Plasmid for expression in cells of bacterium belonging to escherichia class, non-active predecessor of dnase i of human or its muteins; bacterium belonging to escherichia class, - producer of non-active predecessor of recombinant dnase i of human or its mutein; predecessor of recombinant dnase i of human or its mutein; method for obtaining recombinant dnase i of human or its mutein; method for obtaining conjugates of polyethylene glycol and recombinant mutein of human dnase i, fermentative active conjugate of mutein of recombinant dnase i of human

FIELD: biotechnologies.

SUBSTANCE: invention represents a method for obtaining recombinant DNAse I of a human or its mutein, as well as their conjugates with polyethylene glycol, using a bacterium belonging to Escherichia class, transformed with expression plasmid, containing a promoter functioning in a bacterial cell, DNA fragment coding a hexahistidine cluster, a fragment coding enterokinase recognition sequence amalgamated in frame with human DNAse I or its functionally active mutein containing replacements of asparagine with cysteine, transcription termination section, vector pET28a(+) fragment containing initiation section of replication of bacteriophage fl, sequence coding aminoglycoside-3'-phosphotransferase, area of beginning of plasmid pBR322 replication, gene RNA-organising protein Rop, sequence coding lactose operon repressor.

EFFECT: invention allows obtaining recombinant human DNAse I or its mutein with high yield.

18 cl, 7 dwg, 1 tbl, 12 ex

 

The technical field

The invention relates to the field of biotechnology, in particular to the technology of biologically active substances (BAS) by means of genetic engineering, more specifically to methods of obtaining deoxyribonuclease I man.

The prior art.

Desoksiribonukleaza I (synonyms of Tnkase I, Pancreatic desoksiribonukleaza, Deoxyribonuclease I, DNase has I, cipher international classification of Enzymes EC 3.1.21.1) human - natural extracellular enzyme produced by the pancreas and salivary glands. The maximum concentration found in the intestine, where digestion of DNA present in food. Low concentrations of Gnkazy I found in the serum of healthy people. Tnkase I man is a glycoprotein containing 260 amino acids with a molecular mass of 33000-38000 daltons. The enzyme homologous DNase I bull, their amino acid composition identical to 77%. Spatial structure Gnkazy bull was defined in [Suck, D., C. Oefner, et al. (1984). "Three-dimensional structure of bovine pancreatic DNase has I at 2.5 A resolution." EMBO J 3(10): 2423-2430; Suck, D. and C. Oefner (1986). "Structure of DNase has I at 2.0 A resolution suggests a mechanism for binding to and cutting of the DNA." Nature 321(6070): 620-625.].

The main source of Gnkazy I for scientific research and the pharmaceutical industry was cattle. The process of separation and chromatographic purification of Gnkazy I described in [Funakoshi, A., Y. Tsubota, et al. (1980). "Simple purificaton and properties of bovine pancreatic deoxyribonuclease I. J Biochem 88(4): 1113-1118.; Paudel, H.K. and T.H. Liao (1986). "Comparison of the three primary structures of deoxyribonuclease isolated from bovine, ovine, and porcine pancreas. Derivation of the amino acid sequence of ovine DNase has and revision of the previously published amino acid sequence of bovine DNase has." J Biol Chem 261(34): 16012-16017.; Nefsky, C. and A. Bretscher (1989). "Preparation of immobilized monomeric actin and its use in the isolation of protease-free and ribonuclease-free pancreatic deoxyribonuclease I. Eur J Biochem 179(1): 215-219.].

The problem of using the pancreas of the ox as a source of raw materials to highlight Gnkazy I is that in this tissue contains a complex mixture of proteases, which complicates the selection, and, in addition, there is the possibility of contamination of the drug prions, and viruses of animals.

In vitro studies it was found that Tnkase can reduce the viscosity of purulent secrets lung [Armstrong, J.. and J.. White (1950). "Liquefaction of viscous purulent exudates by deoxyribonuclease." Lancet 2(6641): 739-742; Chemick, W.S., G.J. Barbero, et al. (1961). "In-vitro evaluation of the effect of enzymes on tracheobronchial secretions from patients withcystic fibrosis." Pediatrics 27: 589-596].

Bovine pancreatic Tnkase I (dornase) was approved for clinical use in the United States in 1958 as a mucolytic agent inhalation and parenteral use, however, because of the numerous side effects came from medical use. Probable cause side effects was the contamination of the drug other digestive pancreatic enzymes bull (it contains up to 2% trypsin and chymotrypsin) [Lieberman, J. (1962). "Enzymatic dissolution of pulmonary secretions.An in vitro study of will excrete sputum from patients with cystic fibrosis of the pancreas." Am J Dis Child 104: 342-348].

The obvious replacement drugs Gnkazy I bull is a high-purity recombinant of Tnkase I man.

Tnkase person I was isolated and partially purified from the pancreas [Funakoshi, A., Y. Tsubota, et al. (1977). "Purification and properties of human pancreatic deoxyribonuclease I. J Biochem 82(6): 1771-1777], duodenal juice, whey [Love, J.D. and R.R. Hewitt (1979). "The relationship between human serum and human pancreatic DNase has I. J Biol Chem 254(24): 12588-12594] and urine [Murai, K., M. Yamanaka, et al. (1978). "Purification and properties of deoxyribonuclease from human urine." Biochim Biophys Acta 517(1): 186-194]. It was found that N-terminal amino acid of the Mature protein is leucine [Ito, K., Minamiura, N., et al. (1984). "Human urine DNase has I: immunological identity with human pancreatic DNase has I, and enzymic and proteochemical properties of the enzyme." J Biochem 95(5): 1399-1406].

Gene human Gnkazy was isolated from a library of pancreatic cDNA using oligonucleotide probes. Was allocated clone of the full-size cDNA consisting of 1039 base pairs. It was revealed that it contains a single long open reading frame encoding a polypeptide of 260 amino acids, vysokomolochnye bull DNase I. expression of this cDNA in human cells And 293 was obtained active enzyme [Shak, S., D.J. Capon, et al. (1990). "Recombinant human DNase has I reduces the viscosity of cystic fibrosis will excrete sputum." Proc Natl Acad Sci USA 87(23): 9188-9192].

Industrial suitable expression system Gnkazy I person (Rodney), described in U.S. patent 7297526 based on the use of multiwire the number of cells of the Chinese hamster ovary (Cho-DP7), containing multiple copies of the transgene Rodney under the control of the early promoter of cytomegalovirus. This system allows to obtain Cankuzo in large quantities and is used in industrial production of a medicinal product Rodney "Dornase alpha, but at the same time, culturing cells SNO requires the use of expensive culture medium and complex purification system product, including the stage of the virus-inactivation.

Potentially more cost-effective suitable industrial systems gene expression Rodney are based on the use of the yeast S. cerevisae or P. pastoris or bacteria E. coli. Gene expression Rodney in yeast expression systems leads to N-glycosylated form of the protein (U.S. patent 7118901), expression in E. coli the emergence deglycosylation form. The specific enzymatic activity Rodney in both cases the same. Because the structure of N-linked glycans produced by yeast, is significantly different from that for a person and N-glikana immunogenic yeast to mammals, expressed in yeast systems rognosa unsuitable for medical use. Thus, among all systems of expression in microorganisms, the expression system Rodney in the cells of E. coli are better suited to obtain the pharmaceutically privatmoreprodukt.

There are a number of producing enzymatically active Gnkazy I ox in a bacterial system, but the possibility of increased gene expression of this protein is limited due to the toxicity of the product for cell-producers. Unlike eukaryotes, in which the processes of transcription and translation take place in different cellular compartments, the cell E. coli these processes involve. The presence of active Gnkazy in the cytoplasm leads to the degradation of genomic DNA and subsequent lysis of bacterial cells, therefore, increased expression of Gnkazy inevitably leads to genetic instability clone, i.e. the selection of superproducers is also a selection of the most genetically unstable bacteria. So, in [Worrall, A.F. and VA Cormolly (1990). "The chemical synthesis of a gene coding for bovine pancreatic DNase has I and its cloning and expression in Escherichia coli," J Biol Chem 265(35): 21889-21895] expressed active Tnkase bull in the system E. coli using a synthetic gene with optimized codon and promoter of the late genes of the phage lambda pL. It is shown that the expression product had toxic to cells of the producer strain, therefore, the yield of the target protein was in the range from 100 μg to 1 mg/l culture. The activity of the expressed enzyme was comparable with the activity of native enzyme bull. However, the activity values given by the authors (5×108U/g of protein)were measured DL is not completely cleared of the drug. In [Chen, SU, S. .Lu, et al. (1998). "Cloning, sequencing and expression of a cDNA encoding bovine pancreatic deoxyribonuclease I in Escherichia coli: purification and characterization of the recombinant enzyme." Gene 206(2): 181-184] expressed natural cDNA bull in the system E. coli strain BL21(DE3)pLysE. However, the expression level remained low, as the product was toxic to bacteria. Cells were visualized after induction, the enzyme was detected in culture medium and in the cells. According to the authors, induced culture gave 3500 U/L. the Activity of a selected enzyme was 908 U/mg, which is comparable with the control dimension is the same method the activity of the natural enzyme, identified by the authors in parallel from the tissues of the bull (938 U/mg). Thus, the estimated productivity of this method is about 4 mg/l of culture.

A somewhat higher level of expression of deoxyribonuclease I bull was achieved by using the transformation strain JM109 cells of E. coli with plasmid pHEL12 carrying the gene Gnkazy I under the control of T7 promoter and subsequent infection by culture of the cells with bacteriophage M13/T7 simultaneous induction of expression of a target gene using IPTG [Linardou, H., A.A. Epenetos, et al. (2000). "A recombinant cytotoxic chimera based on the mammalian deoxyribonuclease I. Int J Cancer 86(4): 561-569]. A significant limitation of this method is the necessity of infection of the working culture of the bacteriophage, because industrial cultivation the eyes of the TKA equipment from bacteriophage almost impossible.

Detailed description of the present invention

The technical problem solved by the authors, was the creation of technology for the enzymatic active recombinant Gnkazy I person with a higher output.

The technical result is achieved by creating technology that includes a new expression plasmid DNA encoding optimized for expression in a bacterial system gene Gnkazy I, the man, the establishment of producer strain E. coli based on it, and technology selection and modification of Gnkazy I.

The basis of this solution are developed by the authors expression plasmids pET28EK-DNASEI, pET28EK-DNASEIC18 and pET28EK-DNASEIC106 length 6091 BP, containing a DNA fragment comprising a sequence encoding a synthetic ottsepleny leader N-terminal peptide with a length of 19 amino acids, including exegetically cluster and sequence recognition of enterokinase, and merged with it in a frame sequence, encoding Tnkase I man or mutiny [N18C] or [N106C], respectively. The specified fragment contains optimal for E. coli codons, allowing to increase the level of expression of a heterologous protein due to the efficient broadcast of all amino acids of the polypeptide. The presence of a leader peptide inhibits the enzymatic activity of Gnkazy I, which reduces the toxicity of the product expression for bacteria, which leads to a significant increase in the yield of the target protein.

The aim of the present invention is the provision of the expression plasmid containing the DNA fragment encoding the precursor recombinant Gnkazy I man or mutein comprising a sequence encoding ottsepleny N-terminal leader, including exegetically cluster and sequence recognition of enterokinase, fused in frame with the sequence encoding Tnkase I person under the control of a promoter functional in a bacterial cell.

Another objective of the present invention is the provision of the above-described expression plasmids, where this plasmid selected from the group consisting of plasmids pET28EK-DNASEI, pET28EK-DNASEIC18 and pET28EK-DNASEIC106.

Also the aim of the present invention is to provide a bacterium belonging to the genus Escherichia, transformed the previously described plasmid, producer of precursor recombinant Gnkazy I man or mutein.

Another objective of the present invention is the provision of the above bacteria, where this bacterium is represented by strains of E. coli BL21[DE3]/pET28EK-DNASEI, E. coli BL21[DE3]/pET28EK-DNASEI18 and E. coli BL21[DE3]/pET28EK-DNASEI106.

Also the aim of the present invention is the provision of precursor recombinant Gnkazy I man or mutein containing ottsepleny N-terminal leader, including exegetically Klah is Ter, and the sequence of recognition of enterokinase.

Also the aim of the present invention is the provision described above mutein Gnkazy I with lutein contains point replacement N18C or N106C.

Another objective of the present invention is the provision of a method of obtaining a recombinant Gnkazy I man or mutein, comprising culturing the above-described bacteria in a nutrient medium, the selection of Taurus include, solubilization of protein predecessor metallochemistry chromatography under denaturing conditions, the protein refolding predecessor, obtaining Mature protein treatment enterokinase and secretion of the Mature protein.

Also the aim of the present invention is the provision of the above-described method, in which the cultivated strain of E. coli BL21[DE3]/pET28EK-DNASEI, E. coli BL21[DE3]/pET28EK-DNASEI18 or E. coli BL21[DE3]/pET28EK-DNASEI106.

Also the aim of the present invention is the provision of the described method, in which mutein contains point replacement N18C or N106C.

Another objective of the present invention is the provision of a method of obtaining conjugates of polyethylene glycol and recombinant deoxyribonuclease I man or mutein, including preliminary limited recovery of proteins, incubation with maleimide-polyethylene glycol and the allocation of the obtained conjugates.

Also the aim of us is Vashego of the invention is the provision of the described method, in which mutein contains point replacement N18C or N106C.

Another objective of the present invention is the provision of a conjugate of polyethylene glycol and recombinant deoxyribonuclease I man or mutein obtained as described above.

Detailed description of the present invention

For the implementation of the present invention, the main technical challenge was to create a method of producing recombinant Gnkazy I man or mutein and their conjugates with polyethylene glycol, using bacteria, transformed with the expression plasmid containing the DNA fragment encoding the precursor recombinant Gnkazy I man or mutein comprising a sequence encoding ottsepleny N-terminal leader, including exegetically cluster and sequence recognition of enterokinase, and merged with it in a frame sequence, encoding Tnkase I person under the control of a promoter functional in a bacterial cell.

The term "expression plasmid" means a plasmid DNA containing all of the necessary genetic elements for expression of the introduced gene in him, such as promoter, terminator. A concrete example of the genetic elements necessary for expression of the precursor recombinant Gnkazy I men in expressi is authorized cassettes, according to the present invention is, but not limited to, the promoter is an RNA polymerase of bacteriophage T7.

The DNA fragment coding for the precursor recombinant Gnkazy I man, according to the present invention is, for example, a synthetic gene encoding the precursor recombinant Gnkazy I man or mutein comprising a sequence encoding ottsepleny N-terminal leader, including exegetically cluster, and the sequence of recognition of enterokinase, fused in frame with the sequence encoding Tnkase I person. The specified DNA fragment can be obtained by PCR (see Example 1, Fig 1). Also mentioned DNA fragment can be obtained using cloning technology company Sloning BioTechnology, described in PCT application WO 2005071077.

To ensure effective translation of the cloned gene in E. coli, preferably in the sequence that encodes the precursor of Gnkazy I man, all rare codons were replaced by synonymous frequent codons and frequent codons were distributed evenly in the sequence, in accordance with the frequency of codons expressed genes of E. coli.

The sequence of the gene encoding the precursor recombinant Gnkazy I man, according to the present invention, the notion is in the sequence Listing under the number SEQ ID NO:1. Amino acid sequence of the precursor recombinant Gnkazy I man according to the present invention are presented in the sequence Listing under the number SEQ ID NO:2. Amino acid sequence of the Mature recombinant Gnkazy person I is a sequence number SEQ ID NO:2 without 19 the first amino acid.

DNA fragments that encode essentially the same protein can be obtained, for example, by modifying the nucleotide sequence of the DNA fragment (SEQ ID NO:1)encoding the precursor recombinant Gnkazy I person, for example, using the method of site-directed mutagenesis, so that one or more amino acid residues at a specific site will be delegated, substituted, inserted or added. The DNA fragments, modified as described above, can be obtained using traditional processing methods with the aim of obtaining mutations. DNA fragments that encode essentially the same protein can be obtained by expression of the DNA fragments having the mutation described above, in the appropriate box.

Tnkase I (pancreatic desoksiribonukleaza I) is an endonuclease, gidrolizuemye both single-and double-stranded DNA with the formation of a complex mixture of mono - and oligonucleotides containing 5'-phosphate group.

The term m is theine" means the mutant protein or protein, encoded by the mutant gene. The preferred muteena Gnkazy I according to the present invention is a mutant Tnkase I, containing the replacement of one or several amino acids by cysteine. The presence of an additional cysteine residue in malinovich variation Gnkazy I person allows the directed modification of polyethylene glycol with obtaining conjugates in enzyme highly active form.

Indicators of functional activity, in which it is considered that the resulting protein has properties Gnkazy I man, identified by its ability to hydrolyze both single-and double-stranded DNA fragments. For example, the activity of Gnkazy I person can be detected by the method of demografie as described in Example 10. It is believed that the variant protein has properties predecessor Gnkazy I person, provided that the activity specified option is not less than 1% activity of native Gnkazy I man.

The expression plasmid according to the present invention contains a DNA fragment encoding the precursor recombinant Gnkazy I man or mutein comprising a sequence encoding ottsepleny N-terminal leader, including exegetically cluster, and the sequence of recognition of enterokinase, fused in frame with the sequence encoding Tnkase I people the century, under the control of a promoter functional in a bacterial cell.

As recombinant plasmids according to the present invention may be used various plasmids, capable of expression in a cell of the recipient, such as plasmids pBR322, pMW119, pUC19, pET22b, pET28b and the like, but the list of plasmids is not limited to them.

Concrete option implementation of the present invention are plasmids, which consist of:

1) fragment NheI-NcoI length 29 BP, representing a synthetic adapter encoding exegetically the cluster.

2) fragment NcoI-HindIII vector rate(+) length 5246 BP, containing the region of the beginning of replication of plasmids pBR322, gene RNA-organizing protein Rop, the site of initiation of replication of bacteriophage f1, sequence, encoding an aminoglycoside-3'-phosphotransferase, the promoter is an RNA polymerase of bacteriophage T7; plot termination of transcription; the sequence encoding the repressor of Lac operon;

3) slice NheI-HindIII length of 816 BP encoding Tnkase I man or mutiny [N18C] or [N106C] and fused in frame sequence recognition by enterokinase.

These plasmids contain a unique recognition sites of the restriction endonucleases: NheI (1), ApaI (1068), PciI (2958), HindIII (5276).

Patterns corresponding plasmids pET28EK-DNASEI, pET28EK-DNASEIC18, pET28EK-DNASEIC106 shown in Figure 2, 3 is 4.

Using a plasmid can be transformed bacterial cell, preferably a bacterium belonging to the genus Escherichia, receptive to such transformation specified by the plasmid. The choice of a particular cell is not critical, because the methodology and methods of transformation are well known to the person skilled in the art. Although depending on the type of cells and culture conditions the received transformant the level of expression of the precursor of Gnkazy I person may vary, the fact that expression of the target protein will be subject to the successful transformation of the cells of the recipient.

"Transforming cells with plasmid" means the introduction of plasmids into the cell using methods well known to the person skilled in the art. Transformation of this plasmid leads to expression of the gene encoding the protein according to the present invention, and protein synthesis in the bacterial cell. Methods of transformation include any of the standard methods known to a person skilled in the technical field, for example the method described in Jac A. Nickoloff, Electroporation Protocols for Microorganisms (Methods in Molecular Biology) // Humana Press; 1st edition (August 15, 1995).

According to the present invention, the bacterial cell producing predecessor Gnkazy I person" means a bacterial cell that is capable of production, however, is to improve predecessor Gnkazy I man according to the present invention, when the bacterial cell according to the present invention are grown in a specified medium. Used herein, the term "bacterial cell producing predecessor Gnkazy I person" means a cell which is capable of accumulating producer predecessor Gnkazy I person in an amount not less than 1 mg/l, more preferably not less than 30 mg/l Specified predecessor Gnkazy I person accumulates in a specified cell is preferably in the form of Taurus enabled.

Preferably using bacteria belonging to the genus Escherichia, for transformation with recombinant plasmid containing the DNA fragment encoding the precursor of Gnkazy I man.

The term "bacterium belonging to the genus Escherichia can mean that the bacterium belongs to the genus Escherichia according to the classification known to a specialist in the field of Microbiology. As examples of the microorganism belonging to the genus Escherichia can be mentioned Escherichia coli (E. coli).

The range of bacteria belonging to the genus Escherichia, is not limited in any way, however, for example, bacteria, described in the book Neidhardt, F.C. et al. (Escherichia coli and Salmonella typhimurium, American Society for Microbiology, Washington D.C., 1208, table 1), can be given as examples.

A concrete example of the strain of the recipient to obtain producer predecessor is Ncasi I man according to the present invention is, but are not limited to, Escherichia coli strain BL21[DE3].

The Escherichia coli strain BL21[DE3] is characterized by the following cultural-morphological, physiological and biochemical characteristics and genetic traits.

Cultural and morphological characteristics of strain: gram-negative rods to form filaments; on agar medium - large whitish colonies with rough edges. The activity of the strain is determined using densitometry of electrophoregram. The strain is stored in the following conditions: the environment Lurie-Bertrand, 1% glucose, 10% glycerol. Strain propagated in the following conditions - environment Lurie-Bertrand, 1% glucose, kanamycin sulfate 30 mg/ml

Genetic strain. The genotype of strain - F-ompT gal dcm lon hsdSB(rB-mB-)λ(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]).

Transformation of Escherichia coli strain BL21[DE3] plasmids Retek-DNASEI, pET28EK-DNASEIC18, pET28EK-DNASEIC106 leads to the production of producer strains BL21[DE3]/pET28EK-DNASEI, BL21[DE3]/pET28EK-DNASEI18C, BL21[DE3]/pET28EK-DNASEI106C, respectively, which provided a synthesis of the recombinant protein predecessor Gnkazy I person in the amount of 15-40% of the total protein content of the cells.

The Escherichia coli strain BL21[DE3]/pET28EK-DNASEI encodes a hybrid protein precursor LEK-DNASEI consisting of the amino acid sequence Gnkazy I man and fused in frame N-terminal leader peptide length 19 amino is the slot, containing sntihistamine cluster and the site of cleavage by enterokinase preceding the first amino acid Gnkazy I man.

The Escherichia coli strain BL21[DE3]/pET28EK-DNASEI18C encodes a hybrid protein precursor LEK-DNASEI[N18C]consisting of the amino acid sequence mutein Gnkazy I [N18C] and fused in frame N-terminal leader peptide with a length of 19 amino acids, containing sntihistamine cluster and the site of cleavage by enterokinase preceding the first amino acid mutein Gnkazy I man.

The Escherichia coli strain BL21[DE3]/pET28EK-DNASEI106C encodes a hybrid protein precursor LEK-DNASEI[N106C]consisting of the amino acid sequence mutein Gnkazy I [N106C] and fused in frame N-terminal leader peptide with a length of 19 amino acids, containing sntihistamine cluster and the site of cleavage by enterokinase preceding the first amino acid mutein Gnkazy I man.

The method of obtaining Gnkazy I man or mutein according to the present invention includes culturing the above-described bacteria in a nutrient medium suitable for the cultivation of these prokaryotic cells, the selection of Taurus include, solubilization of protein predecessor metallochemistry chromatography under denaturing conditions, the protein refolding the previous is nick, getting Mature protein treatment enterokinase and allocation specified Mature protein recombinant Gnkazy I man or mutein.

Covalent modification by attaching to a protein molecule of the polymer with a specific structure allows you to create preparations with prolonged action, i.e. to overcome several shortcomings of protein-based drugs, which include: lack of stability in vitro and in vivo), instability to the action of proteases (especially peptides), short half-life/half-life when injected into the body (minutes), immunogenicity and antigenicity, the presence of side effects with long-term clinical application [Abuchowski, A.; McCoy, J.R.; Palczuk, N..; van Es, T.; Davis, F.F. (1977), "Effect of covalent attachment of polyethylene glycol on immunogenicity and circulating life of bovine liver catalase". Journal of Biological Chemistry 252 (II): 3582-3586]. Change the pharmacodynamics of the drug method Paglierani used in the production of a series approved for clinical use of drugs, for example, granulocyte colony stimulating factor (g-CSF), interferon beta and other

Therefore, the scope of the present invention also includes a method of obtaining conjugates of polyethylene glycol and recombinant Gnkazy I man or mutein according to the present invention, including preliminary limited recovery Gnkazy I human the and or mutein according to the present invention, incubation with maleimide-polyethylene glycol and the allocation of the obtained conjugates.

Also in the scope of the present invention includes a conjugate of polyethylene glycol and recombinant Gnkazy I man or mutein obtained as described above.

Using the above method allows the synthesis and production of conjugates of Malinov recombinant Gnkazy I person with polyethylene glycol according to the present invention with an activity of at least 10% activity of native Gnkazy I man or a bull.

Features of plasmids and the results of their practical application are given in the following Figures.

Brief description of Figures:

The Figure 1 shows a diagram of the Assembly of the synthetic gene Gnkazy I man of the oligonucleotide primers and the scheme of obtaining expression plasmids Retek-DNASEI, pET28EK-DNASEIC18, pET28EK-DNASEIC106.

The Figure 2 shows a map of the expression plasmid pET28EK-DNASEI. The following symbols are used: "pBR322ori scope the beginning of replication of plasmids pBR322; "ROP" - gene RNA-organizing protein Rop; f1 ori" - the site of initiation of replication of bacteriophage f1; "KanR2" sequence encoding an aminoglycoside-3'-phosphotransferase providing bacterial resistance to kanamycin; "T7 prom" - promoter RNA polymerase of bacteriophage T7; "T7term - the area of termination of transcription; "lacI" - the sequence encoding repressor lactose operon; "LEK-DNASEI" - open reading frame (ORF) of the polypeptide protein predecessor Gnkazy I person, includes detachable N-terminal additional peptide "LEK" and Mature Tnkase I man "DNASEI". Arrows indicate the directions of transcription of the genes. Identifies the recognition sites of restriction endonucleases in parentheses are the numbers of nucleotides at the point of cutting. "N18", "N106" - the triplets of nucleotides corresponding to the sites of N-glycosylation of natural Gnkazy I man.

The Figure 3 shows a map of the expression plasmid pET28EK-DNASEI18C. Use similarly to Figure 2, and also: "LEK-DNASEI[N18C]" is an open reading frame (ORF) of the polypeptide protein precursor mutein Gnkazy I [N18C].

The Figure 4 shows the map of the expression plasmid pET28EK-DNASEI106C. Use similarly to Figure 2, and also: "LEK-DNASEI[N106C]" is an open reading frame (ORF) of the polypeptide protein precursor mutein Gnkazy I [N106C].

The Figure 5 shows electrophoregrams total protein in the cells of the producer strain BL21[DE3]/pET28EK-DNASEI at induction. LTO-SDS page analysis of the cultures of the producer strain, obtained from three randomly selected colonies. Symbols "-" and "+" - sample before induction and after 2 h after induction cultures 1 mm IPTG. "M" is the molecular mass marker. The molecular weight marker bands are indicated in kDa. The position of the target b is the left main coronary artery is indicated by the arrow.

The Figure 6 shows electrophoregrams protein fractions during purification, renaturation and processing protein precursor recombinant Gnkazy I person. Legend: "IB" - solubilization bullock enable, "FF" is the fraction of leakage through metallochemistry column, "20"-"500" - faction stepwise elution increasing imidazole concentrations, in mm; "E" represents the fraction of the eluate when washing the column EDTA, REF - soluble protein after refolding, "EC" - the reaction mixture after 2 h splitting enterokinase. The track "REF" and "EK" - electrophoresis in non conditions, the remaining lanes in reducing. The position of protein-predecessor arrow.

The Figure 7 shows zymograms protein predecessor Gnkazy I. Color bromide by ethidium. The location of the tracks: "[M-1]DNASEI" - recombinant Tnkase I person with additional N-terminal methionine residue, "LEK-DNASEI" - the precursor protein of Gnkazy I man, "bDNAse I" - natural Tnkase I ox, M - prekrashenii marker of molecular masses. The number printed on the corresponding tracks of the proteins indicated in ng, the position of protein-predecessor Gnkazy I person indicated by the arrow. Enzymatic activity is proportional to the size of the dark area on a light background - the land degradation immobilized in polyacrylamide gel double-stranded DNA.

This izobreteny is described in more detail below with reference to the following not limiting the present invention to the Examples.

Example 1. Plasmid DNA isolation PAT-EK-DNASEI, coding predecessor Gnkazy I person with detachable N-terminal peptide

For the known amino acid sequence Gnkazy I man with an added N-terminal leader peptide (SEQ ID NO:3)containing the sequence recognition by enterokinase was held back translation into a sequence of DNA nucleotides. If this were used codons optimal for the expression of this gene in E. coli class, and was also optimized the structure of the gene on secondary structure of mRNA, GC composition, provided no unwanted regulatory elements (e.g., lack of internal binding sites of the ribosome), and the absence of long repeats, palindromes.

The index CAI (Codon Adaptation Index), reflecting the efficiency of gene expression in this organism, the resulting sequence was 0.8, which is a good prognostic indicator for industrial suitability obtained on the basis of the producer strain. The obtained nucleotide sequence shown in SEQ ID NO:4.

A synthetic gene encoding the polypeptide Gnkazy I man, was obtained by polymerase chain reaction using the synthetic oligonucleotides shown in table 1, the device Terzic MC2 (DNA-Technology, Russia).

Preparing incubation mixture of the following composition: 1x buffer for thermostable DNA polymerase; 10 PM of each primer, 2 mm of each deoxyribonucleotide; 1-2 units of thermostable DNA polymerase in a volume of 50 μl. On top of this mixture was layered with 50 μl of light mineral oil and amplification were according to the scheme: 1 cycle of denaturation - 94°C, 3 min; 25 cycles of denaturation 94°C, 30 sec, annealing 55°C for 30 sec, extension 72°C, 45 to 60 sec; 1 cycle - extension 72°C, 7 minutes

The PCR product was isolated from 1% agarose gel using a set of "Wizard SV Gel and PCR Clean-Up System (Promega, USA) according to the manufacturer's Protocol and ligated into vector plasmid PAL-TA (CJSC "Evrogen, Russia) using DNA ligase of phage T4 and standard buffer solution (Fermentas, Lithuania). Received ligase mixture was used to transform cells of E. coli strain DH5α, with genotype F - φ80lacZΔM15 Δ(lacZYA-argF) U169 recA1 endA1 hsdR17 (rk-, mk+) phoA supE44 λ-thi-1 gyrA96 relA1. To do this, 200 µl frozen suspensions of E. coli cells were added to 5 μl of ligase mixture, incubated on ice for 30 min, heated to 42 To 45 seconds and incubated on ice for 5 minutes, then add 800 ál of nutrient broth, SOB, incubated at 37°C for 60 minutes, then the suspension was transferred to a Petri dish containing solid agar medium containing ampicillin at a concentration of 100 μg/ml of agar and placed in a thermostat at 37°C for 18 hours. Colonies of E. coli, selected by blue-white screening, were analyzed by PCR from clones using Primero is the sequence recipient plasmids M13rev (SEQ ID NO:19) and M13dir (SEQ ID NO:20). 5 selected clones was increased in 5 ml of nutrient broth 2xYT-Amp and was isolated plasmid DNA using a kit GeneJET Plasmid Miniprep Kit (Fermentas, Lithuania) according to the manufacturer's Protocol. For the obtained plasmid was determined nucleotide sequence of the region of the insert by PCR-sequencing using standard primers T7prom (SEQ ID NO:21) and SP6 (SEQ ID NO:22) to the sequence of the vector.

Example 2. Obtaining the plasmid PAT-EK-DNASEIC18 and PAT-EK-DNASEIC106 coding mutiny N18C and N106C Gnkazy person with detachable N-terminal leader

To obtain the plasmid PAT-EK-DNASEIC18 conducted site-directed mutagenesis the plasmid PAT-EK-DNASEI method inverse PCR using primers IP-DNA-CN-L-F (SEQ ID NO:23) and IP DNA-CN-L-R (SEQ ID NO:24).

To obtain the plasmid PAT-EK-DNASEIC106 conducted site-directed mutagenesis the plasmid PAT-EK-DNASEI method inverse PCR using primers IP-DNA-CN-R-F (SEQ ID NO:25) and IP DNA-CN-R-R (SEQ ID NO:26).

Site-directed mutagenesis method inverse PCR was performed according to [Michael P. Weiner, Tim Gackstetter, Gina L. Costa, John C. Bauer, and Keith A. Kretz. Site-directed Mutagenesis using PCR in Molecular Biology: Current Innovations and Future Trends. Eds. A.M. Griffin and H.G. Griffin. ISBN 1-898486-01-8, 1995. Horizon Scientific Press, PO Box 1, Wymondham, Norfolk, U.K.] with modifications. Each oligonucleotide was fosforilirovanii separately. The reaction was carried out in buffer Tris-HCl, pH 7.5, containing 10 mm MgCl2, 50 mm dithiothreitol, 1 mm ATP and 100 picomoles of the oligonucleotide, 1 unit Poliny etidronate phage T4 (SibEnzyme, Russia) for 30 min at 37°C. After the reaction, the enzyme iactiveaware at 65°C for 10 min and Then used for carrying out inverse PCR 20 PM on reaction. PCR conducted using a set of "Encyclo PCR kit (Evrogen JSC, Russia) according to the manufacturer's instructions, as follows: 1 cycle: 4 min 94°C, 2 min at 50°C, 2 min 72°C; then 11 cycles of 1 min 94°C, 1 min at 55°C, 2 min 72°C. the PCR Product was diluted in half with a single buffer for endonuclease DpnI was added 10 Units. DpnI and incubated at 37°C for 30 minutes, then made 2.5 Units. polymerase Pfu tolerated at 72°C, and incubated a further 30 minutes the mixture was purified using a set of reagents "Wizard SV Gel and PCR Clean-Up System (Promega, USA) according to the manufacturer's Protocol. Performed ligation of purified product inverted PCR using DNA ligase of phage T4 and standard buffer solution (Fermentas, Lithuania) for 1 hour at room temperature. Received ligase mixture was used to transform cells of E. coli strain DH5α. 4 clone E. coli was increased in 5 ml of nutrient broth 2xYT-Amp and was isolated plasmid DNA using a kit GeneJET Plasmid Miniprep Kit (Fermentas, Lithuania). The nucleotide sequence of the obtained plasmid was determined by PCR-sequencing.

For sequencing plasmid PAT-EK-DNASEIC18 used specific oligonucleotide SQ-DNA-CN-L-F (SEQ ID NO:27).

For sequencing plasmid PAT-EK-DNASEIC106 use the Ali-specific oligonucleotide SQ-DNA-CN-R-F (SEQ ID NO:28).

Example 3. Obtaining vector plasmids pET28Thr-

The vector plasmid was obtained on the basis of commercial vector rate(+) (Novagen, USA), with an inserted short DNA adapter. The recipient plasmid rate (+) was treated sequentially each endonucleases NcoI and NheI, and then iactiveaware enzymes by heating for 20 min at 65°C and was isolated from the gel by a set of "Wizard SV Gel and PCR Clean-Up System (Promega, USA) according to the manufacturer's Protocol, and ligated with an adapter. The adapter was obtained by annealing two partially complementary oligonucleotides AD-6H-NcoF (SEQ ID NO:29) and AD-6H-NheR (SEQ ID NO:30), when the annealing forming a duplex with exposed "sticky" 5'-ends. To get the adapter was made in a test tube, 100 PM of each oligonucleotide was heated to 95°C and slowly cooled to room temperature. Adapter ligated with NcoI-NheI fragment of plasmid Rita T4 DNA ligase (Fermentas), ligase obtained mixture was used to transform cells of E. coli strain DH5α. Colonies of E. coli were analyzed by PCR from clones, using oligonucleotides AD-6H-NcoF (SEQ ID NO:29) and T7t (SEQ ID NO:31).

The selected clones was increased in 5 ml of 2xYT-Kan and perform the selection plasmid DNA kit GeneJET Plasmid Miniprep Kit (Fermentas, Lithuania). The nucleotide sequence of the region of the insertion adapter in the resulting plasmids were identified by PCR-sequencing with primer T7t (SEQ ID NO:31).

Example 4. Obtaining Express the traditional plasmids pET28EK-DNASEI, pET28EK-DNASEIC18 and pET28EK-DNASEIC106

The recipient plasmid pET28Thr is obtained as described in example 3, was treated with endonucleases NheI and HindIII; conducted by dephosphorylation and subsequent inactivation of alkaline phosphatase 10 min at 65°C. the DNA Fragment was isolated from agarose gel set Wizard SV Gel and PCR Clean-Up System (Promega, USA) according to the method of the manufacturer.

Donor plasmids were also treated with endonucleases NheI and HindIII, food restriction were separated in 1% agarose gel and isolated from the gel set Wizard SV Gel and PCR Clean-Up System (Promega, USA).

To obtain the expression plasmid pET28EK-DNASEI in used as donor plasmid PAT-EK-DNASEI, obtained as described in example 1.

To obtain the expression plasmid pET28EK-DNASEIC18 in used as donor plasmid PAT-EK-DNASEIC18, obtained as described in example 2.

To obtain the expression plasmid pET28EK-DNASEIC106 in used as donor plasmid PAT-EK-DNASEIC106, obtained as described in example 2.

The reaction ligating the purified fragments of the donor and acceptor was performed using T4 DNA ligase (Fermentas, Lithuania) according to the method of the manufacturer. Ligase mixture was used to transform cells of E. coli strain DH5α, colonies of E. coli were analyzed by PCR from clones using primers to the sequence of vectors T7t (SEQ ID NO:31) and T7prom (SEQ ID NO:21). The selected clones was increased in 5 ml of 2xYT-cap and the wire is whether the selection of plasmid DNA kit GeneJET Plasmid Miniprep Kit (Fermentas, Lithuania). The nucleotide sequence in the region of the insert in the resulting genetic structures were determined by PCR-sequencing using standard primers to the sequence of vector T7t (SEQ ID NO:31) and T7prom (SEQ ID NO:21).

Example 5. Obtaining strains producing E. coli BL21[DE3]/pET28EK-DNASEI, BL21[DE3]/pET28EK-DNASEIC18, BL21[DE3]/pET28EK-DNASEIC106, assessing the productivity of strains producing and localization of the target protein

To obtain strains producing hybrid proteins predecessors Gnkazy person and its Malinov expression constructs obtained in example 5, was used to transform competent cells of E. coli BL21[DE3] (with genotype F-ompT hsdSB(r-m-) gal dcm (DE3)) and were selected clones, keeping the level of biosynthesis of recombinant polypeptide at least 30-50% of the total cellular protein for at least four consecutive passages.

To obtain E. coli strain BL21[DE3]/pET28EK-DNASEI - producer protein predecessor Gnkazy I human cells of E. coli strain BL21[DE3] transformed the expression plasmid pET28EK-DNASEI.

To obtain E. coli strain BL21[DE3]/pET28EK-DNASEIC18 producer protein precursor mutein [N18C] Gnkazy I human cells of E. coli strain BL21[DE3] transformed the expression plasmid pET28EK-DNASEIC18.

To obtain E. coli strain BL21[DE3]/pET28EK-DNASEIC106 producer protein precursor mutein [N106] Gnkazy I human cells of the strain E. coli BL21[DE3] transformed the expression plasmid pET28EK-DNASEIC106.

Transformants of E. coli BL21[DE3] were sown on agar medium 2xYT agar with the addition of kanamycin and 30 μg/ml and glucose to 2%, conducted an analytical expression of target proteins for five randomly selected clones typical phenotype. Clones were pokasivali in nutrient broth with the addition of kanamycin and 30 μg/ml and glucose to 2% for 6-7 hours, inoculable a new portion of the nutrient medium at a ratio of 1:100, raise culture to achieve an optical density of 2 PU, induced isopropylthio-R-D-galactoside, and cultured for another 2 hours After the end of cultivation the precipitated cells were separated by centrifugation, resuspendable cells in a solution of 10 mm Tris-HCl, 2 mm EDTA-Na, 0.1% Triton-X100, 10 μg/ml of lysozyme in the ratio of 10 ml per 1 g cell paste was kept in suspension for 30 min on ice and carried out the destruction of the cells by ultrasonic disperser to the disappearance of the apparent viscosity of the suspension. Taking samples for electrophoretic analysis, share them soluble and insoluble protein fraction by centrifugation in microcentrifuge additionally resuspendable precipitate in the same solution and precipitated by centrifugation. The results of electrophoretic analysis of total protein for strain BL21[DE3]/pET28EK-DNASEI shown in Figure 5, electr the foretical mobility and the intensity of the band of the target protein for Malinov [N18C] and [N106C] is completely analogous. According to gel electrophoresis of protein fractions all 3 of the target protein were almost completely localized in the insoluble fractions of proteins, i.e. was in the form of "Taurus enable".

Example 6. Time, the isolation and purification under denaturing conditions, proteins predecessors, Gnkazy I man and its Malinov DNASEI[N18C] and DNASEI[N106C]

Getting treated denaturirovannykh protein precursor Gnkazy I man and its Malinov N18C and N106C of producer strains E. coli BL21[DE3]/pET28EK-DNASEI; BL21[DE3]/pET28EK-DNASEIC18 and BL21[DE3]/pET28EK-DNASEIC106 was performed according to the following General scheme: the cultivation of strains-producers, induction, separation of biomass lysis and disintegration of the cells in the presence of EDTA-Na; Department of Taurus include; solubilization; metallobeta chromatography. For this purpose, the strains-producers were sown from the Museum loop debilitating stroke on a Petri dish with agar LB medium containing 30 μg/ml kanamycin and 2% glucose, raised 14 hours at 37°C. a single colony of the appropriate strain was transferred into 5 ml of liquid LB medium containing 30 μg/ml kanamycin and 2% glucose, and grown on a shaker for 14 hours at 37°C. the Obtained cultures were inoculable 3 flasks of 250 ml of 2xYT medium containing 30 μg/ml kanamycin and 0.1% glucose, raised on the rocking 3.5 hours at +37°C, was selected samples of bacterial suspensions for analysis, was added IPTG until the final concentration is 1 mm and grown for another 4 hours.

Was separated by precipitation of the biomass by centrifugation, precipitation cells resuspendable in 20 ml of solution A (50 mm Tris pH of 7.4, 2 mm EDTA)was added lysozyme 10 mg/ml and Triton X100 0.1%, incubated for 30 min on ice. Spent the destruction of cells and genomic DNA by using an ultrasonic disperser heartbeats for 10 seconds before disappearing to the high viscosity of the suspension. Was separated by precipitation by centrifugation 10 min at 18000 rpm Precipitation resuspendable in 20 ml of solution a was added to the detergent NP-40 1%, the suspension was treated with an ultrasonic disperser to the disappearance of sediment particles larger than 1 mm, separated bullock inclusion by centrifugation 10 min at 20000 rpm Obtained precipitation Taurus enable resuspendable in solution And added NaCl to 500 mm, the suspension was treated with an ultrasonic disperser to the disappearance of sediment particles larger than 1 mm, the precipitate was separated by centrifugation for 10 min at 20000 rpm Obtained preparations enriched Taurus inclusion was stored at -70°C. the Purity of all target proteins in the resulting preparations was not less than 80% according to the densitometry of electrophoregram.

To conduct solubilize the target proteins to sub-samples of approximately 50 mg Taurus enable solution was added B (8 M urea, 50 mm Tris-HCl, 50 mm beta-mercaptoethanol, pH 8.0) at a ratio of 10 ml per 1 g of cells. Suspensions were incubated at Pere is eshiwani 2 hours at +37°C, separated undissolved cell debris by centrifugation for 10 min at 18000 rpm Supernatant was applied to a column HiTrap Chelating Sepharose (GE Healthcare, USA), containing chelated ions of cobalt and balanced solution (6 M urea, 50 mm Tris-HCl, 500 mm sodium chloride, pH 7.0). The column was washed with a solution of G (6 M urea, 50 mm Tris-HCl, 500 mm sodium chloride, 50 mm imidazole pH 7.0) and was suirable target protein solution (6 M urea, 50 mm Tris-HCl, 500 mm sodium chloride, 50 mm imidazole pH 7.0). Eluate was concentrated by ultrafiltration to a final protein concentration of 20 mg/ml, was absoluely diafiltrate and froze. The purity of all target proteins in the resulting preparations was not less than 95% according to the densitometry of electrophoregram.

Example 7. Resaturate protein precursor Gnkazy I man and its Malinov [N18C] and [N106C]

Renaturation proteins was performed using refolding by rapid dilution. Disulfide bond denaturirovannykh protein precursor was restored by treatment with 5 mm dithiothreitol for 30 min at room temperature. For all three protein solution was used for refolding of the same composition containing 50 mm Tris-HCl pH=8,0, 4 mm CaCl2, 4 mm MgSO4, 2 mm reduced glutathione, 0.4 mm oxidized glutathione, 1% PEG 1500, 2 M urea. Solutions denaturirovannykh proteins predecessors who drove in solutions for refolding dropwise with constant stirring, used a dilution of 1:40. Led refolding 1 h at room temperature with constant stirring without oxygen. Then the precipitation was separated by centrifugation. The release of soluble covalently Monomeric protein precursor were in all cases not less than 70% by densitometry of electrophoregram. Solutions denaturirovannykh protein was concentrated by ultrafiltration to a final protein concentration of 3-4 mg/ml and immediately separated the N-terminal peptides by treatment with enterokinase.

Example 8. Separation of N-terminal peptides from proteins predecessors, Gnkazy I man and its Malinov DNASEI[N18C] and DNASEI[N106C].

Separation of N-terminal peptides was performed using recombinant enterokinase ("Sigma", USA), using a ratio of enzyme:substrate 1:10 (by weight). The reaction was performed for 2 h at +37°C, using diluted 2-fold with water solutions of proteins predecessors, i.e. substrate concentration of 1.5-2 mg/ml, the Degree of conversion for all three proteins precursor was about 70% according to the gel-electrophoretic analysis.

Example 9. Final cleaning Gnkazy I man and its Malinov DNASEI[N18C] and DNASEI[N106C].

Department protestirovannyx proteins from protein-precursors, free N-terminal peptides, enterokinase and extraneous impurity adsorption of proteins was performed in a volume, adding to p the promotional mixes suspension of sorbent Chelating Sepharose FF (GE Healthcare, USA) with immobilized cobalt ions in the ratio of 300 μl of suspension per 1 mg protein. The reaction mixture incubated with sorbent 1 h at room temperature with stirring. After that supernatant separated, precipitation of the sorbent was washed with 5 volumes of a solution of 25 mm Tris-HCl pH8,0, 2 mm CaCl2, 2 mm MgSO4, 1 mm reduced glutathione, 1 M urea, United supernatant, concentrated them by ultrafiltration to a final total protein concentration of 1.5-2 mg/ml and delete the restored glutathione by diafiltrate to the negative reaction of the filtrate with reagent Allman (5,5'-dithiobis-(2-nitrobenzoic acid)). The result of this procedure were obtained solutions of purified recombinant Gnkazy I man and its Malinov DNASEI[N18C] and DNASEI[N106C], containing not more than 5% impurity proteins according to the gel-electrophoretic analysis.

Example 10. Measurement of activity recgnize I person method demografie.

Prepared plate of the gel for electrophoresis according to laemmli's method. In the separating gel before polymerization was added DNA from thymus cattle to a final concentration of 10 μg/ml was Applied on several dilutions of the samples of the proteins in the solution for preparing a sample for electrophoresis according to laemmli's method, and similarly solubilization washed calf on the control of protein - Gnkazy I person with updat the additional N-terminal methionine residue, and the standard enzyme activity - natural Tnkase I cattle.

Upon completion of electrophoresis separated the concentrating gel separating gel was washed in a solution (Triton X-100 1%, Tris-HCl pH 7.5, 20 mm) 3 times for 10 min to remove gel EDTA, sodium dodecyl sulfate, and renaturation of proteins in mixed micelles of detergent. Then the gel was washed in a solution (Tris-HCl 20 mm, NaCl 150 mm, tween-20 0.05%, the CaCl25 mm MgCl25 mm MnSO45 mm), 2 times for 5 minutes In a third portion of the solution was added ethidium bromide to 1 μg/ml and led the incubation of the gel for 30 min at +37°C. the Gel was then placed on transilluminator and photographed. Continued incubation at +37°C before the onset of visible zones of dissolution of the substrate, but not more than 2 days. When densitometry obtained zymogram it was found that the specific activity of the protein predecessor Gnkazy I in relation to natural DNase I bull is not more than 0.01%, while the specific activity of methionyl-Gnkazy I is about 0.1%, and the specific activity of the Mature recombinant Gnkazy I man - about 1%. Since the only difference recombinant Gnkazy from the natural protein is the absence of N-linked oligosaccharides, it has been suggested that the enzymatic activity of the protein can be recovered by conjugation of amino acids at sites of N-glycosylation sites (positions 18 I) with hydrophilic polymers.

Example 11. Directional conjugation of Malinov DNASEI[N18C] and DNASEI[N106C] maleimide-polyethylene glycol

Peeled mutiny DNASEI[N18C] and DNASEI[N106C]containing substitutions of residues asparagine at residue cysteine, was treated with reagent TSER (trichlorethylene) in a molar ratio of 5:1 for 10 min at room temperature to fully restore the unpaired cysteine residue was added to PEG-maleimide 10 kDa ("CreativePEGWorks, USA) in a molar ratio of 5:1. The reaction mixture was incubated for 60 min at room temperature. Besieged unreacted mutiny dilution of the reaction mixture in 4 times with water and was separated by precipitation by centrifugation. Purification of conjugates was performed by anion-exchange chromatography on columns HiTrap Capto DEAE 1 ml (GE Healthcare, USA)equilibrated with a solution of 20 mm Tris-HCl pH 7.0, 5 mm CaCl2. Supernatant diluted reaction mixtures were applied to the column immediately after centrifugation. The column was washed with 5 volumes of the starting solution and led elution with a linear concentration gradient of sodium chloride from 0 to 300 mm 20 ml, collecting the eluate fractions 1 ml Fractions containing only the monosubstituted conjugates of Malinov (according to LTO-SDS page analysis)were pooled, concentrated by ultrafiltration on a membrane with a cutoff of 10 kDa, was absoluely diafiltrate to a solution of 20 mm Tris-HCl, 5 mm CaCl2prior to ejnoy protein concentration of 1-2 mg/ml and used for enzyme activity determination. Anion-exchange chromatography allows to effectively separate conjugates from unreacted residues of Malinov by changing the surface charge of the protein after conjugation and earlier elution conjugates.

Example 12. Determination of enzyme activity in the solution of recombinant Gnkazy I man, Malinov DNASEI(N18C] and DNASEI[N18C] and their conjugates with peg 10 kDa

Because the PEG-derivative of Malinov DNASEI[N18C] and DNASEI[N106C] have variable molecular weight and do not form a focused areas during electrophoresis LTO-SDS page, measuring their enzymatic activity by demographia difficult. For comparison, the specific enzymatic activity of conjugates, Malinov original recombinant Gnkazy person I used the technique of hydrolysis of supercoiled plasmids in solution with subsequent separation of the reaction products on an agarose gel and calculating the degree of hydrolysis of the substrate by densitometry digital pictures of the gel.

The hydrolysis is conducted in a solution containing supercoiled plasmid pUC19 at a concentration of 30 ng/μl, 25 mm Hepes, pH 7.0, 0.1 µg/µl bovine serum albumin, 4 mm MgCl2, 4 mm MnSO4and/or CaCl2. The reaction mixture was incubated for exactly 10 min, the reaction was stopped by addition of Na-EDTA to 20 mm. It was found that the specific enzymatic activity of recombinant Gnkazy person is not more than 2% of the activity Gnkazy I bull, the enzymatic activity of Malinov DNASEI[N18C] and DNASEI[N18C] in this test were not detected, i.e. less than 10% of the specific activity of recombinant Gnkazy I person. At the same time, the specific activity of both conjugates DNASEI[N18C] and DNASEI[N18C] PEG is 10-20% of the activity Gnkazy I bull.

The results showed that the inclusion in the sequence of protein synthesized leader of the N-terminal peptide encoded optimal for E. coli codons reduces the toxicity of the product expression for bacteria, which leads to a significant increase in the yield of the target protein. N-terminal peptide also allows chromatographic purification of expressed protein under denaturing conditions using metallogenetic chromatography, which, in turn, allows to obtain a homogeneous product using the same chromatographic stage. After removal of the additional peptide treatment enterokinase and branches of Mature Gnkazy I re metallogenetic chromatography can be purified preparation of the protein. Obtained in this way maleinovyi variation Gnkazy person I can be converted into a highly active enzyme form when directed conjugation with polyethylene glycol.

While this invention is described in detail with reference to Examples, those skilled in specified about the Asti equipment obviously, what can be done various changes and produced equivalent replacement, and such modifications and substitutions are within the scope of the present invention.

Table 1.
Oligonucleotides for synthetic gene Gnkazy I man.
NameSequence (5'-3')SEQ ID NO
AS-DN-F1GCGGCAACGATACCTTCAATCGTGAACCGGCAATTGT GCGGTTTTTCTCTCGCTTCACCGAAGTTCGCGAGTTTG CGATCGTAC5
AS-DN-F2TTCGTGTATCGCCCTGATCAGGTGAGCGCAGTAGACA GCTACTATTATGACGATGGGTGCGAGCCTTGCGGCAA CGATACCTTC6
AS-DN-F3CCCGGACACCTATCATTATGTCGTGAGTGAACCACTG GGCCGCAATAGCTATAAAGAGCGCTACCTGTTCGTGT ATCGCCCTGA7
AS-DN-F4CAGGAAGTTCGCGACTCACATTTAACGGCGGTTGGCA AACTGCTGGATAATCTGAATCAGGATGCCCCGGACA STATESTAT8
AS-DN-F5AATGAGTAACGCCACCCTCGTCTCCTATATTGTGCAG ATTCTGAGCCGTTACGATATCGCACTGGTACAGGAAG TTCGCGACTC9
AS-DN-F6ACTATAAAGATGACGATGACAAACTGAAAATTGCCG CGTTTAATATTCAGACGTTTGGGGAAACCAAAATGAG TAACGCCACCC/td> 10
AS-DN-F7TTGCTAGCGACTATAAAGATGACGATGACAAA*11
AS-DN-R1CATCCAGATACACATCGTAGAGGGCATCAATTTCTGC GACAGCGTCCCCCGGGGCAGCATGTAACGGTACGAT CGCAAACTCGC12
AS-DN-R2ATGAACAACCGGCGTTAAAATCCCCCATGAGCATTAC ATCCTCCAGGCCCCATTTCTCTTGTACATCCAGATAC ACATCGTAGA13
AS-DN-R3GGAATCAACCATTGGAAAGTCGGAGACGTCCACAGC CGAATGGAAGACCACTGGGACGGGCGTACATATGAA CAACCGGCGTTA14
AS-DN-R4GCCCGCCACTACAATACGATCATACGCACAATGGGTC GGGGTTGCCGTAGTATCTGCGCTGTCTGGAATCAACC ATTGGAAAGT15
AS-DN-R5GACCATACGCCGCCTGAAAGTTAAACGGTAACGCAC TATCTGGAACCACAGCGCCACGTAAAAGCATGCCCG SALASACAS16
AS-DN-R6GCTTCTATTATTTCAACATCACTTCGACCGGATAGTG ATCCGAAATCGCTTGTGCAAGTTGATCGCTCAGACCA TACGCCGCCT17
AS-DN-R7TTAAGCTTCTATTATTTCAACATCACT**18
* bold website recognition of the restriction enzyme NheI
** bold website recognition indanol the basics of HindIII restriction

1. A plasmid for expression in cells of bacteria belonging to the genus Escherichia, the inactive precursor of Gnkazy I man or Malinov containing ottsepleny N-terminal leader, including exegetically cluster and sequence recognition of enterokinase essentially contains:
a promoter functional in a bacterial cell;
the DNA fragment encoding exegetically cluster;
a fragment encoding the sequence of recognition of enterokinase, fused in frame with Dnazol I man or functionally active muteena containing substitutions of asparagine cysteine;
- part of the termination of transcription;
- fragment vector rate(+)containing the site of initiation of replication of bacteriophage fl, sequence, encoding an aminoglycoside-3'-phosphotransferase, the area of the beginning of replication of plasmids pBR322, gene RNA-organizing protein Rop, the sequence encoding the repressor of Lac operon.

2. Plasmid according to claim 1, characterized in that said DNA fragment coding for the precursor of Gnkazy I is a DNA fragment presented in the sequence Listing under the number SEQ ID:1 or option.

3. Plasmid according to claim 1, characterized in that said promoter is the promoter of the RNA polymerase of bacteriophage T7.

4. Plasmid according to claim 1, characterized in that the specified mutai Gnkazy I contains replacement N18C or N106C.

5. Plasmid according to claim 1, characterized in that the plasmid is selected from the group consisting of plasmids pET28EK-DNASEI, pET28EK-DNASEIC18 and pET28EK-DNASEIC106.

6. The bacterium belonging to the genus Escherichia, transformed with the plasmid according to claim 1, producing an inactive precursor recombinant Gnkazy I man or mutein containing substitutions of asparagine cysteine.

7. The bacterium according to claim 6, distinguish fact that specified mutein Gnkazy I contains replacement N18C or N106C.

8. The bacterium according to claim 6, characterized in that the bacterium is selected from the group comprising bacteria E. coli BL21[DE3]/pET28EK-DNASEI, E. coli BL21[DE3]/pET28EK-DNASEI18C and E. coli BL21[DE3]/pET28EK-DNASEI106C.

9. The precursor recombinant Gnkazy I man or mutein containing ottsepleny N-terminal leader, including exegetically cluster and sequence recognition of enterokinase obtained by culturing the bacterium according to claim 6 in culture medium and used for production of the active form Gnkazy 1 person or mutein.

10. The precursor recombinant Gnkazy I man according to claim 9, containing the amino acid sequence presented in the sequence Listing under the number SEQ ID NO:2, or a variant of it.

11. Predecessor mutein Gnkazy I man according to claim 9, characterized in that the specified mutein contains a substitution of asparagine cysteine N18C or N106C.

12. The method of obtaining recombi is based Gnkazy I man or mutein, comprising cultivating the bacterium according to claim 6 in a nutrient medium, the selection of Taurus include, solubilization of protein predecessor metallochemistry chromatography under denaturing conditions, the protein refolding predecessor, obtaining Mature protein treatment enterokinase and allocation specified Mature protein recombinant Gnkazy 1 person or mutein.

13. The method according to item 12, wherein the cultured strain E. coli BL21[DE3]/pET28EK-DNASEI, E. coli BL21[DE3]/pET28EK-DNASEI18C or E. coli BL21[DE3]/pET28EK-DNASEI106C.

14. The method according to item 12, wherein the specified mutein contains replacement N18C or N106C.

15. The method of obtaining conjugates of polyethylene glycol and recombinant mutein Gnkazy I person obtained by the method according to item 12, including preliminary limited recovery of protein, incubation with maleimide-polyethyleneglycol and the selection of the conjugate.

16. The method according to item 15, wherein the specified mutein contains point replacement N18C or N106C.

17. Enzymatic active conjugate mutein recombinant Gnkazy I person containing the replacement of asparagine cysteine, poly (ethylene glycol) obtained by the method according to item 15.

18. Enzymatic active conjugate according to 17, characterized in that the specified mutein contains point replacement N18C or N106C.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: preparation containing biodestructor of oil contamination represents centrate of cultural liquid of microbial mass of consortium of oil-oxidising microorganisms immobilised on peat carrier. Consortium composition includes the following: Rhodococcus eqvi SRI MCC B-1115 bacteria strain, Rhodotorula glutinis SRI MCC Y-1113 yeast and Rhodotorula glutinis ARSRI MCC Y-1114 yeast strain in the ratio of 1:1:1 respectively, which have been grown jointly.

EFFECT: invention allows improving quality of soil cleaning from oil and oil products under conditions with reduced temperatures.

2 tbl

FIELD: biotechnologies.

SUBSTANCE: Bacillus licheniformis strain has antagonism in relation to Salmonella typhi, Staphylococcus aureus, Listeria monocytogenes and resistance to the following antibiotics: streptomycin and nalidixic acid. The strain is deposited with number BKM B-2712D in the All- Russian collection of microorganisms of the Institute of Biochemistry and Physiology of Microorganisms of the Russian Academy of Science (IBFM RAN).

EFFECT: strain can be used for creation of probiotic bacterial preparations in veterinary.

FIELD: biotechnologies.

SUBSTANCE: strain is deposited in CNCM and has number 1-3689. Strain has ability to inhibit the growth of pathogenic microorganisms in culture, and namely Escherichia coli, Salmonella enteritidis and Listeria monocytogenes. Strain has anti-inflammatory properties at the ratio of IL-10/IL-12 equal to 11.8.

EFFECT: food product containing the above living strain has antimicrobial or immunomodulating properties.

6 cl, 3 dwg, 4 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: Bacillus licheniformis VKM B-2713D strain has apparent antagonism in relation to Salmonella typhi, Staphylococcus aureus, Listeria monocytogenes. Strain has resistance to antibiotics at streptomycin concentration of 20 mcg/ml and at concentration of nalidixic acid of 20 mcg/ml. Strain has α-amylase activity of 0.015 U/ml of the medium at pH 6.0, protease activity of 2.34 U/ml of the medium at pH 7.0.

EFFECT: improving activity.

1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention proposes a method for obtaining recombinant core protein of hepatitis E virus (rtHEV-ORF2) and recombinant vaccine for prophylaxis of hepatitis E virus. Core protein is obtained by cultivation of recombinant yeast strain Hansenula polymorpha "КБТ"-11/pHEV-001, which contains DNA sequence integrated into genom of yeast cell and coding the fragment of amino-acid sequence from position 86 to 607 of core protein of hepatitis E virus of genotype 3 (rtHEV-ORF2) under control of promoter of MOX gene. The method allows obtaining immunogenic antigene of hepatitis E virus, which has properties of natural protein. Based on the obtained antigene there created is recombinant vaccine for prophylaxis of hepatitis E virus. Vaccine includes effective amount of rtHEV-ORF2 protein, adjuvant and a physically acceptable diluter.

EFFECT: vaccine is immunodominant and non-toxic and has no by-effects.

3 cl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents Bacillus licheniformis bacteria strain All-Russian collection of industrial microorganisms B-11302 - producer of heat-resistant lipase. At fermentation of the obtained strain in 3 l of a laboratory fermenter the ferment activity in culture liquid reaches the level of 500 U/ml.

EFFECT: invention allows obtaining heat-resistant lipase with high efficiency degree.

3 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: at fermentation of obtained strain in 3 l of a laboratory fermenter in minimal medium at the temperature of 30°C, ferment activity in culture liquid reaches the level of 210 U/ml.

EFFECT: invention allows obtaining Specific Phospholipase with high efficiency degree.

3 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: production method of keratinase provides for directed adaptation of strain Penicillium citrinum PC-54-91"ВИЛАР" by three-time subcultivation on Czapek agar medium containing 2% of hair keratin as a carbon source. Cultivation under deep conditions on Czapek medium containing 10% of hair keratin and 0.5% of saccharose during 6 days. Separation of biomass from culture fluid with further extraction of target product by two-stage chromatographic cleaning involving gel filtration on TSK-Gel TOYOPEARL HW-40 and affine chromatography on protein A to sepharose CL-4B with further lyophilisation.

EFFECT: invention allows increasing ferment yield, obtaining keratinase preparation decomposing the hair α-keratin, and improving cleaning degree of ferment preparation.

2 tbl, 5 ex

FIELD: biotechnologies.

SUBSTANCE: liquid culture of strain Corynebacterium glutamicum All-Russian collection of industrial microorganisms B-1959 - lysine producer by means of a deep method and liquid cultures of strains Bacillus subtilis All-Russian collection of industrial microorganisms B-8130, Bacillus subtilis All-Russian collection of industrial microorganisms B-2984, Bacillus subtilis All-Russian collection of industrial microorganisms B-4099 and Bacillus licheniformis All-Russian collection of industrial microorganisms B-4162 are prepared. To liquid culture of strain Corynebacterium glutamicum All-Russian collection of industrial microorganisms B-1959 there added in quantity of 30 l is 35 l of the mixture consisting of liquid cultures Bacillus subtilis All-Russian collection of industrial microorganisms B-8130, Bacillus subtilis All-Russian collection of industrial microorganisms B-2984 and Bacillus subtilis All-Russian collection of industrial microorganisms B-4099, which have been taken in the ratio of 6:6:1 respectively. Common mixture of liquid cultures is applied onto the carrier prepared in advance - sterile exhausted beet pulp treated with cellulolytic ferment and enriched with fermentolysate of Saccharomyces cerevisiae yeast. Then, it is mixed and exposed; after that, solid-phase fermentation is carried out under the specified conditions of restricted oxygen access. Liquid culture Bacillus licheniformis All-Russian collection of industrial microorganisms B-4162 containing at least 5.6×108 CFU/g is added in the amount of 65 l. The mixture is mixed and dried to the humidity of 8-10%. Dry powders of purple echinacea and fruits of holy thistle are added in terms of 20-50 g per 1 kg of the end product. The obtained mixture is stirred and subject to crushing till indiscrete mass is obtained.

EFFECT: invention allows improving feedstuff quality.

3 tbl, 1 ex

FIELD: biotechnologies.

SUBSTANCE: strain Aspergillus oryzae RCAM01135 is a producer of proteolytic and amylolytic ferments, which has ability to produce proteolytic and amylolytic ferments. It was deposited at GNU VNIISKHM with the following registration number: RCAM01135. It can be used at production of different food products (fermented spices, additives, and drinks).

EFFECT: invention allows increasing the growth speed and intensity of spore formation.

4 tbl, 2 ex

Organic compounds // 2502802

FIELD: biotechnologies.

SUBSTANCE: invention refers to eucariotic vector for expression of target recombinant product in a mammal cell and to its use, to a mammal cell for production of target recombinant product and to a method for its production, a method of a mammal cell selection and a method for obtaining a target recombinant product. Vector includes the first polynucleotide coding a functional folate receptor bound to a membrane as a selective marker and the second polynucleotide coding the target product that is expressed in a recombinant manner. Target product represents a pharmaceutically active, therapeutically active or diagnostic polypeptide. Functional folate receptor bound to the membrane and target product are expressed from the above expression vector. Sampling system is based on introduction of a gene of exogenic functional folate receptor bound to the membrane to a mammal cell.

EFFECT: invention allows effective selection of transformed cells and high yield of target product.

26 cl, 3 tbl, 2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to a peptide capable of binding with scurfin and inhibiting biological activity of scurfin, which is selected from a peptide consisting of an amino acid sequence Arg-Asp-Phe-Gln-Ser-Phe-Arg-Lys-Met- Trp-Pro-Phe-Phe-X, where X is absent or X is present and represents X14 or X14-X15, where X14 and X15 independently denote an amino acid, a version of said peptide and a pharmaceutically acceptable salt thereof. The invention also discloses a fused protein and a pharmaceutical composition, which involves use of said peptide and fused protein, as well as use thereof to produce and treat pathologies which require transient regulation or inhibition of immunosuppressive activity of regulatory T lymphocytes, such as a neoplastic disease or infectious disease. The invention also relates to a method of producing said peptide and fused protein, including a protein or peptide coding nucleic acid, a DNA construct, an expression vector and a host cell.

EFFECT: invention provides effective treatment of infectious and neoplastic diseases which require transient regulation or inhibition of immunosuppressive activity of regulatory T lymphocytes.

26 cl, 10 dwg, 5 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant human blood coagulability factor VIII with deletion of B-domain (hFVIII-BDD). Recombinant plasmid DNA pAP227 coding polypeptide with sequence hFVIII-BDD also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 2H5 producing recombinant hFVIII-BDD with highly stable yield at the level of about 20 IU/ml/24 h. Cultivation of cells-producers is performed in medium DME/F12 containing 2-4% of Fetal Bovine Serum, 1% of dimethylsulphoxide and 50 IU/l of insulin.

EFFECT: improvement of the method.

4 cl, 5 dwg, 9 ex

FIELD: biotechnologies.

SUBSTANCE: recombinant plasmid DNA pBK415 coding polypeptide with sequence of tissular activator of human plasminogen, also including MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transmission enhancer CMV, internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase providing stability to geneticin (Neo) and a cassette for expression in bacteria cells of gene of β-lactamase providing stability to ampicillin, cells of line Cricetulus griseus CHO DHFR(-) are obtained so that there produced is cell line Cricetulus griseus CHO 1F8 producing recombinant protein of tissular activator of plasminogen with highly stable yield at the level of up to 190 mg/l. Cultivation of cells-producers is performed under perfusion conditions in presence of a mixture consisting of additive CHO Bioreactor supplement and sodium butyrate or dimethylsulphoxide with further separation of a target product.

EFFECT: improvement of the method.

5 cl, 5 dwg, 3 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: invention can be used for obtaining recombinant blood coagulability factor IX of human being (hFIX). Recombinant plasmid DNA pAK380 containing gene of protein rhFIX, MAR - binding area to nuclear matrix of lysozyme gene of birds, virus transcription enhancer CMV and an internal translation initiation site IRES of encephalomyocarditis virus, gene DHFR of a mouse, a polyadenylation signal of virus SV40, gene of aminoglycoside-3'-phosphotransferase for stability to geneticin (Neo), a cassette for expression in bacteria cells of gene β-lactamase for stability to ampicillin, is used for obtaining recombinant factor hFIX in cells of line Cricetulus griseus CHO 1E6. By transformation of cell line C. griseus CHO DHFR - recombinant plasmid DNA pAK380 there obtained is cell line C. griseus CHO 1E6 producing recombinant hFIX with stable high yield at the level of 50 mg/l/24 h. After cultivation of cells-producers there extracted is hFIX by pseudoaffine chromatography on Q Sepharose with elution of 10mM CaCl2; then, on Heparin-Sepharose FF with elution of 600 mM NaCl, and chromatography on hydroxyapatite of type I with elution of 600 mM K3PO3 and chromatography on Source 30Q with elution of 600 mM with ammonium acetate.

EFFECT: improvement of the method.

4 cl, 5 dwg, 7 ex, 3 tbl

FIELD: biotechnologies.

SUBSTANCE: invention proposes an antibody that specifically connects segment M1' IgE and that induces apoptosis in IgE-expressing B-cells and its antigen-binding fragment. Besides, compositions and curing methods of IgE-mediated abnormalitiy, an item, a specific elimination method of IgE-producing B-cells, methods for prophylaxis and reduction of IgE products induced with an allergen, as well as isolated nucleic acid, an expression vector, a host cell and a method for obtaining an antibody as per the invention together with their use are considered.

EFFECT: invention can be further used in therapy of diseases associated with IgE.

46 cl, 19 dwg, 5 tbl, 13 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents recombinant BMPRIA-CBD plasmid, and E.coli strain transformed with that plasmid. The invention also refers to recombinant BMPRIA-CBD protein that is used for production of BMP-2 protein.

EFFECT: invention allows producing chromatographic clean fractions of biologically active dimeric form of BMP-2 protein, which can be used as osteoinductive components of osteoplastic materials of new generation.

4 cl, 2 dwg, 6 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents recombinant BMPRIB-CBD plasmid, and E.coli strain transformed with that plasmid. The invention also refers to recombinant BMPRIB-CBD protein that is used for production of BMP-7 protein.

EFFECT: invention allows producing chromatographic clean fractions of biologically active dimeric form of BMP-7 protein, which can be used as osteoinductive components of osteoplastic materials of new generation.

4 cl, 2 dwg, 6 ex

FIELD: biotechnologies.

SUBSTANCE: versions of an antibody or its fragment, which are specific in relation to β-amyloid protein, are proposed. Each version is characterised by the fact that it includes H- and L-chains, or areas VH and VL, each of which contains three corresponding CDR. The following is described: polypeptide VL, polypeptide VH, as well as coding nucleic acid, expression vector containing it and a cell carrying the vector, which are used for obtaining an antibody or its functional fragment. The following is proposed; a test kit, versions of pharmaceutical composition, a mixture to be used as a medicine based on the antibody or its functional fragment. Versions of the method used for production of an antibody are described: using a cell, nucleic acid or a vector. A composite preparation method, as well as an in vitro amyloid disease diagnostics method, a method for determination of a degree of loading with in vitro amyloidogenic patches, a method for curing or relief of actions of amyloid disease, which use an antibody or its functional fragment, are described. Inventions can be used in therapy and diagnostics of Alzheimer disease and other enlisted amyloid diseases.

EFFECT: proposed inventions provide new antibodies that bind the epitope contained in the area of 12-23 protein αβ1-42; with that, residues 15-20 have a fundamental importance.

44 cl, 18 dwg, 9 tbl, 16 ex

Vns-met-histones // 2498997

FIELD: biotechnologies.

SUBSTANCE: nucleic acid molecule codes a polypeptide consisting of two residues of methionine as the first and the second N-end amino-acid residues connected through a peptide link to a mature eucariotic histone. Polypeptide is obtained by cultivation of a host cell transformed by an expression vector including the above molecule of nucleic acid. Polypeptide is used as part of pharmaceutical composition for therapy of cancer, bacterial, virus or fusarium infections. Besides, polypeptide is used as part of composition for diagnostics of a patient in relation to response to pharmaceutical composition containing the above polypeptide, or in relation to curability using it.

EFFECT: invention allows improving efficiency of recombinant expression and simplifying determination of the above polypeptide in presence of endogenic histones at preservation of biologic activity of mature eucariotic histone.

17 cl, 3 dwg, 6 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: isolated peptide having cytotoxic T lymphocyte (CTL) inducing capacity in the presence of an antigen-presenting cell bearing HLA-A*2402, is used to obtain antigen-presenting cells and therefore CTL. The obtained CTL are used for targeted action against CDCA1-expressing cancer cells.

EFFECT: invention provides an effective vaccine for inducing anti-tumour immunity in a subject.

16 cl, 4 dwg, 1 tbl, 1 ex

Up!