c) CDRH3 presented in SEQ ID NO: 30,
and light chain containing
(d) CDRL1, is provided in SEQ ID NO: 25,
(e) CDRL2 presented in SEQ ID NO: 26, and
(f) CDRL3 presented in SEQ ID NO: 27.

11. Monoclonal antibody or its antigennegative fragment according to claim 1, which contains the amino acid sequence of the heavy chain selected from the group consisting of SEQ ID NO: 8, 10, 12, or at least its variable domain or an amino acid sequence identical in sequence at least 90%, and/or amino acid sequence of the light chain selected from the group consisting of SEQ ID NO: 7, 9, 11, or at least its variable domain or an amino acid sequence identical in sequence, at least 90%.

12. The selected nucleic acid molecule encoding a monoclonal antibody or antigennegative fragment according to claim 1.

13. Expressing the vector containing the nucleic acid molecule according to item 12.

14. A host cell expressing the monoclonal antibody or its antigennegative fragment according to claim 1, containing a vector according to item 13, which is a human cell, bacteria, animal, fungus, amphibians or plants.

15. Monoclonal antibody or its antigennegative fragment according to claim 1 for the diagnosis, prevention or treatment of hyperproliferative diseases associated with expression, overexpression and/or hyperactivity AXL.

16. Method received what I monoclonal antibody or its antigennegative fragment according to claim 1, including the extraction of monoclonal antibodies or antigennegative fragment from the host cell by 14.

17. The way to diagnose hyperproliferative diseases associated with expression, overexpression and/or hyperactivity AXL, including the contact of the sample with a monoclonal antibody or antigennegative fragment according to claim 1, and detecting the presence of AXL.

18. A method of preventing or treating a condition associated with expression, overexpression and/or hyperactivity AXL, in a patient, comprising the administration to a patient in need of such introduction, an effective amount of at least monoclonal antibodies or antigennegative fragment according to claim 1.

19. The use of monoclonal antibodies or antigennegative fragment according to claim 1 for the manufacture of pharmaceutical compositions for the treatment of drug resistant malignancies associated with expression, overexpression and/or hyperactivity AXL.

20. The use of monoclonal antibodies or antigennegative fragment according to claim 1 for the manufacture of a medicine for joint injection with antineoplastic agent for the treatment of hyperproliferative diseases associated with expression, overexpression and/or hyperactivity AXL.

21. Farmacevtichnaasociaciya to diagnose hyperproliferative diseases, associated with the expression, overexpression and/or hyperactivity AXL containing an effective amount of the monoclonal antibody or its antigennegative fragment according to claim 1.

22. Pharmaceutical composition for prevention or treatment of hyperproliferative diseases associated with expression, overexpression and/or hyperactivity AXL containing an effective amount of the monoclonal antibody or its antigennegative fragment according to claim 1.

23. The pharmaceutical composition according to item 21 or 22, where the disease is chosen from the group consisting of breast cancer, lung cancer and other malignancies associated with expression or overexpression of AXL, and formation of tumor metastases, optionally containing an active agent.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically binds heparin-binding EGF-like growth factor (HB-EGF) and its antigen-binding fragment. Invention describes a nucleic acid molecule, an expressing vector, a host cell and a method for obtaining an antibody or its antigen-binding fragment, as well as use of antibody or its antigen-binding fragment for obtaining pharmaceutical composition for diagnostics, prevention or treatment of hyperproliferation disease, methods and sets for diagnostics and prevention or treatment of the state associated with HB-EGF expression. This invention can be further found in therapy of diseases determined with or related to HB-EGF expression.

EFFECT: improving efficiency of composition and treatment method.

34 cl, 43 dwg, 28 ex, 12 tbl

FIELD: biotechnologies.

SUBSTANCE: invention describes polynucleotide, expression vector, host cell and production method of humanised antibody together with their use, as well as medical preparation against rheumatoid arthritis, prophylaxis or treatment method of rheumatoid arthritis and use of humanised antibody at production of pharmaceutical preparation for prophylaxis or treatment of rheumatoid arthritis. This invention can be used in therapy of human diseases associated with α9 integrin.

EFFECT: improved activity and thermal stability.

14 cl, 6 dwg, 6 tbl, 11 ex

Organic compounds // 2502802

FIELD: biotechnologies.

SUBSTANCE: invention refers to eucariotic vector for expression of target recombinant product in a mammal cell and to its use, to a mammal cell for production of target recombinant product and to a method for its production, a method of a mammal cell selection and a method for obtaining a target recombinant product. Vector includes the first polynucleotide coding a functional folate receptor bound to a membrane as a selective marker and the second polynucleotide coding the target product that is expressed in a recombinant manner. Target product represents a pharmaceutically active, therapeutically active or diagnostic polypeptide. Functional folate receptor bound to the membrane and target product are expressed from the above expression vector. Sampling system is based on introduction of a gene of exogenic functional folate receptor bound to the membrane to a mammal cell.

EFFECT: invention allows effective selection of transformed cells and high yield of target product.

26 cl, 3 tbl, 2 ex

FIELD: biotechnologies.

SUBSTANCE: expression vector includes: (a) replication origin OriP obtained from Epstein-Barr virus (EBV), where replication origin contains: 1) symmetry element of the second order (DS); and 2) duplication section (FR) that contains fixation point EBNA; (b) replication origin SV40; (c) insertion section for inserting a gene of concern; (d) promoter EF-1b functionally bound to the insertion section; (e) poly-A signal; (f) bacterial replication origin; (g) selected marker; and unnecessarily containing (h) sequence of nucleic acid, which codes constant area of heavy or light chain of antibody, which is functionally bound to the insertion section. With that, replication origin OriP is bound to an initiation factor of replication EBNA 1, which acts from outside and is not coded with an expression vector.

EFFECT: use of an expression vector in an extracted host cell, a set and a method for obtaining recombinant protein provides production of abundant protein expression.

26 cl, 25 dwg, 3 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant human blood coagulability factor VIII with deletion of B-domain (hFVIII-BDD). Recombinant plasmid DNA pAP227 coding polypeptide with sequence hFVIII-BDD also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 2H5 producing recombinant hFVIII-BDD with highly stable yield at the level of about 20 IU/ml/24 h. Cultivation of cells-producers is performed in medium DME/F12 containing 2-4% of Fetal Bovine Serum, 1% of dimethylsulphoxide and 50 IU/l of insulin.

EFFECT: improvement of the method.

4 cl, 5 dwg, 9 ex

FIELD: biotechnologies.

SUBSTANCE: recombinant plasmid DNA pBK415 coding polypeptide with sequence of tissular activator of human plasminogen, also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 1F8 producing recombinant protein of tissular activator of plasminogen with highly stable yield at the level of up to 190 mg/l. Cultivation of cells-producers is performed under perfusion conditions in presence of a mixture consisting of additive CHO Bioreactor supplement and sodium butyrate or dimethylsulphoxide with further separation of a target product.

EFFECT: improvement of the method.

5 cl, 5 dwg, 3 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant blood coagulability factor IX of human being (hFIX). Recombinant plasmid DNA pAK380 containing gene of protein rhFIX, MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transcription enhancer CMV and an internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase for stability to geneticin (Neo), a cassette for expression in bacteria cells of gene β-lactamase for stability to ampicillin, is used for obtaining recombinant factor hFIX in cells of line Cricetulus griseus CHO 1E6. By transformation of cell line C. griseus CHO DHFR - recombinant plasmid DNA pAK380 there obtained is cell line C. griseus CHO 1E6 producing recombinant hFIX with stable high yield at the level of 50 mg/l/24 h. After cultivation of cells-producers there extracted is hFIX by pseudoaffine chromatography on Q Sepharose with elution of 10mM CaCl2; then, on Heparin-Sepharose FF with elution of 600 mM NaCl, and chromatography on hydroxyapatite of type I with elution of 600 mM K3PO3 and chromatography on Source 30Q with elution of 600 mM with ammonium acetate.

EFFECT: improvement of the method.

4 cl, 5 dwg, 7 ex, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically connects segment M1' IgE and that induces apoptosis in IgE-expressing B-cells and its antigen-binding fragment. Besides, compositions and curing methods of IgE-mediated abnormalitiy, an item, a specific elimination method of IgE-producing B-cells, methods for prophylaxis and reduction of IgE products induced with an allergen, as well as isolated nucleic acid, an expression vector, a host cell and a method for obtaining an antibody as per the invention together with their use are considered.

EFFECT: invention can be further used in therapy of diseases associated with IgE.

46 cl, 19 dwg, 5 tbl, 13 ex

FIELD: biotechnologies.

SUBSTANCE: method involves introduction to a plant, some part of the plant or a plant cell of nucleotide sequence for 80-100% of identical nucleotide sequence determined in SEQ ID NO: 17, and coding a composite protein containing a cytoplasmic end segment, a transmembrane domain, a steam area (CTS domain) of N-acetylglucosaminyl transferase (GNT1), which is merged with catalytic domain of beta-1,4-galactosyl transferase (GalT); with that, the above first nucleotide sequence is functionally connected to the first regulatory area being active in the plant; and the second nucleotide sequence for coding of a target protein; with that, the above second nucleotide sequence is functionally connected to the second regulatory area being active in the plant, as well as transient co-expression of the first and the second nucleotide sequences with synthesis of the target protein containing glycans, with reduced xylosylation, reduced fucosylation or their combination at comparison to the same target protein obtained from a wild plant. The invention described nucleic acid coding the protein that modifies glycosylation of target protein, a composite protein for modification of glycosylation of target protein; nucleic acid that codes it, as well as a plant, a plant cell and a seed, which contain the above nucleic acid or the above composite protein.

EFFECT: invention allows effective production of a target protein with reduced xylosylation, reduced fucosylation or their combination.

20 cl, 7 dwg, 9 ex

Vns-met-histones // 2498997

FIELD: biotechnologies.

SUBSTANCE: nucleic acid molecule codes a polypeptide consisting of two residues of methionine as the first and the second N-end amino-acid residues connected through a peptide link to a mature eucariotic histone. Polypeptide is obtained by cultivation of a host cell transformed by an expression vector including the above molecule of nucleic acid. Polypeptide is used as part of pharmaceutical composition for therapy of cancer, bacterial, virus or fusarium infections. Besides, polypeptide is used as part of composition for diagnostics of a patient in relation to response to pharmaceutical composition containing the above polypeptide, or in relation to curability using it.

EFFECT: invention allows improving efficiency of recombinant expression and simplifying determination of the above polypeptide in presence of endogenic histones at preservation of biologic activity of mature eucariotic histone.

17 cl, 3 dwg, 6 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry, particularly to recombinant fused protein dimers intended to inhibit or suppress immune response in a mammal, which bind human CD80 or human CD86 or the extracellular domain of any thereof, and has higher capacity for suppressing immune response than a dimer of the fused protein LEA29Y-Ig. Also disclosed are nucleic acids which code said dimers, expression vectors containing said nucleic acids, as well as recombinant host cells containing said nucleic acids and/or said vectors. Disclosed are pharmaceutical compositions for inhibiting or suppressing immune response in a mammal, which contain said fused protein dimers, as well as use of said dimers to produce drugs for inhibiting or suppressing immune response in a mammal, treating diseases or disorders of the immune system or treating organ or tissue transplant rejection in a mammal. Methods of producing said fused protein dimers are also disclosed.

EFFECT: invention provides effective inhibition or suppression of immune response in a mammal.

9 cl, 15 dwg, 11 tbl, 12 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically binds heparin-binding EGF-like growth factor (HB-EGF) and its antigen-binding fragment. Invention describes a nucleic acid molecule, an expressing vector, a host cell and a method for obtaining an antibody or its antigen-binding fragment, as well as use of antibody or its antigen-binding fragment for obtaining pharmaceutical composition for diagnostics, prevention or treatment of hyperproliferation disease, methods and sets for diagnostics and prevention or treatment of the state associated with HB-EGF expression. This invention can be further found in therapy of diseases determined with or related to HB-EGF expression.

EFFECT: improving efficiency of composition and treatment method.

34 cl, 43 dwg, 28 ex, 12 tbl

FIELD: biotechnologies.

SUBSTANCE: invention describes polynucleotide, expression vector, host cell and production method of humanised antibody together with their use, as well as medical preparation against rheumatoid arthritis, prophylaxis or treatment method of rheumatoid arthritis and use of humanised antibody at production of pharmaceutical preparation for prophylaxis or treatment of rheumatoid arthritis. This invention can be used in therapy of human diseases associated with α9 integrin.

EFFECT: improved activity and thermal stability.

14 cl, 6 dwg, 6 tbl, 11 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a method for obtaining recombinant DNAse I of a human or its mutein, as well as their conjugates with polyethylene glycol, using a bacterium belonging to Escherichia class, transformed with expression plasmid, containing a promoter functioning in a bacterial cell, DNA fragment coding a hexahistidine cluster, a fragment coding enterokinase recognition sequence amalgamated in frame with human DNAse I or its functionally active mutein containing replacements of asparagine with cysteine, transcription termination section, vector pET28a(+) fragment containing initiation section of replication of bacteriophage fl, sequence coding aminoglycoside-3'-phosphotransferase, area of beginning of plasmid pBR322 replication, gene RNA-organising protein Rop, sequence coding lactose operon repressor.

EFFECT: invention allows obtaining recombinant human DNAse I or its mutein with high yield.

18 cl, 7 dwg, 1 tbl, 12 ex

Organic compounds // 2502802

FIELD: biotechnologies.

SUBSTANCE: invention refers to eucariotic vector for expression of target recombinant product in a mammal cell and to its use, to a mammal cell for production of target recombinant product and to a method for its production, a method of a mammal cell selection and a method for obtaining a target recombinant product. Vector includes the first polynucleotide coding a functional folate receptor bound to a membrane as a selective marker and the second polynucleotide coding the target product that is expressed in a recombinant manner. Target product represents a pharmaceutically active, therapeutically active or diagnostic polypeptide. Functional folate receptor bound to the membrane and target product are expressed from the above expression vector. Sampling system is based on introduction of a gene of exogenic functional folate receptor bound to the membrane to a mammal cell.

EFFECT: invention allows effective selection of transformed cells and high yield of target product.

26 cl, 3 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a peptide capable of binding with scurfin and inhibiting biological activity of scurfin, which is selected from a peptide consisting of an amino acid sequence Arg-Asp-Phe-Gln-Ser-Phe-Arg-Lys-Met- Trp-Pro-Phe-Phe-X, where X is absent or X is present and represents X14 or X14-X15, where X14 and X15 independently denote an amino acid, a version of said peptide and a pharmaceutically acceptable salt thereof. The invention also discloses a fused protein and a pharmaceutical composition, which involves use of said peptide and fused protein, as well as use thereof to produce and treat pathologies which require transient regulation or inhibition of immunosuppressive activity of regulatory T lymphocytes, such as a neoplastic disease or infectious disease. The invention also relates to a method of producing said peptide and fused protein, including a protein or peptide coding nucleic acid, a DNA construct, an expression vector and a host cell.

EFFECT: invention provides effective treatment of infectious and neoplastic diseases which require transient regulation or inhibition of immunosuppressive activity of regulatory T lymphocytes.

26 cl, 10 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant human blood coagulability factor VIII with deletion of B-domain (hFVIII-BDD). Recombinant plasmid DNA pAP227 coding polypeptide with sequence hFVIII-BDD also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 2H5 producing recombinant hFVIII-BDD with highly stable yield at the level of about 20 IU/ml/24 h. Cultivation of cells-producers is performed in medium DME/F12 containing 2-4% of Fetal Bovine Serum, 1% of dimethylsulphoxide and 50 IU/l of insulin.

EFFECT: improvement of the method.

4 cl, 5 dwg, 9 ex

FIELD: biotechnologies.

SUBSTANCE: recombinant plasmid DNA pBK415 coding polypeptide with sequence of tissular activator of human plasminogen, also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 1F8 producing recombinant protein of tissular activator of plasminogen with highly stable yield at the level of up to 190 mg/l. Cultivation of cells-producers is performed under perfusion conditions in presence of a mixture consisting of additive CHO Bioreactor supplement and sodium butyrate or dimethylsulphoxide with further separation of a target product.

EFFECT: improvement of the method.

5 cl, 5 dwg, 3 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant blood coagulability factor IX of human being (hFIX). Recombinant plasmid DNA pAK380 containing gene of protein rhFIX, MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transcription enhancer CMV and an internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase for stability to geneticin (Neo), a cassette for expression in bacteria cells of gene β-lactamase for stability to ampicillin, is used for obtaining recombinant factor hFIX in cells of line Cricetulus griseus CHO 1E6. By transformation of cell line C. griseus CHO DHFR - recombinant plasmid DNA pAK380 there obtained is cell line C. griseus CHO 1E6 producing recombinant hFIX with stable high yield at the level of 50 mg/l/24 h. After cultivation of cells-producers there extracted is hFIX by pseudoaffine chromatography on Q Sepharose with elution of 10mM CaCl2; then, on Heparin-Sepharose FF with elution of 600 mM NaCl, and chromatography on hydroxyapatite of type I with elution of 600 mM K3PO3 and chromatography on Source 30Q with elution of 600 mM with ammonium acetate.

EFFECT: improvement of the method.

4 cl, 5 dwg, 7 ex, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically connects segment M1' IgE and that induces apoptosis in IgE-expressing B-cells and its antigen-binding fragment. Besides, compositions and curing methods of IgE-mediated abnormalitiy, an item, a specific elimination method of IgE-producing B-cells, methods for prophylaxis and reduction of IgE products induced with an allergen, as well as isolated nucleic acid, an expression vector, a host cell and a method for obtaining an antibody as per the invention together with their use are considered.

EFFECT: invention can be further used in therapy of diseases associated with IgE.

46 cl, 19 dwg, 5 tbl, 13 ex

FIELD: biotechnologies.

SUBSTANCE: invention describes polynucleotide, expression vector, host cell and production method of humanised antibody together with their use, as well as medical preparation against rheumatoid arthritis, prophylaxis or treatment method of rheumatoid arthritis and use of humanised antibody at production of pharmaceutical preparation for prophylaxis or treatment of rheumatoid arthritis. This invention can be used in therapy of human diseases associated with α9 integrin.

EFFECT: improved activity and thermal stability.

14 cl, 6 dwg, 6 tbl, 11 ex

Up!