Method for describing indications for choosing conservative therapeutic approach to patients suffered recurrent myocardial infarction

FIELD: medicine.

SUBSTANCE: method for describing indications for choosing a conservative therapeutic approach to the patients suffered recurrent myocardial infarction involves pre-therapeutic patient's blood examination to analyse blood serum for oxidation-resistant lipoproteids (ORLs), to analyse erythrocytes for the pyruvic acid concentration (PAC), and if the ORL value is equal to 1.89 nmole MDA/mg of protein of β-lipoprotein and lower, while the PAC value is equal to 1.81 mmole/l and higher, the conservative therapy is added with the preparations of lipoic acid.

EFFECT: method is simple, has a broad information value and allows a more objective assessment of the patient's state and identifying a group of the patients in need of the conservative treatment and suffered recurrent myocardial infarction by the preparations of lipoic acid.

3 ex

 

The invention relates to medicine, namely cardiology, and will be used to evaluate the effectiveness of the purpose of drug therapy in post-infarction period in patients who have a recurrent myocardial infarction (mi).

Statistics shows that morbidity and mortality from cardiovascular disease among patients who have had THEM many times higher than in the General population (Belousov DO, Coppersmiths I., 2003; Chazov E.I., Fighters S.A., 2009). Despite the apparent success in the treatment of patients with acute IM and secondary prevention remains a high percentage of re-development to THEM. Again THEY hold a special place in connection with those that are more difficult, define a greater number of complications, increase the specific gravity of myocardium, give the greatest mortality in the structure of heart attacks. Patients who have THEM, are at high risk of developing complications of repeated THEM (arrhythmias, heart failure, sudden death)(Belousov DO, Coppersmiths I., 2003; Malykhina AP, 2006).

Improving the efficiency of the treatment THEY largely depends on compliance with pathogenetic integrated approach in providing assistance to this group of patients, the development of methods of revascularization, as well as advances in pharmacotherapy (Stupakov I.N., Gudkov RG, 2007; who kourin R.S. et al., 2010; Bokeria L.A. et al., 2010; Eefting F. et al., 2003; Naik MJ, et al., 2003; Tavilla G. et al., 2004; S. Mussa et al., 2005). Drugs capable of using a variety of mechanisms to mitigate the energy deficit, to protect the cells in a reversible stage of their damage and activate the formation of structure and function, are the protectors and antihypoxants (V.M. Vinogradov, Krivoruchko, B. I., 2001; Vasiliev CU, 2005; Mazin NICHOLAS, 2007; Astashkin H., 2008; Andreev N., 2009; E.M. Zhukov et al., 2009; Tsaregorodtsev D.A. et al., 2010).

Currently, a large group of drugs, which are called antioxidants, enjoys extraordinary popularity among a wide range of doctors. However, the lack of methodological basis of the use of drugs with cytoprotective, anti-radical and antihypoxant effects in the treatment of patients leads to suffering the effectiveness of the treatment, which raises the question, in principle, of the effectiveness of these drugs. All this prompts the need for a rational conception of the use of drugs attributable to the protectors.

Despite the fairly investigated the pharmacodynamics of certain groups of drugs used for the treatment of patients with different forms of CHD, the value of using laboratory biochemical markers for monitoring the effect is vnesti therapy in patients with THEM undoubtedly has broad prospects, as advances in the treatment of primary THEM, reducing mortality raise the question about adequate therapy PIXELS.

For energotropic drugs that increase the intensity of the exchange at the cellular level, with antigipoksicheskim and antioxidant actions, rational basis for their use is poorly designed, often underused effective approaches or revalued ineffective medications are applied randomly, without sufficient knowledge about its capabilities and features, without planning strategy from the standpoint of expediency.

There is a method of predicting the effectiveness of treatment of patients with coronary heart disease drugs essential phospholipids (RF patent No. 2088931, 1997.08.27). The result is achieved by using new diagnostic criteria - definition of diene conjugates on the 3rd day of therapy and when the increase is more than 10 µmol/ml, the prognosis is poor, less than 10 µmol/ml, the prognosis is favorable.

The disadvantages of this method are not high specificity, complexity of technical execution in real clinical practice.

There is a method of determining the sensitivity to angiotensin-converting enzyme inhibitors in patients with myocardial infarction (patent RF №2125447, 1999.01.27). For implementing the method in venous blood of the patient is determined by the t ratio of free and bound forms of the water and when the value of this ratio is less than 1.2 predict the development of refractoriness to this group of drugs, what makes it inappropriate to their function in patients with acute myocardial infarction. When the value of this ratio over 1.3 believe that the patient is sensitive to angiotensin-converting enzyme inhibitors and in the scheme of individual therapy the patient include angiotensin converting enzyme inhibitors, such as captopril at a daily dosage of 25 mg

The disadvantage of these methods is the prediction of treatment failure for only one group of pharmaceuticals.

There is a method of determining a graded assignment heparins in patients with acute coronary syndrome without ST segment elevation (RF patent No. 2225617, 10.03.2004), namely, that the patient determine the concentration of anti-thrombin III AT in the serum and functional class of heart failure, conduct interviews with the patient, including disease duration of disease, age, number of previous myocardial infarction; determine the risk of falling concentrations of AT III: first determine the values of the function F, then the function value at the point X1 and the value of the function at the point x2 is compared, and when the value of the function at the point X1 is greater than the value of the function in the point x2 ascertain the risk of falling concentrations of AT III and prescribed enoxaparin, and when the value of the function at the point X1 is less than the value of the function at the point x2 ascertain Otsu is due to the risk of decreasing the concentration of AT III and appoint nefrackzionirovannam heparin.

The disadvantage of this method is the difficulty of use in real clinical practice, which reduces its diagnostic reliability.

A known method of reducing spontaneous aggregation of erythrocytes in dyslipidemia (RF patent No. 2432936, 10.11.2011), including the use of lipid-lowering diet, measured static and dynamic physical loads, which includes morning hygienic gymnastics, therapeutic gymnastics, fractional exercise throughout the day, daily swimming for at least 30 min a day in the middle of the day and the introduction of simvastatin 10 mg 1 time in the evening after eating for 1.5 months.

The disadvantage of this method is that no specific evidence indicating the effectiveness antilipidemics therapy, there was no systematic approach to assessing the effectiveness of therapy, which in our opinion should include an assessment of the effectiveness of the underlying disease according to blood pressure and urine spectrum of blood.

A known method of reducing spontaneous aggregation of red blood cells in arterial hypertension dyslipidemia and impaired glucose tolerance (RF patent No. 2433813, 20.11.2011), including the use of lipid-lowering diet, measured static and dynamic physical loads, including the surrounding morning hygienic gymnastics, of preventive and curative gymnastics, fractional exercise during the day, a daily swim at least 30 minutes a day in the middle of the day, the reception of lisinopril at a dose of 10 mg 1 time a day, morning and Metformin 500 mg 2 times a day for 2 months. The disadvantage of this method is a fragmentary evaluation study of the system of primary hemostasis and carbohydrate metabolism.

The described method of treatment alpha-lipoic acid (ASPA-liposom) diabetic autonomic neuropathy of the heart (Dwikorita, Penboyr. Therapy with alpha-lipoic acid (ASPA-liposom) diabetic autonomic neuropathy of the heart. - http://www.diabet.ru/Esparma/russian/doctors/cardio/cardio.htm). Diabetic autonomic neuropathy of the heart (DANCE) were determined by results of a comprehensive analysis of the 5 tests of cardiovascular reflexes, recommended by the conference in San Antonio, 1988. Espa-lipon was administered as monotherapy in combination with glucose-lowering drugs in phase 2: intravenous drip infusion at a dose of 600 mg per 100 ml of 0.9% saline (a total of 20, including weekends): immediately after oral administration of 1-2 tablets (600-1200 mg) for 4 weeks.

The disadvantage of this method is the lack of laboratory confirmation, which complicates the reliability of the diagnosis.

Thus, the need for further develo the TCI clinical and laboratory algorithms, in particular, using several informative markers, allowing to assess the systemic effect of these drugs on different levels of organization of the circulatory system, today is extremely relevant.

The prototype of the claimed invention, we have chosen the method described in the patent of Russian Federation №2088931, 1997.08.27.

The prototype disadvantages are eliminated in the invention.

The objective of the invention is the development of a fairly simple way of determining the indications for the choice of tactics of conservative therapy of patients who have a recurrent myocardial infarction.

The problem is solved by the fact that prior to treatment the patient underwent repeated myocardial infarction, carry out a blood test and determine the serum level of resistant to oxidation of lipoproteins (RLP)and in erythrocytes determine the concentration of pyruvic acid (PVA) and, when the value of the RLP, equal 1,89 nmol MDA/mg protein and lower, and STC, equal is 1.81 mmol/l and higher in complex conservative therapy includes drugs lipoic acid (LA) (synonyms: thioctic, Lipatova acid, vitamin N), for example, thioctacid BV.

Positive technical result to be obtained in the practical use of the proposed method is as follows:

the method allows to estimate more objectively sustainablog and to identify a group of patients needs to be conservative therapy after suffering repeated medications LK;

the method is simple, provides adequate treatment for this group of patients in 99%, which reduces the number of complications in the post-infarction period, to improve the quality of life of patients by reducing symptoms of angina and congestive heart failure;

the method has broad information content by identifying changes in cellular adaptation and, at the same time, high sensitivity.

During our studies found that patients who underwent repeated THEM, there is a decrease in the concentration of total cholesterol 14.6% (p>0,05) compared to patients with ischemic heart disease (comparison group)that may be associated with increased oxidative modification of LDL. In addition, the detected changes in the metabolism of lipoproteins characterized by the prevalence of atherogenic fractions. Thus, in patients who have had repeated THEM, there is a significant reduction HSLIT 49.5% (p<0,001), which can be considered as a bad prognostic sign of underlying disease course. In addition, we registered a strong rise in concentration HLPP by 45.5% (p<0,001) in the face of decreasing HELPOP 17.1% (p<0,001). It is possible that such changes are due to the violation of the systems of transport and reception of PL-particles in the discoveries excessive oxidative destruction of their protein and lipid structures in conditions of oxidative stress. Such changes are a prerequisite for their long circulation in blood stream and increase the risk of oxidative modification.

In patients undergoing repeat THEM significant decrease in the concentration PSV by 42.6% (p<0,001) with a significant decrease in the level RLP 1.92±0.03 nmol MDA/mg protein β-lipoproteins 58.6% (p<0,001) compared to the comparison group.

Apparently, this marked reduction in the concentration of PSV serum is indicative of the absorption of macrophage system, or about the depletion of their pool due to the transition in resistant forms. This may be a reflection of the characteristics of a post-infarction and the development of cardiosclerosis, respectively. Identified metabolic pattern as a whole can be characterized as low functioning processes of lipid metabolism, which is consistent with the concept of "hypoenergetic state".

In patients undergoing repeated THEM, there is a significant increase in the concentration of PVA in RUR 439,3% to a rate of 1.51±0.30 mmol/l (p<0,001), significantly exceeding the growth of lactate on 138,8% (p<0,001), indicating that the prevalence of anaerobic phase of glycolysis due to deterioration of metabolism, which can cause complications including arrhythmias.

It is established that chronic ischemia of the heart h is ruchaetsya, first of all, regulation of activity of key enzymes involved in the metabolism of energy substrates, and these changes occur on the background of long-term preservation of the structure of enzymes (Essop M.F., Opie, L.H., 2004). So pathogenetically justified is the use of drugs that have a positive impact on the mechanisms of transport and utilization of the energy in morpho-functional status of the myocardium (Makolkin V.I. et al., 2000; S. Tereshchenko. et al., 2002; Pierre Coste, 2011). Drugs affecting the oxidative metabolism of energy substrates in cardiomyocytes, received the name of anti-metabolic drugs (Astashkin H., Glaser MG, 2006; G.D. Lopaschuk, 2003; Marzilli M., 2003; Stanley, W.C., 2002; Rupp H, et al., 2002; Grynberg, A., 2005).

To stimulate adaptive responses of the cardiovascular system, the transition to the optimal level of functioning in the formation of sclerotic processes require the use of drugs with a comprehensive corrective action on all levels of functioning of the cardiovascular system. We found that this drug of choice may be LK. Lipoic acid (α-lipoic or thioctic acid) affects the metabolic system, which can reduce the formation of reactive oxygen species, decrease exp is the size of systemic oxidative stress.

Luke is a disulfide derivative of octanoic acid is a coenzyme in the oxidative decarboxylation of STC to acetyl-COA is the source compound in the Krebs cycle, and α-Ketoglutarate to succinyl-COA in the Krebs cycle) (birch CT, 1990; Amrus A. et al., 2009). As a coenzyme, it is involved in carbohydrate and protein metabolism, α-lipoic acid (La) is a natural prosthetic group in α-ketonization dehydrogenase complex in mitochondria and cleavage of glycine (Dieter N.Z. et al., 2002; Miquel J., 2002). α-LK classified as bituminoid is a conditionally essential nutrient. In the body it is synthesized in quantities capable of preventing shortages (Bilska A.L. et al., 2002).

The main function of LK - direct participation in carbohydrate metabolism, namely in aerobic metabolism product of glycolysis is pyruvate. In the process of oxidation LK eventually formed three ATP molecules, which significantly increases the energy potential of the cell. Facilitates the conversion of lactic acid to pyruvic with subsequent decarboxylation of the latter, thereby facilitating the elimination of metabolic acidosis (Karlovich TI, Ilchenko LU, 2008). Antioxidant effect of LC due to the presence of two thiol groups in the molecule (C.K. Sen, L. Packer, 2000). The deficit LK is expressed in the reservation of pyruvate in the cytosol and turning it into Molo is strong acid, and reduction in aerobic power, anaerobic threshold and available energy.

It is established that hepatoprotective, hypolipidemic, hypocholesterolemic, hypoglycemic effect of α-lipoic acid, the ability to improve trophism of neurons, a unique antioxidant properties allow you to not only affect the symptoms of some diseases and their pathogenesis (Luvthewnba, Aveley, Oiguseta. The clinical use of drugs lipoic acid. - Consilium Medicum. - Volume 05/No. 5/2007). Continue experimental and clinical studies of this substance for other pathological conditions. It is about using α-LK in cardiology.

We have not identified evidence of the use of drugs LK in the treatment of THEM and repeat THEM. Our studies allowed us to establish the following: Luke, being a powerful natural lipophilic antioxidant, captures free radicals: effectively neutralize peroxyl and hydroxyl radicals, and radicals of oxygen, affecting the redox status of the cells, reduces vascular dysfunction. The rationale for our use of α-lipoic acid in patients with re-appeared to THEM:

- ability to reduce FLOOR [binds free radicals and free tissue iron];

- participation in the oxidation of fatty acids and acetate;

- participation in decarbox is Yerevani α-ketoacids (energy cells);

- increase the transmembrane transport of glucose into the cell.

Detailed description of the method and examples of its clinical use

Before treatment the patient is undergoing THEM, are conducting a study of blood and determine the serum level of resistant to oxidation of lipoproteins (RLP)and in erythrocytes determine the concentration of pyruvic acid (PVA) and, when the value of the RLP, equal 1,89 nmol MDA/mg protein β-lipoproteins and below, and STC, equal is 1.81 mmol/l and above, conservative therapy include the preparation of a-lipoic acid: thioctacid BV company MEDA PHARMA GmbH&Co.KG, oral dose of 600 mg once daily 30 minutes before meals, 30 days.

STC is defined by Friedemann and Haugen modification Mpelasoka (babeskin BTW, the Way to determine pirovinogradnoi acid in the blood: A.S. No. 877436. USSR: Proposal from 13.02.80, No. 2877502/28-13, published 30.10.81. MCI G 33/52). Protein-free extract prepared by the impact of a 10% solution of trichloroacetic acid on the haemolysis of red blood cells with subsequent processing of diphenylhydrazine (DPG) and photometry of the mixture. To improve the accuracy of the method and its acceleration in the reaction mixture containing DNPH make an aqueous solution of alkali (NaOH). The results are expressed in μmol/ml thick sediment erythrocytes.

Resistant to oxidation of lipoproteins is determined according to the method of Regina SCI, Dushkina M.I. (Resist ntest to oxidation heparinisation β-lipoproteins in the serum of coronary heart disease. // Clinical laboratory diagnostics, 1998, No. 11, p.3-5). β-lipoproteins were obtained from 1 ml of serum by precipitation in the presence of heparin (200 IU per 1 ml of serum) and manganese chloride (50 mm per 1 ml of serum). To remove unbound heparin and manganese chloride precipitated β-lipoproteins washed with 0.9% sodium chloride solution with 50 mm phosphate buffer solution pH 7.4, after which the precipitated β-lipoproteins dissolved in 1 ml of 1M solution of sodium chloride. Then spend the oxidative modification of β-lipoproteins in the environment Dulbecco containing 50 mmol of copper sulfate in the presence of 0.2 mg/ml β-lipoproteins. Samples incubated for 2 hours at 37°C in a water bath.

Before incubation and after 2 hours of incubation assess the degree of oxidative modification of β-lipoproteins by determining the concentration of malondialdehyde (MDA) by the photometric method described by Steel I.D. (I.D. Steel, Garishvili YEAR Modern methods in biochemistry. M.: Medicine, 1977, p.66-68). To do this in the centrifuge tube is placed 0.5 ml of the obtained solution is poured 2.5 ml of 20% solution of trichloroacetic acid and 1 ml of 0.67% solution thiobarbituric acid (TBA). Heated in a boiling water bath for 30 minutes. Then cooled and centrifuged for 10 minutes in a centrifuge type Central laboratory-1 at 3000 revolutions per minute. Then, the resulting t is ntrifugal photometrate on fotoelektrokalorimetry CPK-2 at a wavelength of 540 nm in a 0.5 cm cuvette against a control sample. The calculation of the concentration of malondialdehyde, make use of a coefficient of molar extinction of the reaction product MDA/TBQ equal to 1.56×105cm-1M-1. The obtained results are expressed in nmol MDA/mg protein β-lipoprotein.

The performance of the proposed method is confirmed by the following clinical examples.

Example 1

Patient C-cue, 48 years old, medical history, No. 9453. In January 2011 went to the polyclinic at the place of residence with complaints of weakness, fatigue, decreased performance. From the anamnesis it is known that in 2000 underwent primary THEM for 6 months before applying suffered repeated THEM. Constantly get plavix 75 mg 1 time per day; aspirin cardio 100 1 time per day; betaloc ZOK 50 mg 1 time per day; crestor 10 mg 1 time per day. According to the clinical examination at admission: heart tones are muted, rhythm 82 beats./min, BP 130/90 mm Hg In the lungs vesicular breathing, wheezing no. Peripheral edema no. ECG: sinus rhythm, heart rate of 82 beats per minute. Q in V1V2V3. Slabopolozhitelnym T V1V2V3. Focal changes peredneperegorodochnoj region of the left ventricle of indeterminate years ago.

Has a preliminary diagnosis: ischemic heart disease, myocardial infarction (2000; 2010). HSN I. FC II.

The biochemical results and the research of blood

UFC 17 U/l [normal 24-170 U/l]; MV-ck 0 U/l

Test troponin T negative quality

Test troponin T quantitative 0.1 ng/ml

According to the claimed method was determined in the serum level of the RLP, and red blood cell concentration STC: RLP is equal to 1.87 nmol MDA/mg protein β-lipoprotein, STC is of 1.81 mmol/L.

Blood glucose 4.8 mmol/l; creatinine 0.08 mmol/l; urea 7.0 mmol/l; bilirubin to 17.4 µmol/l; AST 0.32 mmol/l; Alat 0.32 mmol/L.

Data Echocardiography: the abdominal Aorta Department 21 mm; Vmax 113 cm/s; the arc 22 mm; Vmax in descending Department 102 cm/s Upward Department 27 mm Aortic valve FC 25 mm, sash sealed; the amplitude differences of the valves 16 mm; Vmax 132 cm/with no regurgitation. The left atrium 35 mm; the left ventricle.

End-systolic dimension (DAC) 33 mm; end-diastolic dimension (CRA) 47 mm; interventricular septum (MoHSP) 10 mm; posterior wall of the left ventricle (ssli) 11 mm; the distance of the front wall of the mitral valve (PSMC-annuals) 5 mm, end-systolic volume (CSR) 47 cm3; end-diastolic volume (BWW) 102 cm3; stroke volume (PP) 55 ml; ejection fraction (EF) 53%; heart rate (HR) 76 beats./min global contractile function of the myocardium of the left ventricle satisfactory. Area hypokinesia in peredneperegorodochnoj region of the left ventricle. Doppler transmitral thread is: E 43 cm/s; And 66 cm/sec. The right atrium 29 mm; right ventricle 32 mm; tricuspid valve is not modified Vmax 251 cm/s; TR I senior GP 25 mm Hg. Pulmonary artery 26 mm. Pressure in the pulmonary artery 26 mm Hg. The bottom hollow vein on the breath subsided 50%; up to 17 mm. Diastolic dysfunction I type. Sclerosis of the aorta. Mitral valve insufficiency I step.

Conclusion

General contractile function of the myocardium of the left ventricle was slightly reduced. Focal changes peredneperegorodochnoj region of the left ventricle. Dilatation of the left atrium. Myocardial hypertrophy of the left ventricle.

Complete blood count: leukocytes (WBC) of 4.7×109/L; erythrocytes (RBC) of 4.25×1012/L; hemoglobin (HGB) 133 g/L; HCT 36,1 L; MCV 84,6 fL; MCH 29,6 Pg; MCHC 350 g/L; platelets (PLT) 280×109/L; neutrophils 57%; stab 3%; segmented 54%; lymphocytes 35%, monocytes 6%, eosinophils 2%.

In a comprehensive ongoing therapy: plavix 75 mg 1 time per day; aspirin cardio 100 1 tablet 1 time per day; betaloc ZOK 50 mg 1 time per day; crestor 10 mg 1 time per day additionally assigned thioctacid BV 600 mg 1 time per day 30 minutes before meals for 30 days.

Re-examination of the patient 32 days. The complaint does not show. According to the data of objective examination: heart tones are muted, heart rate 76 beats./min, BP 120/90 mm Hg In the lungs vesicular breathing, wheezing no. Peripheral edema no. ECG: rhythm Sina is new, heart rate 76 beats per minute. Q in V1V2V3. Slabopolozhitelnym T V1V2V3. Focal changes peredneperegorodochnoj region of the left ventricle of indeterminate years ago.

Routine biochemical analysis is unchanged.

RLP 2.4 nmol MDA/mg protein β-lipoproteins; STC 0.7 mmol/L.

Thus, the timely selection of patients for conservative re-treatment medications LK has greatly improved his health, quality of life and reduce complications.

Example 2

Patient L-rd, 51, case history No. event ID 14148. In October 2011 went to the polyclinic at the place of residence with complaints of discomfort in the chest on the left, a clear connection with physical exertion not notes, weakness, fatigue. History: in 2005 underwent primary; 8 months prior to this treatment suffered repeated THEM. Constantly gets cardiomagnyl 75 mg 1 time per day; egilok 25 mg 2 times a day; zocor 20 mg 1 time per day. According to clinical examination: heart tones are muted, heart rate 86 beats./min, BP 130/80 mm Hg In the lungs vesicular breathing, wheezing no. Peripheral edema no. ECG: sinus rhythm. The heart rate of 86 beats per minute. Pathological Q in II, III, aVF leads, the T wave slabopolozhitelnym in III,aVF. Focal changes nizhnetierryanshoe region of the left ventricle of indeterminate years ago.

Diagnosed with CHD, myocardial infarction (2005; 2011). HSN Art. I FC I-II.

The results of biochemical studies of blood

UFC 20 U/l (normal 24-170 U/l), MW-2 ck U/l

Test troponin T negative quality

Troponin T quantitative 0.2 ng/ml

According to the claimed method was determined in the serum level of the RLP, and red blood cell concentration STC: RLP equal to 1.82 nmol MDA/ mg protein β-lipoproteins; STC equal at 1.91 mmol/L.

Complete blood count: WBC of 5.5×109/L; RBC of 5.15×1012/L; G 146 g/L; HCT 40,4 L; MCV 78,4 fL; MCH 28,3 Pg; MCHC 361 g/L; PLT 228×109/L; neutrophils 56%; stab 5%; segmented 51%; lymphocytes 39%, monocytes 5%.

Blood glucose 5.1 mmol/l; creatinine 0.09 mmol/l; urea 7,3 mmol/l; AST 0.32 mmol/l; Alat 0.64 mmol/l; bilirubin 20.05 mmol/L.

Data Echocardiography: the abdominal Aorta Department 22 mm; Vmax 115 cm/s; arc 21 mm;

Vmax in descending division 111 cm/s Upward Department 27 mm Aortic valve FC 32 mm, sash sealed; the amplitude differences of the valves 21 mm; Vmax 128 cm/s; no regurgitation. The left atrium 30 mm; the left ventricle: DAC 31 mm; the CRA 45 mm; annuals 12 mm; ssli 13 mm; the distance PSMC-annuals 7 mm; CSR 47 cm3; BWW 98 cm3; PP 60 ml; PV 50%; HR 80 beats./min global contractile function of the myocardium of the left ventricle udovletvoritelnitsu hypokinesia identified in the lower diaphragmatic region of the left ventricle. Doppler transmitral flow: E 42 cm/s; And 61 cm/sec. The right atrium 30 mm; right ventricle 31 mm; tricuspid valve is not modified Vmax 240 cm/s; GP 26 mm Hg. Pulmonary artery 26 mm. Pressure in the pulmonary artery 29 mm Hg.

Conclusion

Global contractile function of the myocardium of the left ventricle is reduced. Zone hypokinesia in the lower - diaphragmatic region of the left ventricle. Moderate dilatation of the left atrium. Myocardial hypertrophy of the left ventricle. The increased pressure in the pulmonary artery.

According to Echocardiography, the results of standard biochemical studies it is impossible to identify the cause of ill health and quality of life of the patient. However, the figures obtained RLP 1.82 nmol MDA/mg protein β-lipoproteins and STC at 1.91 mmol/l indicate reduced siteanalytics status of the patient. Ongoing basic therapy (cardiomagnyl 75 mg 1 time per day; egilok 25 mg 2 razas day; zocor 20 mg 1 time per day) additional assigned thioctacid BV 600 mg of 1 times a day 30 minutes before meals for 30 days.

On re-examination the patient appeared after 30 days. Complaints at the time of inspection does not show. Echocardiography, complete blood count, blood biochemistry is unchanged. RLP 2.8 nmol MDA/ mg protein β-lipoproteins; STC 0.75 mmol/L.

Thus, the timely selection of the patient for TB is being conservative treatment re-NAMED drugs LK has greatly improved his health and to reduce the number of complications.

Example 3

Patient X-n, 51, case history No. 8661. Was on a routine inspection in September 2010. Complaints at the time of inspection does not show. Recorded occasionally from pressing pain in the chest associated with intense physical exercise. History: moved the primary to THEM in 2001; re - for the six months prior to treatment. In the last two months of deterioration were noted. Constantly receives aspirin cardio 100; egilok retard 100 mg 1 time per day; Liprimar 10 mg 1 time per day. According to clinical examination: heart tones are muted, heart rate 76 beats./min, BP 120/80 mm Hg In the lungs vesicular breathing, wheezing no. Peripheral edema no. ECG: sinus rhythm, heart rate 76 beats per minute.

Pathological Q in II, III, aVF leads, V7V8V9ST on the contour of the tooth T slabopolozhitelnym in III, aVF, V7V8V9. Focal changes back (nizhnetierryanshoe and zadnemotornoy) wall of the left ventricle of indeterminate years ago.

Diagnosed with ischemic heart disease, post-infarction (2006; 2010) cardiosclerosis. HSN Art. I FC I-II.

The results of biochemical studies of blood

UFC 18 U/l (normal 24-170 U/l); MV-ck 0 U/l

Test troponin T negative quality

Test troponin T quantitative is not defined

Complete blood count: WBC of 4.6×109/L; BC 4,5×10 12/L; HGB 142 g/L; HCT 35,8 L; MCV 82,1 fL; MCH of 31.4 Pg; MCHC 346 g/L; PLT 263×109/L; neutrophils 61%; stab 5%; segmented 56%; lymphocytes 28%, monocytes 7%, basophils 1%, eosinophils 3%.

Blood glucose 5.3 mmol/l; creatinine 0.11 mmol/l; urea 6 mmol/l; AST 0.28 mmol/l; Alat of 0.56 mmol/l; bilirubin 20,05 µmol/L.

According to the claimed method was determined in the serum level of the RLP, and red blood cell concentration of pyruvic acid STC: RLP 2.9 nmol MDA/mg PL, STC 0,63 mmol/L.

Data Echocardiography: the abdominal Aorta Department 24 mm; Vmax 118 cm/s; arc 21 mm; Vmax in descending division 103 cm/s Upward Department 27 mm Aortic valve FC 32 mm, sash calcified; the amplitude differences of the valves 17 mm; Vmax 138 cm/s regurgitation no. The left atrium 40 mm; the left ventricle: DAC 38 mm; the CRA 54 mm; annuals 11 mm; ssli 12 mm; distance PSMC-annuals 8 mm; CSR 62 cm3; BWW 140 cm3; PP 65 ml; PV 50 %; HR 78 beats./min global contractile function of the myocardium of the left ventricle satisfactory. Area hypokinesia in nizhnetierryanshoe region of the left ventricle. Doppler transmitral thread: M 58 cm/s; And 43 cm/sec. The right atrium 32 mm; right ventricle 33 mm; tricuspid valve is not modified Vmax 250 cm/s; TR I senior GP 24 mm Hg. Pulmonary artery 26 mm. Pressure in the pulmonary artery 21 mm Hg.

Conclusion

Global contractile function of the myocardium of the left ventricle several what about the reduced. Zone hypokinesia in nizhnetierryanshoe region of the left ventricle. Dilatation of the left atrium. Myocardial hypertrophy of the left ventricle. Calcification of the aortic valve.

In the absence of complaints, according to Echocardiography, the results of routine laboratory studies it is impossible to judge about siteanalytics the patient's status and the need for the appointment of protectors. However, the results RLP 2.9 nmol MDA/mg protein β-lipoproteins and STC to 0.63 mmol/l give the opportunity to judge satisfactory siteanalytics condition of the patient and about the lack of inclusion of LC in the treatment regimen. The patient was recommended to continue the previously held therapy: aspirin cardio 100 1 tablet 1 time per day; egilok retard 100 mg 1 time per day; Liprimar 10 mg 1 time per day.

The claimed methods surveyed 93 patients who underwent re-NAMED and examined in 5-8 months from the date of re-development of coronary incident, which in the scheme of complex treatment was included lipoic acid; the average age of patients in this group was 51±7,9 years. The comparison group consisted of 22 patients with coronary heart disease, whose average age was 51±4.2 years.

All patients received basic therapy, which was standardized and included β-blockers, disaggregants, statins, nor the rata inhibitors of angiotensin converting enzyme (ACE) inhibitors or receptor blockers angiotensin II if necessary.

Before treatment the patient is conducting a study of blood and determine the serum level of the RLP, and in erythrocytes determine the concentration of pyruvic acid STC and, when the value of the RLP, equal 1,89 nmol MDA/ mg protein β-lipoproteins and below, and STC, equal 1,81 mmol/l and higher in conservative therapies include drugs lipoic acid. In the treatment regimen of patients from this group in the composition of the basal therapy was included thioctacid BV company MEDA PHARMA GmbH&Co.KG oral dose of 600 mg once daily 30 minutes before meals for 30 days. It is important to specify that patients clinical group our research during the informed destination pathogenetic therapy (lipoic acid) was detected increase of the concentration of RLP 87.5% to 3.60±0.20 nmol MDA/mg protein β-lipoproteins (p<0,001), indicating a decrease in the involvement of lipoproteins in response pereokislenie. The concentration of PVA in this group of patients was decreased by 86,09% to 0.21±0,025 mmol/l (p<0,05), consistent with healthy people. Such dynamics STC due to the influence of LK, which is characterized by reduced inhibitory effect of acetyl-SKoA on piruvatcarboksilazy. Obviously, the simultaneous determination of the level of the RLP and the concentration of PVA allows high accuracy to assess the feasibility of conservative therapy, including preparations of Luke.

Analyzing the results of observation of the clinical status of patients, it should be noted that all patients within 30 days from the start of treatment was noted positive dynamics in the improvement of the General condition. All patients noted an increase vitality, reduce fatigue, weakness, decrease irritability, stabilization of sleep, improvement of the emotional sphere, increase efficiency, increase of interest in life, which attested to the adequacy of treatment.

In accordance with the tasks, along with the assessment of clinical data, dynamic electrocardiogram analysis and key indicators traditional blood tests, patients were graded exercise test, daily ECG monitoring, the study of the main indicators of global and regional systolic and diastolic function of the left ventricle at rest and during exercise stress Echocardiography with dobutamine.

The advantages of the proposed method over the known are that it is simple, specific and facilitates the choice of adequate therapeutic management and increase the effectiveness of treatment.

Thus, the use of the proposed method in clinical practice allows high accuracy to assess the feasibility of conservative therapy, VK is causa drugs lipoic acid and the effectiveness/ineffectiveness of drug therapy in patients with recurrent myocardial infarction in anamnesis received an additional opportunity to reduce unnecessary medical burden on the patient. The method allows to assess more objectively the patient's condition and to identify a group of patients that needs carrying out of conservative therapy, including drugs lipoic acid.

The proposed method is tested on sufficient clinical material and can be recommended for use in cardiology and therapy hospitals.

Implementation of the proposed method in practical medicine will provide a rational policy for the management of patients with CHD who underwent repeated THEM, and prevention of SN, which will reduce the percentage of disability and mortality of patients undergoing repeat THEM.

The method for determining the indications for the choice of tactics of conservative therapy of patients who have a recurrent myocardial infarction by examining the blood, characterized in that prior to treatment the patient is conducting a study of blood and determine the serum level of resistant to oxidation of lipoproteins (RLP)and in erythrocytes determine the concentration of pyruvic acid (PVA) and, when the value of the RLP is 1,89 nmol MDA/mg protein β-lipoproteins and below, and STC is of 1.81 mmol/l and above, conservative therapy includes drugs lipoic acid.



 

Same patents:

FIELD: medicine.

SUBSTANCE: taken venous blood is separated into two samples. The first sample is stabilised with a solution of sodium citrate, the second one - with ethylene diamine tetraacetate. The first sample of whole blood is added with adenosine diphosphate as an aggregation inducer and tested for a peak amplitude of thrombocyte aggregation and a peak amplitude of adenosine triphosphate release profile by impedance method. The second sample is used to measure a fraction of thrombocytes and a fraction of blood corpuscles. It is followed by calculating a thrombocyte aggregation potential index by formula I=LmaxPTCΩmaxHTC100%; wherein Lmax is the peak amplitude of adenosine triphosphate release profile, Ωmax is the peak amplitude of thrombocyte aggregation, PCT is the fraction of thrombocytes, HTC is the fraction of blood corpuscles. If the value I is less than 0.5%, the low clinical effectiveness of the antiaggregant therapy is stated, and the value I being 1.5-2.5% shows the high effectiveness thereof.

EFFECT: improving the objective estimation of the clinical effectiveness of the antiaggregant therapy in the patients with acute coronary syndrome, and providing an opportunity for predicting the clinical course of the disease.

1 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine. A composition for stimulating the skin stem cell production containing interleukin-1 alpha and a dermatologically acceptable diluent or carrier.

EFFECT: invention provides improving the stem cell stimulation.

2 ex

FIELD: chemistry.

SUBSTANCE: method involves dissolving 855 mg of a crystalline hydrate of copper chloride (CuCl2·2H2O) in 100 ml of distilled water (concentration of Cu2+ ions in the prepared solution is 50 mmol/l) and adding 1 ml of the prepared solution to 100 ml of a standard reagent used in glucose oxidase test. The ascorbic acid oxidant used is copper chloride solution in end concentration in the glucose oxidase reagent of 500 mcmol/l.

EFFECT: method enables correct determination of glucose content.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: workers' blood serum is analysed for interleukin 4, protein S-100β, protein S-100 autoantibodies, voltage-dependent Ca-channel autoantibodies, glutamate receptor autoantibodies, γ-aminobutyrate receptor autoantibodies, dopamine receptor autoantibodies; diagnostic coefficients F1 and F2 are calculated; if the value F1 is less than F2, the early changes of the nervous system are diagnosed for the chronic exposure to vinyl chloride; F1 more or equal to F2 enables stating the absence of any signs of the chronic exposure to vinyl chloride. The developed method may be used in the periodic medical screenings, medical examinations of workers to diagnose some occupational diseases.

EFFECT: use of the invention improves higher accuracy of identifying the various signs of the chronic exposure to vinyl chloride through the use of a complex of the immunological structures of nerve tissue in the chronic exposure to vinyl chloride.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention may be used to predict a developing myocardial dysfunction in the children with acute lymphoblastic leukemia (ALL) at different stages of polychemotherapy (PCT). The method involves the blood examination for the iron metabolism parameters, namely before the beginning of polychemotherapy (1) and after the induction of remission (2), blood serum ferritin, hepcidin and iron are evaluated in the patients; the derived values are inserted into the equations to calculate varying ECG, IMS, B(E-Ea) NT-pro-BNP after the completion of the intensive PCT course (3) and the total coefficient K is calculated by formula K=ECG3* IMS3* B(E-Ea)3* NT-pro-BNP3, wherein a probability of the myocardial dysfunction is stated by the total coefficient, namely: the coefficient K> 0.24 ensures predicting the developing cardiac complications, while K <0.24 show a lower risk of the cardiac complications.

EFFECT: possibility to detect a risk of the developing myocardial dysfunction accompanying the early PCT by the biochemical parameters, namely in terms of iron metabolism.

1 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: method consists in determining a characteristic profile of a test sample of a human biological fluid. It is concentrated off-line. Biologically active substances are separated using complexing additives, and a 'reference' is determined. Steroid hormones are taken as the analysed biologically active substances. The hormones are separated by performed by reversed-phase HELC in gradient elution using a diode array detector. The steroid profiles are used to form a matrix of the analytical signal intensities and the retention factors of each steroid. Each sample is graphically imaged by method of principal components, and the graphical images are used to form 'reference' and deviation clusters. The 'reference' and deviation clusters are corrected by soft independent modelling of class analogy taken as a reference. The pathologies are diagnosed by an ability of the patient's image to come with a 'reference' or a deviation.

EFFECT: reliable diagnosis of the pathologies associated with adrenal cortical diseases.

6 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: what is presented is a method for prediction the efficacy of the anti-TNF therapy in the patients with rheumatoid arthritis on the basis of genetic typing the polymorphisms of TNF-alpha proinflammatory cytokine. The allelic polymorphism of the TNF-alpha gene promoter is studied in position 857. If the heterozygous state (genotype - 857ST) or the homozygous T allele carriers (genotype - 857TT) is identified, a high probability of the successful infliximab therapy is predicted. If identifying the homozygous allele C carrier in position - 857 of the TNF-alpha gene promoter (genotype - 857SS), a high probability of the failed infliximab therapy is predicted.

EFFECT: invention enables the rapid and effective prediction of the clinical outcome of the anti-TNF therapy in the patients with rheumatoid arthritis by one polymorph position.

2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: menopausal women with an endometrial hyperplastic type having complaints about spotting undergo biopsy of the lining of the uterus to determine endometrial progesterone and testosterone, if observing progesterone falling within the range of 2.0 to 7.0 ng/g of tissue and testosterone falling within the range of 4.0 to 8.8 ng/g of tissue, developing endometrial cancer is predicted, while progesterone within 24.0 to 29.6 ng/g of tissue and testosterone within 16.8 to 22.4 ng/g of tissue enable predicting developing uterine fibroid. The technical and economic effectiveness of the method consists in the fact that the detected levels of progesterone and testosterone in the intact endometrial tissue in the menopausal patients with a hyperplastic type are high-information laboratory indicators of the presence of either malignant, or benign uterine pathology, which can be used to form the groups of patients with the high risk of malignancy in the body of the uterus.

EFFECT: method is available, quick to implement.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: laboratory diagnostic technique for the small-dose poisoning with organophosphorous agents consists in assessing catalytic activity of blood plasma aryl esterase heated to 55°C for 5 min with indophenyl acetate used as a substrate. Catalytic activity of the enzyme and its increase after heating are assessed once after a contact with a organophosphorus agent; the effect of increasing catalytic activity of blood plasma aryl esterase after heating is expressed in %, taking catalyst activity of blood plasma aryl esterase before heating as 100%. In case activity of plasma aryl esterase after heating is increased by more than 20%, the small-dose poisoning with organophosphorus agents is diagnosed.

EFFECT: use of the declared technique enables stating effectively the fact of the small-dose poisoning with OFAs in the absence of any clinical signs of poisoning.

1 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: method for prediction the recurrence-free survival period in cervical cancer (CC) is implemented by blood plasma catalase activity test, and the local process of cervical cancer (FIGO stage Ib-IIa) with activity 0.041 to 0.113 mmol/min/l in the patients enables predicting 50% probability of the 18-month period of the recurrence-free survival period, while blood plasma catalase activity 0.008 to 0.035 mmol/min/l shows 80% probability of the recurrence-free survival period.

EFFECT: prediction of the recurrence-free survival period in local cervical cancer.

6 ex

FIELD: medicine.

SUBSTANCE: instant diagnostic technique for enterovirus antigens in cerebrospinal fluid by detecting the antigens in a biological material by conducting modified complement binding; the biological material is cerebrospinal fluid added with hemolytic serum; then the analysed samples are settled under certain conditions; that is followed by quantitative measurement of oxidase enzymes by tetramethylbenzidine; and in the presence of the antigen in the analysed material, enteroviral infection is diagnosed.

EFFECT: technique enables higher diagnostic accuracy in the enterovirus antigens in cerebrospinal fluid that enables the further prediction both of the clinical course, and of the clinical outcome.

3 ex

FIELD: medicine.

SUBSTANCE: whole venous blood of pregnant women is examined. Specific induction by biological titration is followed by interferon a (IFN-α) and IFN-γ production tests. If the relation IFN-α/IFN-γ exceeds 5, premature birth and intrauterine infection is predicted.

EFFECT: higher accuracy of predicting premature birth with a possibility to choose an adequate preventive treatment.

3 ex

FIELD: medicine.

SUBSTANCE: histochemical study of the primary tumour preparations is conducted, and a histogenetic type of breast cancer is determined. Additionally, a distribution pattern of the receptor to oestrogen expression is described as follows: homogeneous one in the uniform, only severe, only moderate or only mild expression, heterogeneous one - in various combinations of the severe, moderate or mild expression, and negative one, with taking into account the stage of the process and the extent of a surgery performed. A regression value in a surgical scar is calculated by the presented formula.

EFFECT: higher accuracy and information value of the prediction procedure.

3 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: technique involves the stages of immobilising an antigen into the wells of a polystyrene 96-well plate, binding the antigen to a biotylated antigen, conducting a reaction of the biotylated antigen and a streptavidin complex (a complex of streptavidin - biotin - DNA target), conducting a real-time polymerase chain reaction using a fluorescent probe. What is used is the DNA target with a sequence: ACCAOCTCCCCACCACTOCCAACCACCTCOCOTA GGATAGAGTCAGTCCTTGGCCTCCTTGGCCCAGTTAAGAAGTTGCAGCC ACACACGCTGTTGTTGGGTTCGGGGCGGAGTTGCAGCCATCTACACAA ACGATACCCTCGTGCAGCTGGAGAAGCAGCACGGCCTATTACCTGGAG GAGGATCGAAACTGA, and the monoclonal antibody 15B3. The antibody reacts with a pathogenic prion protein, but not with a normal one, and detects PrPSc in homogenates of the infected material without the need of action of proteinases. The technique enables simplifying the real-time immuno-PCR method and increasing its sensitivity by immobilising the antigen on a plate substrate with using no capture antibodies, as well as using the DNA target having no homology with the GenBank database sequences.

EFFECT: reducing a risk of false responses as a result of exogenous contamination.

6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: blood plasma is examined for a prothrombin index, a liver size projecting from an arch of a costal arch is measured, a diseases length as shown by anamnestic data and patient's age at the moment of examination are specified, and a stage of chronic hepatitis C (SCHC) is calculated by a specific formula. The value of 0≤SCHC≤0.50 enables diagnosing a stage of chronic hepatitis C involving no liver tissue fibrosis; the value of 0.51≤SCHC≤1.50 shows a minimal stage, the value of 1.51≤SCHC≤2.50 - a moderate stage, while the value of 2.51≤SCHC≤3.50 provides stating a manifested stage and a cirrotic stage is shown by the value of SCHC≥3.51. The declared technique is the non-invasive diagnostic technique for a stage of CHC in the RNA-HCV "+" patients.

EFFECT: ease to use, lower price, higher accuracy, applicability for regular medical check-ups and enabled well-timed solution of a problem of the beginning of an antiviral therapy.

1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: flap is visually inspected, and further the parameters of oxygenation and carbon dioxide saturation in the myocutaneous flap are measured, and when the level of oxygenation occurs to decrease provided a steady increase in the degree of carbon monoxide saturation, the functional consistency is stated.

EFFECT: use of the declared method enables improving the accuracy and timeliness of analysing the functional consistency of the myocutaneous flap accompanying the repair interventions in treating skin and soft tissue tumours.

2 cl, 4 ex

FIELD: medicine.

SUBSTANCE: method for predicting the developing two-wave clinical course of tick-borne encephalitis by blood analysis, wherein patient's thrombocytes are examined for serotonin, and if the value is more than 200 ng/ml, the single-wave clinical course of the disease is predicted, while the value less than 200 ng/ml shows the two-wave clinical course.

EFFECT: method simplifies and accelerates the early prediction of the two-wave clinical course of tick-borne encephalitis; it is a high specific and sensitive.

3 ex

FIELD: medicine.

SUBSTANCE: blood serum of a patient with acute inflammatory polyneuropathy is examined by ELISA as shown by a biomarker of neurofilament heavy-chain (NfH), and if the value NfH is more than 0.144 ng/mL, developing respiratory failure requiring artificial pulmonary ventilation (APV) and developing manifested bulbar syndrome requiring tube feeding are predicted. The values NfH falling within the range of 0.094-0.144 ng/mL enable predicting developing manifested bulbar syndrome requiring tube feeding and either developing respiratory failure requiring no artificial pulmonary ventilation (APV), or no respiratory failure. If the value is less than 0.094 ng/mL, either developing bulbar syndrome requiring no tube feeding, or no bulbar disorders, and no respiratory failure are predicted.

EFFECT: use of the declared method enables the high-sensitivity and specificity prediction of developing severe clinical presentations of the disease, such as developing respiratory failure requiring artificial pulmonary ventilation, and bulbar disorders requiring tube feeding on the first days of the disease.

1 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: in the method of choosing a surgical approach to sialolithiasis, while localising a concretion in the parotid or submaxillary duct, the Lithos System diagnostic kit is presented to be used to examine a sample of non-stimulated saliva from the gland duct. In the presence of the radially directed leave-shaped structures at the facie edge, a concretion is suggested to be removed with the salivary gland, while in the absence of the radially directed leave-shaped structures at the facie edge, the concretion is recommended to be removed from the duct with the salivary gland preserved.

EFFECT: method enables the timely appropriate treatment, improved quality of life of these group of patients.

2 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: erythrocyte suspension of healthy individuals and sterile patients are pre-tested; average suspension cell velocities, minimum, average and maximum diameters thereof are measures while exposed to an alternating-electric field. These data are used to determine the electrical and viscoelastic erythrocyte parameters. The similar measurements of the erythrocyte samples are performed in a potentially sterile patient. The derived data are compared to the relevant corresponding values in a group of healthy individuals. If observing more than 60% of the parameters different from those in the group of healthy individuals, and incoming to the boundary values for the group of sterile patients, the patients suffering sterility undetectable by existing methods and caused by impaired microcirculation leading to ischemia are found.

EFFECT: method enables choosing the further therapeutic approach, decreases the complexity of the study.

1 tbl, 6 ex

FIELD: medicine, psychiatry.

SUBSTANCE: one should isolate DNA out of lymphocytes of peripheral venous blood, then due to the method of polymerase chain reaction of DNA synthesis one should amplify the fragments of hSERT locus of serotonin carrier gene and at detecting genotype 12/10 one should predict the risk for the development of hallucino-delirious forms of psychoses of cerebro-atherosclerotic genesis.

EFFECT: more objective prediction of disease development.

3 ex

Up!