Synthetic oligonucleotide primers and method to detect lactobacillus delbrueckii subspecies bulgaricus in starter cultures used in production of cultured milk foods

FIELD: biotechnologies.

SUBSTANCE: invention relates to oligonucleotide primers and the method of their use for detection of Lactobacillus delbrueckii subspecies bulgaricus in starter cultures. Proposed synthetic oligonucleotide primers have nucleotide sequences: Lbul4F 5'-GGCCAGCCAGATCGCCAGC-3' and Lbul5R 5'-GACCAGGTCGCTGTCCGGC-3'. The proposed method includes performance of PCR. In case a DNA ferment is detected with size of 409 base pairs. a conclusion is made on availability of Lactobacillus delbrueckii subspecies bulgaricus in the investigated biomaterial.

EFFECT: inventions may be used in milk processing industry for detection and identification of strains and cultures Lactobacillus delbrueckii subspecies bulgaricus in starter cultures used in production of cultured milk foods.

2 cl, 1 tbl, 3 ex

 

The invention relates to biotechnology, namely, DNA technology, and can be used in dairy industry for genotyping of strains and cultures of Lactobacillus delbrueckii subspecies bulgaricus.

Up to now, the main method for typing of strains and isolates of Lactobacillus delbrueckii subspecies bulgaricus is a method based on the accumulation data of bacteria in the non-fatty milk. For example, when highlighting the culture of a sample of yogurt, one drop of the product make a bacteriological loop in sterile skim milk. Crops thermostatic at 37°C until the coagulation of milk. The study of biological and biochemical properties and comparison of the received data is carried out with a differential data tables 9 and 10 listed in the directory Laennecwas, Nscolorwell, Wefeelfine (Microbiological basis of milk production. M Agropromizdat. - 1987. - P.15-18), and table 19.1 of the determinant of microorganisms, Bergey (Keys bacteria Burgi. In 2 so - 2. - Ed. Cholta, Ncrha, Penita, Jsteele, Suillus. - M.: Mir. - 1997. - N.574-576) allows the typing of the studied bacteria.

The disadvantages of this method include the need for a large number of differentiating biochemical tests, the duration of the testing process and high cost.

The most is her closest solution of the present invention is a method for genotyping Lactobacillus, including the synthesis of oligonucleotide primers for intergenic insertion of 16S-23S rRNA (Identification to the species level of Lactobacillus isolated in probiotic prospecting studies of human, animal or food origin by 16S-23S rRNA restriction profiling/ J.L.S Moreira, R.M Mota, M.F Horta et al.//BMC Microbiology. - 2005. - vol.5. No. 15. - P.1-9.) Then the synthesis of the DNA sequence of intergenic insertions and hydrolysis of its 11 endonucleases. Next is electrophoresis and comparison of the obtained patterns 6 specific base points compared with reference strains. This technique allows to distinguish almost all isolated culture at the species level, but not subspecies.

The disadvantages of this method include the need for hydrolysis of amplicons and comparing patterns of each sample with the reference strains, the duration of the testing process and high cost.

The closest solution adopted for the prototype, is the synthesis by PCR 16S rRNA genes using primers selected on the basis of Lactobacillus species. This allows you to identify the kind of data microorganisms and differences in relation to other bacteria (Ephrata, Kvelstad/ Identification of bacteria of the genus Lactobacillus using PCR-system// Sibirskii Vestnik S.-H. science. - 2011. No. 7-8. - Pp.109-117).

The disadvantages of this method include the fact that reveals only the genus and species of Lactobacillus.

The task of the image is to be placed is expanding Arsenal of specific oligonucleotide primers and reduce the time of detection of Lactobacillus delbrueckii subspecies bulgaricus using specific synthetic oligonucleotide primers.

The problem is solved in that the synthesized synthetic oligonucleotide primers for the detection of Lactobacillus delbrueckii subspecies bulgaricus in the starter cultures used in the production of fermented milk products:

Lbu14F 5'-GGCCAGCCAGATCGCCAGC-3' and

Lbu15R 5'-GACCAGGTCGCTGTCCGGC-3'.

The task is solved in that in the method of detection of Lactobacillus delbrueckii subspecies bulgaricus in starter cultures in the production of fermented milk products, including PCR using synthetic oligonucleotide primers according to the invention, the primers have a nucleotide sequence

Lbu14F 5'-GGCCAGCCAGATCGCCAGC-3' and

Lbu15R 5'-GACCAGGTCGCTGTCCGGC-3',

and in case of detection of DNA fragment size 409 i.e. make a conclusion about the presence in the studied biological material Lactobacillus delbrueckii subspecies bulgaricus.

The invention is illustrated by the following examples.

Example 1. The method of production of synthetic oligonucleotide primers

The search for new specific primers carried out on the basis of the selected DNA gene mfd (reduced-repair coupling factor), is characteristic only of Lactobacillus delbrueckii subspecies bulgaricus, in the analysis of complete genomes reference strains of Lactobacillus delbrueckii subspecies bulgaricus: ATCC11842, ATCCBAA-365, ND02 and 2038 submitted to GenBank (http://www.ncbi.nlm.nih.gov/ GenBank Search.html). The selected DNA fragments tested using the program Blast (http://www.ncbi.nlm.nih.gov/blast).

The final choice PRA the Mer is based on the following criteria: high level of similarity of DNA fragments with DNA of different strains of Lactobacillus delbrueckii subspecies bulgaricus, the content of the reason GC is not less than 50%, do not form dimers, complementary DNA sequences at the boundaries of the specific fragment.

Chemical synthesis of primers carry out method was used on the automatic synthesizer ASM-102U.

The concentration of specific oligonucleotide primers in the mother solution, determine spectrometric method.

Thus, this method allows to obtain synthetic oligonucleotide primers complementary DNA gene mfd (reduced-repair coupling factor), is characteristic only of Lactobacillus delbrueckii subspecies bulgaricus.

Example 2. The method of using synthetic oligonucleotide primers for the detection of Lactobacillus delbrueckii subspecies bulgaricus in starter cultures in the production of fermented milk products

The method is carried out in several stages

Step 1. DNA isolation of Lactobacillus delbrueckii subspecies bulgaricus

For DNA extraction take suspensions of strains and isolates of Lactobacillus delbrueckii subspecies bulgaricus, highlighted on the environment from hydrolyzed milk (HMS), as well as the biomaterial from dairy products.

In the allocation of bacterial cell culture precipitated the plaque by centrifugation 1-2 min at 5000-7000 rpm the Supernatant removed. 50 μl of culture added to 300 ál of warmed up to +80°C 10% to BECOME mixed and incubated at 80°C for 30 minutes. Then cooled prior to matnog temperature and add 0.5 volume (300-350 ml) mixture of phenol/chloroform/isoamyl alcohol (25:24:1), gently stir 2-3 times for 1 min and centrifuged for 10 min at 13,000 rpm Aqueous phase is transferred to another test tube and poured 300 μl of a mixture of chloroform/isoamyl alcohol (24:1), stirred for 1 min and centrifuged for 6 min at 13,000 rpm To the aqueous phase add 50 μl (1/10 volume) of 3M sodium acetate pH 4.8 and 1000 μl of ethanol, stirred and placed for 1 hour at -20°C. the Sample was centrifuged 10 min at 13000 rpm and the precipitate is washed with 70% ethanol, dried in an inclined position the tubes at 37°C for 25-30 min and dissolved in 30-50 ál of autoclaved bidistilled water.

Step 2. Conducting polymerase chain reaction

The composition of the reaction mixture: For each of the studied DNA samples prepared PCR mix: 650 mm Tris-HCl pH 8,9; 160 mm (NH)4SO4; 30 mm MgCl; 0,5% Tvin-20; 2.5 mm dNTP, no 0,15 µg of each primer; 1,0 EA. Taq polymerase, and 2 ál of sample DNA and autoclaved bidistilled water up to 25 µl.

Temperature PCR: amplification Program consists of the following temperature conditions: heating the reaction mixture at 95°C for 3 min for 1 cycle, then denaturation at 94°C for 0.2 min, annealing at 60°C for 0.2 min, elongation at 72°C for 0.4 min for 35 cycles and docentes at 72°C for 0,8 minutes

Step 3. Determine the size of PCR products

The PCR products analyzed by electrophoresis in 0.5x Tris-borate buffer prepared from 5x TBE buffer (0,089 M Tris-borate; 0,089 M boric acid; a 0.002 M EDTA).

The PCR products were visualized by electrophoresis in 1%agarose gel with bromide by ethidium when amperage 25-40 mA within 30-40 minutes of 12.5 μl of the amplicon is mixed with 3 μl of the buffer for the application of 0.25% bromophenol blue, 30% glycerol in bidistilled water) and applied to the wells of the gel under electrophoretic buffer. Electrophoresis is carried out at a voltage of 10 V/cm the length of the gel as long as the dye will take place from the start not less than 2.0-2.5 cm of the gel (about 35-40 minutes). The results of electrophoresis consider viewing the gel under ultraviolet light with a wavelength of 254 nm on the device "Transilluminator". As a token use DNA pSKII(+), gidralizovanny MspI fragments 710, 489, 404, 328, 242, 190 n / a or 100 bp. The result of the PCR is considered positive if the PCR product corresponds to the size of the DNA fragment in 409 n / a

Example 3. Determination of the specificity of PCR

The results of studies to determine the specificity of the reaction with the primers Lbu14F and Lbu15R presented in the table show that the positive analysis of PCR products receive only when as a matrix using the DNA fragment of the gene mfd (reduced-repair coupling factor), is characteristic only of Lactobacillus delbrueckii subspecies bulgaricus. The tests were negative when used DNA to other bacteria.

To confirm the special is epichnosti test DNA fragment of the gene mfd (reduced-repair coupling factor), characteristic only of Lactobacillus delbrueckii subspecies bulgaricus, established a fragment of the DNA matrix strain 630 Lactobacillus delbrueckii subspecies bulgaricus (collection of the GNU SibNIA, Barnaul) and held sequencing. Analysis nucleotidyl sequence of the synthesized fragment was carried out by the methods of alignment with other published sequences of complete genomes reference strains of Lactobacillus delbrueckii subspecies bulgaricus: ATCC11842, ATCCBAA-365, ND02 and 2038 submitted to GenBank (http://www.ncbi.nlm.nih.gov/ GenBank Search.html). Established that the nucleotide sequence of strain 630 Lactobacillus delbrueckii subspecies bulgaricus (collection of the GNU SibNIA, Barnaul) coincided with the nucleotide sequence as matrix using the DNA fragment of the gene GenBank above reference strains of Lactobacillus delbrueckii subspecies bulgaricus.

Thus, the developed synthetic oligonucleotide primers and the method of detection of Lactobacillus delbrueckii subspecies bulgaricus in starter cultures in the production of fermented milk products have high specificity and effectively carry out the identification of strains and cultures of Lactobacillus delbrueckii subspecies bulgaricus used in the dairy industry.

1. Synthetic oligonucleotide primers for the detection of Lactobacillus delbrueckii subspecies bulgaricus in the starter cultures used in the production of kilomole the different products and having the nucleotide sequence:
Lbul4F 5'-GGCCAGCCAGATCGCCAGC-3' and
Lbul5R 5'-GACCAGGTCGCTGTCCGGC-3'.

2. The method of detection of Lactobacillus delbrueckii subspecies bulgaricus in the starter cultures used in the production of fermented milk products, including PCR with oligonucleotide primers, and the primers have the nucleotide sequence:
Lbul4F 5'-GGCCAGCCAGATCGCCAGC-3' and
Lbul5R 5'-GACCAGGTCGCTGTCCGGC-3',
and in case of detection of DNA fragment size 409 i.e. make a conclusion about the presence in the studied biological material Lactobacillus delbrueckii subspecies bulgaricus.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: nutrient medium contains HMF - agar, erythrocytic mass from donor's human blood, serum of cattle and yeast extract at the specified ratio.

EFFECT: invention makes it possible to increase sensitivity of medium to extracted microorganisms, to improve growth properties of nutrient medium and to simplify method of its preparation.

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and use of a Trichoderma harzianum Rifai strain as a producer of an Impatiens necrotic spot tospovirus inhibitor. The Trichoderma harzianum Rifai strain, which is deposited in the Russian National Collection of Industrial Microorganisms under No.F-180, is a producer of the homogeneous enzyme L-lysine-a-oxidase, which exhibits marked antiviral activity with respect to Impatiens necrotic spot tospovirus.

EFFECT: reduced loss of decorative and vegetable crops caused by Impatiens necrotic spot tospovirus.

2 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: chemistry.

SUBSTANCE: group of inventions relates to diagnosis, particularly to methods and reagents, including biochips, for detecting presence of one or more analysed objects in a sample, based on use of a set of granules which contains a plurality of families or subsets of granules, wherein each of the granules inside each family of granules of a subset can be connected with a labelled probe for capturing nucleic acid, which is capable of binding with an HPV strain specific region of the HPV genome. Each of the families of granules inside each separate set has a different fluorescence intensity.

EFFECT: fast methods and reagents which can be used in diagnosis.

13 cl, 4 ex, 5 tbl

FIELD: biotechnologies.

SUBSTANCE: method provides for performance of a reaction of multi-segment reverse transcription (M-RT) of virus RNA, matched with reaction of cDNA amplification. Reactions are carried out in one stage with the help of one pair of universal primers selected to highly conservative areas available in all virus segments, in presence of fluorescently labelled nucleotides. The matrix for this reaction is a single-chain RNA of flu virus from analysed biological samples. The quality of the produced fluorescently labelled cDNA of type A flu virus is checked by the method of electrophoresis in 1% agarose body. The proposed method makes it possible to perform quick production of fluorescently labelled amplificates of a virus cDNA for all segments of a virus genome.

EFFECT: using this method considerably reduces time required to do detection and subtyping of A flue virus on diagnostic biochips in analysed samples.

2 dwg

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and virology. The hMPV amplification according to the present invention is compatible with detecting the other viruses causing respiratory infections, as well as with the hMPV genetic typing as found in a sample. After the test sample are amplified with primers specific for each virus, the amplification products are used to produce one-chain DNAs and hybridised with the probes specific to the relevant viruses.

EFFECT: there are described the method and kit for detecting and identifying human metapneumovirus (hMPV) in the test samples, as well as s number of sequences and their application as the hMPV amplification primers.

19 cl, 5 dwg, 2 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, namely a method for differentiation of tularemia microbial subspecies. The invention may be used in laboratory diagnosis of tularemia. The method involves PCR amplification with the use of gene-specific iglC and chromosome regions containing E. coli-like Chi-sequences of the primers FiglC-AAGGATAAGACCTGTCTG, RiglC-TTGAAACCATACCGGGTA and Chi If CTAGG-GCTGGTGG-G. It is followed by electrophoresis of the amplification products to be differentiated by comparing electrophoretic mobility of the produced amplicons and mobility of DNA marker fragments. If observing a specific light-producing strip at the level of 986 base pairs, the strain data are recorded as Francisella gen. The strip distribution pattern within the range of ~190 to ~830 base pairs enables differentiating the analysed samples at the level of tularemia microbial subspecies: ~190 base pairs for subsp. novicida, ~500-570 base pairs for subsp. mediasiatica, ~570 base pairs for subsp. holarctica, whereas subsp. tularensis is characterized by the fragment of ~500 base pairs.

EFFECT: presented invention enables accurate, instant and high-specific method for differentiation of F tularensis subspecies.

1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, particularly a method for analysing a reaction frequency of a target nucleotide sequence and one or more nucleotide sequences of concern. The method provides (a) preparing a sample of cross-linked DNA and (b) cross-linked DNA cleavage by a first restriction fragment. It is followed by (c) ligation of the cross-linked nucleotide sequences, (d) removal of the cross links; (e) nucleotide sequence cleavage by a second restriction fragment, and (f) ligation of one or more DNA sequences having a known nucleotide composition with accessible cleavage site(s) by the second restriction fragment which flanks one or more nucleotide sequences of concern. Then, (g) one or more nucleotide sequences of concern are amplified with the use of two nucleotide primers with each primer hybridised with DNA sequences which flank the nucleotide sequences of concern. It is followed by (h) hybridisation of the amplified sequence(s) with a chip; and (i) determination of the reaction frequency of the DNA sequences.

EFFECT: what is presented is the method for co-localised chromatin trapping and characterising.

29 cl, 19 dwg, 2 tbl, 8 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, molecular biology, molecular epidemiology. There are presented oligonucleotide primers for B. mallei genetic typing by polymerase chain reaction.

EFFECT: invention may be used in medicine for detecting an equinia agent.

3 dwg, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes the following stages: contact of a sample with a source of nutrition for cells, containing antioxidant, representing pyroracemic acid or its salt, and an inhibitor of cell proliferation, which is selected from ciprofloxacin and cefalexin; contact of the specified sample with fluorescent-marked oligonucleotide probes, capable of specific hybridisation at least with one section of ribosomal nucleic acids, which belong to microorganisms of Legionella pneumophila kind and type; and detection and quantitative determination of a fluorescent signal.

EFFECT: provided method and set make it possible to more accurately and reliably detect and calculate viable microorganisms of Legionella pneumophila type, having excluded natural fluorescence of microorganisms from calculation.

6 cl, 2 dwg, 6 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

Up!