Method of producing culture medium for culturing lactose-fermenting yeast

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and dairy industry. The method of producing a culture medium for culturing lactose-fermenting yeast involves the following: Tap water is mixed with Arshan resort mineral water with mineral content of 4.1 mg/l in ratio of 1:1, followed by addition of baking yeast in amount of 10-12 g/l of the mixture of tap water and mineral water and a yeast overcook is prepared. The obtained yeast overcook is filtered and sterilised and peptone and lactose are added in amount of 1% and 4%, respectively, per 100 ml of the yeast overcook, to obtain the medium. The obtained medium is re-sterilised and cooled.

EFFECT: invention increases biomass output of lactose-fermenting yeast.

1 dwg, 3 ex

 

The present invention relates to biotechnology and can be used in the manufacture lactobacilli yeast, as well as in the dairy industry.

A method of obtaining biomass of yeast, which consists in the fact that while growing yeast in a nutrient medium containing molasses as a carbon source, nitrogen sources, phosphorus, as a growth promoter use the residual extract of sugar beet seeds in the ratio of molasses extract of 1:10-1:13. (see SU 1630313 A1, C12N 1/18, publ. 29.12.1988,)

However, this method is time consuming and involves the introduction of additional sources of nitrogen, phosphorus. This method cannot be applied in regions where there is no seed beet plants, wastes which are key in the specified method.

Also known is a method of growing yeast Saccharomyces cerevisia, namely, that in molasses injected diluted with water to a salinity of 2.0-2.4 g/l of geothermal water content of 9.5% carbohydrates, then the diammonium phosphate is added and stirred the mixture. The ratio of components in the environment is (g/l): molasses 160-180, diammonium phosphate 1.0 to 1.5, geothermal water - other (RU 2084519 C1, C12N 1/18, publ. 20.07.1997,).

The disadvantage of this method is that the environment is not selective for lactobacilli yeast, as well as the high complexity of this method of producing biomass. In addition, in the preparation of multicomponent media increases the risk of overdose some of its components.

The closest to the technological nature of the claimed method is selected as a prototype method for producing a nutrient medium for growing yeast. At the specified method on 1 liter of water (Mediterranee) water take 80 grams of pressed Baker's yeast, boiled for 15 min, filtered through a paper filter, pour it into bottles and sterilized at 1 ATM 20 minutes To 100 ml of sterile water add yeast 1% peptone, 4% glucose or maltose), filtered, poured into test tubes and sterilized at 0.5 ATM 20 min (Handbook of microbiological and virological methods of research. Ed. Mourer. - 3rd ed., revised and enlarged extra - M.: Medicine, 1982. - 464 S.).

The disadvantage of this method is that the biomass yield after 48 hours of cultivation varies from 10 to 15 mg/ml (optical density is 2,98 nm). In addition, the environment is not selective for lactobacilli yeast.

The technical result of the invention is to increase the biomass yield lactobacilli yeast, reducing the cost of the nutrient medium for cultivation.

This technical result is achieved in that in the method of obtaining the feeder is the first environment for the cultivation lactobacilli yeast providing for the preparation of yeast parivara obtained by heat-treating and filtering the mixture of tap water and natural mineral water and Baker's yeast, and then to the resulting yeast to perevary add peptone, carbohydrates, the mixture is filtered, sterilized, cooled, according to the invention in the preparation of yeast parivara to impose additional water natural mineral water resort Arshan" with mineralization of 4.1 mg/l in the ratio of 1:1, with Baker's yeast take in the amount of 10-12 grams per 1 liter of a mixture of tap water and natural mineral water, as well as carbohydrates use lactose.

Distinctive features of the proposed method is the introduction of nutrient medium composition of natural mineral water resort Arshan" as a source of mineral nutrition lactobacilli yeast and lactose as a carbohydrate.

"Arshan" Spa and mountain-climatic resort on the territory of Russia, Buryatia, Eastern Sayan mountains, situated at the foot of the Tunka bald mountains at an altitude of 900 meters Mineral water Orshanskogo field is one of the most famous in Russia in the fields of plexil mineral waters.

Natural mineral water resort Arshan" is characterized by the following chemical composition (content in 1 liter of Catino and anions):

Cations: Ca - up to 0.6 g/l, Na up to 0.2 g/l, K to 0.03 g/l, Mg to 0.1 g/l, Mn - 0.05 g/l, Zn - 0,008 mg/l, Co - 0,02 mg/l, Pb, up to 0.01 mg/l Li - up to 6.0 mg/l, Fe - to 7 mg/l, Ni - 0,008 mg/l,

Anions: CO3up to 2.4 g/l, SO4to 0.7 g/l, Cl - up to 0.07 g/l, F - to 1.6 mg/l,

Medicationabana molecules: carbon dioxide - up to 2.4 g/l, silicic acid to 0.1 g/l, boric acid 0.4 mg/L.

The chemical composition of mineral water resort Arshan" classification Vaalasranta belong to the 1st class, being carbon dioxide with high gas content.

The total mineralization of natural mineral water resort Arshan" is 4.1 mg/l, which is the highest rate for mineral waters of the Republic of Buryatia.

(Mineral water resort Arshan" belong to the class of cold carbon dioxide ferruginous siliceous hydrocarbonate-calcium-magnesium waters. They are the closest to the type of Vichy and carlsbad (silicon). Mineral water resort Arshan" does not contain toxic and radioactive components. From other mineral waters of our country is consistency and a higher content of dry (macro - and micronutrients) residue, and a significant content of carbon dioxide, sulphates of calcium and magnesium. It does not change its chemical composition for more than 100 years. Its shallow depth under basalt cover in depth is m ore than 1500 meters swimming pool of this mineral water. Mineral water resort Arshan" no adverse effects on the metabolism of microbial cells, as they contain no mercury, arsenic.

Use as a source of carbohydrate nutrition of microorganisms lactose allows to obtain a selective nutrient medium for cultivation of yeasts, spaziali lactose.

The use of natural resources mineral water in the claimed method allows to reduce the cost of purchasing expensive chemical compounds, which are traditionally used as sources of minerals, to reduce the complexity of the process of preparation of the nutrient medium and the risk of overdose components of the nutrient medium.

The use of lactose as a carbohydrate source allows the use of a nutrient medium as a differential for lactobacilli yeast.

The influence of nutrient medium composition on growth lactobacilli yeast is shown on the drawing. For control taken a nutrient medium Saburo.

As can be seen from the drawing, the introduction of mineral water resort Arshan" in the nutrient medium composition increases the yield of biomass lactobacilli yeast. This reduced the amount of compressed yeast in comparison with the known method.

As the rate of accumulation of biomass during the experiment using the optical density of the bacterial suspension (nm). The optical density was measured every 24 hours for 144 hours, including at the beginning of the experiment (0 h). As can be seen from the drawing, the dynamics of growth lactobacilli yeast on different nutrient media varies. Thus, the optical density of microbial suspensions, obtained by cultivation lactobacilli yeast on the experimental culture medium after 48 hours was reached values 3,4685 nm, and the cultivation of PA control 2,943 nm. The highest biomass growth lactobacilli yeast under cultivation on the experimental culture medium was observed after 48 hours after the moment of insulinopenia, while on the control and on the third day (72 hours). Thus, when the cultivation of yeast in the medium Saburo, which was the prototype, the biomass yield after 48 hours is from 10 to 15 g/l, and under cultivation on the environment by the proposed method, the biomass yield up to 25 g/L.

Obviously, such productivity lactobacilli yeast associated with contained in thermal water, mineral substances in the form of ions and medicationabana molecules that support acid-base balance, affecting the enzymatic activity of yeast. The nature and rate of flow of the basic metabolic processes also depend on changes in the functional activity of the membranes. As these p the parameters affect chemical reactions, which keep the organism alive, there are built-physiological mechanisms to maintain them at the required level. However, it is clear that in order to ensure self-propagating yeast cell has developed regulatory mechanisms that allow it to guide and coordinate biochemical processes.

It is noteworthy that the mineral water resort Arshan" contains silicic acid in the form of medicationabana molecules. Silicon as a biogenic element participates in diverse physiological processes ranging from changes in the cell membrane to DNA synthesis. This element is a required component of nucleic acids, where its content is 0.15 to 0.36%. In deoxyribonucleic acid (DNA) one atom of silicon has an average of 20-30 phosphorus atoms.

In the test medium, obtained by the claimed method, increased (in comparison with the environment Saburo) the content of Na, Ca, Fe, enough K, Mg, Mn, are Co, Zn, Ni. The supply of nutrients into the cell due to the special mechanisms of Na+-K+-ATP-ases in plasmatic membranes and Ca-Mg-ATPase in sarcoplasmic reticulum, which provides favorable for almost all enzymatic reactions. So, for example, introduced into the nutrient medium mineral water rich in ion and magnesium Mg 2+(143,5 mg/l), resulting in active permease system. In addition, ions of Mg2+have a stimulating effect on the quantitative content of ribosomes that speeds up protein synthesis.

For yeast one of the most popular minerals is Zn. The content of Zn in the mineral water resort Arshan" up to 8 ág/L.

Manganese mineral water resort Arshan" is the main activator of several enzymes, including alcoholic fermentation. He actively participates in the synthesis of vitamins, protein and some amino acids.

Cobalt affects the synthesis of non-protein nitrogenous substances of nature (DNA, RNA, amino acids).

Thus, the rich mineral content of the input water resort Arshan has a beneficial effect on the metabolism lactobacilli yeast, which showed high enzymatic activity, resulting in increased biomass yield (optical density of bacterial suspension at 48 hours after insulinopenia reaches the value 3,468 them under cultivation on the experimental nutrient medium and under cultivation on the environment Saburo - 2,943 nm) and decreased the duration of the fermentation process (at cultivation on the experimental nutrient medium maximum biomass growth was observed after 48 hours and under cultivation on the environment Saburo - 72 hours). Chrome is also the inventive method provides reduction process, reducing the complexity of the receiving medium.

Experimentally it was determined the optimal ratio of water and mineral water resort Arshan", which was 1:1. If you increase or decrease the amount of water in a specified ratio is reduced biomass yield lactobacilli yeast.

The optimum quantity of Baker's yeast installed within 10-12 g per 1 liter of a mixture of water and mineral water resort Arshan". When the number of yeast more than 12 oz and reduction of less than 10 Gy there is a decrease in biomass productivity.

Applying the proposed method to obtain lactobacilli yeast will increase the generative activity of yeast cells, to reduce the cost and accelerate the process of obtaining the active biomass of yeast.

The proposed method of obtaining nutrient medium for cultivation lactobacilli yeast is carried out as follows. On the basis of a mixture of natural mineral water resort Arshan" with mineralization of 4.1 mg/l and the tap water (ratio 1:1) prepare yeast parivar. The amount of raw pressed Baker's yeast is 10-12 g per 1 liter of a mixture of tap water and natural mineral water. Then yeast prewar filtered and sterilized, add 4% lactose, 1% peptone, mix, re-sterilize, cool.

EXAMPLE 1

To 0.5 liters of water (Mediterranee) of water, add 0.5 liters of mineral water resort Arshan and mix. To the resulting mixture of water, add 10 g of pressed Baker's yeast, boiled for 15 min, filtered through a paper filter, poured into flasks and sterilized at 1 ATM for 20 minutes After which 100 ml of the prepared yeast parivara add 1% peptone, 4% lactose, subjected to repeated sterilization at 0.5 ATM for 20 minutes, cool.

EXAMPLE 2

To 1 liter of water (Mediterranee) water add 1 liter of mineral water resort Arshan and mix. To the resulting mixture of water, add 20 g of pressed Baker's yeast, boiled for 15 min, filtered through a paper filter, poured into flasks and sterilized at 1 ATM for 20 minutes After which 100 ml of the prepared yeast parivara add 1% peptone, 4% lactose, subjected to repeated sterilization at 0.5 ATM for 20 minutes, cool.

EXAMPLE 3

Prepared according to example 1 nutrient medium used for cultivation lactobacilli. the yeast. This nutrient medium inoculant lactobacilli yeast in the amount of 10% of the number of medium, culturing is continued for 48 hours at a temperature of 22°C.

The output of the yeast after 48 is aces cultivation up to 25 g/L.

The method of obtaining nutrient medium for cultivation lactobacilli yeast, prepared on the basis of yeast parivara obtained by heat treatment and filtration of a mixture of water and baking yeast, after which the obtained yeast to perevary add peptone, carbohydrates, the mixture is filtered, sterilized, cooled, characterized in that in the preparation of yeast parivara to impose additional water natural mineral water resort Arshan" with mineralization of 4.1 mg/l in the ratio of 1:1, with Baker's yeast take in quantity of 10 to 12 g per 1 liter of the mixture of water and natural mineral water, as well as carbohydrates use lactose.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: invention relates to oligonucleotide primers and the method of their use for detection of Lactobacillus delbrueckii subspecies bulgaricus in starter cultures. Proposed synthetic oligonucleotide primers have nucleotide sequences: Lbul4F 5'-GGCCAGCCAGATCGCCAGC-3' and Lbul5R 5'-GACCAGGTCGCTGTCCGGC-3'. The proposed method includes performance of PCR. In case a DNA ferment is detected with size of 409 base pairs. a conclusion is made on availability of Lactobacillus delbrueckii subspecies bulgaricus in the investigated biomaterial.

EFFECT: inventions may be used in milk processing industry for detection and identification of strains and cultures Lactobacillus delbrueckii subspecies bulgaricus in starter cultures used in production of cultured milk foods.

2 cl, 1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: nutrient medium contains HMF - agar, erythrocytic mass from donor's human blood, serum of cattle and yeast extract at the specified ratio.

EFFECT: invention makes it possible to increase sensitivity of medium to extracted microorganisms, to improve growth properties of nutrient medium and to simplify method of its preparation.

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and use of a Trichoderma harzianum Rifai strain as a producer of an Impatiens necrotic spot tospovirus inhibitor. The Trichoderma harzianum Rifai strain, which is deposited in the Russian National Collection of Industrial Microorganisms under No.F-180, is a producer of the homogeneous enzyme L-lysine-a-oxidase, which exhibits marked antiviral activity with respect to Impatiens necrotic spot tospovirus.

EFFECT: reduced loss of decorative and vegetable crops caused by Impatiens necrotic spot tospovirus.

2 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Disclosed is a method for bioremediatio of water contaminated with 2,4,6-trinitrotoluene (TNT). The method is carried out in three series-connected bioreactors with continuous flow of the purified medium. At the first step, bioreactors are filled by a third with a liquid TNT-containing medium and mixers and the aeration system are turned on. A day old culture of yeast Yarrowia lipolytica VKPM Y-3492 is then added to the first bioreactor. The Y. lipolytica is cultured until full conversion of TNT to a S-3 monohydride Meisenheimer complex of a deep red colour. A day old culture of Y. lipolytica is added to the second bioreactor at the same time as the beginning of operation of the first bioreactor and then cultured until accumulation of yellow-orange S3, S5 dihydride Meisenheimer complexes. A day old culture of Y. lipolytica is added to the third bioreactor at the same time as the beginning of operation of the first and second bioreactors and then cultured until full decomposition of TNT-dihydride complexes with decolouration of the purified medium. At the second step, the biodegradation of TNT is carried out in continuous mode of culturing Y. lipolytica. The process of culturing Yarrowia lipolytica VKPM Y-3492 is carried out at temperature ranging from +24°C to +31°C, pH from 3.0 to 7.0 and rate of mixing the medium of 100-250 rpm. The source of carbon and energy for growth of the strain and degradation of TNT used is monosaccharides or triatomic alcohols or aliphatic hydrocarbons.

EFFECT: method increases efficiency of the process of decontaminating water contaminated with TNT and cuts the bioremediation time: provides 85% decomposition of TNT in concentration of 100 ml/g a day.

1 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to a composition containing yeast cells for reducing or eliminating the negative effects of mycotoxins. The yeast cell including a yeast cell wall containing a certain amount of clay or a clay-containing ingredient built into said yeast cell wall, for reducing or eliminating the negative effects of mycotoxins. The composition for reducing the bioavailability of mycotoxins, which contains a yeast cell wall extract with the in-built clay or clay-containing ingredient. Animal feed for reducing the bioavailability of mycotoxins, which contains the yeast cell wall extract with the in-built clay or clay-containing ingredient. The method for reducing the bioavailability of mycotoxins for animals or a human. The method for preparing the yeast cell wall extract with the in-built clay or clay-containing ingredient for reducing the bioavailability of mycotoxins.

EFFECT: yeast cell described above, the based composition and the extract thereof effectively reduce or eliminate the negative effects of mycotoxins.

50 cl, 9 dwg, 5 tbl, 7 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to feed production, particularly a method for microbiological production of feed yeast from grain wastes. The method involves preparation of grain material by grinding to 120-160 mcm particles. Further, the ground grain material is used to prepare an aqueous suspension containing 15-25% dry substances. The obtained suspension is saccharified with α-amylase and glucoamylase to 6-10% glucose content in the suspension. Nitrogen and phosphorus sources are added to the obtained suspension such that 90 mg of nitrogen and 45 mg of phosphorus are required for synthesis of 1 g of biomass. A culture is added to the obtained nutrient medium, said culture being a producer of the Saccharomyces cerevisiae yeast strain VKPM U-3585, having amylase activity, which is deposited in the Russian National Collection of Industrial Microorganisms (VKPM) and can be used in producing feed protein. The Saccharomyces cerevisiae yeast strain VKPM U-3585 is continuously grown in a multiple-section apparatus while feeding the nutrient medium simultaneously into several sections, followed by concentration of the suspension by vacuum evaporation and drying. Moisture freed at the vacuum evaporation and drying steps is used to prepare the aqueous suspension of grain material.

EFFECT: invention increases output of crude protein and true protein.

5 ex

FIELD: food industry.

SUBSTANCE: invention relates to the field of medicine, biology, prevention of the human diseases and health preservation. The substances composition for impact on the microbial-tissular complex of the human bowel is represented by a complex target product. The product includes inactivated yeast cytoskeletons. The yeast is represented by Saccharomyces symbiotic races mixture immobilised on a carrier. The carrier is produced depending on the composition of a mixture of offal of cereals and/or legumes and/or nuts by way of their extrusion under a pressure up to 300 kg/cm2 and at a temperature of 80 - 220°C combined with drinking water in a proportion equal to 1 kg of the mixture per 0.5-2.0 l of drinking water. Additionally the complex target product includes Saccharomyces symbiotic races vital activity products biomass at a ratio of 15 - 85 % of the Saccharomyces biomass total quantity. The physical and chemical composition of the product is determined according to presence of microelements and/or enzymes and/or hormones introduced in the process of Saccharomyces biomass growth on the carrier as well as according to presence of oligosaccharides in the carrier composition equal to less than 50% of the total content of carbohydrates contained in the carrier. The vital activity products biomass combined with microelements and/or enzymes and/or hormones, produced as a result of their processing by Saccharomyces on extruded offal of cereals and/or legumes and/or nuts having a porous surface no less than 2.0 m2/g and with Saccharomyces cells concentration equal to no less than 103-1012 cells/g, is represented by a biotransformed compound. This compound provides for presence of element compound as follows in the target product, wt %: carbon - no less than 45, hydrogen - no less than 6.4, oxygen - no less than 30, nitrogen - 7.5-10, phosphorus -1.6-3.5, calcium - 0.3-0.8, potassium - 1.5-2.5, magnesium - 0.1-0.4, sodium - 0.06-0.2, sulphur - 0.2% as well as presence of biotransformed yeast microelements in the biotransformed compound which include, mg/kg: ferrum - 90- 350, cuprum - 20-135, zinc - 100-160, molybdenum - 15-65. The biotransformed compound presence in the substances composition ensures adaptogenic, immunomodulatory, metabolic-homeostasing, enterosorption, detoxification and antiinflammatory activity under impact on the bowel microbial-tissular complex with persons suffering from acute and chronic diseases as well as persons having undergone environmental impact.

EFFECT: invention allows to recover the microbial-tissular complex of the human bowel in general.

4 cl, 7 dwg, 1 tbl, 12 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Disclosed is a yeast strain Yarrowia lipolytica VKPM Y-3492 - a trinitrotoluene (TNT) decomposer.

EFFECT: strain decomposes TNT with content thereof up to 150 g/l over a 14 hour culturing period with amount of yeast cells of 0,5 g/l and glucose concentration of 2 g/l.

FIELD: medicine.

SUBSTANCE: what is presented is recombinant plasmid DNA pPBS-St9 coding polypeptide having a sequence of the human growth hormone somatotropin of molecular weight 4.1 MDa (6266 base pairs), as well as the Saccharomyces cerevisiae strain BY4739 [leu2 ura3 lys2 prcl::LEU]/pPBS-St9 containing recombinant plasmid DNA pPBS-St9 that is a recombinant somatotropin producer.

EFFECT: invention may be used for producing the recombinant human growth hormone in treating dwarfism.

2 cl, 5 dwg, 2 ex

FIELD: chemistry.

SUBSTANCE: contaminated natural and waste water is treated using cells of a yeast strain Geotrichum sp. VKPM F-1037 in series-connected bioreactors fitted with suitable equipment with a continuous stream of the contaminated and purified medium. Optimum temperature from +24°C to + 32°C, medium pH from 3.0 to 7.0 and rate of mixing biomass and medium from 100 to 250 rpm are maintained in the bioreactors.

EFFECT: method enables destruction of TNT and its metabolites in a short period of time when treating water contaminated with high concentrations of TNT.

5 cl, 1 dwg

FIELD: food industry.

SUBSTANCE: pressed yeast preliminary activation method preparation of nutritive medium for yeast activation, introduction of milled pressed yeast into the nutritive medium to produce a mixture and the mixture maintenance during 20-30 minutes at a temperature of 30-32°C. The nutritive medium preparation consists in obtainment of brew of part of wheat flour and water at a ratio of 1:3. Added into 50-60°C brew is active white malt in an amount of 0.2 kg per 100 kg of flour in the dough, an additional quantity of wheat flour in an amount of 1.3-2.0 kg and watermelon cake produced of watermelon seeds processed at a temperature of 70-90°C in a two-screw press extruder. The obtained mixture is thoroughly stirred and cooled to 30-32°C. Continuously stirring, one introduces the corresponding quality of cold water. The ratio of flour: water: watermelon cake is (1.0:2.5:0.1)-(1.0:4.0:0.5).

EFFECT: improvement of crumb porosity structure and bread aroma; increase of ready products volume and reduction of bread crumb staling rate; enhancement of intensity of gas generation in the process of dough fermentation as well as of dough gas-retaining property which enables pressed yeast consumption reduction by a factor of 1,3.

1 tbl, 3 ex

FIELD: food industry.

SUBSTANCE: one proposes Geotrichum sp yeast strain. All-Russian collection of industrial microorganisms F - 1037 implementing biological degradation of 2,4,6-trinitroluene.

EFFECT: strain preserves high activity and ensures accelerated destruction.

1 ex

FIELD: chemistry.

SUBSTANCE: Saccharomyces cerevisiae Dagestan Cherry yeast strain has high rate of propagation, high activity of enzymes of the carbohydrate and nitrogen complex and is deposited in the Russian National Collection Of Industrial Microorganisms (VKPM) of the State Research Institute Of Genetics And Selection Of Industrial Microorganisms under registration number Y-3587.

EFFECT: invention enables to obtain natural cherry wine with a finer aroma of fresh cherry, a velvet taste and a beautiful ruby colour.

2 tbl, 2 ex

FIELD: fodder industry.

SUBSTANCE: invention relates to a method for preparing protein-vitamin fodder that involves solid or liquid waste in production and processing the natural raw (grains, milling waste, post-alcoholic distillery grains, beer pellets, fruit pulps or whey). Enzyme lysates are prepared from solid waste and starch waste. Cobalt salt is added to liquid waste or enzyme lysates. Prepared nutrient medium is used in incubation of lactobacillus and propionibacillus microorganisms taken by the following pairs: Lactobacillus acidophilus 1660/02 with Propionibacterium freudenreichii subsp. shermanii 103/12; or Lactobacillus acidophilus 1660/02 with Propionibacterium acnes 1450/28; or Lactobacillus plantarum 578/25 with Propionibacterium freudenreichii subsp. shermanii 103/12; or Lactobacillus plantarum 578/25 with Propionibacterium acnes 1450/28. This method provides preparing fodder enriched with vitamins and proteins and containing live cells of lactobacillus and propionibacillus microorganisms. Method enriches animal intestine microflora after feeding the prepared fodder to animals. Fodder comprises protective substances (organic acids, enzyme systems) and can be stored as crude form for the prolonged time.

EFFECT: improved preparing method, valuable properties of fodder.

13 cl, 1 tbl, 12 ex

Up!