Plasmid 40gal determining synthesis of α-galactosidase α-psgal, strain ecoli rosetta(de3)/40gal - producer of chimeric protein containing amino-acid sequence α-psgal, and method for its production

FIELD: biotechnologies.

SUBSTANCE: invention represents plasmide determining synthesis of α-galactosidase α-PsGal, which includes Ncol/Sall - fragment of plasmid pET-40b(+) (Novagen) and DNA fragment, with the size of 2142 pairs of bases, which contains a chimeric gen consisting of structural part of gene α-PsGal, which is adapted on N-end for expression in E. coli cells, and a nucleotide coding a specific sequence for enteropeptidase. The invention also refers to strain E. coli Rosetta (DE3) transformed with the above plasmid - producer of chimeric protein containing amino-acid sequence of recombinant α-galactosidase α-PsGal and sequence specific for enteropeptidase. The invention also refers to a method for obtaining recombinant α-galactosidase α-PsGal, which involves the following stages: incubation of the above strain-producer in liquid nutritional medium LB during 12 hours at 16°C, deposition of bacterial cells by centrifugation, disintegration of a suspension of cells in a buffer, centrifugation of an extract, chromatography of above-deposit liquid on a column with metal affine resin, elution of protein, concentration of active fractions by means of ion-exchange resin, incubation with enteropeptidase and separation of a target product by gel-filtration.

EFFECT: invention allows obtaining more active and stable recombinant alpha-galactosidase with high efficiency degree.

3 cl, 1 dwg, 3 ex

 

The invention relates to biotechnology, in particular genetic engineering, and concerns a method for obtaining recombinant protein α-galactosidase marine bacterium Pseudoalteromonas sp. strain KMM 701 VKM B-D (α-PsGal), and plasmids to obtain and recombinant Escherichia coli. The invention allows to produce highly active recombinant α-galactosidase for use in transfusion and clinical medicine, genetic engineering and molecular biology.

α-D-galactosidase (EC) catalyzes the hydrolysis of α-galactosides communication in such oligosaccharides like raffinose, melibiose, stachyose, and polysaccharides such as galactomannan, and glycoconjugates, including glycoproteins and glycolipids. α-PsGal recommended for use in transfusion medicine as an enzyme capable of removing α-1,3-linked galactose residues from glycoproteins group of substances In the blood with the last transformation in the substance group N (O); in clinical medicine as a preventive and therapeutic antibacterial agent for treatment of mucosal and wound surfaces; in molecular biology as a tool to study the structure of oligo - and polysaccharide matrices; in genetic engineering to obtain the reference proteins, etc.

Developing effective way to obtain universal group properties e is trozitos for emergency transfusiological aid continues to be very relevant. α-Galactosidase, inactivating serological activity of human erythrocytes group (EB-B), is a relatively rare enzymes. Clinical trials converted erythrocytes in human volunteers have demonstrated that the enzymatic conversion of EB-doable that converted by the enzyme ECH-ECH-O viable and can function as raw EB, which are chosen by blood group in accordance with the rules adopted in clinical transfusion medicine. However, the amount of enzyme (mg), in these studies, even with modern efficient recombinant expression technology is an economic barrier for use in transfusion medicine as one package (200 ml) of red blood cells requires 1-2 g of the enzyme [Zhang Y.P, F. Gong, Bao G.Q., Gao H.W, Ji SP, Y.P. Tan, S.B. Li, Li L. l, Wang Y.L., Xu N., Xu L.J., Tian S.G., Zhang Z.X., Lu Q.S., Qiu Y., Bai, J.S. Chen J.T. To O 2 erythrocyte conversion by the recombinant α-galactosidase // Chin. Med. J. - 2007. - Vol.120, No. 13. - P.1145-1150]. In addition, great importance has a pH optimum of the enzyme and narrow substrate specificity. So, all described in the literature enzymes, effective on erythrocytes, are optimum in the acidic pH, which is highly undesirable for erythrocytes.

The analysis of numerous literature data showed that bacteria contain enzymes, one of the properties that meet those of the ideological requirements (optimum activity when pH 7.0), requirements for modification of erythrocytes under physiological conditions.

Marine bacteria as a source of enzymes with unique specificity attract more and more attention of researchers. It was found that α-galactosidase from the marine bacterium Pseudoalteromonas sp. KMM 701 in addition to inactivating action on serological activity In erythrocytes has an antibacterial property to destroy microbiological film pathogenic strains formed on the mucous membranes of man. Treatment of epithelial cells of the human larynx preparation of this enzyme significantly reduced adhesion of the pathogen diphtheria .diphtheriae [L.A.Balabanova, I.Y.Bakunina, O.I.Nedashkovskaya, I.D.Makarenkova, T.S. Zaporozhets, N.N.Besednova, T.N.Zvyagintseva and V.A.Rasskazov. Molecular Characterization and Therapeutic Potential of a Marine Bacterium Pseudoalteromonas sp.KMM 701 α-Galactosidase // Mar Biotechnol. - 2010. - Vol.12. P.111-120].

A method of obtaining natural protein α-galactosidase from wild producer strain Pseudoalteromonas sp. VKM B-D [EN 2113479 C1, 20.06.1998]. The main disadvantage of this method are the high technological costs in storage and cultivation of the wild strain.

Was recently installed the nucleotide sequence of a Mature protein α-galactosidase Pseudoalteromonas sp. KMM 701 (GenBank code DQ530422.1). However, the ways to obtain active recombinant analogue of α-galactosidase Pseudoalteromonas sp. IN-D (α-PsGal) is not yet known. Obtaining dissolve the Oh highly active α-PsGal in heterologous bacterial systems difficult, since the functional protein is a psychrophilic and consists of two subunits.

The objective of the invention is the construction of a recombinant strain of E. coli, the plasmid that encodes the synthesis of the recombinant protein α-PsGal, and designing method thereof.

The problem is solved by the creation of genetic structure in the form of recombinant plasmids 40Gal and E. coli strain Rosetta(DE3)/40Gal providing induced synthesis with high and stable yield of active soluble recombinant α-galactosidase in periplasm cells of Escherichia coli.

The technical result of the claimed invention - obtain active recombinant α-galactosidase α-PsGal with high yield and purity level.

Plasmid 40Gal has 8306 base pairs (BP) and is characterized by the presence NcoI/SalI fragment of plasmid pET-40b(+) (Novagen) and the sequence of the DNA fragment size 2142 BP, adapted by the N-end for expression in E. coli cells containing a chimeric gene consisting of the structural part of the gene of α-PsGal, and specific sequences for enteropeptidase to remove additional amino acid residues from the N-terminal part of the molecule of the recombinant protein.

The drawing shows a physical map of plasmid 40Gal and scope of plasmids responsible for the expression of recombinant protein α-PsGal.

The nucleotide sequence of FR is gment plasmids 40Gal, flanked by sites Ncol and Sail, contains the sequence of the structural gene of α-PsGal with an adapted N-end for expressii in E. coli, the corresponding open reading frame for the protein α-PsGal, and sequence-specific enteropeptidase (SEQ ID No. 1).

The E. coli strain Rosetta(DE3)/40Gal obtained by transformation of cells of E. coli Rosetta (DE3) (Novagen) plasmid 40Gal using conventional genetic engineering techniques [Sambrook J., Fritsch E.F., Maniatis T. // Molecular Cloning. A. Laboratory Manual. 2bd ed. Cold Spring Harbor, NY, 1989.].

Recombinant E. coli strain Rosetta(DE3)/40Gal characterized by the following features.

Cultural morphological traits

Cells of strain form large round with smooth edges, convex colonies up to 5 mm in diameter, surface colonies are smooth, the consistency of mucous. The pigment does not accumulate. Gram-negative, do not form spores, capsules do not have. Colonies grow well on simple nutrient media (LB). With the growth in liquid media intensive form a smooth suspension.

Physical-biological characteristics

The E. coli strain Rosetta(DE3)/40Gal of uidatepicker on its biochemical properties. The strain does not possess gelatinase activity, not fermented lysine; breaks down glucose, lactose, mannitol, sucrose to acid and gas. Has a mutation in the gene lac, providing control of the level of expression, as well as translation of rare codons. Optimum for growth is the raised temperature of 37°C. as for the production of psychrophilic α-PsGal 16°C.

Antibiotic resistance

Cells of strain are characterized by resistance to chloramphenicol (34 μg/ml) and kanamycin (25 μg/ml).

Pathogenicity and toxicity

Recombinant E. coli strain Rosetta(DE3)/40Gal not pathogenic and non-toxic to warm-blooded animals.

The strain is stored in the usual way in suspensions with glycerol (30%) at -20°C. the Inventive method of production of recombinant α-galactosidase α-PsGal lies in the cultivation of cells of E. coli strain Rosetta (DE3)/40Gal in LB nutrient medium containing kanamycin, the separation of the biomass from the culture fluid, the destruction of microbial cells, followed by separation of the target product water extraction and chromatographic purification of enzyme preparation. Purification of the target product are carried out by chromatography on metallogeny resin and gel-filtration.

The yield of recombinant α-PsGal as a result of application of the described method is at least 10 mg of recombinant protein from 1 l of culture with a specific activity of more than 500 units/mg protein, which is higher than the specific activity of the natural analogue of 5 times.

Recombinant protein α-PsGal is a glycosilated with a molecular mass of 160 kDa, has an optimum reaction temperature of 20-22°C and the optimum pH=7,0-7,5, and its activity is not dependent on the presence of ions of bivalent metals in incubat the Onna environment. Recombinant α-PsGal can be successfully used to remove the group specificity of human erythrocytes of blood group B(III) and obtain the universal donor blood group O(I), since after the reaction is easily inactivated after 25°C. α-PsGal can also be used for the treatment of mucosal epithelium of human rights in the prevention and treatment of infectious diseases.

Significant advantages of the proposed method are:

- the use of the producer strain E. coli Rosetta (DE3)/40Gal that allows you to get in the biosynthesis of a large number of full-sized, docsubject and high-level recombinant α-PsGal;

- use two-step chromatographic purification of the enzyme, which allows to obtain pure recombinant protein in a short time and with low losses.

The way to obtain functionally active protein on the basis of the gene encoding α-galactosidase marine bacteria in the α-PsGal, is illustrated by the following examples.

Example 1. Construction of plasmids 40Gal.

Recombinant plasmid 40Gal containing the structural gene of α-PsGal encoding the Mature form of α-galactosidase Pseudoalteromonas sp. KMM 701, and sequence-specific enteropeptidase, flanked by the restriction sites NcoI and SaiI, design on the basis of commercial plasmid pet-40b(+) (Novagen).

fragment DNA containing a full-sized gene α-PsGal, obtained by polymerase chain reaction using genomic DNA of the strain of the marine bacterium Pseudoalteromonas sp.KMM 701, VKM B-D, as a matrix, and primers G2-NcoI-for40 and G3-SalI-rev40, where G2-NcoI-for40 - primer, it is specific to the N-terminal sequence of α-PsGal, including the sequence for enteropeptidase, G3-SalI-rev40 reverse primer, it is specific to the C-terminal sequence of α-PsGal:

G2-NcoI-for40: 5'-

ATTACCATGGATGACGACGACAAGGCCGACACTAAATCATTTTATCGATTAGACA-3'

G3-SalI-rev40: 5'-ACACGTCGACTTACGCTTTGTTGAGCTCAAATATAAGC-3'

This reaction is carried out under the following conditions: 10x Encycio buffer, 50x mix polymerases Encycio ("Encycio PCR kit, Evrogen, Moscow), 50x dNTP mixture (10 mM each), primers mix (5 μm each), 50 ng DNA. The amplification process comprises the following steps: heating at 95°C for 2.5 min, 35 PCR cycles (15 sec at 95°C, 2 min 72°C) and incubation of 10 min at 72°C. After amplification, the DNA fragment purified by electrophoresis in 1% agarose gel. Fragment (1 μg) treated with restrictase NcoI and SaiI in the optimal buffer (Fermentas) for 3 hours, then the enzymes are removed from the reaction medium by the standard method with phenol (1:1). In the aqueous fraction containing the fragment, add 1/10 volume of 0.3 M Na acetate, pH 5.2, and 1/2 volume isopropanolamide alcohol and leave at -20°C for 30 minutes Then centrifuged at 14000 rpm for 20 min, the precipitate is raybaut 75% ethanol and dried at room temperature. The precipitate was dissolved in 20 μl.

5 μg of plasmid DNA pet-40b(+) treated with restrictase NcoI and Sail in accordance with the methodology described above, and from the resulting hydrolysate allocate vector portion of the plasmid in 1% gel low-melting agarose.

The obtained fragment and the vector portion of the plasmid pet-40b(+) sew using a ligase reaction in 50 μl of buffer for ligation according to the instructions (Fermentas). 10 μl of the reaction mixture used to transform competent cells of E. coli Rosetta(DE3). Transformants plated on LB-agar containing 25 μg/ml kanamycin. After incubation for 16 h at 37°C. clones Tsevaot, isolated plasmid DNA and examined for the presence of mutations using automated sequencing. Selected DNA containing the desired sequence representing plasmid 40Gal size 8306 BP

Example 2. Obtaining E. coli strain Rosetta (DE3)/40Gal transformed by the plasmid 40Gal producer chimeric protein containing the amino acid sequence of the recombinant α-galactosidase α-PsGal and sequence-specific enteropeptidase.

Producing strains obtained by transformation of cells of E. coli strain Rosetta(DE3) recombinant plasmid 40Gal. Night culture (0.5 ml LB) producer strain of recombinant α-PsGal grown in one-liter flask in liquid LB medium containing per liter 10 g bacto-three the tone, 5 g bacto-yeast extract and 10 g NaCl, 25 mg/ml kanamycin, pH of 7.7, on a shaker at 200 rpm at 37°C for 2 hours to an optical density of 0.6-0.8 (OD600), then add the inducer of the expression of IPTG to a final concentration of 0.2 mm and then incubated at 16°C for 12 hours. To determine the productivity of the strain of cell water extracts analyzed by electrophoresis in 12% polyacrylamide gel with sodium dodecyl sulfate. Gel paint Kumasi R-250 according to standard methods and determine the relative amount of protein in the band of the target product. The content of the recombinant protein in the soluble cellular fraction is not less than 30% of all proteins of this fraction.

Example 3. Isolation and characterization of recombinant α-galactosidase α-PsGal.

Producing strains of recombinant α-galactosidase α-PsGal E. coli Rosetta (DE3)/40Gal incubated liter flask in liquid LB medium containing per liter 10 g bacto-tryptone, 5 g bacto-yeast extract and 10 g NaCl, 0.2 mm IPTG, 25 mg/ml kanamycin, pH of 7.7, on a shaker at 250 rpm for 12 hours at 16°C. Bacterial cells precipitated by running the centrifuge at 5000 rpm for 10 minutes, the Suspension of cells disintegrate in 100 ml of buffer A (0.01 to M NaH2PO4pH of 7.7, 0.01% NaN3) for 5×30 sec, cooling in ice. Then centrifuged at 5000 rpm for 10 min. the Supernatant liquid is to be collected and placed on a column with metallating resin (Qiagen), pre-equilibrated with buffer A. the Elution of the protein is performed with buffer a containing 50 mm EDTA. The active fractions are collected and concentrated to 3 ml in a buffer containing 0.4 mm NaCl, ion-exchange resin DEAE-toyoperl 650M (TOYA SODA) and incubated with enteropeptidase (Invitrogen) at 21°C for 15 hours. The protein solution is applied on a column for gel filtration with Sephacryl S-200 HR (Sigma). The yield of recombinant protein is about 10 mg from 1 liter of culture. The obtained recombinant polypeptide is determined by the first 10 amino acids on an automated sequencing machine. Carried out the sequencing of the recombinant α-galactosidase α-PsGal isolated from cells of E. coli strain Rosetta (DE3)/40Gal, showed that the N-terminal amino acid sequence A1A-Asp-Thr-Lys-Ser-Phe-Tyr-Arg-Leu-Asp corresponds to the first 10 amino acids of a full-sized natural protein α-galactosidase Pseudoalteromonas sp. KMM 701, WCMW-D,similar to the α-PsGal.

The activity of α-galactosidase is determined by the splitting of the p-nitrophenylacetylene (p-PHP). The reaction mixture in a total volume of 400 µl containing 10 mm NaH2PO4(pH of 7.2), 3 mm of substrate and enzyme. After 20 min incubation at 20°C. the reaction is stopped by adding 0.6 ml of 1 M Na2CO3. The number formed during the enzymatic reaction product determined spectrophotometrically at 400 nm. Per unit of activity taking quantities of the enzyme, catalyzing the release of 1 μm p-NPG (E400 nm=18600) within 1 min of incubation. Specific activity is expressed as units of enzyme activity per 1 mg of protein. The concentration of protein in solution is determined by the method of Bradford.

Data on physico-chemical characteristics and enzymatic activity of the expression product of artificial chimeric gene α-PsGal in cells of E. coli strain Rosetta (DE3)/40Gal demonstrate compliance of investigational polypeptide of its natural counterpart.

As follows from the above examples, the claimed group of inventions allows to obtain active recombinant α-galactosidase α-PsGal with high yield in a relatively simple and reliable technology.

The claimed invention allows to:

- using producer strain E. coli Rosetta(DE3)/40Gal to obtain active recombinant α-galactosidase α-PsGal;

- the use of the producer strain E. coli Rosetta(DE3)/40Gal allows you to get in the biosynthesis of a large number of full-size recombinant α-galactosidase α-PsGal;

- use metallogeny and gel-filtration chromatography in the purification of the enzyme from an aqueous extract of cells of strain-producer allows you to obtain an enzyme with a purity of more than 98%.

The list of nucleotide and amino acid sequence

<110> Balabanova L.A., Gelatin VA, Bakunina, Stories, VA

<120> Plasmid 40Gal, which determines the synthesis of α-galactosidase α-PsGal, a strain ofE. coliRosetta(DE3)/40Gal - producing strains of recombinant α-galactosidase α-PsGal and the way it was received.

<160> 1

<210> 1

<211> 2156

<212> DNA

<213>Pseudoalteromonassp. KMM 701 VKM B-D

<223> the Nucleotide sequence of the fragment of the plasmid 40Gal containing the restriction sites NcoI and SalI, sequence-specific enteropeptidase, and the sequence of the structural gene of α-PsGal, the corresponding open reading frame for the protein α-PsGal, including the stop codon.

1. Plasmid 40Gal size 8306 base pairs (BP), which determines the synthesis of recombinant α-galactosidase marine bacterium Pseudoalteromonas sp. BKM-D (α-PsGal) and characterized by the presence of the following fragments: NcoI/SalI fragment of plasmid pET-40b(+) (Novagen) and DNA fragment size 2142 BP, containing a chimeric gene consisting of the structural part of the gene of α-PsGal adapted for N-end for expression in E.coli cells, and a nucleotide encoding a specific sequence for enteropeptidase (SEQ ID No. 1).

2. The strain of E.coli Rosetta(DE3), transformed with plasmid 40Gal according to claim 1, producing a chimeric protein containing the amino acid sequence of the recombinant is Oh α-galactosidase α-PsGal and sequence specific enteropeptidase.

3. A method of obtaining a recombinant α-galactosidase α-PsGal, characterized in that the producing strains according to claim 2 incubated in liquid culture medium LB for 12 h at 16°C, and then the bacterial cells precipitated by centrifugation, the suspension of cells disintegrate in the buffer, then the extract was centrifuged, then the supernatant was placed on a column with metallating resin, then elute the protein, then the active fractions are concentrated on ion-exchange resin, incubated with enteropeptidase and produce the target product by gel-filtration.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention describes polynucleotide, expression vector, host cell and production method of humanised antibody together with their use, as well as medical preparation against rheumatoid arthritis, prophylaxis or treatment method of rheumatoid arthritis and use of humanised antibody at production of pharmaceutical preparation for prophylaxis or treatment of rheumatoid arthritis. This invention can be used in therapy of human diseases associated with α9 integrin.

EFFECT: improved activity and thermal stability.

14 cl, 6 dwg, 6 tbl, 11 ex

FIELD: biotechnologies.

SUBSTANCE: expression vector includes: (a) replication origin OriP obtained from Epstein-Barr virus (EBV), where replication origin contains: 1) symmetry element of the second order (DS); and 2) duplication section (FR) that contains fixation point EBNA; (b) replication origin SV40; (c) insertion section for inserting a gene of concern; (d) promoter EF-1b functionally bound to the insertion section; (e) poly-A signal; (f) bacterial replication origin; (g) selected marker; and unnecessarily containing (h) sequence of nucleic acid, which codes constant area of heavy or light chain of antibody, which is functionally bound to the insertion section. With that, replication origin OriP is bound to an initiation factor of replication EBNA 1, which acts from outside and is not coded with an expression vector.

EFFECT: use of an expression vector in an extracted host cell, a set and a method for obtaining recombinant protein provides production of abundant protein expression.

26 cl, 25 dwg, 3 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: invention relates to field of medicine, neurobiology and pharmacokinetics and deals with method of obtaining valid molecular-genetic model of human absence epilepsy. Claimed method consists in the following: parent individuals P with genotype A1/A1 of gene DRD2 are identified by means of genotyping of Taq 1A DRD2 locus in rats of WAG/Rij line, crossed with each other with obtaining offspring F1, which is grown to reproductive age, after that, nonaudiogenic individuals are identified among offspring F1, after which nonaudiogenic individualsof offspringF1 are crossed with each other to obtain offspring F2, which is then also grown to reproductive age with the following selection of nonaudiogenic individuals among them, crossing and selection being performed repeatedly to obtain homogeneous population of nonaudiogenic rats of WAG/Rij line with genotype A1/A1 of gene DRD2, control of "ПВР" type in selected individuals of offspring F1 for further crossing is carried out by means of encephalographic analysis, which includes morphological control.

EFFECT: invention can be used for pre-clinical tests of anti-epileptic medications.

1 dwg, 1 tbl

FIELD: biotechnologies.

SUBSTANCE: invention represents bacterium of Escherichia family, which produces L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. With that, bacterium is modified so that expression of bssR gene in the above bacterium is strengthened. The invention also refers to the method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine using the above bacterium.

EFFECT: invention allows obtaining aminoacids with high efficiency degree.

4 cl, 2 tbl, 14 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. The method involves growth of bacterium of Enterobacteriaceae family, which is modified so that expression of yeel gene in the above bacterium is strengthened, and extraction of the above L-aminoacid from cultural liquid.

EFFECT: invention allows obtaining L-aminoacids with high efficiency degree.

5 cl, 2 tbl, 14 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a method for obtaining L-aminoacid chosen from the group consisting of L-glutamine, L-glutamine acid, L-proline, L-arginine, L-citrulline and L-ornithine. The method involves growth in nutritional medium of bacterium of Escherichia family, which is modified so that expression of ycfR gene in the above bacterium is strengthened, and extraction of the above L-aminoacid from cultural liquid.

EFFECT: invention allows obtaining L-aminoacid with high efficiency degree.

4 cl, 2 dwg, 14 tbl

FIELD: biotechnologies.

SUBSTANCE: invention proposes a production method of a nanosized delivery system of fragments of nucleic acids (FNA) and their analogues to cells of mammals. A suspension of TiO2 nanoparticles with concentration of 1-2 mg/ml in 0.1-0.5 M solution of NaCl is obtained. With that, TiO2 particles have the size of 3-20 nm, and mainly 3-5 nm, and are contained in amorphous or crystalline anatase or brookite form. The obtained TiO2 suspension is mixed with water solution of polylysin with concentration of 20 mg/ml in the ratio of TiO2 to polylysin, which is equal to 1:(0.05-0.8). The mixture is incubated at room temperature during at least 30 minutes. Then, to the obtained suspension of polylysin-containing nanoparticles there added is 5-70 mcL of FNA solution with concentration of 10-4-10-7 M and incubated in 0.1-0.5 M solution of NaCl at room temperature during 20-30 minutes. Nanocomposite TiO2-PL FNA with capacity as per FNA of 0.2-60 nmol/mg is obtained.

EFFECT: invention allows simplifying a production method of FNA delivery system and shortening its duration.

4 cl, 3 dwg, 14 ex

FIELD: biotechnology.

SUBSTANCE: vector plasmids ("docking vectors") are proposed for the synthesis of transgenes (RES), which represent a cloning vector, which is included in the cloning module consisting of four gene joints (GJ 1-4) and three nucleotide sequences (NS 1-3) located between them, where each of GJ comprises from 2 to 4 non-variable rare restriction sites from more than 6 nucleotides, and the nucleotide sequences between GJ include "inserts" which while cloning are replaced in the NS 1 by the promoter module, in the NS 2 by expression module and in NS 3 by 3'-regulatory module. At that, either GJ 1 or GJ 2 independently contain 3-4 non-variable rare restriction sites of more than 6 nucleotides. According to the invention, the variation of connection vector RES is also proposed which is designed for the multiple cloning (MC), and characterised in that at least one of the three NS is the module of multiple cloning with a site of multiple cloning comprising common restriction sites which are unique in the docking vector RES.

EFFECT: improvement of the method.

6 cl, 21 dwg

FIELD: biotechnologies.

SUBSTANCE: invention is a vector for production of a vector for expression in a bacterial cell of a precursor of a target recombinant protein, fused with an N-end peptide, containing a decahistidine cluster and a site of recognition with proteinase, substantially containing of a section of initiation of replication of pBR322 ori; a gene of a repressor of a lactose operon; a bacterial promotor; an area coding the N-end leader peptide, containing a decahistidine cluster and, not necessarily, a site of recognition with proteinase; a section of cloning (polylinker); a section of termination of transcription functioning in the bacterial cell; a fragment coding a non-genome pair toxin-antitoxin, at the same time the gene of antitoxin is oriented so that the direction of its transcription matches the direction of transcription of the target gene; the gene coding the bacterial marker of selection. The invention also relates to a vector for expression in a bacterial cell of a precursor of a target recombinant protein fused with an N-end peptide, a bacterium containing such vector and the method for production of the recombinant protein using the bacterium.

EFFECT: invention makes it possible to produce a new vector with high segregation stability for highly efficient expression of recombinant proteins with a leader N-end peptide fused in the frame, containing a decahistidine cluster and a site of recognition with proteinase.

9 cl, 12 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention is recombinant plasmid DNA pMALTEV-legumain, with molecular weight of 4.78 megadalton and size of 7839 bp, coding a polypeptide having antigenic properties of protein legumain Opisthorchis felineus, and containing a fragment of a vector plasmid pMALTEV, including a Ptac promotor; a lac-operator sequence; a sequence of a gene malE, coding a maltose-binding protein; a combination of terminators of transcription rrnB T1T2 E.coli; a gene of b-lactamase and a section of ori (pBR322) replication initiation; complementary DNA of gene legumain O.felineus without a signal peptide flanked with sites of restriction BamHI and Hindlll; a hybrid promotor Ptac; a lac-operator sequence for amplification of lac-repressor binding; terminators of transcription of gene rrnB E.coli (t1 and t2); as a genetic marker - a gene of B-lactamase (ampR), which determines resistance of E.coli cells transformed with plasmid pMALTEV-legumain to ampicillin antibiotics; a nucleotide sequence, which codes MBP (maltose-binding protein), being a part of a hybrid sequence of a recombinant protein MBP-legumain and making it possible to separate a recombinant polypeptide by methods of affine chromatography; unique sites of endonucleases of restriction, having the following coordinates: BamHI (2668), EcoRI (2675), StuI (2685), Sail (2691), Spel (2704), NotI (2711), Xbal (2725), PstI (2737), Xhol (2740), SphI (2750), Kpnl (2756), Hindlll (2758). The invention also relates to a strain E.coli BL21(DE3)pLysS-pMALTEV-legumain, produced with the help of the recombinant plasmid DNA pMALTEV-legumain, deposited in the collection of microorganism cultures in the Federal Budget Institution of Science State Science Centre of Virusology and Biotechnology "Vector" of Federal Service for Oversight of Consumer Protection and Welfare under the number B-1253. The invention makes it possible to produce a recombinant hybrid polypeptide with antigenic properties of protein legumain O.felineus, providing for high specificity to antibodies of a parasitic infection O.felineus.

EFFECT: high-sensitive test-systems with application of the specified polypeptide.

2 cl, 6 dwg, 5 ex

FIELD: molecular biology.

SUBSTANCE: the suggested innovation deals with the fact that nucleic acids should be isolated directly out of the sample without pipetting stage but with the help of interconnected reservoirs being prepared beforehand. The above-mentioned vessels should be applied either separately or being interconnected according to standard microtitrating format. The sample should be mixed with a lyzing buffer and nucleic acids are bound with matrix in closed system including, at least, two interconnected reservoirs. Forced movement of sample's mixture and buffer back and forth from one reservoir into another one for several times through narrow passage provides their thorough intermixing. The method provides quick and safe isolation of nucleic acids.

EFFECT: higher efficiency.

44 cl, 4 dwg, 1 ex

FIELD: genetic and tissue engineering, biotechnology, medicine, agriculture.

SUBSTANCE: invention relates to the development of simple with constructive relation peptide vector (PGE-κ) consisting of polypeptide sequence of epidermal growth factor (EGF) and modified sequence of signal peptide T-antigen SV-40. New vector PGE-κ is able to provide the selective delivery of genetic material in target-cell cytoplasm carrying external receptors to EGF and the following its transport across nuclear membrane. Also, invention proposes a method for preparing peptide vector PGE-κ involving its expression as a fused protein "mutant thioredoxine-linker-vector" and cleavage of product expressed in E. coli in the linker region with specific protease. Invention provides preparing the recombinant strain E. coli B-8389 VKPM as a producer of the fused protein comprising PGE-κ. Proposed vector shows simple structure, absence of toxicity and immunogenicity and these properties provide its usefulness for the directed genetic modification of epithelial, embryonic and tumor cells in vivo.

EFFECT: improved preparing method, valuable medicinal properties of vector, improved genetic modification.

7 cl, 12 dwg, 4 tbl, 16 ex

FIELD: genetic engineering, medicine.

SUBSTANCE: invention relates to T-cell receptor sequence being detected in patients with extended sclerosis and is useful in diagnosis and therapy. Oligonucleotide including sequence which represents or is derived from 5'-CTAGGGCGGGCGGGACTCACCTAC-3' or nucleotide sequence being fully complementary thereto. Oligonucleotide together with nuclear acid including nearly 15-30 oligonucleotides, which doesn't comprise oligonucleotide sequence and presents in region from Vβ to Jβ of Vβ13.1 gene in T-cell Vβ13.1-subgroup, wherein oligonucleotide and nuclear acid sequences don't present in the same chain of pair sequences of Vβ13.1 gene, is used in Vβ13.1 gene part amplification. In method for detection of LGRAGLTY motive, which is present in T-cell receptors of T-cell Vβ13.1-subgroup, oligonucleotide is used in combination with labeling particle. Once LGRAGLTY motive is detected, development monitoring and treatment are carried out by removing of LGRAGLTY motive-containing peptide.

EFFECT: simplified methods for detection of LGRAGLTY motive in T-cell receptors and treatment of patients with extended sclerosis.

21 cl, 7 dwg, 3 tbl, 3 ex

FIELD: biotechnology, in particular virulent genes and proteins.

SUBSTANCE: peptide with Neisseria meningitidis antigen activity and polynucleotide encoding the same are used in preparation of drug for prevention or treatment of diseases and conditions associated with Neisseria or gram-positive infections. Antibodies is obtained by using disclosed peptide. Vaccines for prevention or treatment of diseases and conditions associated with Neisseria meningitides contain attenuated mutant strain of Neisseria meningitides having gene mutation, insertion or deletion which disturbs expression of certain nucleotide sequence.

EFFECT: method for prevention or treatment of Neisseria infection with increased effectiveness.

13 cl, 1 tbl

FIELD: genetic engineering, agriculture.

SUBSTANCE: invention relates to a method for preparing transgenic plants. Method involves selection of the strain of the required plant, preparing mother plants and carrying out the multiplication of the vegetable material for preparing leaf explants. Then method involves making a vector for transfer of genetic material expressing the end protein that enhances resistance of plants against phytopathogens followed by the agrobacterial transformation of explants with agrobacterium Agrobacterium tumifaciens and the following selection of transgenic tissue and multiplication of transformants. At the transformation stage method involves stage-by-stage co-cultivation of explants with steps amount taken in the range from 2 to 5 and wherein leaf disks with the ratio of cut length to the area disk is in the range 0.1-0.2 mm/mm2 are used as explants. Invention provides preparing transgenic plants showing the enhanced resistance against phytopathogens and also to enhance frequency of the transient expression, frequency in formation of transgenic tissues, frequency in regeneration of transgenic sprouts, part of direct transformants and to reduce frequency of somaclonal alterations.

EFFECT: improved preparing method, valuable properties of transgenic plants.

5 cl, 9 dwg, 12 tbl, 16 ex

FIELD: biotechnology, biochemistry, amino acids.

SUBSTANCE: invention describes a polynucleotide showing activity of glucose-6-phosphate isomerase and comprising polynucleotide sequence taken among the group including: a) polynucleotide encoding polypeptide that comprises amino acid sequence identical at least by 90% with amino acid sequence represented in SEQ ID NO:2; b) polynucleotide that is complementary with polynucleotides given in sub-paragraph a). Also, invention describes a method for enhancing the metabolism intensity in pentose phosphate cycle by attenuation of pgi gene and a method for preparing L-amino acids. Invention provides preparing L-amino acids with the high effectiveness degree.

EFFECT: improved preparing method, valuable properties of polynucleotide.

16 cl, 7 dwg, 3 tbl, 6 ex

FIELD: biotechnology.

SUBSTANCE: invention describes recombinant host-cells comprising a chimerical gene involving the heterologous promoter sequence associated functionally with nucleic acid that encodes at least one polypeptide implicated in biosynthesis of epotilons, or polypeptide expressed by recombinant way and implicated in biosynthesis of epotilons, and Bac clones also. Using the invention provides to realize a method for preparing epotilons with high degree of effectiveness.

EFFECT: valuable properties of host-cell.

9 cl, 6 tbl, 15 ex

FIELD: biotechnology, microbiology, biochemistry, molecular biology.

SUBSTANCE: for preparing l-lysine method involves carrying out fermentation with using corynebacterium strain producing L-lysine wherein polynucleotide comprising the polynucleotide sequence encoding the component H of phosphotransferase system is enhanced. Prepared L-lysine is isolated. The claimed invention provides enhancing the effectiveness of synthesis of L-lysine by corynebacteria.

EFFECT: valuable properties of strain, enhanced effectiveness of amino acid synthesis.

16 cl, 3 dwg, 1 tbl, 5 ex

FIELD: biotechnology, biochemistry.

SUBSTANCE: invention represents enzyme glycosyl hydrolase (variants) produced by hyphamycetes, in particular, by Chrysosporium lucknowense and nucleic acid construction for expression of glycosyl hydrolase also. Invention provides preparing glycosyl hydrolase by culturing fungus Chrysosporium under optimal conditions providing expression and isolation of enzyme with high degree of effectiveness.

EFFECT: valuable biological and biochemical properties of sequences.

19 cl, 2 dwg, 4 tbl, 1 ex

FIELD: molecular biology, agriculture.

SUBSTANCE: invention relates to a method for determination of plants sex at seedling stage used in selection of hop. Sex of hybrid hop plants is determined by method of molecular marking wherein two combinations of oligonucleotide primers are used for carrying out polymerase chain reaction that provide amplification of DNA fragments specific for male plants. Invention enhances effectiveness of selection and allows decreasing consumptions of labor, agents, squares and time.

EFFECT: improved marking method.

3 dwg, 1 tbl

Up!