Method for probiotic correction of postintoxification psychosis in patients suffering alcohol dependence syndrome

FIELD: medicine.

SUBSTANCE: invention refers to medicine and pharmacology, and represents a method for probiotic correction of postintoxification psychosis in the patients suffering alcohol dependence syndrome, consisting in restoring the hepatic function ensured by increasing the detoxification and metabolic functions with the use of biologically active additives containing the probiotic culture of bifidus bacteria 10 CFU/g 3 times a day and lactobacilli 108 CFU/g 3 times a day for 5 days.

EFFECT: provided reduced activity of the AST enzymes, activated pigment, protein and synthetic hepatic function, restored normal flora of the colon.

2 ex

 

This invention can be used in medicine (drug and alcohol abuse, therapy) to improve the effectiveness of treatment of patients with acute alcoholic psychosis on the background of the syndrome zavisimosti from alcohol (be).

The main etiological factors leading to the development of liver disease, are chronic alcohol intoxication (Podymova S.D., 2005; Abdurakhmanov DT, 2007; M. S. 2008; Ivashkin V.T., 2009; breverb S.A., 2011).

Liver disease manifested by abnormalities of biochemical homeostasis with the change in the activity of the blood serum enzyme (aspartate aminotransferase (ACT), mainly in patients with cap, alanine aminotransferase (ALT), mainly in patients with viral hepatitis, gammaglutamyltransferase (GGT), alkaline phosphatase (apase)), elevated levels of total and direct bilirubin, changes in protein synthetic function of the liver (Mayevskaya M.V., 2005; Lobzin J.V., 2006; Radchenko V.G., 2010), as well as violations of the microflora of the large intestine, manifested by a decrease in the content of bifidobacteria and lactobacilli, increasing the number of conditionally pathogenic microorganisms (Brick I.A., 2001; Sozinov A.S., 2002; Zakirov IA, 2004; Chukhrov M.G., 2007; assumption Y.P., 2008; Fedosin E.A., 2009).

Most patients with chronic hepatitis have been violations of the wall digestion, lack of synthesis of vitamins of group In the formation of toxic substances, increased permeability of the gut wall for pathogenic microorganisms, micro - and macromolecules, disorders of the immune system. All this leads to vzaimootnosheniam lesions of the intestine and liver (Seliverstov PV, 2010).

Among the drugs used to optimize intestinal microbiocenosis, allocate probiotics, prebiotics, synbiotics (Baranovski, A., 2008; Tkachenko, H., 2010).

Therapeutic effect of probiotics is to restore the damaged protective mucosal barrier of the intestine, with non-immune and immune protection components. Immune effects mediated normalization of the microecology of the intestine and decrease its permeability. Immune mechanism of action is associated with amplification of Ig And response, attenuation of the inflammatory process. Probiotics have immunomodulatory effects by controlling the expression of anti-inflammatory cytokines (Shenderov B.A., 2005; A.V. Gorelov, 2008; Mayevskaya M.V., 2009; Avdeev A.G., 2010; Ploskirev A.A., 2010; Mayev I.V., 2011).

At present poorly understood are the frequency of occurrence and severity of intestinal dysbiosis in patients with chronic liver diseases, the role of changes in the normal intestinal mechanisms in the development of liver pathology, dynamics and orientation of the specified edit the deposits on the background of probiotic correction.

The aim of the invention is the rationale for the use of probiotic preparations in patients with syndrome of alcohol dependence in a state of acute alcoholic psychosis.

We recommend the use of dietary supplements containing bifidobacteria in the dose of 106CFU/g 3 times a day and Lactobacillus in the dose of 108CFU/g 3 times a day for 5 days with the re-capture of faeces in 2 days after completion of the course (in accordance with industry standard 91500.11004-2003 "records of the patients. The dysbacteriosis". The Ministry of health of the Russian Federation No. 231 from 9.06.2003).

The results showed that, at the time of exit from a psychotic state in patients with be, have not received biocorrection, remained high enzymatic activity of blood serum, violations of pigment metabolism, protein synthetic function of the liver and dysbiotic changes of the colon. In patients given probiotics had more rapid decline in the enzyme activity (ACT), activation of the pigment of liver function (decrease of total and direct bilirubin) and protein synthetic function of the liver (increased levels of albumin) and restore the normal flora of the colon (the increase in the number of bifidobacteria and lactobacilli, content and frequency of occurrence of enterococci, the decrease in the content of the E. coli with hemolytic properties.

The results of the study confirmed the following clinical examples.

Clinical example 1. Patient P., 42 years. Diagnosis: syndrome of alcohol dependence, acute psychotic state alcoholic Genesis, acute hallucinosis. The data of biochemical and microbiological studies on the background of standard detoxification therapy: 1 day: ACT with 97.1 U/l, ALT - 45,2 U/l, GGT - 145,3 U/l, alkaline phosphatase - 105,2 U/l, total bilirubin - 18.4 µmol/l, direct bilirubin - 5.6 µmol/L. Microbiocenosis of the colon: bifidobacteria - 6,7 lg CFU/g lactobacilli to 3.2 lg CFU/g Enterococcus - 4,2 lg CFU/g, E. coli is 6.4 lg CFU/g, hemolytic Escherichia coli - 7,62 lg CFU/g, the frequency of detection of hemolytic E. coli - 24%, E. coli with lamotrigine properties is 20%, the prevalence of Staphylococcus aureus - 6%.

Clinical example 1. Patient I., 41. Diagnosis: syndrome of alcohol dependence, acute psychotic state alcoholic Genesis, acute hallucinosis. The data of biochemical and microbiological studies on the background of standard detoxification therapy and biocircle probiotic algal drugs "Eligibil and Angilak". 1 day: ACT - 88,1 U/l, ALT and 49.2 U/l, GGT - 146,3 U/l, alkaline phosphatase - U/l, total bilirubin of 17.2 µmol/l, direct bilirubin - 5.1 mmol/L. Microbiocenosis of the colon: bifidobacteria - 6,1 lg CFU/g lactobacilli and 3.4 lg CFU/g, enterococ the s - 4,2 lg CFU/r, E.coli and 7.6 lg CFU/g, the frequency of detection of hemolytic forms of E. coli - 21%, E.coli with lamotrigine properties - 19%, the frequency of occurrence of Staphylococcus aureus - 8%. day 7: ACT - 61,8 U/l, ALT - 43,4 U/l, GGT - 118,3 U/l, alkaline phosphatase - 107,1 U/l, total bilirubin - 10.2 mmol/l, direct bilirubin - 3.1 µmol/L. Microbiocenosis of the colon: bifidobacteria - 7,9 lg CFU/g lactobacilli of 4.1 lg CFU/g Enterococcus - 5,2 lg CFU/g, E. coli - 7,3 lg CFU/g, the frequency of detection of hemolytic forms of E.coli - 5%, E.coli with lamotrigine properties -12%, the frequency of occurrence Staphylococcus aureus - 5%.

Sources list

1. Abdurakhmanov DT Alcoholic liver disease / Getalgorithmname // ROS. Journe. gastroenterology, Hepatology and Coloproctology. - 2007. No. 6. - P.4-10.

2. Avdeev A.G. Place of probiotics and prebiotics in the treatment of diseases of the gastrointestinal tract / Agideas // Farmateka. - 2010. No. 5. - P.45-48.

3. Baranovsky, A. Dysbacteriosis / A. Baranowski, Oaanoaeanu. - M.: Peter, 2008. - 240 S.

4. Breverb S.A. Alcoholic liver disease: is it possible to improve forecast / Aooueoau, Aealo, Wtihin // Wedge, the prospects of gastroenterology, Hepatology. - 2011. No. 2. - P.3-10.

5. The relationship between the liver and the intestine against the imbalance of the microflora of the colon / Pvelite [and other] // Gastroenterology. Saint-Petersburg. - 2010. No. 2-3. - P.15-18.

6. Burned is in AV The role of microflora in the gastrointestinal tract and the principles of correction of violations of its composition / Avilov, Davyenko// Rus. the honey. Journe. - 2008. - No. 18. - S-1177.

7. Intestinal dysbiosis. Guidelines for the diagnosis and treatment / edited by: Eyidence, Antufiev. - SPb.: Informed, 2009. - 278 S.

8. Zakirov I.G. dysbacteriosis of the intestine in chronic viral hepatitis / Ightarrow. - Kazan: New Knowledge, 2003. - 86 C.

9. Ivashkin V.T. Local immunity and microbiocenosis in diseases of the bowel / Wtihin, Nleya // ROS. Journe. gastroenterology, Hepatology and Coloproctology. - 2009. No. 6. - C.11-16.

10. Brick I.A. Biological syndromes" alcoholabusing postintoksikatinom States / Iagine, Agibalova // human Ecology. - 2001. No. 4. - P.37-40.

11. Intestinal microflora and associated diseases of the gastrointestinal tract in patients with chronic viral hepatitis b and C / Assasino [and other] // Ukr. Microbiology, Virology and epidemiology. - 2002. No. 1. - P.61-64.

12. Mayevskaya M.V. Possible use of probiotics in gastroenterology / Mavka // ROS. Journe. gastroenterology, Hepatology and Coloproctology. - 2009. No. 6. - P.65-72.

13. Acute alcoholic hepatitis: forecast and approaches to therapy / Snehdeep [and other] // ROS. Journe. gastroenterology, Hepatology and Coloproctology. - 2008. No. 6. - S.43-50. Npositive A.A. the Role of probiotic is of IKI and probiotic products in the treatment and prevention of infectious diseases / AOV // Infect. disease. - 2010. No. 3. - P.58-63.

15. Podymova S.D. liver Disease / Sedepadova. - M.: Medicine, 2005. - 767 S.

16. Probiotics and prebiotics in clinical practice / Ivew [and other] // Farmateka. - 2011. No. 5. - S. 33-41.

17. Radchenko VG intestinal Dysbiosis and chronic liver disease / Vgiagra, Pvelite, Laetitia // S-Denmark. braces. Vedomosti. - 2010. No. 2. - P.61-65.

18. The assumption P. the Influence of alcohol on the intestinal microbiocenosis in patients with chronic gastroduodenitis / Upolinski, Masiakos, Navarinou // Man, alcohol, Smoking and food addiction: Proc. of II interdisciplinary. Grew up with. fo. - SPb., 2008. - S.

19. Fedosin E.A. Bacterial microflora of the intestine and liver disease / Iagidina, Msearch, Mavka // ROS. Journe. gastroenterology, Hepatology and Coloproctology. - 2009. No. 6. - S-81.

20. Cukrowa MG Microbiocenosis of intestines and its role in alcoholism / Mchuchuma, Ngermeduu, Yevtifeev // People and alcohol - 2007: collection of materials of the first interdisciplinary. scient. fo. - SPb., 2007. - S.

21. Shenderov B.A. Medical Microbiology: some results and prospects of research / Bassendean // Vestnik St.Petersburg University. The RAMS. - 2005. No. 12. - S-24.

How probiotic correction postintoksikatinom psychosis in patients with syndrome of alcohol dependence, consisting of vostanovleniemxorowii liver by increasing detoxification and metabolic functions with the use of dietary SUPPLEMENTS, containing probiotic culture bifidus bacteria in a dose of 106CFU/g 3 times a day and Lactobacillus in the dose of 108CFU/g 3 times a day for 5 days.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to medicine. What is presented is a compound for preparing an oral rinse for treating radio-induced xerostomia in the following proportions of the ingredients in water 200 ml: ethyl cellulose 0.5 - 0.9 g, calcium hydrophosphate 0.1 - 0.3 g, potassium hydrophosphate as a buffer system 0.4 - 0.6 g, succinic acid 0.10 - 0.14 g.

EFFECT: invention provides the improved clinical effectiveness in radio-induced xerostomia ensured by the recovered physical-chemical properties of saliva and normalised processes of solid tissue mineralisation.

2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely oncology and anaesthesia, and may be used for anaesthetic care for surgical management of oncological patients with accompanied cardiovascular insufficiency. Before the operation, blood 200-250 ml is sampled from a median cubital vein into a blood transfusion container with the anticoagulant Glugicirum 49 ml. Then, the container is added with the complex preparation cytoflavin 0.16I0.02 ml/kg of body weight. After cytoflavin is incubated on autoblood at t -37C for 30 minutes, it is administered intravenously drop-by-drop immediately before the beginning of the anaesthetic care.

EFFECT: method provides improved quality of the anaesthetic care in such patients due to provided adequate correction of haemodynamics and related metabolic homeostatic disorders, prevented developing oxidative stress at all the operative stages, as well as ensured non-specific extra stimulation of the immune system.

1 tbl, 1 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to pharmaceutical industry, namely to a method for providing cold and influenza virus resistance. The method for providing cold and influenza virus resistance involves the stage whereat a composition containing cholecalciferol and tea extract taken in certain proportions is introduced into an individual. The method for providing cold and influenza virus resistance involves: the stage whereat a composition containing cholecalciferol, tea extract and a probiotic taken in certain proportions is introduced into an individual. The method for providing cold and influenza virus resistance involves: the stage whereat a composition containing cholecalciferol, vitamin D2 and tea extract taken in certain proportions is introduced into an individual.

EFFECT: methods effectively improves cold and influenza virus body resistance, and ensures favourable effects of fit of energy, stress relief and mood improvement in the individual.

20 cl, 37 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, and aims at anaesthetic care of post-burn oesophageal bougienage. Before a bougienage procedure, a solution 25-30 ml containing sterile glycerol and 2% lidocaine hydrochloride in the following proportions: sterile glycerol - 100 ml, 2% lidocaine hydrochloride - 10-15 ml is intaken. Besides, reinforced pharyngeal reflex requires cerucal 2 ml to be intramuscularly injected 20-30 min before the bougienage procedure.

EFFECT: method enables pain relief during the post-burn bougienage procedure and prevented mucosal injures.

2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely to surgery and pulmonology, and may be used to improve the clinical course of the postoperative period in the patients with ventral hernias. A cough limit is determined one week before the operation. That is ensured by nebuliser inhalations of citric acid solutions in increasing concentrations into patient's airways by 5-second slow inhalation after maximum exhalations for three times every 10 seconds. The inhalation is continued till observing five and more coughs running or if achieving the highest concentration of the solution. The sensitivity threshold of the cough receptors is considered to be the maximum concentration of the citric acid solution causing 5 and more coughs, in case the solution inhalation with the further concentration also causes coughing. If the cough limit makes 2.5 g/l and lower, high sensitivity of the cough receptors is stated. That required the postoperative administration of the preparation indicated for the antitussive therapy, e.g. Stoptussin 1 tablet 3 times a day, at least 5 days before the operation and for 7 days after. If the cough limit makes 2.6 to 10 g/l, moderate sensitivity of the cough receptors is concluded. In this case, Soptussin is administered in a dose of 1 tablet 2 times a day 3 days before the surgical management and for 5 days thereafter. If the cough limit makes 10 g/l and more, lower sensitivity of the cough receptors in the person being tested is stated, and no antitussive preparations prescribed.

EFFECT: method provides higher therapeutic quality in ventral hernias ensured by prevented development of postoperative coughing.

2 ex

FIELD: chemistry.

SUBSTANCE: invention relates to immunology. Disclosed is an immunostimulating oligonucleotide 5' TCGTCGTTTTTCGGTGCTTTT 3'. Described are versions of using the oligonucleotide to obtain an immunostimulating oligonucleotide with the same immunostimulating activity with at least one lipophilic substituted nucleotide analogue or as an adjuvant in a vaccine for inducing antigen-specific immune response.

EFFECT: use of the invention provides an immunostimulating oligonucleotide which causes, in a population of CD4+ T-cells, production of a large amount of T-cells which secrete IFN-gamma and more polyfunctional T-cells than ODN 5' TCGTCGTTTTTCGGTCGTTTT 3', which can be utilised in medicine.

25 cl, 21 dwg, 3 tbl, 4 ex

Scfv-binding sparc // 2477728

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology. There are presented versions of anti-SPARC ScFv, as well as a composition for treating a condition associated with high expression of SPARC with KD making at least 7.8×10-5 M containing said antibody in the effective amount bound to a therapeutic agent, as well as a method of treating a mammal based on the use of said composition. What is described in a composition for diagnosing the condition associated with high expression of SPARC on the basis of the anti-SPARC ScFy antibody bound to the diagnostic agent.

EFFECT: use of the invention can find application in medicine for treating the diseases associated with high expression of SPARC.

9 cl, 19 dwg, 1 tbl, 5 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biopharmaceutical industry, namely a biopreparation of actoprotective, adaptogenic action. A method for preparing the biologically active additive possessing actoprotective and adaptogenic action characterised by the fact that a dry mixture of ground blastemas (Cladoma) and snowdone rose roots and rhizomes (Rhodiola rosea, fam. Crassulaceae) are mechanically and chemically one-stage activated with no solvents added into a drum of a vibrocentrifugal mill in the certain environment. The biologically active additive possessing actoprotective and adaptogenic action, prepared by the method described above.

EFFECT: biologically active additive possesses improved physiological actoprotective and adaptogenic action; it eliminates lactic acid from the body.

2 cl, 6 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to medicine and pharmacological industry, concerns creating a pharmaceutical composition (PC) developed on the basis of active substances recovered from plants. The pharmaceutical composition presented both in the liquid (aqueous-alcoholic), and dry form, may be used in clinical practice for preventing and treating oncological patients, age-related pathologies. The PC may be used in medicine, including pharmacology.

EFFECT: presented pharmaceutical composition on the basis on the active substances recovered from plant extracts, including ethanolic extract; it is easy-to-prepare, easy-to-use, easy-to-keep and has low price.

2 cl, 3 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: group of inventions refers to veterinary science and biotechnology and aims at immune correction and detoxification. A method involves hydromechanical preparation of a porous carbon material and drying of the product. Betulin is dissolved in ethanol at mass ratio of betulin: ethanol 0.01-0.06:1 or in an ethanol-glycerol solution at mass ratio of betulin: glycerol: ethanol 0.03:0.14:1. Then it is dispersed in a porous structure of a carbon carrier by betulin impregnation in ethanol or ethanol-glycerol solution in mass ratio of betulin: carbon carrier 0.4-1 at room temperature and mixing. That is followed by ethanol and drying. The ready preparation contains, wt %: betulin 0.5-1.8, glycerol 0-5, carbon carrier - the rest, and is characterised by granula size 0.5-0.8 mm and specific absorption surface 170-250 m2/g.

EFFECT: use of the declared group of inventions enables producing a preparation possessing higher adsorption properties and immune correction action.

1 dwg, 1 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely gynaecology, and may be used for treating chronic inflammatory genital diseases in females. That is ensured by the use of Promed balm which is introduced into vagina once a day, as well as taken orally 3 times a day. Promed balm may be introduced into vagina taking into account biological rhythms from 19 to 21 o'clock, and taking into account biological rhythms 9 to 11 o'clock, from 13 to 15 o'clock and from 19 to 21 o'clock. The method provides the improved clinical effectiveness ensured by providing the local and systemic anti-inflammatory effect due to the delayed growth of pathogens and toxin purification of the female body as a result of a diuretic and choleretic effect, immunomodulatory action, as well as due to activation of biological centres and their rhythm functioning, and regulation of metabolism and genital glands. In addition, it has a regenerating effect on skin and mucous membranes and recovers the nervous system.

EFFECT: achieved diet fortification and prevented recurrence of the disease.

3 cl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely gynaecology, and may be used for treating chronic inflammatory genital diseases in females. That is ensured by the use of Promed balm which is introduced into vagina once a day, as well as taken orally 3 times a day. Promed balm may be introduced into vagina taking into account biological rhythms from 19 to 21 o'clock, and taking into account biological rhythms 9 to 11 o'clock, from 13 to 15 o'clock and from 19 to 21 o'clock. The method provides the improved clinical effectiveness ensured by providing the local and systemic anti-inflammatory effect due to the delayed growth of pathogens and toxin purification of the female body as a result of a diuretic and choleretic effect, immunomodulatory action, as well as due to activation of biological centres and their rhythm functioning, and regulation of metabolism and genital glands. In addition, it has a regenerating effect on skin and mucous membranes and recovers the nervous system.

EFFECT: achieved diet fortification and prevented recurrence of the disease.

3 cl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely gynaecology, and may be used for treating chronic inflammatory genital diseases in females. That is ensured by the use of Promed balm which is introduced into vagina once a day, as well as taken orally 3 times a day. Promed balm may be introduced into vagina taking into account biological rhythms from 19 to 21 o'clock, and taking into account biological rhythms 9 to 11 o'clock, from 13 to 15 o'clock and from 19 to 21 o'clock. The method provides the improved clinical effectiveness ensured by providing the local and systemic anti-inflammatory effect due to the delayed growth of pathogens and toxin purification of the female body as a result of a diuretic and choleretic effect, immunomodulatory action, as well as due to activation of biological centres and their rhythm functioning, and regulation of metabolism and genital glands. In addition, it has a regenerating effect on skin and mucous membranes and recovers the nervous system.

EFFECT: achieved diet fortification and prevented recurrence of the disease.

3 cl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine, namely gynaecology, and may be used for treating chronic inflammatory genital diseases in females. That is ensured by the use of Promed balm which is introduced into vagina once a day, as well as taken orally 3 times a day. Promed balm may be introduced into vagina taking into account biological rhythms from 19 to 21 o'clock, and taking into account biological rhythms 9 to 11 o'clock, from 13 to 15 o'clock and from 19 to 21 o'clock. The method provides the improved clinical effectiveness ensured by providing the local and systemic anti-inflammatory effect due to the delayed growth of pathogens and toxin purification of the female body as a result of a diuretic and choleretic effect, immunomodulatory action, as well as due to activation of biological centres and their rhythm functioning, and regulation of metabolism and genital glands. In addition, it has a regenerating effect on skin and mucous membranes and recovers the nervous system.

EFFECT: achieved diet fortification and prevented recurrence of the disease.

3 cl, 2 ex

FIELD: nanotechnology.

SUBSTANCE: invention relates to the use of nanoparticles for prevention and/or treatment of cancerous diseases, when the nanoparticles are injected with anti-cancer therapeutic agent, and the nanoparticles and anti-cancer agent are simultaneously present in the patient's body. The nanoparticles are free from binding with the anti-cancer medicinal product and have a coating which contains polycondensated aminosilanes.

EFFECT: simultaneous presence of nanoparticles and the anti-cancer therapeutic agent in the body of patients enables to increase the activity of the said anti-cancer agent with simultaneous reduction of the side effects.

12 cl, 1 tbl, 13 dwg, 196 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to pharmaceutical industry, namely to a method for providing cold and influenza virus resistance. The method for providing cold and influenza virus resistance involves the stage whereat a composition containing cholecalciferol and tea extract taken in certain proportions is introduced into an individual. The method for providing cold and influenza virus resistance involves: the stage whereat a composition containing cholecalciferol, tea extract and a probiotic taken in certain proportions is introduced into an individual. The method for providing cold and influenza virus resistance involves: the stage whereat a composition containing cholecalciferol, vitamin D2 and tea extract taken in certain proportions is introduced into an individual.

EFFECT: methods effectively improves cold and influenza virus body resistance, and ensures favourable effects of fit of energy, stress relief and mood improvement in the individual.

20 cl, 37 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to medicine, particularly to pharmacology in cardiology, particularly to a herbal tea for treating adolescents with labile arterial hypertension. The herbal tea for treating the adolescents suffering stable arterial hypertension containing dried grinded herbal raw material: quinquelobate motherwort herb, origanum herb, Baikal skullcap roots, thin-leaved milkwort roots taken in certain proportions.

EFFECT: herbal tea is effective in treating the adolescents with labile arterial hypertension.

2 cl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to medicine, particularly to pharmacology in cardiology, particularly to a herbal tea for treating adolescents with labile arterial hypertension. The herbal tea for treating the adolescents suffering stable arterial hypertension containing dried grinded herbal raw material: quinquelobate motherwort herb, origanum herb, Baikal skullcap roots, thin-leaved milkwort roots taken in certain proportions.

EFFECT: herbal tea is effective in treating the adolescents with labile arterial hypertension.

2 cl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to medicine, particularly to pharmacology in cardiology, particularly to a herbal tea for treating adolescents with labile arterial hypertension. The herbal tea for treating the adolescents suffering stable arterial hypertension containing dried grinded herbal raw material: quinquelobate motherwort herb, origanum herb, Baikal skullcap roots, thin-leaved milkwort roots taken in certain proportions.

EFFECT: herbal tea is effective in treating the adolescents with labile arterial hypertension.

2 cl

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention relates to medicine, particularly to pharmacology in cardiology, particularly to a herbal tea for treating adolescents with labile arterial hypertension. The herbal tea for treating the adolescents suffering stable arterial hypertension containing dried grinded herbal raw material: quinquelobate motherwort herb, origanum herb, Baikal skullcap roots, thin-leaved milkwort roots taken in certain proportions.

EFFECT: herbal tea is effective in treating the adolescents with labile arterial hypertension.

2 cl

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

Up!