Polypeptides competitively inhibiting gq-protein, methods of their production and application

FIELD: biotechnology.

SUBSTANCE: polypeptides for the prevention or treatment of myocardial hypertrophy correspond to sequences of amino acids SEQ ID NO:2-3, 5-8. The composition for prevention or treatment of myocardial hypertrophy comprises a polypeptide corresponding to sequences of amino acids SEQ ID NO:2-3, 5-8, and pharmaceutically acceptable additives. The method of production of the said polypeptides comprises a step of synthesis of the polypeptide with the amino acid sequence SEQ ID NO:2-3, 5-8 in a synthesizer of polypeptides or ligation of the corresponding nucleotide sequence with the vector to form a recombinant vector, transformation of the said recombinant vector into a host cell, induction of expression of the said polypeptide in the said host cell, and isolating of the said polypeptide.

EFFECT: invention enables to produce new polypeptides for prevention or treatment of myocardial hypertrophy.

12 cl, 6 dwg, 9 tbl, 8 ex

 

The technical field

The present invention relates to the polypeptide. More specifically, the present invention relates to peptide - competitive inhibitor of Gq-protein α. The present invention also relates to a method for the specified polypeptide composition containing a specified polypeptide, and the use of the specified polypeptide to obtain drugs for reversal of the restructuring of the myocardium.

The level of technology

The restructuring of the myocardium (known as myocardial hypertrophy) is a symptom in which the number of cardiocytes constantly, but the amount of cardiocytes increased. This phenomenon is a joint response cardiocytes to various pathological stimuli, and may be the result of hemorheological effects of incentives, such as hypertension, heart disease, acute myocardial infarction, congenital heart disease and is caused by physical stress increase blood pressure, as well as humoral regulators, such as endothelin, angiotensin II, catecholamines, transforming growth factor β and interleukin-1, and is therefore characterized by an extremely high prevalence of[1]. For only one hypertension incidence in the West is 15-20%. Despite the fact that in China, the incidence is slightly lower number of patients exceeds 150 is illionos. Myocardial hypertrophy may be accompanied by some compensation at the initial stage of development of this symptom. With the development of this condition is myocardial hypertrophy can lead to dysfunction of the heart due to the development of abnormalities such as diffuse rearrangement of the fibers of the myocardium and disorders of contractile activity of the heart, and such diseases, and in the future may lead to heart failure. Myocardial hypertrophy is a major mortality factor, as it may lead to heart failure, which, in turn, leads to death. Thus, the search for specific medicines that are effective for the treatment and control of hypertrophy of the myocardium, is not only a subject of study and current research task, but also one of the main tasks in the field of health, which requires immediate solutions around the world.

At the present time there is no clinical therapeutic drugs specifically for the treatment of hypertrophy of the myocardium, mainly due to multiple etiologies and the complexity of the mechanism underlying this condition. Studies have shown that stimulation of stretch-induced changes in hemorheological parameters or humoral endocrine regulators (PR is dstanley a reverse causality in the development of this disease), may cause pathological responses, such as myocardial hypertrophy, interstitial fibrosis, and others, almost all of which are mediated by through appropriate receptors and postreceptor signal transmission[2]. Based on these data, attempts were made different therapies aimed at addressing the etiological causes hypertrophy of the myocardium with the use of endothelin antagonist, antihypertensive drugs, angiotensin-converting enzyme and other drugs that have been shown some effectiveness. However, since many factors and receptors involved in the development of pathological response and, in addition, the above antagonists/inhibitors can cause an increase regulation of the receptors and increased compensatory secretion of ligands to other related receptors in suppression of the functions of signaling molecules, the effect of the treatment is very limited[3-6]. Thus, there is an expressed need for the development of specific drugs for prevention and treatment with the involvement of more fundamental mechanisms.

G-proteins are heterotrimeric GTP-binding proteins composed of subunits α, β and γ and play a key role in lane is giving stimulating signals from the extracellular space into the cell. Norepinephrine (NE), endothelin (ET), angiotensin II (Ang II) and similar substances are agonists α1-AR, AT1receptors and endothelin receptor, respectively, then activates the effector enzyme phospholipase C (PLC-β), with the participation of G-proteins of the Gq family, with the specified enzyme, in turn, affects PIP2obtaining a DAG and PIP3; and induce the expression of embryonic genes in the cell, usually via the signal path of the DAG-PKC-Ras-MAPK and IP3-Ca2+-CaN/CaMPK II-NFAT3/GATA-4, which leads to the transformation of the infarction. In addition to activation of Raf1, mediated by integrins, the factors that enhance stretching can stimulate the secretion of Ang II, NE and ET1and, thus, are also closely connected with Gq. In addition, the experiments showed that: (1) the pathological process of rebuilding the myocardium signal Gq is largely redundant and is much higher than the physiological signal Gq in normal tissues, at the same time as the function and morphology of cardiocyte not significantly change with increased expression of Gqα twice (or below); myocardial hypertrophy and contractile function of the heart occur when increased expression of Gqα four times, heart failure occurs when the increased expression of Gqα approximately eight times; (2) overexpression of the gene Gqα inherent in transgenic about the Sabbath.the organisms, in the heart of the mouse can induce significant myocardial hypertrophy and fatal heart failure in an animal; (3) blocking the expression of Gqα in heart can significantly attenuate the hypertrophic response of the heart to increase pressure[7-9]. Thus, it is possible to see that Gqα plays a Central role in the emergence and development of the restructuring of the myocardium and is regarded as a common target for many signaling pathways and key signaling element for adjustment /hypertrophy of the myocardium caused by various factors. Thus, it is expected that the regulation of Gqα can become a new strategy and may be successful for reversion adjustment /hypertrophy of the myocardium.

However, transgenic animals represent a class of animals that are artificially introduced exogenous gene stably integrated into the chromosomal genome and could be transmitted by inheritance. The principle of obtaining transgenic animals is as follows: interest gene/gene fragment, isolated by methods of molecular biology, is introduced into the zygote/preimplantation embryonic cells of experimental animals with different genetic procedures introduced zygote/preimplantation embryonic stem cells are then transplanted into the fallopian tubes or the uterus of the animal is about the recipient and expect development of transgenic animal, carrying the exogenous gene. The operation of this exogenous gene assessed by analysis of the degree of integration of the exogenous gene in the transgenic animal and the phenotype of the transgenic animals, and those animals which are obtained by genetic engineering and have the best qualities bred with conventional methods of genetic selection. Thus, on the basis of current technology treatment of adult patients with acquired re-infarction/hypertrophy using transgenic methods impractical and irrational. In addition, blocking the expression of Gqα in the heart will lead to severe toxic side effects, as Gqα also has important physiological functions. Thus, these two strategies and methods described above have no practical value in clinical control adjustment /hypertrophy of the myocardium.

In this regard, the inventors have obtained a series of polypeptides with significant activity against reversion adjustment infarction/hypertrophy using systematic methods, such as molecular design, optimization, genetic engineering, obtaining polypeptides, screening in vitro and in vivo activity and other methods.

Description of the invention

Taking into account these shortcomings, the current known solutions, the present invention is to obtain a series of polypeptides, which not only have therapeutic activity against reversion hypertrophy of the myocardium, but also can be easily obtained at low cost and ready for implementation in the production and commercialization.

Another objective of the present invention is the provision of a method of obtaining a series of polypeptides, the method should be simple, cost-effective and should produce a series of polypeptide products of high purity, with its superior performance activity against reversion hypertrophy of the myocardium.

Another objective of the present invention is the provision of a composition containing the polypeptide and the use of this polypeptide to obtain drugs for the treatment of the restructuring of the myocardium.

To achieve the objective of the present invention was first derived polypeptide in accordance with the sequence of the polypeptide Gqα, the amino acid sequence of which is presented in SEQ ID NO:1 (sequence pentamethylheptane) and has activity against reversion myocardial hypertrophy.

In a preferred embodiment of the invention, the polypeptide proposed according to the present invention, the stand is made by a polypeptide, obtained by deletion of at least one amino acid residue in any position starting from the first amino acid from the N-end of the sequence SEQ ID NO 1, while maintaining at least 12 amino acid residues from the C-end of a specified polypeptide.

In a preferred embodiment of the invention, the polypeptide proposed according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:2 (sequence pentamethylheptane), which is obtained by deletion of amino acid residues in positions 1-10 from N-Terminus sequence is SEQ ID NO:1.

In a preferred embodiment of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:3 (sequence pentatricopeptide), which is obtained by deletion of amino acid residues in positions 1-20 N-end of the sequence SEQ ID NO:1.

In a preferred embodiment of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:4 (sequence triacetate), which is obtained by deletion of amino acid residues in positions 1 to 25 from N-Terminus sequence is SEQ ID NO:1.

In preferred options the ante implementation of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:5 (sequence heptacosane), which is obtained by deletion of amino acid residues in positions 1 through 28 N-end of the sequence SEQ ID NO:1.

In a preferred embodiment of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:6 (sequence pentecontaetia), which is obtained by deletion of amino acid residues in positions 1 to 30 from the N-end of the sequence SEQ ID NO:1.

In a preferred embodiment of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:7 (sequence icosapentate), which is obtained by deletion of amino acid residues in positions 1 to 35 from N-Terminus sequence is SEQ ID NO:1.

In a preferred embodiment of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:8 (sequence heptadecapeptide), which is obtained by deletion of amino acid residues in positions 1 to 38 from N-Terminus sequence is SEQ ID NO:1.

In prefer enom variant implementation of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:9 (sequence pentadecapeptide), which is obtained by deletion of amino acid residues in positions 1 to 40 N-end of the sequence SEQ ID NO:1.

In a preferred embodiment of the invention, the polypeptide according to the present invention is a polypeptide, the sequence of which is presented in SEQ ID NO:10 (sequence dodecapeptide), which is obtained by deletion of amino acid residues in positions 1 to 43 from N-Terminus sequence is SEQ ID NO:1.

Polypeptide proposed in the present invention, may also be a polypeptide which is obtained by replacement, deletion or addition of one or more amino acids in any of the above polypeptide sequences, and has properties for reversion of adjustment of the myocardium that is identical or similar to the action of this polypeptide with the above sequence.

Polypeptide proposed in the present invention, may also be a polypeptide that includes the above-described polypeptide sequence and has properties for reversion of adjustment of the myocardium.

The invention also includes nucleotide sequences encoding either the polypeptides described:

the nucleotide sequence presented in SEQ ID NO:11 encoding a polypeptide presented in SEQ ID NO:1;

the nucleotide sequence presented in SEQ ID NO:12 encoding the polypeptide presented in SEQ ID NO:2;

the nucleotide sequence presented in SEQ ID NO:13 encoding the polypeptide presented in SEQ ID NO:3;

the nucleotide sequence presented in SEQ ID NO:14 encoding the polypeptide presented in SEQ ID NO:4;

the nucleotide sequence presented in SEQ ID NO:15 encoding the polypeptide presented in SEQ ID NO:5;

the nucleotide sequence presented in SEQ ID NO:16, encoding the polypeptide presented in SEQ ID NO:6;

the nucleotide sequence presented in SEQ ID NO:17 encoding the polypeptide presented in SEQ ID NO:7;

the nucleotide sequence presented in SEQ ID NO:18, encoding the polypeptide presented in SEQ ID NO:8;

the nucleotide sequence presented in SEQ ID NO:19, encoding the polypeptide presented in SEQ ID NO:9;

the nucleotide sequence presented in SEQ ID NO:20 encoding the polypeptide presented in SEQ ID NO:10,

According to the present invention also proposed a recombinant vector, which contains any of the above nucleotide sequences.

In another preferred embodiment, i.e. monitoring) reference and inventions, the recombinant vector contains a T7 promoter.

In a preferred embodiment of the invention the recombinant vector contains the nucleotide sequence and plasmid pIVEX2.3MCS.

According to the present invention also proposed a composition containing the above-described polypeptides and pharmaceutically acceptable additives.

In a preferred embodiment of the invention the composition is a composition for parenteral injection.

In another aspect according to the present invention it is proposed to use the above-described polypeptide to obtain drugs for the treatment of hypertrophy of the myocardium.

In a preferred embodiment of the invention, the proposed polypeptide performs the function of the active ingredient in the medicinal product, which also includes pharmaceutically acceptable additives.

In another aspect according to the present invention, a method for obtaining a polypeptide, comprising the step of synthesis of the polypeptide in accordance with the above-described amino acid sequences in the polypeptide synthesizer.

According to the present invention proposed a method of producing polypeptides comprising the following stages: ligation of the corresponding nucleotide sequences from the vector with the formation of recombi is based vector; the transformation of the indicated recombinant vector into the cell host; the induction of expression of the specified polypeptide in said cell host; and the allocation of the specified polypeptide.

In a preferred variant implementation of the method of producing the polypeptide of the recombinant vector contains a T7 promoter.

In a preferred variant implementation of the method of producing the polypeptide, the vector is a plasmid, and a host cell is an E. coli cell.

In a preferred embodiment of the invention for obtaining a polypeptide using plasmid pIVEX2.3MCS, a E.coli. represents E. coli. the BL21 strain.

For the above-mentioned variants of the invention provides that a series of polypeptide obtained by deletion of a certain number, but at least one amino acid residue in any position starting from the first amino acid residue from the N-Terminus amino acid sequence of SEQ ID NO:1 in the direction of the C-end of this sequence, which is a gradual decrease in the N-terminal sequence up to 43 deletions of amino acids while maintaining only 12 amino acid residues from the C-end of the sequence. On the basis of this inventive concept have been optimized gene and the molecular structure of antepenultimate, length antepenultimate was successfully juice is asana 78.2% with the preservation and enhancement of its activity, and analyzed polypeptides were successfully synthesized with 99.2 percent purity through the use of advanced methods for the synthesis of peptides and in the presence of all key parameters for implementation in production.

The present invention also allows you to successfully obtain the desired polypeptide by genetic engineering methods. Because the full length gene antepenultimate is only 165 BP and 180 BP after adding restriction sites, we chose a method in which two parts of this gene (consisting of 4 fragments) were separately synthesized and then cloned in the expression vector. Was constructed expression plasmid pIVEX2.3MCS2-antepenultimate containing a full-sized gene antepenultimate under the control of the T7-promoter. It made possible the successful expression of antepenultimate using this expression plasmids in prokaryotic cell under the control of the T7-promoter.

In the framework of the present invention was carried out a more systematic study of the pharmacodynamics of the investigational polypeptide using methods such as light microscopy, electron microscopy, direct weighing, color ultrasound b-type, and other methods and it was shown that the pharmacodynamic parameters characteristic is caresource significant efficiency. When conducting this study, it was shown that the polypeptide is characterized by good efficacy for prophylaxis in in vitro models of hypertrophy cardiocytes induced by various factors, such as angiotensin II, norepinephrine, and other factors; has a very good inhibitory effect on the activity change MARK, stimulated by the action of angiotensin II, and other factors; has good therapeutic effects on myocardial hypertrophy in mice in the normal model of the inverted coarctation of the thoracic aorta obtained by surgical intervention in vivo. B the framework of the present invention was carried out a more systematic study of the pharmacodynamics of the investigational polypeptide using methods such as light microscopy, electron microscopy, direct weighing, color ultrasound b-type and other methods and it was shown that the pharmacodynamic parameters are characterized by significant efficiency. When conducting this study, it was shown that the polypeptide is characterized by good efficacy for prophylaxis in in vitro models of hypertrophy cardiocytes induced by various factors, such as angiotensin II, norepinephrine, and other factor is mi; has a very good inhibitory effect on the activity change MARK, stimulated by the action of angiotensin II, and other factors; has a positive therapeutic effect on myocardial hypertrophy in mice in the normal model of the inverted coarctation of the thoracic aorta obtained by surgical intervention in vivo, and myocardial hypertrophy, caused by acute volume overload in normal rats; it was also shown a clear effect on the reversion of adjustment of the myocardium, the reversion of pathological thickening of the walls of blood vessels and lowering blood pressure in rats with spontaneous hypertension.

In the preliminary safety assessment has been shown that the observed polypeptide is extremely safe for injection. (1) the Test for cytotoxicity: cytotoxicity absent (negative). (2) Test for genotoxicity: genotoxicity absent (negative). (3) mutagenicity Test (Ames test): mutagenic effect is absent (negative). The maximum allowable dose of the investigational polypeptide in mice exceeds the minimum value of 50 mg/kg, the limit dose to effective dose exceeds the minimum value of 500; where the ratio of the LD50 for mice usual dose (clinical dose was converted into dose for a mouse) captopril, Losartan, and n is Filipina, typical anti-hypertensive drugs with effect reversal of hypertrophy of the myocardium, 388, 349 and 157, respectively, which indicates that the safety of the investigational polypeptide is significantly higher than the security of the above medicines. Moreover, did not observe the development of any toxic unwanted effects when conducting this test.

DESCRIPTION of GRAPHIC MATERIALS

Figure 1. Changes in the morphology of the tissues of the heart muscle in the model group rats with spontaneous hypertension (SHR).

Figure 2. Changes in the morphology of the tissues of the heart muscle in the model group treated with losartan.

Figure 3. Changes in the morphology of the tissues of the heart muscle in the group treated with heptaacetate.

Figure 4. Changes ultramicrostructure tissue of cardiac muscle in the model group rats with spontaneous hypertension.

Figure 5. Changes ultramicrostructure tissue of cardiac muscle in the group treated with losartan.

6. Changes ultramicrostructure tissue of cardiac muscle in the group treated with heptaacetate.

EXAMPLES

The invention is illustrated in more detail under a separate implementation variant in combination with the figures.

Example 1: Solid-phase synthesis of polypeptide

1. The process of synthesis and purification of heptaacetate

25 g of resin (Kee is hydrated Deputy 0.6 mmol/g) was used to obtain in laboratory scale in the following steps. In the industrial scale used 1 kg of the resin, in proportion to increased loading of nutrients input and increased reaction time.

1.1 synthesis of heptaacetate

1. Preparing an accurately weighed sample (25 g of Fmoc-Val-Wang resin was placed inside the reactor with a capacity of 1000 ml, then added dichloromethane, shaken and stirred for 30 minutes, washed with respectively 500 ml of dichloromethane, methanol and dimethylformamide twice and was filtered using a pump to remove solvent.

2. Added 500 ml of 20% piperidine/dimethylformamide, was dissolved at room temperature and reaction was performed for 30 minutes to remove the N-terminal Fmoc protective group. After removal of the solvent by filtration using a pump the resin was washed with 500 ml of dichloromethane, methanol and dimethylformamide twice and the solvent was removed by vacuum filtration.

3. Prepared sample of 21.2 g of Fmoc-Leu-OH and 22.8 g of hexaflurophosphate 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium (HBTU) and was dissolved in 500 ml of dimethylformamide was then added 40 ml of diisopropylethylamine and carried out the reaction at room temperature for 30 minutes under stirring. The mixture then was placed in the reactor, and reaction was performed at room temperature for 2 hours with shaking. After removal of the reaction liquid is barb by filtration using a pump the resin was washed with 500 ml of dichloromethane, methyl alcohol and dimethylformamide twice and the solvent was removed by vacuum filtration.

4. Repeating steps 2 and 3, all conditions were kept unchanged and actions were identical except that in Step 3 was added to the amino acid Fmoc-Asn(Trt)-OH in the amount 35,8 g, and the reaction time was 3 hours.

5. Repeating steps 2 and 3, and all conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Tyr(tBu)-OH in the amount of 27.6,

6. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Glu(OtBu)-OH in the amount of 25.5.

7. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Lys(Boc)-OH in the amount 28,1,

8. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Leu-OH in the amount of 21.2,

9. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Asn(Trt)-OH in the amount 35,8,

10. Repeating steps 2 and 3, and all other conditions were the OS is aulani without changes and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Leu-OH in the amount of 21.2,

11. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Gln(Trt)-OH in the amount of 36.7,

12. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Leu-OH in the amount of 21.2,

13. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-IIe-OH in the amount of 21.2,

14. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Thr(tBu)-OH in the number of 23.9,

15. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Asp(OtBu)-OH in the amount of 24.7,

16. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Lys(Boc)-OH in the amount 28,1,

17. Repeating steps 2 and 3, and all other conditions were kept unchanged and Astia were identical, except that in Step 3 was added to the amino acid Fmoc-Val-OH in the amount of 20.4,

18. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Ala-OH in the amount of 19.8,

19. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Ala-OH in the amount of 19.8,

20. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Phe-OH in the amount of 23.2 g

21. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Val-OH in the amount of 20.4,

22. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Phe-OH in the amount of 23.2 g

23. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Arg(pbf)-OH in the amount 39,0,

24. Repeating steps 2 and 3, and all other conditions were kept unchanged and deactivable identical, except that in Step 3 was added to the amino acid Fmoc-IIe-OH in the amount of 21.2,

25. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Asn(Trt)-OH in the amount 35,8,

26. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Glu(OtBu)-OH in the amount of 25.5,

27. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Thr(tBu)-OH in the number of 23.9,

28. Repeating steps 2 and 3, and all other conditions were kept unchanged and actions were identical, except that in Step 3 was added to the amino acid Fmoc-Asp(OtBu)-OH in the amount of 24.7,

29. Added 500 ml of 20% piperidine/dimethylformamide, was dissolved at room temperature and reaction was performed for 30 minutes to remove the N-terminal Fmoc protective group. After removal of the solvent by vacuum filtration the resin was washed with 500 ml of dichloromethane, methanol and dimethylformamide twice and was filtered using a pump to remove solvent. The resin was dried in vacuum overnight.

30. The dried resin was weighed, about the th weight was 68 g, the increase in weight was 43, the Resin was placed in a round bottom flask with a capacity of 250 ml, was added 150 ml of a mixture of triperoxonane acid/TA/1,2-ethane dithiol/ TIS/H2O/phenol ratio 7:1:1:0,1:0,35/0,5 and stirred at room temperature for 4 hours. The resin was separated from the filtrate by filtration using a pump, to the filtrate was added 2000 ml of ethyl ether at 0°C and the resulting precipitate was separated from the ethyl ester by centrifugation and then dried to obtain a mass of 40 g of the crude product containing heptaacetate.

1.2 purification Method of heptaacetate

1.2.1 Liofilizovannye sample of the crude product containing heptaacetate was dissolved in dimethyl sulfoxide, was divided using the system for reversed-phase high-performance liquid chromatography and was suirable along the gradient. Fractions of the main peak of heptaacetate were collected, combined and subjected to repeated freeze-drying to obtain purified primary raw material heptaacetate. Liofilizovannye product after the initial purification was dissolved in 15% acetonitrile and subjected to secondary purification using the system for reversed-phase high-performance liquid chromatography. Collected fractions of the main peak, it was removed pollutants near the ground is the main peak, were combined and subjected to repeated freeze-drying to obtain purified heptaacetate.

1.2.2 Conditions for chromatography:

the equipment for carrying out chromatography: equipment for conducting liquid chromatography Varian prepstar and software for management and analysis;

the chromatographic column; chromatographic column C18(250×50 mm)filled with Load & Lock;

the mobile phase A: 0.05% of TFA/2% acetonitrile/water; B: 90% acetonitrile/water; gradient elution: initial cleaning: 8-8-32-57% mobile phase B for 70 minutes, the level gradient within 5 minutes; secondary treatment: 0-0-34-55% mobile phase B for 70 minutes, the level gradient within 5 minutes.

the wavelength of UV detector: 275 nm.

2. Methods synthesis and purification of antepenultimate

25 g of resin (permanent Deputy 0.6 mmol/g) was used to obtain in laboratory scale in the following stages. In the industrial scale used 1 kg of the resin, in proportion to increased loading of nutrients input and increased reaction time.

1. Preparing an accurately weighed sample (25 g resin Fmoc-Val-Wang and placed inside of the reactor with a capacity of 67,63 FL oz (2 l)was then added dichloromethane was shaken and kept for 30 minutes, washed, respectively, in 500 ml of dichloromethane, methanol and digitiform the foreign Ministry twice and subjected to vacuum filtration to remove solvent.

2. Added 500 ml of 20% piperidine/dimethylformamide, stirred at room temperature and reaction was performed for 30 minutes to remove the N-terminal protective group is Fmoc. After removal of the solvent by filtration using a pump the resin was then washed with 500 ml of dichloromethane, methanol and dimethylformamide twice and the solvent was removed by vacuum filtration.

3. Prepared sample of 21.2 g of Fmoc-Leu-OH and 22.8 g hexaphosphate 2-(1H-benzotriazol-1-yl)-1,1,3,3-tetramethyluronium and was dissolved in 500 ml of dimethylformamide was then added 40 ml of diisopropylethylamine and carried out the reaction at room temperature for 30 minutes under stirring. Then the resulting mixture was placed in a reactor and the reaction was performed at room temperature for 2 hours with shaking. After removal of the reaction liquid by filtration using a pump the resin was washed with 500 ml of dichloromethane, methanol and dimethylformamide twice and the solvent was removed by vacuum filtration.

4. Repeated washing and removing the protective group in Stages 2 and 3 and these amino acids are successively introduced to the reaction with the last amino acid.

5. Added 750 ml of a mixture of 20% piperidine/ dimethylformamide, stirred at room temperature and reaction was performed for 30 minutes to remove the N-terminal protective is the Fmoc group. Then solvent was removed by filtration using a pump, the resin then was washed with 500 ml of dichloromethane, methanol and dimethylformamide twice, and the solvent was removed by filtration using a pump. The resin was dried in vacuum overnight.

6. The dried resin was weighed: total weight was 113 g, the increase in weight was 88, the Resin then was placed in a round bottom flask with a capacity of 250 ml, then added to 8.45 FL oz (250 ml) of the mixture triperoxonane acid/TA/1,2-ethane dithiol/TIS/N2O/phenol 7:1:1:0,1:0,35/0,5 and stirred at room temperature for 4 hours. The resin was separated from the filtrate by filtration using a pump, to the filtrate was added to 3000 ml of ethyl ether at 0°C, the precipitate was separated from the ethyl ester by centrifugation and then dried to a weight of 85 g of the crude antepenultimate.

7. Cleaning method and conditions for chromatography were determined with reference to the same stages related to obtaining heptaacetate.

3. The method of synthesis and purification of dodecapeptide.

1-4. Those same stages as and when receiving antepenultimate.

5. Added 500 ml of a mixture of 20% piperidine/dimethylformamide, was dissolved at room temperature and reaction was performed for 30 minutes to remove the N-terminal protective group is Fmoc. Then delete R is storytell by filtration using a pump, the resin was then washed with 500 ml of dichloromethane, methanol and dimethylformamide twice and the solvent was removed by vacuum filtration. The resin was dried in vacuum overnight.

6. The dried resin was weighed: total weight was 46 g, weight gain was 21, the Resin was placed in a round bottom flask with a capacity of 250 ml, was then added 100 ml of a mixture of triperoxonane acid/TA/1,2-ethane dithiol/TIS/H2O 7:1:1:0,1:0.35 and stirred at room temperature for 3 hours. The resin was separated from the filtrate by filtration using a pump, to the filtrate was added 1500 ml of ethyl ether at 0°C and the resulting precipitate was separated from the ethyl ester by centrifugation and then dried to obtain 0.67 oz (17.0 g) of the crude product containing dodecapeptide.

7. Cleaning method and conditions for chromatography were determined with reference to the same stages related to obtaining heptaacetate.

Example 2. Getting antepenultimate and heptacosane method of genetic engineering and their cleaning

On the basis of the nucleotide sequences encoding antepenultimate and heptacosane corresponding oligonucleotide sequences used to construct expression vectors.

To obtain antepenultimate synthesized the four-stranded oligonucleotide as follows:

55-1: 60 BP

5' tcgagctccatgggtcgagaattcattctgaagatgttcgtcgactaaacgttctctgca 3'

55-2: 52 P.N.

5' gagaacgtttagtcgacgaacatcttcagaatgaattctcgacccatggagc 3'

55-3: 85 BP

5' gaggtcgacctgaacccagacagtgacaaaattatctactcccacttcacgtgtgccacagacaccgagaatatccgctttgtct 3'

55-4: 85 BP

5' tagcccggggaccagattgtactccttcaggttcagctggaggatggtgtccttgacggctgcaaagacaaagcggatattctcg 3'

To obtain heptaacetate two-stranded oligonucleotide were synthesized as follows:

27-1:

5' catggacaccgagaatatccgctttgtctttgcagccgtcaaggacaccatcctccagctgaacctgaaggagtacaatctggtctaaccc 3'

27-2:

5' gggttagaccagattgtactccttcaggttcagctggaggatggtgtccttgacggctgcaaagacaaagcggatattctcggtgtc 3'

The first and second single-stranded oligonucleotides synthesized to obtain antepenultimate, annealed to obtain a double-stranded DNA fragment with sticky ends, the obtained DNA fragment was cloned in the forward direction between the restriction sites Xho I and Pst I in the plasmid pEGFP-N1 plasmid provided by the Department of genetics, Third military medical University, Contin, China) and the resulting plasmid was named pEGFP-A. Because it was 20 complementary bases on the 3'-ends of the third and fourth synthesized oligonucleotides, third and fourth oligonucleotides were annealed and extended using Taq polymerase to obtain double-stranded DNA fragment Century Amplificatory fragment was observed in position 150 BP marker of molecular weight DNA for conducting electrophoresis in 2.5% agarose gel. The fragment In p which has Dorgali dual decomposition using Sal I and Sma I and then in the forward direction cloned between the restriction sites Sal I and Sma I in the plasmid pEGFP-A and the resulting plasmid was named pEGFP-55, which contains the gene antepenultimate completely. Gene antepenultimate was obtained by double restriction using Xho I and Sma I and inserted between the restriction sites Xho I and Sma I in plasmid pIVEX2.3-MCS and the resulting plasmid was named pIVEX2.3MCS-55. Screening for the desired plasmid can be carried out as follows: sample plasmid is subjected to double decomposition using Xho I and Sma I, analyzed by electrophoresis in 2.5% agarose gel and defined as a positive clone, if the gel has a band corresponding to approximately 180 BP marker of molecular weight DNA.

The first and second single-stranded oligonucleotides synthesized to obtain heptadecapeptide, annealed to obtain a double-stranded DNA fragment with sticky ends for Nco I and Sma I, plasmid pIVEX2.3 were subjected to double decomposition using Nco I and Sma I and subjected to electrophoresis and then a fragment of the plasmid with the sticky ends were isolated using a kit for isolation of DNA fragments from the gel. Gene heptaacetate in the forward direction cloned in plasmid pIVEX2.3 (purchased from Roche, Switzerland) using T4 DNA ligase. A positive clone contains the gene of heptacosane, and this plasmid was named pIVEX2.3-27. With a Cup containing ampicillin were selected in the six colonies with legirovannoi recombine the amplifying plasmid, placed in 5 ml of LB medium and cultivated during the night; the plasmids were isolated, were double splitting using endonuclease enzyme Nco I and Sma I and examined by electrophoresis method for identification; clone identified as positive, then confirmed by sequencing. It was found that the plasmid pIVEX2.3MCS-55 and pIVEX2.3-27 were successfully constructed. Plasmids pIVEX2.3MCS-55 and pIVEX2.3-27 were separately transformed into competent cells BL21 (DE3) pLysE (purchased in the company Sangon Biotech Co., Ltd., Shanghai), plasmids were isolated from colonies of transformed cells using the kit for plasmid isolation and identified by restriction analysis, and single colonies were selected and cultured for 10 hours in 2 ml of LB medium with ampicillin (100 μg/ml) at 37°C with shaking 180 rpm To the obtained bacterial suspension (200 ál) was added to 250 ml of LB medium with ampicillin, and cultivated for 10 hours at 37°C with shaking 180 rpm, then added IPTG to a final concentration of 1 mm, were cultured for 4-6 hours at 37°C and then at 30°C for 10 hours. Bacterial cells were besieged by centrifugation and stored at -70°C until use. 1 g of wet bacterial sludge resuspendable in 5 ml of binding buffer solution, was destroyed by ultrasonic treatment in ice (the parameter is: the duration of the pulse 6, the amplitude of 15-20, recess 8-10 minutes) and centrifuged at 12000 rpm for 10 minutes. The resulting supernatant was collected by pipette to clean. Purification was performed using affinity chromatography using Nickel-chelating resin under denaturing conditions. Column with Nickel-chelating resin is first balanced 5 ml of denaturing binding buffer. The supernatant obtained after processing resuspending bacterial sludge by ultrasound, was passed through a column with a controlled flow rate not exceeding 10 m/h and collect the eluate. The column was placed 5 ml of denaturing wash buffer and collected eluate. Mixed 1 ml of the fluid with sedentarism wash buffer and denaturing wash buffer In respect 0:1, 1:9, 2:8, 3:7, 4:6, 5:5, 6:4, 7:3, 8:2, 9:1 and 1:0. Then suirable the contents of the column using the same buffer solution, and then 2 ml sedentarised buffer for washing (total duration of the treatment should be at least 2-3 hours) and collect the eluate. Eluting buffer A (3 ml) was passed through the column for elution of protein and collect the eluate. Eluting buffer a (2×3 ml) was passed through the column for elution of protein and collect the eluate. The purity of the obtained protein was determined by electrophoresis in SDS-polyacryl midna gel. It was shown that bacterial cells BL21 (DE3) to Express the desired polypeptide, the number of expressed polypeptide is approximately 10% of the total protein in bacterial cells, and the polypeptide of 250 ml of bacterial suspension after purification on a column with Nickel-chelating resin and renaturation is about 1.5 mg. Most of this polypeptide was suirable solution of 500 mm imidazole, and the polypeptide forms a single band when conducting electrophoresis in SDS-polyacrylamide gel, the purity of the product determined by densitometry method was 98%.

Example 3. A series of polypeptides described in the present invention, can reduce the protein content in rats in the model hypertrophy cardiocytes induced by norepinephrine.

1. The study was performed on Wistar rats aged 1-3 days after birth (acquired in the Center of experimental animals of the Third military medical University). Rats were killed by cervical dislocation and recorded on the section table. The skin in the ventral part of the body disinfected with 2% tincture of iodine and then 75% ethyl alcohol. Heart was removed, cut into pieces measuring approximately 1-3 mm3were subjected to repeated splitting using diesterweg solution containing 0.08% trypsin, 0.02% EDTA and 0.05% is lagena. Cells were collected in modified according to the method of Dulbecco culture medium Needle containing 10% fetal bovine serum, and cultured in the incubator at 37°C and the content of CO25%.

2. Cardiocyte were cultured for 48 hours and placed in not containing whey modified by way of Dulbecco culture medium Needle and then were cultured for 24 hours before adding the medicinal product in accordance with the following division into groups:

normal control group: added 10 μl of phosphate-saline buffer;

the norepinephrine group; norepinephrine (NOREPINEPHRINE, Serva Corporation, USA) was added at a concentration of 1 μm;

the group of polypeptide: added N norepinephrine, while the corresponding polypeptide was added at a concentration of 10 nm.

3. After adding the drug, the cells were cultured for 24 hours and then deleted the culture medium. The culture was then washed using phosphate-saline buffer was then added 0.5 ml of 5% trichloroacetic acid to a cell and kept at 4°C for 1 hour. The obtained precipitate was dissolved in 1 ml of 0.1 M NaOH. The protein content was determined by the method of Lowry.

4. Result: antepenultimate, pentaceratops, pentatriacontane, triacetate, heptacosane, pentadecapeptide, dicos the peptide, heptadecapeptide and pentadecapeptide in the amount of 10 nmol/l can significantly reduce the protein content in hypertrophy cardiocytes induced by norepinephrine; dodecapeptide has no obvious effect (as shown in Table 1).

Table 1
The influence of repetitive polypeptides described in the present invention, the protein content in the culture cardiocyte rats (n=6,x±s)
GroupDose (nmol/l)The protein content (µg/105cells)
Control-80,5±13,9
Norepinephrine1000to 121.0±13,2**
Antepenultimate10to 90.3±10,8##
Pentaceratops10of 92.7±12,3##
Pentatricopeptide 10for 93.4±12,0##
Triacetate10and 99.8±9,9##
Heptaacetate1089,4±10,7##
Pentadecapeptide10of 100.2±11,6##
Disapated10103,4±11,4#
Heptadecapeptide1096,4±10,5##
Pentadecapeptide10the 104.3±12,6##
Dodecapeptide10113,3±11,6
**P<0,01 compared with the control group;#P<0,05;##P<0,01 compared with a group of norepinephrine.

Example 4. A series of polypeptides described in the present invention, can reduce the protein content in rats in the model hypertrophy cardiocytes caused by angiotensin II (Angiotensin II).

1. Cardiocyte were cultured for 48 hours as described you the e, then put in not containing whey modified by way of Dulbecco culture medium Needle and were cultured for 24 hours before adding the medicinal product in accordance with the division into the following groups: normal control group: added 10 μl of phosphate-saline buffer; the group of angiotensin II: angiotensin II was added at a concentration of 1 μm; group a series of polypeptides: added angiotensin II, while dodecapeptide, pentadecapeptide, heptacosane, antepenultimate was added at a concentration of 10 nm.

2. After adding the drug, the cells were cultured for 24 hours and then deleted the culture medium. The culture was then washed using phosphate-saline buffer was then added 0.5 ml of 5% trichloroacetic acid to a cell and kept at 4°C for 1 hour. The obtained precipitate was dissolved in 1 ml of 0.1 M NaOH. The protein content was determined by the method of Lowry.

3. Results: the addition of angiotensin II in the culture medium significantly increases the protein content in cardiocyte (µg: 143,2±5,49 compared to 113.9±of 7.48, p<0.01) compared with normal control group. Compared with angiotensin II pentadecapeptide, heptacosane and antepenultimate can reduce the protein content in cardiocyte in varying degrees, while dodecapeptide n who has a clear effect (see Table 2).

Table 2
The influence of repetitive polypeptides in the protein content in the hypertrophic cardiocyte, formed under the action of angiotensin II (n=6,x±s)
GroupDose (nmol/l)The protein content (µg/105cells)
Control-to 113.9±of 7.48
Angiotensin II1000143,2±5,49**
Dodecapeptide10144, 0mm±11,7
Pentadecapeptide10to 130.6±10,79#
Heptaacetate10to 125.3±9,41##
Antepenultimate10to 127.2±6,33##
Note the tion: **P<0,01 compared with the control group;#P<0,05;##P<0,01 compared to the group of angiotensin II.

Example 5. Polypeptides can significantly suppress myocardial hypertrophy in mice induced by norepinephrine.

Fifty mice used in this experiment (acquired in the Center of experimental animals of the Third military medical University) were divided into five groups containing 10 mice in the group. Mice in the control group injected with a mixture of 0.1% ascorbic acid, 3 mg % mixed tartrate potassium sodium and physiological solution of sodium chloride. Mice in the model group were administered a mixture of 0.1% ascorbic acid, 6 mg % of norepinephrine bitartrate, physiological solution of sodium chloride (equivalent to 1.5 mg/kg norepinephrine). The mice in the three dose groups were introduced pentadecapeptide, heptacosane and antepenultimate in the amount of 30 μg/kg, respectively, during the administration of a mixture of 0.1% ascorbic acid, 6 mg % of norepinephrine bitartrate and physiological solution of sodium chloride. The introduction was carried out by sequentially administered intraperitoneally twice a day for 15 days. The volume of dosing for each group was 50 ml/kg animals were Then scored by cervical dislocation, opened the chest, took out the heart, p is washed from the blood chilled physiological solution of sodium chloride, promocao filter paper and weighed on the scales. Carefully separating the Atria and right ventricle (leaving the interventricular septum) and weighed the left ventricle.

The results show that a series of polypeptides can significantly prevent the development of hypertrophy of the myocardium in mice, and various indicators of hypertrophy of the myocardium in all other groups were significantly improved, in addition to the mass of the heart in the group pentadecapeptide (reduction of 9.9% in P>0,05) (see Table 3).

td align="justify"> Norepinephrine
Table 3
The impact of a series of polypeptides on myocardial hypertrophy in mice (x±s)
GroupNMT (g)MS (mg)MLG (mg)C (mg/g)ILE (mg/g)
Control1025,1±2,1998,8±9,6870,8±8,213,95±0,312,82±0,27
823,2±1,69112,1±12,1*85,6±9,16**4,82±0,44**3,69±0,36**
Pentadecapeptide923,6±of 2.51to 100.9±12,8to 74.7±9,25##4,27±0,42##3,16±0,39##
Heptaacetate823,1±2.26 and95,2±5,79#67,9±6,30##4,17±0,52##2,98±0,48##
Antepenultimate823,3±2,05a 99.0±16,3#72,9±12,8##4,24±0,59##3,13±0,50##
Note: MT is the mass of the body; MS is the mass of the heart; MLI is the mass of the left ventricle; C - cardiac index; ILI - the index of the left ventricle or the index of hypertrophy 5 of the myocardium.
*P<0,05;**P<0,01 compared with the control group;#P<0,05;##P<0,01 compared with a group of norepinephrine

Example 6. A series of polypeptides described in the present invention significantly suppresses myocardial hypertrophy in rats induced by norepinephrine.

Selected thirty of Wistar rats and were divided into five groups of 6 animals. Rats of the control group is injected with a mixture of 0.1% ascorbic acid, 3 mg % mixed tartrate potassium sodium and physiological solution of sodium chloride; the rats in the model group were administered a mixture of 0.1% ascorbic acid, 6% mg of norepinephrine bitartrate and physiological solution of sodium chloride; the rats in the three groups of dosing was introduced pentadecapeptide, heptacosane and antepenultimate in the amount of 15 μg/kg, respectively, during the administration of norepinephrine. The volume of dosing for each group was 33 ml/kg, and the introduction was carried out by sequentially administered intraperitoneally twice a day for 20 days. After a specified period of time, the heart and the left ventricle was weighed.

The results showed that pentadecapeptide can significantly reduce the index of the left ventricle, heptacosane and antepenultimate can significantly reduce the weight of the left ventricle, cardiac index and the index of the left Zheludok is a (see Table 4).

Table 4.
The influence of repetitive polypeptides on myocardial hypertrophy in rats, induced by the action of norepinephrine (n=6,x±s)
GroupMT (g)MC (g)MLG (g)C (g/kg)ILI (g/kg)
Control189±150,573±0,0350,408±0,0273.043±0,1782.166±0,114
Norepinephrine187±5,00,690±0,078*0,555±0,055**3.674±0,348**2.954±0,225**
Pentadecapeptide188±120,673±0,0550,490±0,0383.580±0,2262.606±0,154#
Heptacosane ptid 200±130,622±0,0320,442±0,017##3.111±0,041##2.213±0,056##
Antepenultimate190±210,630±0,0520,450±being 0.036##3.310±0,137#2.368±0,166##
Note: MT is the mass of the body; MS is the mass of the heart; MLI is the mass of the left ventricle; C - cardiac index; ILI - the index of the left ventricle, or the index of hypertrophy 10 of the myocardium.
*P<0,05;**P<0,01 compared with the control group;#P<0,05;##P<0,01 compared with a group of norepinephrine

Example 7. Polypeptides that can significantly the development of hypertrophy of the myocardium in rats induced by coarctation of the aorta.

Adult male Wistar rats (purchased in the Center of experimental animals of the Third military medical University) were randomly divided into the following groups: the group, which was conducted by simulating the operation; the group, which was held model operation; and the group treated with the polypeptides. Prior to the operation and the animals were not fed during the night and were given unlimited access to water, then the animal was introduced anesthesia (phenobarbital sodium) and conducted peritonectomy. The abdominal aorta was separated and along the abdominal aorta introduced 8 G needle (outer diameter 0.80 mm) on top of the right renal artery using silk surgical thread before the needle was quickly removed. Then the abdomen was sutured with silk surgical sutures. Rats from groups simulate the operation was subjected to the same procedure as above, except that the ligature of silk yarn not put. From the first day after surgery, the rats in the group simulation operations and in the group of model operations administered intraperitoneally injected with physiological solution of sodium chloride in the amount of 7.5 ml/kg once a day; rats in the group of polypeptide administered intraperitoneally injected pentadecapeptide, heptacosane and antepenultimate respectively, in the amount of 15 μg/kg once a day. Rats were bred for 3 weeks and then scored, opened the chest, took out the heart, washed from blood chilled physiological solution of sodium chloride, probatively filter paper and weighed on the scales. Weighed the heart and the left ventricle.

The results showed that a series of polypeptides can significantly prevent the development of hypertrophy of the myocardium in rats observed a significant decrease in MS, M IS W, SI and ILI (see Table 5).

Table 5
The influence of repetitive polypeptides on myocardial hypertrophy in rats induced by coarctation of the aorta (x±SEM)
nMT (g)MS (mg)MLG (mg)C (mg/g)ILE (mg/g)
The group, which was conducted simulation operations6222±8,2713±23,3399±24,93,22±0,081,80±0,07
The group, which was held model operation5204±5,8813±31,3*508±26,4*3,98±0,09**2,48±0,10**
Pentadecapeptide528±5,6 706±30,8#418±12,3#3,39±0,10##2,01±0,06##
Heptaacetate5211±6,4696±30,7##413±22,1#3,30±0,08##1,96±0,08##
Antepenultimate5215±8,0702±31,3##409±24,6#3,27±0,08##1,90±0,07##
*P<0,05;**P<0,01 compared with a group that was conducted simulation operations;#P<0,05;##P<0,01 compared with a group, which was held model operation.

Example 8. A series of polypeptides described in the present invention, can prevent the rebuilding of the myocardium in rats with spontaneous hypertension.

1. Thirty rats at the age of 13 weeks with spontaneous hypertension (SHR, purchased in Beijing laboratory animal technology Vital River Co. Ltd., Beijing) were selected and randomly distributed into five gr the PP for 6 rats per group.

Rats with spontaneous hypertension in the model group (placebo) administered intraperitoneally injected with 0.9% saline solution in an amount of 5 ml/kg twice a day.

In the positive control group (losartan) to rats daily intragastrically injected potassium losartan in the amount of 6 mg/kg

In the group of pentadecapeptide: rats injected pentadecapeptide in the amount of 30 mg/kg administered intraperitoneally twice a day.

In the group of heptaacetate: rats injected heptaacetate in the amount of 30 mg/kg administered intraperitoneally twice a day.

In the group of antepenultimate: rats injected antepenultimate in the amount of 30 mg/kg administered intraperitoneally twice a day.

Six rats line WKY (Wistar-Kyoto) (acquired in the Center of experimental animals of the Third military medical University) were further selected as normal control.

2. The introduction of drugs was carried out consistently for eight weeks (14 weeks 21 weeks). Values of body weight of all tested rats received once in two weeks and injected dose was adjusted based on the obtained values of body mass.

3. The results suggest that:

(1) a series of polypeptides has some antihypertensive effect and can significantly reduce systolic blood arterial the Noah pressure in rats with spontaneous hypertension (see Table 6).

Table 6
The influence of repetitive polypeptides described in the present invention, the systolic blood pressure in rats with spontaneous hypertension (x±s, n=6).
GroupDoseSystolic blood pressure (mm Hg)
0 weeks2 weeks4 weeks6 weeks8 weeks
WKY143,8±10,79144,8±9,03143,8±8,16144,4±9,67142,6±4,82
Placebo-176,9±1,82207,4±8,80##225,3±16,24##238,6±8,09*248,1±7,27*
Losartan 6 mg/kg178,3±2,24165,1±4,80**177,1±8,27**178,3±6,23**to 172.6±4,82**
Pentadecapeptide30 ág/kg177,3±6.42 per190,4±7,75**200,2±4,13**217,1±8,82**224,1±6,37**
Heptaacetate30 ág/kg180,0±3,60185,2±6,92**189,4±6,34**211,6±3,97**202,3±a 3.87**
Antepenultimate30 ág/kg178,2±4,15189,8±7,80**193,4±5,31**216,0±5,55**218,3±8,54**
## P<0,01 compared to WKY;**P<0,01 compared with placebo.

(2) Application of a series of polypeptides, proposed according to the present invention, can mean the flax to improve the condition for the reconstruction of the myocardium in rats with spontaneous hypertension, and can lead to a significant decrease MT, MLS, C and ILE rats (table 7), and the thickness of the posterior wall of the left ventricle (TSKJ) and the thickness of the interventricular septum (tmip) in rats with spontaneous hypertension (table 8).

Table 7
The influence of repetitive polypeptides on myocardial hypertrophy in rats (x±s, n=6).
GroupDoseMT (g)MS (mg)MLG (mg)C (mg/g)ILE (mg/g)
WKY300±8876±29582±202,92±0,051,94±0,10
Placebo-309±61176±39##950±31##3,80±0,08##3,07±0,13##
Vines shall rtin 6 mg/kg288±91003±16**789±883,48±0,05**2,74±0,28
Pentadecapeptide30 ág/kg307±81055±30**775±28**3,44±0,05**2,46±0,04**
Heptaacetate30 ág/kg304±10849±23**609±99**2,80±0,03**2,01±0,07**
Antepenultimate30 ág/kg291±7949±28**705±49**3,26±0,05**2,30±0,08**
Note:**P<0,01 compared with placebo;##P<0,01 compared to WKY

(3) the Action of a series of polypeptides described in the present invention, the morphology of the heart condition is Oh muscular tissue in rats with spontaneous hypertension.

The results of morphological analysis suggests that while the transverse diameter (PD) and the cross-sectional area (PPP) cardiocyte rats of the model group decreased significantly compared with the data parameters in the WKY group (P<0.01), and the cross-sectional area of cardiocyte rats in the group treated with a series of polypeptides and in the group treated with Losartan significantly reduced compared with the data parameters in the model group (P<0,01) (see Table 9).

Table 9
Morphological analysis of cardiocytes rats (x±s, n=6)
GroupDoseDD (μm)PPP (μm2)
WKY-11,30±2,35248±26
Placebo-15,5612,94##375±11##
Losartan6 mg/kg13,83 is 2,54 335±20**
Pentadecapeptide30 ág/kg14,88±2,56329±24**
Heptaacetate30 ág/kgof 12.33±1,84**286±22**
Antepenultima
Ted
30 ág/kg14,62±2,36313±29**
## p<0,01 compared to WKY;**p<0,01;**p<0,01 compared with placebo.

Under light microscope, it was seen that the kernel of cardiocyte was painted blue, plasma cells was painted in pink color, and the collagen was not painted.

In the model group rats with spontaneous hypertension (Figure 1): the fibers of the myocardium was totalsales, swollen, had opaque intervening spaces were broken, blended, or randomly located, and a part of the fibers of the myocardium was characterized by a more pronounced degeneration of the myocardium over a vast area; cardiocyte were subjected to significant hypertrophy, cloudy swelling, degeneration using type; cell nuclei were increased or been picknose; steriously became granular, the broken and blended, even attended the areas of necrosis; patchy necrotic lesions and focal necrotic lesions were seen in multiple fields of view; the walls of blood vessels was totalsales; smooth muscle cells proliferated and were gipertrofirovanie; observed interstitial fibrosis of the myocardium in several separate fields of view. But in General, the degree of fibrosis is relatively mild and inflammatory response in acute and in the model group; foci of necrosis were observed in multiple fields of view.

In the group treated with Losartan (Figure 2): pathological changes in some way superior and presents primarily as infiltration of inflammatory cells. You can see that cardiocyte subjected to inflammatory changes, such as a visible cloudy swelling, hypertrophy, and other changes, and areas of necrosis is also observed in several fields.

In the group treated with heptaacetate (3): compared with model group rats with spontaneous hypertension of the above pathological changes in cardiocyte much easier. Improvement of pathological changes in the group of heptaacetate significantly advance the status of this group to the normal control group, and inflammatory changes were seen randomly in separate fields of view, such as not is considerable swelling cardiocytes and other changes. Areas of necrosis are not formed, and the morphology of the fibers of the myocardium and blood vessels are normal.

(4) the Effect of heptaacetate on the ultrastructure of cardiocyte in rats with spontaneous hypertension (transmission electron microscope PHILIPS-TECNI10, the Netherlands).

In the model group rats with spontaneous hypertension (Figure 4): the amount of cardiocytes increased, the integrity of the nuclear membrane cardiocytes violated, the core is subjected to irregular changes such as hypertrophy, strain, lysis and other changes; sarcoplasmatic reticulum expanded; mitochondria proliferate, randomly located and swollen in varying degrees (slightly, moderately or sharply), inside of which are formed vacuoles; myofilament mainly properly organized and are focal lysis in terms of cardiocytes; cross banding with blurred edges may be visible in some areas and Z-line mainly correspond to the norm, some of which randomly placed; interstitial collagen fibers do not show significant proliferation.

In the group treated with Losartan (Figure 5): the morphology of the cell nucleus is essentially the norm and in some way irregular; myofilament under the plasma membrane undergo focal lysis; mitochondria slightly abusie; sarcoplasmatic reticulum expanded and slightly swollen; the structure of Z-lines and cross-banding mainly correspond to the norm.

In the group treated with heptaacetate (6): compared with model group rats with spontaneous hypertension, ultrastructure of the myocardium is significantly improved. Structure cardiocytes mainly corresponds to the norm: the sarcomeres of cardiocyte and myofilament mainly correspond to the norm; lateral stripes are clearly visible; interstitial collagen fibers do not show significant proliferation; Z-lines are organized; the mitochondria are not characterized by a significant proliferation, some mitochondria slightly swollen; myofilament slightly subjected to lysis; and endothelial cells of the capillary vessels are normal.

Despite the above examples, the embodiments of the present invention is not limited to the above examples; different variations of options for implementing the present invention can be offered, without going beyond the scope of this invention, and in any case will be in the amount determined by the formula of the present invention.

References

1. Cooper G 4th. Basic determinants of myocardial hypertrophy: a review of molecular mechanisms. Annu Rev Med, 1997, 48:13-23.

2. Aoki H, Sadoshima J, Izumo S. Myosin light chain kinase mediates sarcomere organization during cardiac hypertrophy in vitro. Nat Med 200, 6(2):183-188.

3. McKinsey TA, Kass DA. Small-molecule therapies for cardiac hypertrophy: moving bneth the cell surface. Nat Rev Drug Discov. 2007; 6(8):617-635.

4. Mitchell JA, Ventura HO, Mehra MR. Early recognition and treatment of hypertensive heart disease. Curr Opin Cardiol. 2005; 20(4):282-289.

5. Jalili T, Carlstrom J, Kim S, Freeman D, Jin H, Wu TC, Litwin SE, David Symons J. Quercetin-supplemented diets lower blood pressure and attenuate cardiac hypertrophy in rats with aortic constriction. J Cardiovasc Pharmacol. 2006; 47(4):531-541.

6. Carlstrom J, Symons JD, Wu TC, Bruno RS, Litwin SE, Jalili t A quercetin supplemented diet does not prevent cardiovascular complications in spontaneously hypertensive rats. J Nutr. 2007; 137(3):628-633.

7. Niizeki T, Takeishi Y, Kitahara T, et al. Diacylglycerol Kinase zeta Rescues Galphaq-Induced Heart Failure in Transgenic Mice. Circ j 2008; 72(2):309-317.

8. Dorn GW 2nd, Tepe NM, Lorenz JN, Koch WJ, Liggett SB. Low - and high-level transgenic expression of β2-adrenergic receptors differentially affect cardiac hypertrophy and function in Gαq-overexpressing mice. Proc Natl Acad Sci USA. 1999; 96(11):6400-6405.

9. Berenji K, Drazner MH, Rothermel BA, Hill JA. Does the load-induced ventricular hypertrophy progress to systolic heart failure? Am J Physiol Heart Circ Physiol. 2005; 289(1):H8-H16.

1. The polypeptide corresponding to the sequence SEQ ID NO:2, for the prevention or treatment of hypertrophy of the myocardium.

2. The polypeptide corresponding to the sequence SEQ ID NO:3, for the prevention or treatment of hypertrophy of the myocardium.

3. The polypeptide corresponding to the sequence SEQ ID NO:5, for the prevention or treatment of hypertrophy of the myocardium.

4. The polypeptide corresponding to the sequence SEQ ID NO:6, for the prevention or treatment of hypertrophy of the myocardium.

5. The polypeptide corresponding to the sequence SEQ ID NO:7, to profile Chiki or treatment of hypertrophy of the myocardium.

6. The polypeptide corresponding to the sequence SEQ ID NO:8, for the prevention or treatment of hypertrophy of the myocardium.

7. Composition for prevention or treatment of hypertrophy of the myocardium containing the polypeptide according to any one of claims 1 to 6 and a pharmaceutically acceptable additive.

8. The composition according to claim 7, characterized in that the composition is an injectable drug for parenteral administration.

9. The use of the polypeptide according to any one of claims 1 to 6, together with pharmaceutically acceptable additives to obtain drugs for prevention or treatment of hypertrophy of the myocardium.

10. The method of producing the polypeptide according to any one of claims 1 to 6, including the step of synthesis of the polypeptide with the amino acid sequence according to any one of claims 1 to 6 in the synthesizer polypeptides.

11. The method of producing the polypeptide according to any one of claims 1 to 6, comprising the following steps:
ligation of the corresponding nucleotide sequences with the vector with the formation of the recombinant vector;
the transformation of the indicated recombinant vector into the cell-host;
the induction of expression of the specified polypeptide in said cell-host;
the selection of the specified polypeptide.

12. The method according to claim 11, characterized in that said vector is a plasmid pIVEX2.3MCS, and specified a host cell is an Escherichia coli strain BL21.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: inventions refers to biotechnology and concern hypoallergic fused proteins. A presented hypoallergic fused protein consists of one hypoallergic molecule originated from an allergen, fused with a second non-allergic protein originated from a pathogen, or a fragment thereof with the hypoallergic molecule originated from the allergen showing 50% decreased ability to bind IgE, 30% decreased T-cell responsiveness as compared with a wild-type allergen. A nucleic acid molecule coding the fused protein, an expression vector, a host cell expressing the same protein, and a vaccine composition containing the protein are also presented.

EFFECT: presented invention enables preparing therapeutic and prophylactic drugs for an allergy or diseases caused by pathogens with using no toxic adjuvants, showing no side effects.

14 cl, 23 dwg, 17 tbl, 27 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. What is presented is a human antibody or an antigen-binding antibody fragment which specifically binds to human CD20 and contains CDR1-3 of a light chain and CDR1-3 of a heavy chain. What is described is a version of the antibody or antigen-binding antibody fragment characterised by amino acid sequences of the light and heavy chains. There are presented: a coding nucleic acid molecule, a based expression vector, as well as a method for producing the antibody or antigen-binding antibody fragment with using the vector. What is disclosed is a pharmaceutical composition based on the antibody. What is described is a method for reducing a severity or suppressing a CD20-caused disease or condition, and using the antibody or antigen-binding antibody fragment for preparing a medicine for reducing a severity or suppressing the CD20-mediated disease or condition.

EFFECT: invention provides the antibodies that extend asymptomatic survival from approximately 2 to approximately 9 times or more, relative to animals control in human lymphoma simulated in mice, have high affinity, that can be find application in medicine.

15 cl, 1 dwg, 14 tbl, 10 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology and biotechnology. What is presented is an antibody specifically bound to human CD26. There are described versions of coding NC, expression vector, and versions of a host cell for producing the antibodies. There are disclosed methods of inhibiting (cell proliferation, tumour growth) and a method of treating a condition caused by CD26 expression, as well as a pharmaceutical composition using the antibody of cl. 1. There are described methods of inhibiting (tumour growth, metastasis proliferation) using the pharmaceutical composition. What is disclosed is E.coli for producing the antibody, deposited under accession number PTA-7695 in ATCC (American typical culture collection).

EFFECT: use of the invention can find application in treating the immune disorders associated with CD26 expression, including cancer.

29 cl, 42 dwg, 14 tbl, 14 ex

FIELD: chemistry.

SUBSTANCE: present invention refers to immunology. There are presented versions of a human thymic stromal lymphopoietin (hTSLP) receptor antibodies characterised by the presence of variable reionso of a heavy and light chain or 3 CDR of a light chain and 3 CDR of a heavy chain respectively. There are described versions of a recovered or recombinant coding polynucleotide, a recovered host cell for producing the antibody containing coding DNAs. There is also described a method of treating an hTSLP-mediated inflammatory disorder involving the administration of a pharmaceutical composition containing an effective amount of the antibody.

EFFECT: using the invention provides the new hTSLP antibodies that can find application in medicine for treating the inflammatory diseases associated with hTSLP activity.

27 cl, 08 dwg, 2 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. What is presented is a lymphotoxin-alpha (LTα) antibody, including chimeric and humanised versions thereof. Where are disclosed compositions containing it, using it for preparing a medication for autoimmune disorders, a method of inhibiting ex vivo lymphotoxin-alpha activated cell proliferation with using the antibody under the invention, as well as a nucleic acid, an expression vector, a host cell and a method of producing the antibody that proceeds from using them.

EFFECT: present invention can find further application in a therapy of the autoimmune diseases.

51 cl, 21 ex, 27 dwg, 7 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: presented invention refers to immunology. There are presented versions of recovered monoclonal antibodies and an antigen-binding portion thereof specific to human IP-10. There are described: an immunoconjugate, bispecific molecule thereof, as well as versions of a composition of the antibody, immunoconjugate or bispecific molecule - for treating autoimmune and inflammatory diseases. There are also disclosed: a coding nucleic acid, an expression vector thereof and a host cell carrying this vector to produce the antibody. What is described is using the antibody or antigen-binding portion thereof for preparing a medicine for treating: either a viral or bacterial infection entailing undesired IP-10 activity, or autoimmune and inflammatory diseases caused by undesired IP-10 activity. What is presented is a hybridoma producing the antibody, derived from a transgenic mouse splenocyte cross-linked to an immortalised cell.

EFFECT: use of the invention provides the novel antibodies that can be find application in medicine to treat a variety of diseases associated with IP-10 activity.

22 cl, 30 dwg, 9 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: vector is proposed for controlled expression of protein, having a function of interleukine-12, and also the method to produce modified in vitro dendrite cells and appropriate cells, which express interleukin-12 in a controlled manner, under control of the system of gen expression modulation in presence of activating ligand.

EFFECT: invention may be used in therapy for treatment of animals, including a human being.

FIELD: biotechnologies.

SUBSTANCE: extracted polypeptide is provided, which has NADH-dependent HMF-reductase activity, where the specified polypeptide is by 80% homological by amino acid sequence SEQ ID NO:2, available in the description, which has replacements in positions corresponding to positions a) Y295C, b) Y295C and S117L, c) Y295C and S110P, or d) Y295C and S110P and S117L in SEQ ID NO:2. A nucleic acid is described, which codes the specified polypeptide, as well as an expression vector, containing the specified nucleic acid, and a host cell containing the specified vector and designed for expression of the polypeptide with NADH-dependent HMF-reductase activity. It is proposed to apply the specified polypeptide, nucleic acid, vector or host cell in production of large-capacity chemicals from lignocellulose raw materials and furane-containing material.

EFFECT: invention makes it possible to produce NADH-dependent HMF-reductase with increased specific activity.

18 cl, 6 tbl, 4 dwg, 7 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. There are presented versions of a CD20 modified antibody or its antigen-binding fragment. Each version is characterised by the fact that it comprises a variable region of a light chain and a variable region of a heavy chain and induces a higher level of apoptosis as compared with B-Lyl murine antibody. There are presented versions of the compositions to enhance the effector functions. One of such compositions contains antibodies wherein at least 20% of the Fc oligosaccharides are bisectional and non-fucosylated, whereas the other one contains antibodies wherein at least 50% of the oligosaccharides are non-fucosylated. Also, there are described: versions of a host cell to produce the antibodies, an expression vector, as well as the versions of the coding polynucleotides, a method for producing the antibodies in a cell and using the antibodies for preparing a drug for treating disorders treated by B-cells depletion.

EFFECT: use of the inventions provides the antibodies with the improved therapeutic properties, including with higher Fc receptor binding and enhanced effector function that can be find application in treating tumors.

36 cl, 3 ex, 9 tbl, 26 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention provides RANK-L targeted amino acid sequences, as well as to a compound or a construct, and particularly, proteins and polypeptides which comprise or substantially consist of one or more of these amino acid sequences. The invention also discloses nucleic acids encoding such amino acid sequences and polypeptides; methods for preparing such amino acid sequences and polypeptides; host cells expressing or able for expressing such amino acid sequences or polypeptides. There are also disclosed compositions and particularly, pharmaceutical compositions for preventing and/or treating bone diseases and disorders, which include such amino acid sequences, polypeptides, nucleic acids and/or host cells. What is shown is a possibility to use the amino acid sequences or polypeptides, nucleic acids, host cells and/or compositions for the preventive, therapeutic or diagnostic purposes.

EFFECT: polyvalent construct of the invention has a half-life in human serum from 12 hours to 19 days.

32 cl, 30 dwg, 24 tbl, 17 ex

FIELD: biotechnologies.

SUBSTANCE: peptide is presented, which is produced from protein WT1, which is able to bind with a molecule HLA-A*1101 and to induce CTL, having a sequence SEQ ID NO:6 or SEQ ID NO:7, presented in the description. Besides, a peptide dimer is described, which is used for the same purposes and comprises two peptide monomers selected from a group of peptides that includes SEQ ID NO:7, SEQ ID NO:3, SEQ ID NO:8 and SEQ ID NO:9, available in the description. A nucleic acid is presented, which codes the specified peptide and the expression vector, which contains the specified nucleic acid. A pharmaceutical composition is described for treatment or prevention of cancer of an individual, positive by HLA-A*1101, which contains the specified peptide, nucleic acid or vector. A WT1-specific CTL is described, which is induced by the specified peptide or dimer, and an antigen-presenting cell that presents the peptide. There is data on the method and set for induction of the WT1-specific CTL and for induction of the antigen-presenting cell. The method of in vitro diagnostics of cancer in an individual positive by HLA-A*1101 is presented, which includes incubation of the specified CTL or the antigen-presenting cell with a sample received from an individual positive by HLA-A*1101, and detection of the quantity of the specified CTL or antigen-presenting cell.

EFFECT: invention makes it possible to expand assortment of peptides that bind with HLA-A*1101 and are produced from the antigen WT1.

14 cl, 1 tbl, 14 dwg, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, more specifically preparing a tumour necrosis factor receptor and may be used in medicine. Genetic engineering technique is used to produce mutant TNFRp75 bound to a tumour necrosis factor and lymphotoxins substantially consisting of N-terminal 257 amino acid residues TNFRp75 wherein the N-terminal residue Glu92 is substituted by Asn, His, Ser or Ala and wherein the N-terminal residue Trp89 is optionally substituted by Tyr or Phe. The produced mutant is used to construct a fused protein with an additional amino acid fragment specified in a constant area of human immunoglobulin and one of five functional areas of albumin found on C-terminal of the soluble mutant TNFRp75. The produced mutant TNFRp75 and the fused protein is used as a part of a pharmaceutical composition for treating the diseases associated with TNFα overexpression which involve rheumatoid arthritis, psoriasis, sclerodermatitis, Sjogren syndrome, Strumpell-Marie disease, lupus erythematosus, acute disseminated myositis and syndrome similar to systemic lupus erythematosus.

EFFECT: invention enables producing soluble TNFRp75 mutant able to be bound to tumour necrosis factor and lymphotoxins at a high affinity degree.

9 cl, 12 dwg, 10 ex

FIELD: medicine.

SUBSTANCE: invention relates to genetics and sports medicine. Claimed is method of determining predisposition to long physical effort. Method is based on genotyping polymorphism rs2070744 (C786T) of NOS3 gene and polymorphism rs5370 (G925T) of EDN1 gene by method of polymerase chain reaction. In case of determining genotype TT (rs2070744) and GG (rs5370), genetic predisposition to long physical effort is diagnosed. Technical result of claimed invention is increased efficiency, accuracy and reliability of diagnostics of predisposition to long physical effort.

EFFECT: increase of efficiency, accuracy and reliability of diagnostics of predisposition to long physical effort.

4 ex

Silk proteins // 2467015

FIELD: medicine.

SUBSTANCE: there are produced silk polypeptides having a double-spiral structure and originated from honey bee, bumble bee, bulldog ant, green tree ant and golden-eyed fly. A recombinant method is used to produce a host cell, transgenic plant and animal which produce silk polypeptide. Antibodies are produced for prepared polypeptides.

EFFECT: invention enables using producing silk polypeptides in various fields of industry.

21 cl, 14 dwg, 14 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: invention refers to biochemistry and represents versions of antibodies binding human anaplastic lymphoma kinase (ALK) protein. There are also presented: versions of radiolabelled or toxin antibodies; a DNA sequence coding the antibody, an expression vector containing the DNA sequence; a host cell transformed by the vector, a method for producing the antibody by cell cultivation, as well as using the antibody for preparing a drug for treating cancer or tumours.

EFFECT: invention may be effectively used for treating tumour or cancer.

32 cl, 5 dwg, 2 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention is an isolated nucleic acid comprising a canine RNA polymerase I regulatory sequence and containing (i) at least 250 or at least 350 or at least 450 adjoining nucleotides or an entire nucleotide sequence, which is in form of SEQ ID NO:26, (ii) a nucleotide which is at least 80% identical to said nucleotide sequence (i) or includes a complementary or reverse complementary (i) or (ii) sequence. The nucleotide sequence (i) or (ii) is operably linked to cDNA which encodes influenza virus vRNA, and when produced in MDCK cells, is capable of directing expression of said influenza virus vRNA. The present invention also describes expression vectors and cells containing such nucleic acids, as well as methods of using such nucleic acids to obtain influenza viruses, including infectious influenza viruses.

EFFECT: canine plasmid rescue system pol I enables to obtain recombinant influenza viruses in a canine cell culture with high titre.

25 cl, 16 dwg, 7 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: invention may be used in medicine. DNA coding a peptide able to bind with TGF-β1 and to inhibit its biological activity in vitro and in vivo is used as an agent inhibiting biological activity of TGF-β1.

EFFECT: invention enables the effective treatment of diseases or pathological disorders associated with hyperexpression or dysregulated expression of TGF-β1 due to inhibition of biological activity of TGF-β1.

4 cl, 6 dwg, 4 tbl, 4 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and a method of producing recombinant spider-web proteins of orb-weaving spiders in yeast cells, fused proteins containing spider-web recombinant protein sequences of orb-weaving spiders, recombinant DNA encoding fused proteins, yeast host cells and expression vectors used to realise the method, as well as producer strains of recombinant proteins of orb-weaving spiders. The method involves constructing an expression vector containing a DNA sequence encoding recombinant spider-web proteins of orb-weaving proteins, fused with a sequence which encodes ubiquitin or an ubiquitin-lie protein SUMO of yeast Saccharomyces cerevisiae, which occupies the N-terminal position in the fused protein relative the recombinant spider-web protein, transformation of yeast cells with the obtained expression vector and expression of orb-weaving spider web protein in the transformed cells.

EFFECT: method increases production of recombinant spider-web protein during accumulation thereof in yeast cells in a water-soluble fraction in form of a protein which does not contain a hybrid component.

24 cl, 6 dwg, 12 ex

FIELD: medicine.

SUBSTANCE: there is constructed a recombinant plasmid DNA pAP271 containing a rhFVII protein gene, a MAR matrix attachment region of an avian lysozyme gene, CMV virus transcription amplifier, a promoter of translational factor of human EF-1α elongation, an internal site of translational initiation of encephalomyocarditis IRES virus, a mouse DHFR gene, a SV40 virus polyadenylation signal, a cartridge comprising all elements required for aminoglycoside-3'-phosphotransferase (APH) gene expression, a cartridge for expression in bacterial cells of β-lactamase gene, as well as unique recognition sites of the following restriction endonucleases: Agel (850 base pairs), BbvCI (1657 base pairs), BmgBI (4202 base pairs), BssHII (6672 base pairs), Eco47III (11269 base pairs), EcoRI (10929 base pairs), EcoRV (11863 base pairs), Fsel (1455 base pairs), NotI (4812 base pairs), RsrII (6790 base pairs), Sbfl (2330 base pairs), Sfil (6027 base pairs), Tthllll (6390 base pairs), Xcml (2404 base pairs).

EFFECT: presented invention provides producing stably high-yield recombinant human blood coagulability factor VII.

2 cl, 4 dwg, 2 ex

FIELD: medicine.

SUBSTANCE: composition contains an effective amount of a full length hepatocyte growth factor (flHGF) and a deletion version of hepatocyte growth factor (dHGF), or one or more polynucleotides coding said isoforms.

EFFECT: invention provides effective treatment and preventing of cardiac diseases in a subject, and also activation of endothelial cell growth in a blood vessel.

39 cl, 20 dwg, 4 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to compounds which contain peptides and peptide mimetics, which are capable of binding protein S3 and inhibit complement activation.

EFFECT: compounds exhibit considerably high activity with respect to inhibiting complement activation compared to existing compounds.

16 cl, 8 dwg, 6 tbl, 11 ex

Up!