Producer of impatiens necrotic spot virus inhibitor

FIELD: chemistry.

SUBSTANCE: invention relates to biochemistry and use of a Trichoderma harzianum Rifai strain as a producer of an Impatiens necrotic spot tospovirus inhibitor. The Trichoderma harzianum Rifai strain, which is deposited in the Russian National Collection of Industrial Microorganisms under No.F-180, is a producer of the homogeneous enzyme L-lysine-a-oxidase, which exhibits marked antiviral activity with respect to Impatiens necrotic spot tospovirus.

EFFECT: reduced loss of decorative and vegetable crops caused by Impatiens necrotic spot tospovirus.

2 ex

 

The invention relates to biochemistry and may find application in agricultural biotechnology, Microbiology and plant breeding.

In recent years the Russian Federation of the European countries annually imported hundreds of thousands of ornamental plants, which may be the owners of tospovirus necrotic spots balsam (Impatiens necrotic spot tospovirus). Due to the fact that this virus has an extremely wide range of host plants on most ornamental and vegetable crops, creates a potential risk of infection of host plants by the virus. Virus necrotic spots balsam brings significant losses to the production of ornamental crops in many European countries.

Impatiens necrotic spot tospovirus inflicted great harm various kinds of ornamental and vegetable crops grown in greenhouses in Mexico, the United States and in southern Canada and Europe. Yield losses reached 100% (4, 5).

The prior art known inhibitor of herpes simple 1-th type (1) and inhibitor of human immunodeficiency virus (2), as an inhibitor which was used metabolite strain Trichoderma harzianum Rifai - homogeneous enzyme L-lysine α-oxidase.

Also the prior art, the possibility of using gene that inhibits the virus spot of balsam by its introduction is a plant of the family of Balzaminov obtaining transgenic plants, resistant to this virus (US 6528703 B1, 04.03.2003) prototype. However, this technique is time consuming and requires large financial and time costs.

The technical result of the invention is to reduce losses of ornamental and vegetable crops, caused by a virus and Impatiens necrotic spot tospovirus.

The technical result is achieved by the fact that a strain of Trichoderma harzianum Rifai is a producer inhibitor tospovirus necrotic spots balsam. The strain is deposited in Russian national collection of industrial microorganisms under the number F-180 (Moscow, Road 1-y passage, 1, Institute of genetics and breeding, 1987).

Morphological and biochemical characteristics of strain

Strain Trichoderma harzianum Rifai on the environment wort agar forms a colony growing. Mycelium hyaline, septate, open. On the 4th - 5th day of growth appear Mat with conidiophores, cushion-shaped, at first white, yellow or dark green. Fieldy butylate /9-12µ/, verticils of 3 or more. Each felide conidia are formed, glued to the head. Conidia of the fungus rounded, smooth, small /3-5µ/, in transmitted light, pale green, and in the mass of the dark.

On agar medium of čapek colonies producer strain growing, but poorly paronomasia. The strain grows well in the environment of čapek, but the OST is on the environment wort agar. Agar and gelatine not thins, milk is not peptonized. Aerobic fungus. The temperature optimum of +28 to +29°C. On potato-dextrose agar, the decrease of the growth rate, the formation of aerial mycelium and sporulation. Optimum conditions for growth of the fungus at pH 4-6, however, can grow and at a pH from 1.5 to 9.

Trichoderma harziatum Rifai equally internalizes as ammonium and nitrate salts. The best source of nitrogen from organic compounds is peptone. Grows well in a medium with asparagine and glutamic acid. The best sources of carbon are xylose, glucose, sucrose, lactose, galactose, mannitol, starch. In environments with these sugars occur rapidly. Poorly digested alcohols methyl, ethyl, dulcet. Well assimilated as a carbon source, wheat bran. The inoculum of the fungus grown on medium containing wheat bran, gives a positive result when used for fermentation in media of different composition.

Strain Trichoderma harzianum Rifai has L-lysine α-oxidase activity. The activity of L-lysine α-oxidase in culture liquid of Trichoderma harzianum Rifai was calculated as the increase in N2About2, which amount was determined spectrophotometrically orthodeuterium micromethods. The essence of the method lies in the interaction of all clicks is soumaya in the reaction H 2O2with O-vanishedamericana.com. The incubation mixture contained 20 μg peroxidase, 250 μg O-danishdigimida and 0.1-0.5 mg of protein in 1 ml final volume. After 20 minutes incubation in a thermostat at a temperature of +37°C. the samples were cooled to +4°C. the Optical density of the colored solutions of the test and control (without substrate) of the samples were measured on the spectrophotometer SF-16 at 540 nm against the second control sample (without peroxidase).

To construct a calibration curve by both molarity of freshly prepared solution H2O2was determined by permanentally. Substrates served as L-and DL-forms of amino acids ("Reanal, Hungary). Used 0.05 M phosphate buffer. As a catalyst peroxidase-catalyzed reactions used the peroxidase firm "Reanal", and as a donor of protons - O-danishdairyboard (Merck, Germany). Per unit of activity took the amount of enzyme catalyzing the formation of 1 µmol N2About2for 1 min at a temperature of +37°C.

The specific activity of enzyme was expressed by the number of units of activity per 1 mg of protein or 1 ml of culture fluid. Protein was determined by the method of Lowry. As the standard used 0.05%solution of crystalline bovine albumin ("Reanal, Hungary).

To assess the purity of the drug used electrophoresis in 10% of Pagu the presence of sodium dodecyl sulfate, as well as capillary electrophoresis on the installation Drops 105 production company LUMAX (St. Petersburg).

The cultivation conditions of a strain of Trichoderma harzianum Rifai

Fermentation of the strain was carried out on the equipment Experienced process plant IBPM RAS. Gscreen (Pushchino).

Used the fermenter type BIOR-01 produced by BLS Bureau, the city of Kirishi, volume 100 l with a fill factor of 0.6. The fermenter equipped with a magnetic stirrer, filters air, temperature and pH.

Nutrient medium was prepared directly in the apparatus. For this purpose, the apparatus was filled with 60 l of tap water, contributed 1% wheat bran, stimulant - 0,1%, 1.3% of ammonium sulfate, the pH value of 5.8 to 6.0 has established a 10%HCl solution. Wheat bran and stimulant pre-soaked in 10 l of water for 4 h, were sterilized in an autoclave for 1 h at a temperature of +125°C. Then prepared the fermenter was seeded with seed material from the flasks. Sowing dose of at least 5%. Cultivation was carried out at a temperature of +26°C, air flow throughout the fermentation of 30 l / minute, the mixer rotation speed of 200 rpm. The pH value in the process of growth was adjusted to 6.5. Duration of cultivation was 94-98 h, the final pH from 5.3 to 7.5.

At the end of the fermentation culture liquid is to be sent to the site pre-treatment, where the fungal mycelium was separated by filtration under vacuum on the suction filter. The weight of the obtained biomass was 3.5 kg Received native solution was subjected to additional separation in the separator of the type RSD at 9000 rpm for one hour at a temperature of +2 to +4°C. Then the native solution in a volume of 55 l, obtained after separation of the biomass was concentrated to 1.5 l (concentrate).

Ribonucleic acid (RNA) tospovirus necrotic spots balsam was isolated from ornamental potted plants Streptocarpus (lat. Streptocarpus) of the family Gesneriaceae. Produced freezing at -20°C plant samples (leaves decorative culture Streptocarpus). Then the samples were ground in a porcelain mortar until a homogeneous state with the addition of lytic buffer from the set of "Sample NC" firm LLC Agravante". From pre-prepared samples were isolated RNA using sets of "Standard NC" firm LLC Agravante" Protocol from a set.

For the production of reverse transcription (FROM) in a test tube was added the following mixture for FROM: FROM-buffer AMV company Promega (250 mM Tris-HCl, 250 mM KCl, 50 mM MgCl2, 2.5 mM spermidine, 50 mM DTT) - 5 µ1, the mixture dNTP company CJSC Dealt LTD (da, dt, DG, DC - 200 µm each), and 2.5 μl, Rnasin - ed. (1 µ1), revertase AMV company Promega (10 U/μl) - 3 μl water to a total volume of 20 μl of Incobrasa - 5 μl. The reverse transcription reaction (the formation of double-stranded DNA by matrix-stranded RNA) occurred when the temperature was 42°C for 1 h, at a temperature of +95°C - 5 minutes

At the stage of reverse transcription to isolated and purified RNA virus necrotic spot of vinegar was added to the concentrate of the culture fluid in different dilutions (from 5 to 0.025 U/ml). Next to amplification reaction was prepared with the following mixture: 10x MagMIX - 2025 closed joint stock company "Dialout-LTD - 2,5 μl of the sample, the primers INSV direct (S1) and reverse (S2) 2 μl (10 ρmol/μl) to the sample, cDNA and 5 μl of water to 25 µ1, mineral oil. As a result, the complimentary deoxyribonucleic acid (cDNA). To obtain the reaction products (amplicons) were heated mixture as follows: one cycle at a temperature of 94°C for 15 minutes, 30 cycles at a temperature of 94°C for 1 minute, at a temperature of +48S for 1 minute and at a temperature of 72°C for 1 min; one cycle at a temperature of 72°C for 10 minutes. Storage was carried out at a temperature of +4°C. amplicons (repeatedly increased the number of copies of the study area cDNA) was made in a 1.5% agarose gel, after which he received electrophoregram and evaluate the results (6).

Example 1

After carrying out reverse transcription to samples selected the cDNA was added to the enzyme at concentrations of 2.5 U/ml and 5 U/ml Was also taken control sample cDNA, which was not added enzyme. On electrophoregram the presence of dark bands in the sample testified to the preservation of a virus, no stripes meant his destruction. At a concentration of 2.5 U/ml or more cDNA of the virus is destroyed, with no formation of the dark stripes.

Example 2

After carrying out reverse transcription to samples selected cDNA was added to the enzyme at different concentrations (1, 0,1, 0,05, of 0.025 U/ml). Was also taken control cDNA sample without added enzyme. On electrophoregram the presence of dark bands in the sample testified to the preservation of a virus, no stripes meant his destruction. At a concentration of more than 1 U/ml cDNA of the virus was destroyed, this was not observed the formation of the dark stripes. At a higher dilution of the enzyme viral cDNA is saved and there is a dark band.

Literature

1. Inhibitor of herpes simple 1-St type. RF patent №2022012, 1994. Alekseev SB, birch CT, Andjaparidze OG and other

2. Inhibitor of human immunodeficiency virus. RF patent №2022011, 1994. S.B. Alekseev, Weight B.C., Smirnov I.P., etc.

3. Smirnov I.P., S.B. Alekseev biosynthesis of the antitumor enzyme L-lysine α-oxidase Trichoderma sp. // Antibiotics and chemotherapy. - 2009 - T. - B.5-6. - C8-11.

4. OERR/ERRO (2004). Diagnostic protocol for regulated pests. PM 7/34(1). Tomato spotted wilt tospovirus, Impatiens necrotic spot tospovirus and Watermellon silver mottle tospovirus. Bulletin OERR/ERO Bulletin 34, 271-279.

5. Windham A.S., F. Hale, J. Yanes Impatiens necrotic spot virus: a serious pathogen of floral crops (1998). Agricultural Extension Service the University of Tennessee. SP370A.

6. Mumford R.A., Barker I., Wood K.R. (1996b) An improved method for the detection of Tospoviruses using the polymerase chain reaction. Journal of Virological Methods 57, 109-115.

The application of strain Trichoderma harzianum Rifai deposited in ACIM # F-180 - as a producer inhibitor of virus necrotic spots balsam.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: anti-viral preparation represents water extract from strain of namatophagous fungus Duddingtonia flagrans F-882, obtained by extraction of fungus biomass with ratio biomass:water 1:5, with further removal of insoluble deposit. Preparation possesses high activity against human immunodeficiency virus of the first type, viruses of human and avian influenza of type A and pox vaccine virus. Index of neutralisation of human influenza A virus in culture of MDCK cells constitutes 3.5 lg, of avian influenza A - 2.5-3.0 lg. Virus-neutralising preparation action with respect to pox vaccine virus no Vero cells constitutes 25-50% of cells. If preparation in concentration 25 mcg/ml is introduced into MT-4 cells simultaneously with virus adsorption inhibition of HIV-1reproduction, or in concentration 12.5 mcg/ml after adsorption in cells constitutes 100%.

EFFECT: increase of activity.

2 cl, 6 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: inhibitor of influenza A virus reproduction represents water extract of basidial Laetiporus sulphureus, obtained by extraction of crushed fungus biomass with water at ratio 1:1 or 1:2 with further removal of insoluble deposit from extract. Claimed inhibitor demonstrates high inhibiting effect with respect to influenza A virus. Index of virus neutralisation in culture of MDCK cells constitutes 2.5-7 lg. Titres of influenza A virus in homogenates of light infected mice constitute (4.67±0.6)-(6.0±0.57) lgEID50/ml±I95.

EFFECT: high inhibitor activity.

3 cl, 6 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: inhibitor of influenza A virus reproduction represents water extract of basidial fungus Phallus impudicus, obtained by extraction of crushed fungus with water at ratio 1:5 with further removal of insoluble deposit from extract.

EFFECT: inhibitor possesses high activity against human and avian influenza of A type.

3 cl, 1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Trichoderma harzianum Rifai, having L-lysine-alpha-oxidase activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number RNCIM F-180 and may be used in agricultural biotechnology and plant growing.

EFFECT: invention makes it possible to reduce losses of decorative and vegetable crops.

2 ex

FIELD: chemistry.

SUBSTANCE: selenium-containing complex is an autolysate of fungal strain Cephaliophora tropica D3, obtained by growing fungus in a liquid culture medium with subsequent autolysis of the obtained biomass for 12 hours at temperature of 53-55°C and for 5-6 hours at temperature of 63-65°C. The culture medium contains the following trace elements in form of water-soluble salts: selenium 0.003-0.04 g/l, iodine 0.001-0.035 g/l, cobalt 0.001-0.017 g/l, copper 0.001-0.02 g/l, zinc 0.01-0.07 g/l, manganese 0.02-0.42 g/l, magnesium 0.02-0.8 g/l, iron 0.1-0.95 g/l, boron 0.0005-0.108 g/l, calcium 0.4-3.5 g/l.

EFFECT: obtained complex is capable of optimising metabolism of selenium and iodine in the body and can be used as a biologically active additive.

7 ex

FIELD: chemistry.

SUBSTANCE: method involves culturing a strain of Laetiporus sulphureus BKM-F-4276D on a cabbage medium which contains glucose in amount of 2%, milk whey in amount of 1%, with addition of sodium selenite in concentration of 15-25 mg/l.

EFFECT: invention increases content of selenium in the mycellium of the strain.

8 dwg, 4 tbl, 6 ex

FIELD: medicine.

SUBSTANCE: method of obtaining proteinase-activator of protein C in blood plasma includes cultivation of strains of Aspergillus ochraceus VKM F-4104D or Aspergillus ochraceus VKM F-4105D or Aspergillus ochraceus VKM F-4106D or Aspergillus ochraceus VKM F-4107D on nutritional medium at initial value pH 6.5. Nutritional medium contains (%): glucose 3.2-3.8, starch 0.1-1.0, fish flour hydrolysate 0.5-1.0, peptone 0.1-0.5, NaCl 0.1-0.2, KH2PO4 0.04-0.06, MgSO4-7H2O 0.04-0.06, water to 100%. Anticoagulant activity of solution of proteins of culture liquid of strains on elongation of activated partial thromboplastin time (CPTT) constitutes 1020-1032%. Activity of protein C activator in culture liquid of strains constitutes 79.8-89.9 units/ml.

EFFECT: increased activator activity.

2 tbl, 8 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. Spores of filamentous fungi Cunninghamella are grown on wort agar at temperature 27-28°C for 5-6 days. Trehalose in amount of 0.2% is added to the wort agar layer. The spores are washed and held for 20-30 minutes in sterile tap water while slightly shaking. The washed off spores are fermented as inoculum for 90-96 hours at temperature 29±0.5°C on a culture medium containing glucose, ammonium nitrate, magnesium sulphate heptahydrate, potassium dihydrophosphate, a yeast extract and 0.1-0.2% D-glucosamine or 0.11-0.15% N-acetyl-B-glucosamine. The obtained biomass is separated and lyophilised. Lipids are extracted by shaking the lyophilised biomass with a mixture of chloroform and ethyl alcohol in ratio 2:1 on a shaker.

EFFECT: method increases output of lipids.

8 ex

FIELD: chemistry.

SUBSTANCE: powder of coarsely ground lichen fronds undergoes solid-phase mechanochemical treatment in a bead mill at 1500 rpm for 3 minutes with addition of 0.5 wt % sodium bicarbonate.

EFFECT: invention improves quality, antibacterial action of the preparation and simplifies the process of producing said preparation.

3 tbl, 5 dwg

FIELD: medicine.

SUBSTANCE: what is offered is the Trichoderma harzianum rifai M 99/51 strain deposited in the Russian National Collection of Industrial Microorganisms, No. F-1027. The strain is characterised by synthesis of active anticancer non-peptide compounds having no amide bonds. Besides, the strain is marked by producing the anticancer compounds. The strain has high cytotoxic activity with respect to the anticancer cell lines (human HaCaT-keratinocytes; THP-1 macrophage-like human cell line; A431 - human epidermoid carcinoma line; JurKat - human T-cells; K562 - chronic myeloid leukemia cell line; HEK293T - human embryonic kidney cells) and may be used for producing anticancer preparations.

EFFECT: using this strain as a producer for making the based anticancer preparations.

8 dwg, 6 ex

FIELD: biotechnologies.

SUBSTANCE: strain Trichoderma harzianum Rifai, having L-lysine-alpha-oxidase activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number RNCIM F-180 and may be used in agricultural biotechnology and plant growing.

EFFECT: invention makes it possible to reduce losses of decorative and vegetable crops.

2 ex

Up!