Method of preparing stabiliser, vulcanisation accelerator or microorganism-modified natural rubber

FIELD: chemistry.

SUBSTANCE: neutral carbon source used is glucose, which is converted to aniline under the action of Escherichia coli or Streptomyces griseus bacteria. The glucose is obtained from plants. The stabiliser, vulcanisation accelerator or modified natural rubber is prepared from aniline obtained as described above.

EFFECT: invention improves environmental friendliness of methods of preparing a stabiliser, vulcanisation accelerator and modified natural rubber, which saves oil resources.

6 cl, 3 dwg, 5 ex

 

The present invention relates to a method for preparing a stabilizer (antioxidant), of a vulcanization accelerator or modified by a microorganism of natural rubber. In particular, the present invention relates to a method for preparing a stabilizer, of a vulcanization accelerator or a modified natural rubber using aniline or aniline derivative, produced by the microorganism.

Currently, the stabilizers used for the manufacture of rubber, titlovi the vulcanization accelerators and sulfenamide the vulcanization accelerators are synthesized from aniline as the raw materials for which use petroleum products. Given the increase in oil prices and the depletion of its reserves, there is a need for a method of preparation not requiring the use of petroleum products. In addition, methods of preparation stabilizers and vulcanization accelerators are the cause of global warming since the industrial production of aniline from petroleum resources allocated significant amounts of heat and carbon dioxide. Thus, the idea of utilization of natural resources is the basis of the known method, in which the vulcanization accelerator synthesize, using as material obtained naturally long am is h, which are prepared by reductive amination of saturated or unsaturated fatty acids obtained by hydrolysis of natural fat and oil (JP-A-2005-139239).

However, cooking methods vulcanization accelerators used Acrylonitrile, mercaptobenzothiazole and dibenzothiazepine. Currently, no guidance is given about how to obtain these materials from natural resources.

In addition, there is a method of cooking in which the modified natural rubber is prepared graft-polymerization or by adding to the raw material containing natural rubber compounds containing polar group, under the action of mechanical shear stress (JP-A-2006-152171). However, this method does not require the use of material obtained in a natural way, as a compound containing a polar group.

The aim of the present invention is the provision of environmentally acceptable methods of preparation of the stabilizer, of a vulcanization accelerator and a modified natural rubber, which will prevent the depletion of oil resources in the future.

The present invention relates to

method of preparation stabilizer

including the conversion of glucose into aniline or an aniline derivative by the action of microorganism.

In addition, the present from retina applies to

the method of preparation of a vulcanization accelerator,

including the conversion of glucose into aniline or an aniline derivative by the action of microorganism.

And, in addition, the present invention relates to

method for preparing a modified natural rubber, including

the transformation of glucose into aniline or an aniline derivative by the action of microorganism and

modification of natural rubber specified aniline or aniline derivative.

Below is a detailed description of the present invention.

In accordance with the present invention as a neutral carbon source used glucose, which is converted into aniline or an aniline derivative by the action of microorganism. Stabilizer, a vulcanization accelerator or a modified natural rubber is prepared from the thus obtained aniline or aniline derivative.

Glucose used in accordance with the present invention, are derived from plants, which absorb carbon dioxide from the atmosphere. Examples of such plants may include wood waste, straw, paddy, weeds and inedible parts of food crops (stem, root and xylem). Glucose can be obtained by adding acid to the specified materials and their subsequent hydrolysis or treatment of hot water is od pressure.

Then nitrate, obtained by extraction of the plant with hot water, add to glucose, and the resulting mixture is converted into aniline or an aniline derivative by the action of microorganism.

Examples of microorganisms used in accordance with the present invention may include Escherichia lli W (ATCC9637) and actinobacteria, such as Streptomyces griseus (ATCC23345 and ADS).

The transformation of glucose in aniline can be carried out in water or in a solvent which is a mixture of water and an organic solvent. Examples of organic solvents may include methanol, ethanol, dimethyl sulfoxide, diethyl ether, tetrahydrofuran and acetone.

The temperature of treatment is preferably from 20°C. to 42°C. At temperatures below 20°C the activity of the microorganism is reduced. At temperatures above 42°C, the organism usually dies. Thus, in both cases, the reduced output. More preferably, the lower limit temperature is 25°C and the upper temperature limit is 30°C.

Preferably, during the reaction the pH is from 4 to 9. If the pH values are outside the specified range, the yield of aniline is rapidly falling.

Time of cultivation is from 3 to 6 days, preferably from 4 to 5 days.

Examples of the aniline derivatives may include compounds having a benzene ring of aniline substituents, for example hydroxyl or carboxyl group. Preferred aniline derivatives include 3-carboxy-6-hydroxyanisol.

Examples of the stabilizer may include: as p-phenylendiamine stabilizer - N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine, and as quinoline stabilizer is a polymer of 2,2,4-trimethyl-1,2-dihydroquinoline.

For example, N-(1,3-dimethylbutyl)-N'-phenyl-p-phenylenediamine can be obtained from aniline by using the following method of synthesis. According to this method, methyl isobutyl ketone, which as intermediate is added to the amine can be synthesized using the dry distillation of calcium acetate or by aldol condensation of acetone, which is obtained acetone-butanolide fermentation (fermentation). Such methods allow to prepare the target compound without the use of oil resources.

The polymer of 2,2,4-trimethyl-1,2-dihydroquinoline can be prepared from aniline and acetone with continuous feeding of the latter on the reaction time at 140°C in the presence of an acid catalyst. The method allows to prepare the specified connection without the involvement of petroleum resources.

Examples of vulcanization accelerators include: as tatalovich vulcanization accelerators - 2-mercaptobenzothiazoles and dibenzothiazepine, and ka is este sulfenamide vulcanization accelerators - N-cyclohexyl-2-benzothiazolesulfenamide, N,N-DICYCLOHEXYL-2-benzothiazolesulfenamide and M-tert-butyl-2-benzothiazolesulfenamide.

2-Mercaptobenzothiazoles can be obtained from aniline by the following method of synthesis. According to this method, the carbon disulfide can be obtained and selected, for example, by the reaction of mustard oil content in leaf mustard is 0.4%, with hydrogen sulfide. This method allows you to cook accelerator of vulcanization without the use of oil resources. Dibenzothiazepine synthesized by oxidation of the thus prepared 2-mercaptobenzothiazoles.

As natural rubber can be used as a regular natural rubber and deproteinizing natural rubber. Modified natural rubber can be obtained by graft-polymerization of aniline and natural rubber held under the action of electron beam irradiation, mechanical shear stress, etc.

Stabilizers, accelerators, vulcanization or modified natural rubber obtained by the method according to the present invention, can be used as materials for the manufacture of conventional products made of rubber, and, in particular, as the rubber compositions used for the manufacture of tires.

The rubber composition can be prepared by mixing inorganic fillers, such as clay, aluminum hydroxide and calcium carbonate, and compendiously additives usually used in rubber industry, such as process oils, softeners, stabilizers, necessary vulcanizing vulcanizing additives and additives, as well as rubber components, silicon dioxide, Milanovich binders, carbon black, and vulcanization accelerators.

A rubber composition prepared by kneading a rubber component and required compendiously additives using a kneading machine, for example using a mixer Bunbury (closed rubber mixer or open roll (open roll), including, if necessary, various additives extruded material thus obtained devulcanizing rubber composition in the form of corresponding parts tires; forming devulcanizing tires at the tire-molding machine, and hot pressing devulcanizing tires in the vulcanizer.

In accordance with the present invention a stabilizer, a vulcanization accelerator or a modified natural rubber prepared from the aniline or aniline derivative obtained by using a microorganism. The method is environmentally acceptable and helps prevent East the distribution of oil resources in the future.

The present invention is illustrated below with specific examples of implementation. However, these examples in no way limit the scope protected by the present invention.

EXAMPLES

Example of preparation of aniline using microorganism

As the source material used is glucose, the concentration of which was maintained equal to 5%. Culture medium TSB (trypticase-soy broth) was thermally treated at 120°C for 20 minutes and cooled to room temperature. Streptomyces griseus (ATCC23345 and ATSS) were cultured at 28°C, 170 rpm for 4-5 days under aerobic conditions in a culture medium. Then culture medium was added diethyl ether and the extraction was performed twice. The crude extract was concentrated by an evaporator, and purified flash chromatography on a column filled with silica gel 60. Aniline identified by NMR and IR spectroscopy.

An example of the preparation of the stabilizer of aniline

In a flask equipped with a device for the introduction of the acetone by distillation device, a thermometer and a stirrer, were placed 190 g (1.5 mol) of aniline, obtained by chemical transformation produced by the action of the microorganism used as the acid catalyst, hydrochloric acid (0.20 mol)and then heated to 140°is. The reaction system was kept at 140°C. for 6 hours to the system was continuously added 580 g (10 mol) of acetone. Warded off unreacted acetone and aniline periodically returned to the reaction system. The result has been 180,7 g (yield: about 30%) of the polymer of 2,2,4-trimethyl-1,2-dihydroquinoline. The degree of polymerization of the obtained polymer ranged from 2 to 4. Unreacted aniline and the monomer 2,2,4-trimethyl-1,2-dihydroquinoline was removed by distillation under reduced pressure. Unreacted aniline was distilled at 140°C., and the monomer was distilled after raising the temperature to 190°C. the Yield of monomer was 19.1 g (6.9 per cent).

Additional example 1

(Example of preparation of aniline using Streptomyces griseus)

Culture medium TSB (trypticase-soy broth)containing a carbon source derived from soy, and a nitrogen source, heat-treated at 121°C for 20 minutes and cooled to room temperature. Under sterile conditions to the cooled medium was added glucose to obtain a final concentration of 5%. Then, on Wednesday seeded Streptomyces griseus (ATCC11984 or ATSS) and cultured under aerobic conditions at 30°C and 170 rpm for 7 days. For aniline extraction from the obtained culture specified culture was transferred into a separation funnel and was extracted with diethyl ether. This operation is the extraction of the implementation of the Yali twice with obtaining the crude aniline extract. The crude extract was concentrated by evaporation of the diethyl ether in the evaporator and then the residue was applied for the purification of aniline flash chromatography using a column filled with silica gel 60. The obtained aniline identified using UV spectroscopy (see attached UV range).

Additional example 2

(Example of preparation of aniline using Escherichia coli)

Culture medium LB (Luria-Bertani)containing a carbon source derived from soy and yeast, and a nitrogen source, heat-treated at 121°C for 20 minutes and cooled to room temperature. Under sterile conditions to the cooled medium was added glucose to obtain a final concentration of 5%. Then, the medium was seeded with Escherichia coli (ATCC25922 or ATSS) and cultured in aerobic conditions at 37°C and 170 rpm for 2 days. For aniline extraction from the obtained culture specified culture was transferred into a separation funnel and was extracted with diethyl ether. This extraction was performed twice with obtaining the crude aniline extract. The crude extract was concentrated by evaporation of the diethyl ether in the evaporator and then the residue was applied for the purification of aniline flash chromatography using a column filled with silica gel 60. The obtained aniline identified using UV spectroscopy (is m the applied UV range).

Additional example 3

(Preparation method of carbon disulfide from sources other than oil)

The carbon disulfide was obtained by the reaction of approximately 0.4% mustard oil, which is contained in the leaf mustard, with hydrogen sulfide or by heating charcoal and sulfur at 900°C.

(Preparation method of a vulcanization accelerator of aniline)

93 g (1.0 mol) of aniline, obtained in the previous example, 80 g (1.1 mol) of carbon disulfide obtained in the above manner, and 16 g (1.0 mol) of sulfur were loaded into the reactor under pressure, 500 ml, reaction was carried out at 250°C and 10 MPa for two hours and then was cooled to 180°C to obtain 2-mercaptobenzothiazoles. The output was 100.1 g (67%).

Additional example 4

(Example of preparation of a graft-copolymer of natural rubber and aniline)

In a 4-neck flask, equipped with a mixing rod, addition funnel, tube for introducing nitrogen, and a condenser was loaded with 300 g of natural rubber latex and then added 250 ml of distilled water, 1.0 g poliakrilovom ether, 5.0 g of aniline obtained in the above example, to 91.6 g of methyl methacrylate with a small stirring in nitrogen atmosphere. Then the mixture was intensively mixed for sufficient mixing of each component. Then add recipients who do 1.5 g of potassium persulfate and reaction was performed at 60°C for five hours to obtain a graft-copolymer.

1. The method of preparation of a stabilizer (antioxidant), including the conversion of glucose aniline under the action of Escherichia coli or Streptomyces griseus and preparation of the stabilizer from the specified aniline.

2. The method of preparation of the stabilizer according to claim 1, in which the stabilizer is a p-phenylendiamine stabilizer or quinoline stabilizer.

3. The method of preparation of a vulcanization accelerator, including the conversion of glucose aniline under the action of Escherichia coli or Streptomyces griseus and preparation of a vulcanization accelerator from the specified aniline.

4. The method of preparation of a vulcanization accelerator according to claim 3, in which the vulcanization accelerator is titlovi accelerator of vulcanization or sulfenamide accelerator of vulcanization.

5. The method of preparation of the modified natural rubber, including
the transformation of glucose in aniline under the action of Escherichia coli or Streptomyces griseus and
modification of natural rubber specified aniline.

6. The method of preparation of the modified natural rubber according to claim 5, in which the modified natural rubber is obtained graft-polymerization of the specified aniline and natural rubber.



 

Same patents:

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0416 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5'-TGGCGGAGTATGGATGCTG-3' - BmVAT6-Ch2s 5'-GAACGAGAACACCTACGACCTGAT-3' - BmVAT6-Ch2as.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0416 of the equinia agent.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: chemistry.

SUBSTANCE: disclosed is Enterobacteriaceae bacteria family - producer of L-aspartic acid, which is modified such that said bacteria contain aspartate dehydrogenase. Disclosed is a method of producing L-aspartic acid, involving growing said bacteria in a culture medium and separating L-aspartic acid from the culture fluid.

EFFECT: invention enables to obtain L-aspartic acid in a large amount.

21 cl, 28 dwg, 22 tbl, 10 ex

Up!