Nutrient medium for extraction, cultivation and determination of haemolytic properties of bacteria from clinical material

FIELD: biotechnologies.

SUBSTANCE: nutrient medium contains HMF - agar, erythrocytic mass from donor's human blood, serum of cattle and yeast extract at the specified ratio.

EFFECT: invention makes it possible to increase sensitivity of medium to extracted microorganisms, to improve growth properties of nutrient medium and to simplify method of its preparation.

 

The invention relates to Microbiology, in particular nutrient environments, can be used in research and practical work for bacteriological diagnosis of bacteria, including bronchopulmonary pathogens, such as Streptococcus pneumoniae, Moraxella (Branchamella) catarrhalis, Streptococcus pyogenes, β-hemolytic Streptococcus spp., Staphylococcus aureus.

Diseases of the respiratory system according to official statistics consistently in our country, the first place in the overall morbidity of children and adolescents. Many clinical forms of respiratory pathology determine the level of child morbidity and infant mortality. Often bronchopulmonary disease, starting from children, continue in adulthood, lead patients to disability and sometimes to a dramatic outcomes [10]. It is therefore important improvement of laboratory diagnostics of inflammatory diseases of the respiratory system and upper respiratory tract, including bacterial etiology in children.

The choice of nutrient medium for inoculation of clinical material from patients with inflammatory diseases of the respiratory system and ENT is hampered by the multiplicity of agents and variety of clinical material in this pathology.

Known breeding ground for seeding and selection of Streptococcus pneumoniae, a copy of which is designed Katoo the Oh L.K. [1, 2], for which as agar basis, you can use aritra-agar, dry nutrient agar, RM-agar No. 1 (contains pancreatic hydrolysate fish meal, dry), RM-agar (dry), AGV (agar of Givental-Witch) with optimum pH of the medium was 7.2 ą 0.2. After autoclaving, the agar is cooled to a temperature of 45°C, add 10% inactivated horse serum, 3% red blood cell mass, or 5% defibrinating blood.

In a ready-made basis, which can be used aritra-agar, dry nutrient agar, RM-agar No. 1, RM-agar, the agar of Givental-Witch, prepared according to the recipe shown on the label, pH 7,2±0,2 cooled to 45°C, add:

1) 3% red blood cell mass (100 ml fundamentals 3 ml) or 5% defibrinating blood;

2) 10% inactivated horse serum (100 ml base - 10 ml);

3) pour into Petri dishes.

The disadvantages of this nutrient should include good growth properties in relation only to Streptococcus pneumoniae; use of horse serum for most practical clinical Microbiology laboratories, especially in the area is difficult, which ultimately increases the cost of the final product.

Known nutrient medium with 5% blood agar for the initial allocation of microorganisms and determine their hemolytic properties, which recommended P is Icaza of the Ministry of health of the USSR No. 535 of April 22, 1985, "On the unification of microbiologic methods, used in clinical diagnostic laboratories medical institutions" [9]as the main breeding ground for planting, detachable respiratory str (detachable throat and nose; sputum; the contents of the bronchi, obtained by bronchoscopy or by suction through a tracheostomy (in patients on hardware breath); exudates; resected tissue and others) and ENT-organs. To prepare this environment, according to the order №535, used as a base dry nutrient agar. According to the recipe shown on the label, prepare 2% agar, pH 7.4 and 7.6. To the melted and cooled to 45°C. the agar, following the rules of asepsis, add 5% (5 ml of blood per 100 ml of culture medium) defibrinating sheep, horse or rabbit blood, citrate or defibrinating human blood without antibiotics. The mixture was thoroughly stirred, to form foam, and pour into sterile Petri dishes, pre-heated at thermostat, a layer of 3-4 mm Layer of agar should be evenly colored red. Store no more than two weeks in cellophane bags at 4-6°C.

The disadvantages of this nutrient include: low growth properties for fastidious organisms, particularly Streptococcus pneumoniae, Streptococcus pyogenes, β-hemolytic Streptococcus spp.

The prototype of the proposed the Reda was a breeding ground for Katosova L.K., where total is the basis of dry nutrient agar and adding erythrocyte mass. And distinctive features are: add in our environment bovine serum and yeast extract instead of 10% inactivated horse serum. Prototype - one should be for the drafting of claims, perhaps the closest analogue (prototype) is a nutrient medium for the recipe Katosova L.K. AND if you agree with this, then please specify the General characteristics and Distinguishing features of Your environment and the environment of the prototype. And also need the prototype for the method.

To determine the hemolytic activity of bacteria, a number of authors recommends agar with cardiac hood (with the addition of blood, HiMedia, Heart Infusion Agar) [11], which is used for isolation and cultivation of a large variety of microorganisms, in particular as a basis for preparation of blood agar with 5% defibrinating blood rabbit, horse or sheep to determine the hemolytic activity of S.pneumoniae, these bacteria to antibiotics. Composition, g/l, includes:

Hood beef heart 500,0

Tryptose 10,0

Sodium chloride 5,0

Agar 15,0

pH 7,4±0,2

Known also another nutrient medium for the detection of hemolytic activity of fastidious microorganisms - base blood agar No. 2 (HiMedia, Blood Agar No. 2) [11]. Composition, g/l: peptone Proteose the th 15,0; the hepatic extraction of 2.5; yeast extract 5,0; sodium chloride 5,0; agar 15,0; pH 7.4 ą 0.2. After sterilization by autoclaving 15 minutes at a temperature of 121°C is cooled to 45-50°C and add sterile 7% sterile sheep blood, rabbit, horse or human (without preservatives).

The number of known media for the isolation and cultivation of pneumococcus, such as trypticase prewar meat Hottinger [11], which contains: 70-75% hydrolyzed meat on Hottinger or casein (1.8-2.0 g/l of amino nitrogen); 20-25% of hydrolyzed bovine hearts (1.4 to 1.5 g/l of amino nitrogen); 1,7-2,0% agar; distilled water 1000,0 ml; pH of 7.6±0,1. This basis sterilized at 121°C for 20 minutes Before use to the melted and cooled to 45°C. the medium was added 0.5% extract of fodder yeast (together with serum or blood).

The disadvantages of the above culture media to determine the hemolytic activity of bacteria, isolation and cultivation of pneumococcus should be attributed to their high cost and the use of scarce components in the preparation.

The technical result is to increase the growth properties of the nutrient medium with simultaneous reduction of its cost, and to ensure the availability of its preparation for practical clinical Microbiology laboratories. Due to the fact that the most frequent bacterial pathogens inflammatory is of deseases respiratory and ENT community-acquired etiologies are Streptococcus pneumoniae, Moraxella (Branchamella) catarrhalis, Streptococcus pyogenes, β-hemolytic Streptococcus spp., Staphylococcus aureus, Haemophilus unfluenzae[4, 8, 13, 14], we offer the following medium - trovano-serum agar for the isolation, cultivation and determination of hemolytic properties of bacteria from clinical material.

This technical result is achieved by the features.

Nutrient medium for the isolation, cultivation and determination of hemolytic properties of bacteria from clinical material containing GMF - agar, RBC mass from donated human blood, serum bovine and yeast extract with the following proportions of components:

GMF - agar- 100 ml
red blood cells from donated human blood3 ml
serum of cattle5 ml
yeast extract3 ml

The method of preparation of the nutrient medium for the isolation, cultivation and determination of hemolytic properties of bacteria from clinical material, includes 3 stages:

1) stage - preparation of yeast extract: 2 the distilled water dissolve 1 kg of Baker's yeast, cook with after boiling 1 hour Then you need to pour in a glass volumetric flask, 1 l, cover with a cloth and give will settle at room temperature until the morning. The next day the supernatant was poured through a sterile pipette into a sterile measuring 100 ml flasks with cotton-gauze tube (a total of 1.5 l of yeast extract) and sterilized by autoclaving at 110,8°C (0.5 kg/cm2[6]) 30 minutes After the cooling of the bottles with yeast extract can be stored in the refrigerator (+2 to+8°C up to 1 month.

The prototype of the method of preparation of the yeast extract was the way described in the book "Enterobacteria", 1985, edited by Pokrovsky V.I. [12]. Composition: 1. Yeast cake of bread (preferably uterine) - 0.5 kg 2. Distilled water - 1000 ml Yeast crush and boil on low heat for 1 hour, again stir, pour into bottles, sterilized at 121°C for 30 minutes the Finished extract is placed in the refrigerator for 5-7 days. For cooking environments use the supernatant liquid. Can the addition of 0.5% chloroform. Canned extract can be stored at 4-10°C for several months.

Common to both methods is the dissolution of Baker's yeast in distilled water and boiling for 1 h, and prepared for further nutrient media use the supernatant liquid.

Distinct is ranked on the characteristics of our proposed method is: 1) after boiling the finished extract into a volumetric flask and allow to stand at room temperature, after which the supernatant liquid is poured into the measuring sterile vials is convenient from a practical point of view, because there is no possibility of the sludge with the addition of yeast extract in the culture medium; 2) sterilization by autoclaving at 110,8°C (0.5 kg/cm2[6]) for 30 min, resulting minimizes the harmful effect of the temperature factor on the nutrients contained in yeast extract; 3) we do not add preservative - 0.5% chloroform, resulting minimizes the harmful effect of the preservative on the nutrients contained in yeast extract, and subsequently no inhibitory effect on the growth of microorganisms in a nutrient medium with the addition of yeast extract.

2) stage - preparation of a basis of dry nutrient agar for cultivation of microorganisms, pH 7.4 and 7.6 (GMF - agar, ingredients: hydrolyzed meat enzymatic 15.0 g; sodium chloride 9.0 g; agar 12,0, Ready dry, manufacturer : CJSC "Scientific-research center of pharmacotherapy", St. Petersburg), according to the recipe shown on the label: 36,0 g GMF - agar stir in 1 l of distilled water, boil for 1-2 minutes to fully melt the agar. Filtered through a cotton-gauze filter, poured into sterile volumetric flasks and sterilized by autoclaving at 121°C (1.1 kg/cm2) 15 minutes is the ed cooled to 45-50°C, poured into a sterile measuring 100 ml flasks with cotton-gauze tube, the pH of the basics of 7.4 and 7.6. After the cooling of the bottles with yeast extract was stored in a refrigerator (+2 to+8°C up to 1 month.

3) the stage of immediate preparation of the nutrient medium for the isolation, cultivation and determination of hemolytic properties of bacteria from clinical material: 100 ml basis to melt in a water bath, then cooled to 45°With the base to add in the sterile conditions of Boxing, 5 ml bovine serum, 3 ml of erythrocyte mass of human blood and 3 ml of yeast extract. The mixture was thoroughly stirred, to form foam. Then Wednesday (KSA) pour into sterile pipette 20 ml in sterile Petri dishes (the thickness of the agar should be 3-4 mm). A layer of agar should be evenly colored red. To give the environment to harden and ready environment to store in the refrigerator (+2 to+8°C for 2 weeks in packets (to prevent drying).

The quantitative ratio of the components of the nutrient medium and its pH provide the sensitivity of the environment.

The increase in the growth properties of the nutrient medium is caused by the presence of the 1) yeast extract, which is a source of carbon and nitrogen with a high nutritional value, source of b vitamins, vitamin D and other growth factors - purine and pirimidinovykh grounds. Protein yeast balanced amino acid composition, and that index is close to that of animal protein. Has a high content of lysine, leucine, isoleucine, aspartic and glutamic acids, and essential amino acids - arginine, histidine, tryptophan, tyrosine, cysteine, phenylalanine, methionine, threonine [3, 8]; 2) bovine serum required for the growth of Streptococcus pneumoniae and manifestations of them typical morphology and culture characteristics: delicate translucent clearly defined colonies with a diameter of about 1 mm, or they can be flat with a hollow in the centre. In addition, the serum stimulates the formation of capsules of Streptococcus pneumoniae [5]; 3) erythrocyte mass add, which, firstly, has diagnostic value of determination of hemolytic properties of the microorganism (α, β, γ-hemolysis), and secondly, provides an effective growth of Streptococcus pneumoniae, Streptococcus pyogenes, β-hemolytic Streptococcus spp., they have no cytochrome and utilize oxygen atmosphere using system flavoprotein, resulting in the formation of hydrogen peroxide, which microorganisms are unable to neutralize, as they do not possess catalase [2].

Thus, the obtained data showed that the proposed environment and the method of its preparation allow bacteriological method main bronchiole the internal pathogens even when a small amount of the pathogen in the pathological material. The proposed environment has the best growth properties than the currently used media, in addition, the availability of the components of its production does not require scarce drugs, such as inactivated horse serum or defibrinated sheep, horse or rabbit blood and other Ease of preparation of the inventive environment allows its use for isolation, cultivation and determination of hemolytic properties of bacteria, including bronchopulmonary pathogens, such as Streptococcus pneumoniae, Moraxella (Branchamella) catarrhalis, Streptococcus pyogenes, β-hemolytic Streptococcus spp., Staphylococcus aureus from clinical material in the laboratory in the diagnosis of inflammatory diseases.

The authors conducted a comparative study of the proposed environment trovano-serum agar (nutrient agar for cultivation of microorganisms, pH 7.4 and 7.6 (GMF - agar) - 100 ml + red blood cells from donated human blood 3 ml + serum of cattle 5 ml + yeast extract 3 ml), the nutrient medium according to the recipe Katosova L.K. (100 ml base, prepared from dry nutrient agar according to the recipe shown on the label, pH 7,2±0,2 + 10 ml of inactivated horse serum + 3 ml erythrocyte mass) and 5% blood agar according order No. 535 (100 ml fundamentals - 2% agar, pH 7.4 and 7.6, prepared from dry pittelkow the agar according to the recipe, specified on the label, + 5 ml of blood defibrinating blood).

For the biological control of nutrient media used culture Streptococcus pneumoniae ATCC 49619 and clinical material from patients with inflammatory diseases of the respiratory system and upper respiratory tract (sputum, segregatory and nasopharyngeal swabs, bronchoalveolar lavage, tracheal aspirate, punctate sinuses and the pleural cavity, obtained by tympanocentesis the contents of the middle ear from sick children). All crops were cultivated at 37°C in normal atmosphere within 24-48 hours (up to 48 h, when the sowing of clinical material from the patient on the first day growth of microorganisms were not identified).

To determine the sensitivity of the environments were preparing microbial suspension of the daily culture of Streptococcus pneumoniae ATCC 49619, corresponding to a density of 0.5 standard Mac-Farland (containing approximately 1.5×108CFU/ml), obtained from microbial suspensions were prepared a series of serial dilutions of 1:10. Then on the prepared cups with the appropriate agar were sown 0.1 ml suspension -5, -6, -7 dilution, containing, respectively, 1×103, 1×102, 1×101CFU/ml With good nutritional properties of the medium should be celebrated the growth of microorganisms of -6, -7 dilutions [7].

The results showed that the proposed composition of the nutrient is Reda has high sensitivity - the selection of a minimum number of Streptococcus pneumoniae ATCC 49619 (up to 10 colonies when seeding from -7 cultivation), and the proposed method for the preparation of a full environment in terms of practical laboratory is a simple and affordable for laboratories of any level.

In addition, in the study of 20 samples of sputum and 496 samples of bronchoalveolar lavage from patients children with chronic infectious and inflammatory diseases (HUSL) in the period from January 2005 to April 2011, S. pneumoniae and M. catarrhalis isolated in 18,8% and 10.6%, respectively, of the claimed nutrient medium that can be used for diagnostic purposes. In 49.1% of cases when HIMSL was isolated Haemophilus influenzae on chocolate agar, growth was observed on the claimed medium for 2 days incubation at 37°C, normal atmosphere in the form of point colonies without hemolysis.

In the study segregating and nasopharyngeal smears from children to declare environment were also highlighted in 1 case, Neisseria meningitidis, and in one case Corynebacterium diphtheriae.

The cost of the proposed environment 680 rubles/liter

Literature

1. Isolation, identification and definition of sensitivity to antibiotics of Streptococcus pneumoniae / Listresponse, Ohikiitavaa, Raskatov, Tambogrande, Aoustic, MSG, Lccation, Louisiaha, Mietauto // Clinical Microbiology and antimicrobial chemotherapy. - 2000.- Vol.2, No. 1. P.88-98.

2. R.S. Kozlov Pneumococci: past, present and future. Smolensk: Smolensk state medical Academy, 2005. - 128 S.

3. Kozlov Y.A. Nutrient medium in medical Microbiology. Instructions for the manufacture of culture media for microbiological institutes and sanitary-bacteriological laboratories. State publishing house of medical literature MEDGIZ, 1950, Moscow. - 252 S.

4. Murray P.R., Shea I.R. Clinical Microbiology. QuickStart: Per. s angl. M.: Mir, 2006. - 425 S.

5. Medical Microbiology. Edited Weaponammo. - 3rd ed. M: GEOTAR-Media, 2005. - 768 S.

6. Guidelines for the control of steam and air sterilizers, appr. The Ministry of health of the USSR from 28.02.91, N 15/6-5.

7. MUK 4.2.1890-04 "Determination of the sensitivity of microorganisms to antibiotics". - M.: Federal center of state sanitary and epidemiological surveillance Ministry of health of Russia, 2004. - 91 S.

8. Pole MS, sucharewicz VI, sucharewicz ME Nutrient medium for medical and sanitary Microbiology. SPb.: ALBI-SPb. - 2008. - 352 S.

9. The order of the USSR Ministry of health No. 535 of April 22, 1985, "On the unification of microbiologic methods used in clinical diagnostic laboratories medical institutions".

10. Pulmonology children: problems and solutions. Edited by Mi is erricolo UL, Tsaregorodtseva A.D. Issue 4. Moscow, 2004. - 257 C.

11. Private medical Microbiology techniques microbiological studies: a training manual. Edited Labinsky A.S., Blinkovoj L.P., Asinou A.S.): JSC "Publishing house "Medicine", 2005. - 600 C.

12. Enterobacteria: a Guide for physicians / Iwholename, Wailea, Bscales and other edited Weaponammo. - M.: Medicine, 1985. - 321 S.

13. Essential procedures for clinical microbiology. Editor in chief, Henry D. Isenberg. Washington, DC 20005, 1998. 841 P.

14. Manual of clinical microbiology. Editor in chief, Patrick R. Murray. 7thed. Washington, DC 20005, 1999. 1773 P.

Nutrient medium for the isolation, cultivation and determination of hemolytic properties of bacteria from clinical material containing GMF-agar, RBC mass from donated human blood, serum bovine and yeast extract with the following proportions of the components, ml:

GMF-agar100
red blood cells from donated human blood3
serum of cattle5
yeast extract3



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and use of a Trichoderma harzianum Rifai strain as a producer of an Impatiens necrotic spot tospovirus inhibitor. The Trichoderma harzianum Rifai strain, which is deposited in the Russian National Collection of Industrial Microorganisms under No.F-180, is a producer of the homogeneous enzyme L-lysine-a-oxidase, which exhibits marked antiviral activity with respect to Impatiens necrotic spot tospovirus.

EFFECT: reduced loss of decorative and vegetable crops caused by Impatiens necrotic spot tospovirus.

2 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: device comprises a through cell equipped with holes, where at least one hole represents an inlet hole for intake of fluid medium from the specified technological flow, and at least one hole is an outlet hole for discharge of fluid medium from the specified through cell. To one of specified holes an RK probe is attached, possibly, an OVP probe, a cleaning accessory. The first pipeline is connected to the inlet hole. Possibly, the second pipeline is connected to the outlet hole. A valve is connected to the specified through cell. With the help of the specified devices and methods they measure volume microbiological activity and surface microbiological activity in a process flow of water by means of measurement of dissolved oxygen concentration.

EFFECT: method improvement.

45 cl, 10 dwg, 2 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: method includes the following stages: contact of a sample with a source of nutrition for cells, containing antioxidant, representing pyroracemic acid or its salt, and an inhibitor of cell proliferation, which is selected from ciprofloxacin and cefalexin; contact of the specified sample with fluorescent-marked oligonucleotide probes, capable of specific hybridisation at least with one section of ribosomal nucleic acids, which belong to microorganisms of Legionella pneumophila kind and type; and detection and quantitative determination of a fluorescent signal.

EFFECT: provided method and set make it possible to more accurately and reliably detect and calculate viable microorganisms of Legionella pneumophila type, having excluded natural fluorescence of microorganisms from calculation.

6 cl, 2 dwg, 6 tbl, 2 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: method under the invention provides detoxification and polymerisation of antibiotics in 0.15±0.05% glutaric aldehyde at 38-40°C for 3-5 days, and then in 0.1% alkyl dimethyl benzyl ammonium chloride at 38-40°C for 3-5 days.

EFFECT: method provides effective bactericidal, virusocidal and fungicidal action of antibiotics and enables extending their therapeutic spectrum of application.

1 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: method under the invention involves detoxification and polymerisation of the tested antibiotics 150-200 mg/ml at first in 0.15±0.05% glutaric aldehyde at 38-40°C for 2-3 days, then in 0.1% aethonium or 0.1% alkyl dimethyl benzyl ammonium or 0.1% Biopague D at 38-40°C for 2-3 days.

EFFECT: use of the method provides 1,5-2,0 times higher activity of the antibiotic as compared to commercial preparations and ensures the bactericidal efficacy to antibiotic-resistant Ecoli.

2 ex

FIELD: biotechnologies.

SUBSTANCE: thermostatting of a biocatalyst is carried out on the basis of immobilised microbial cells and a non-innoculated carrier within the biocatalyst, as well as infrared scanning of the biocatalyst surface and the carrier with the help of a highly sensitive infrared chamber, and production of thermal characteristics of the biocatalyst, such as distribution of temperatures on its surface and difference of temperatures between the surface of the biocatalyst and the non-innoculated carrier. Distribution of temperatures makes it possible to control homogeneity of activity distribution on the biocatalyst surface. The difference of temperatures is used to determine intensity of adsorption and metabolic activity of fixed bacterial cells. A plant for detection of efficiency of adsorption immobilisation of microorganisms and monitoring of functional condition of biocatalysts includes an infrared chamber fixed on a tripod, and connected with a computer, and a heat-insulating box with a hole on top, closed with a cover, which makes it possible to minimise oscillations of ambient temperature down to ±1°C/hr and reduces impact of the infrared chamber at analysis results.

EFFECT: reduced time of analysis performance, higher efficiency and profitability of biological methods of chemical compounds transformation and biological utilisation of hazardous substances.

6 cl, 2 dwg, 3 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: invention refers to medical microbiology and concerns differentiation of toxigenic and non-toxigenic strains of cholera vibrios serogroup 0139. The described method involves preparing a synthetic medium 100 ml by using weights of: sodium chloride 0.5 g, agar 2 g, bromthymol blue 0.002 g; then the weight ingredients are dissolved in 0.01 M tris HCl buffer 100 ml, pH 7.8 and boiled for 30 minutes; the prepared medium is added with a substrate in the form of 1% aqueous sodium dodecyl sulphate (SDS) to the final concentration of 0.1% in the medium; it is followed by loop inoculation of the prepared medium on the analysed culture and incubation for 24-48 hours; the results are considered by the presence of milky-white areas 2-10 mm surrounding the inoculations on the agar sectors; the presence of those makes the strain to be referred to as toxicogenic (ctx+ tcp-), while the absence of those shows that the strain is non-toxicogenic (ctx+ tcp-).

EFFECT: method is simple and visual and may be used for determining the epidemic relevance of the strains of Vibrio Cholerae 0138 serogroup.

3 tbl, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to field of medicine, namely to microbiology and is intended for increasing efficiency of microbiological diagnostics of staphylococcal infections. Method of isolating uncultivable staphylococcus bacteria includes cultivation of studied material on beef-extract agar for 24 hours at temperature 37°C. After that, grown bacterial culture is kept at temperature +4°C for 48 hours.

EFFECT: method makes it possible to increase efficiency of isolation of causative agents of staphylococcal infections, reduce number of false negative results of analyses and ensure carrying out of anti-epidemic actions in foci of staphylococcal infections more fully.

2 ex

FIELD: chemistry.

SUBSTANCE: culture medium for determining drug susceptibility of Mycobacterium tuberculosis to four main drugs - streptomycin, isoniazid, rifampin and ethambutol contains: 4.7 g dry Middlebrook 7H9 broth, 1.25 g microbioligical agar-agar, 1.25 g pancreatic digest of casein, 900 ml distilled water and 100 ml growth additive OADC. The additive contains, g/l: sodium chloride 8.5, bovine albumin (fraction 5) 50.0, glucose 20.0, catalase 0.03 and oleic acid 0.6 ml/l.

EFFECT: invention enables to obtain analysis results faster and ensures easy visual reading of results.

4 tbl

FIELD: medicine.

SUBSTANCE: claimed is method of detecting antibodies to Mycobacterium leprae (M.leprae) on solid carrier. Places of application of components of immunologic reaction in ELISA on solid carrier (fluoroplastic tape) are sensitised with antigen from ultrasound disintegrate (sonicate) of M.leprae in dose 5 mcg/ml in volume 20 mcl for each sample of patients' blood serum. After that immunoperoxidase conjugate against human IgG is applied in the same volume on the places of previous location of reaction components. Unbound antigen from sensitised tape is removed with buffer solution (BPST) after each stage of reaction. Reaction results are estimated visually by difference in substrate mixture colouring.

EFFECT: simplification of method of detection of antibodies to Mleprae due to application in ELISA of solid carrier-fluoroplastic tape.

2 ex

FIELD: medicine.

SUBSTANCE: in in vitro conditions, imitating digestion process in humans quantities of live microorganisms at the beginning and at the end of experiment are determined and their numeric values are compared. Conclusion is made on the basis of the results of comparison after incubation of probiotic microorganisms during 4 h in acidic model medium with acidin-pepsin by inoculation of microorganism suspension on dense nutritional medium. Grown colonies are counted and number of viable microorganisms is determined. Remaining suspension is separated from incubation medium, alkaline model medium with pansinorm forte 20000 is added to sediment in volume, analogous to volume of acidic model medium. Sediment is resuspended and suspension is incubatred during 12 hours, remaining number of viable microorganisms is determined by inoculation on a dense nutritional medium and counting grown colonies.

EFFECT: increased efficiency and accuracy of method and possible therapeutic-preventive efficiency of medication, administered to patient with intestinal disbacteriosis.

5 cl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: new strain of bacteria Pasteurella trehalosi is proposed, where the specified bacteria are positive in respect to beta-haemolysis, positive in respect to oxidase, positive in respect to catalase, negative in respect to urease, positive in respect to nitrates, negative in respect to indole, MacConkey-positive, positive in respect to glucose, positive in respect to saccharose, positive in respect to mannitol, negative in respect to arabinose, negative in respect to cellobiose, positive in respect to xylose, negative in respect to salicin, negative in respect to ornithine, negative in respect to esculin, negative in respect to alpha-fucosidase, positive in respect to beta-galactosidase. Also the strain of bacteria Mannheimia haemolytica is proposed. These bacteria are deposited under registration numbers ATCC No. PTA-3667, ATCC No. PTA-3668, ATCC No. PTA-3669.

EFFECT: immunisation of chickens with the purpose to prevent disease caused by above bacteria.

7 cl, 22 dwg, 2 tbl, 6 ex

Up!