Oligonucleotide primers for b.mallei genetic typing by polymerase chain reaction

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology and concerns oligonucleotide primers for B.mallei genetic typing. The presented primers are complementary to a differentiation fragment BMA0577 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and have the following structure: 5' - GAG GAT GAA GGT GCC GTG G - 3' - BmVATl-Chls 5' - GAC AAC TAC TTC ATC GGC TAT CTG - Y - BmVATl-Chlas.

EFFECT: presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA0577 of the equinia agent.

3 dwg, 3 ex

 

The invention relates to biotechnology, molecular biology, molecular epidemiology, and can be used in medicine to detect differential DNA fragment WMA in the scheme genotyping of the causative agent of glanders Burkholderia mallei as for practical health, service, Rospotrebnadzor, and for scientific research.

The causative agent of glanders (Burkholderia mallei) is an aerobic gram-negative non-fermentative bacterium belonging to the genus Burkholderia and related to potential agents of bioterrorism Century group Can particularly dangerous zoonotic infection. The need for research aimed at genotyping of strains .mallei, the persistence of the threat of a disaster or biological situations, due to the occurrence of man-made disasters, natural disasters and potential terrorist attacks with the use of this agent.

Genotyping - a comprehensive analysis unique to each living organism genotype based on the study of its DNA. Method for genotyping on the basis of the analysis variable amplicons (VAT - variable amplicontyping) consists of a series of polymerase chain reactions with primers flanking fragments of a unique DNA targets, existing only in certain strains, which allows for intraspecific differentiation.

The method of the polymer is Noah chain reaction is a direct method of detecting target DNA segments. The method is based on PCR lies the natural process of DNA replication is complementary completing DNA matrix, carried out by the enzyme DNA polymerase.

The process of doubling the nucleic acids can be used for copies of a short DNA segments that specific strains of specific microorganisms, i.e. to carry out a targeted search for such specific areas, which is the purpose of genotyping causative agent of glanders.

For efficient PCR required primers synthetic oligonucleotides of a certain size that are specific to certain strains of the causative agent of glanders. Primers complementary to DNA sequences on the left and right boundaries of the differentiating portion and are oriented so that the finished construction of a new DNA chain flows only between them. In the PCR is a manifold increase in the number of copies (amplification) of a specific gene, catalyzed by the enzyme DNA polymerase. The choice of a specific fragment and selection of primers plays a crucial role in the specificity of carrying out amplification, which affects the quality of the analysis of the studied microorganisms.

The closest analogue is the scheme genotyping using the differential amplification of fragments for wosb the producer of melioidosis, proposed Kwanjit Duangsonk al. in 2006 [Use of a Variable Amplicon Typing Scheme Reveals Considerable Variation in the Accessory Genomes of Isolates of Burkholderia pseudomallei, Kwanjit Duangsonk, Daniel Gal, Mark Mayo, C. Anthony Hart, Bart J. Currie, and Craig Winstanley]. For the agent of glanders these earlier studies were not conducted.

The aim of the present invention to provide oligonucleotide primers to identify differentiating genome fragment WMA .mallei by polymerase chain reaction.

The objective is achieved by designing specific oligonucleotides for the identification of variable DNA fragment strains of the causative agent of glanders, which has active forward and reverse primers in the amplification reaction having the following structure:

5'-GAGGATGAAGGTGCCGTGG-3'-BmVAT1-Ch1s

5'-GACAACTACTTCGGCTATCTG-3'-BmVAT1-Ch1as

Characterization of oligonucleotide primers and plot amplificare DNA.

Based on the data presented in the GenBank NCBI (National Center for Biotechnology Information, USA), primers were selected, marked BmVAT1-Ch1s/BmVAT1-Ch1as, complementary differentiating fragment WMA for intraspecific typing .mallei. The estimated length of the specific fragment is 480 BP

Testing of primers and probe was carried out on a set of strains of the causative agent of glanders collection centre (yrc Volgograd scientific research anti-plague Institute.

Examples of specific the CSOs execution.

Example 1. The method of designing oligonucleotide primers for detection of differentiating fragment WMA the DNA of the causative agent of glanders by PCR method.

On the basis of theoretical study sequenced the nucleotide sequences of the four strains of the causative agent of glanders, present in the databases (EMBL, Genbank, DDBJ), for design of primers was selected variable sequence WMA detected in silico in the first chromosome of strains .mallei NCTC 10229 and .mallei ADS 23344. In the genome of strain .mallei SAVP1 and .mallei NCTC 10247 this fragment was not detected. This leads us to consider the sequence WMA as differentiating fragment suitable for genotyping of the causative agent of glanders. The estimated length of the DNA fragment, flankiruemogo offer primers - 480 BP

When using computer programs, we have analyzed the structure of the selected primer pairs (formation of dimers, hairpins and other secondary structures) and shows their theoretical suitability for the successful initiation of the amplification reaction.

Example 2. Amplification of specific DNA fragments using designed primers for intraspecific differentiation of causative agent of glanders.

In the composition of the reaction mixtures consisted of complementary specific fragment primers, deoxyribo nucleosidase, buffer solution and the enzyme Taq polymerase. To prevent evaporation in the process of amplification on multicyclone "Terzic" on the surface of the mixture was layered 20 ál of mineral oil. For the negative control in a test tube instead of a sample made of the same volume of distilled water. Amplification for a period of 40 cycles were carried out in microcentrifuge tubes (0.5 ml) at multicyclone "Terzic" (JSC "APF of DNA technology", Moscow) in a volume of 25 µl using a "hot start".

The conditions of the reaction: initial denaturation of DNA at 95°C for 5 min, then for 40 cycles denaturation of DNA at 95°C, 10 sec; annealing of primers at 62°C, 10 sec; chain elongation at 72°C for 10 sec, with a final polymerization for 1 minute

Analysis of PCR products was performed by electrophoresis in 3% agarose gel by comparing their mobility with the mobility of the bands of the molecular weight markers (figure 1). The specificity of the band of amplified DNA was confirmed by its position in relation to the control marker fragments (ladder 100 BP DNA Interlabservice LLC, Moscow) and DNA (DNA isolated from .mallei 10230 concentration of 1×105M.K./ml).

Example 3. The use of oligonucleotide primers BmVAT1-Ch1s/BmVAT1-Ch1as in the scheme of differentiation of strains of the causative agent of glanders on the Museum strains collectionnew the center of the living cultures of the Volgograd scientific research anti-plague Institute.

The specificity of the amplification reaction with designed specific primers were evaluated in the study samples of DNA isolated from bacterial suspensions of cells grown on solid nutrient media in 4 ml of 0.15 M NaCl at a concentration corresponding to 1×109M.K./ml standard sample turbidity gisk named after. Laurasia (CCA 42-28-85 P). Disinfection of the material was performed in accordance with MU 1.3.1794-03 and MU 3.5.5.1034-01.

Disinfection of the investigated samples produced by adding a solution of thimerosal sodium to a final concentration of 0.1% and heating for 40 minutes at a temperature of 56°C. the isolation of DNA from pure cultures Burkholderia was performed using the method of nucleosil on silica gel in the presence of guanidinoacetate (R.Boom et al. - 1990). The formulation of the PCR reaction was carried out as described in example 2.

When testing culture collections .mallei Volgograd scientific research anti-plague Institute developed using oligonucleotide primers for the amplification product was synthesized with DNA from the following strains of the causative agent of glanders: .mallei C-5, .mallei Mukkuvar, .mallei V-120, .mallei Zagreb, .mallei Bogor, .mallei 10230, .mallei Budapest. With strains of .mallei C-4, B. mallei 11, .mallei 8, B. mallei P-1, .mallei Ivanovich, .mallei 5584, .mallei Z-12 in a PCR reaction with the primers in 100% of cases a negative result is obtained (pic2).

On the basis of the analysis variable amplicons, we have developed a genotyping scheme of the causative agent of glanders, consisting of 9 reactions of amplification. The combination of positive and negative PCR results forms VAT-patterns that are unique to each strain of the causative agent of glanders (fig.3a).

Thus, using the designed primers BmVAT1-Ch1s/BmVAT1-Ch1as in the scheme of intraspecific differentiation of causative agent of glanders method VAT, managed to split the 18 investigated strains .mallei 15 types (Fig.3).

Oligonucleotide primers for genotyping .mallei by polymerase chain reaction with active forward and reverse primers in the amplification reaction having the following structure:
5'-GAG GAT GAA GGT GCC GTG G-3'-BmVAT1-Ch1s
5'-GAC AAC TAC TTC ATC GGC TAT CTG-3'-BmVAT1-Ch1as,
complementary differentiating fragment of the genome of the causative agent of glanders WMA.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry. Sewage water with increased content of phenol compounds 300 - 1200 mg/l, content of sulfide-ions to 64.1 mg/l and content of sulfate-ions to 401.4 mg/l and 1843.7 mg/l in case of sparging with air, is passed through column type reactor. Reactor contains adsorbent - petroleum coke, onto which cells of strain of aerobic bacteria Pseudomonas putida 131 All-Russian collection of industrial microorganisms B-10894 are immobilised. Orthophosphoric acid or its salts are preliminarily dissolved in sewage water as biogenic additive in order to obtain pH 7-8, optimal for phenol destruction by bacteria strain.

EFFECT: invention ensures increased quality of purification of sewage water, which contain sulfide-ions and sulfate-ions, from phenol compounds to 0-50 mg/l.

1 dwg, 8 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: invention may be used to extract carotenoids, in particular, deinoxanthine, which is used to develop new antioxidant and radioprotector preparations to increase adaptation capabilities of humans and aminals, prevention and treatment of diseases. The method provides for extraction of carotenoids from the bacterial mass Deinococcus radiodurans by the mixture acetone : ethanol (at the 1:1 ratio). Separation of carotenoids with extraction of deinoxanthine on preparative columns of a liquid low-pressure chromatograph, where the sorbent is hydroxyapatite, and the eluent - ethanol.

EFFECT: invention makes it possible to increase quantity and quality of extracted deinoxanthine.

2 dwg, 1 tbl, 4 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, molecular biology, molecular epidemiology. There are presented oligonucleotide primers for B. mallei genetic typing by polymerase chain reaction.

EFFECT: invention may be used in medicine for detecting an equinia agent.

3 dwg, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes the following stages: contact of a sample with a source of nutrition for cells, containing antioxidant, representing pyroracemic acid or its salt, and an inhibitor of cell proliferation, which is selected from ciprofloxacin and cefalexin; contact of the specified sample with fluorescent-marked oligonucleotide probes, capable of specific hybridisation at least with one section of ribosomal nucleic acids, which belong to microorganisms of Legionella pneumophila kind and type; and detection and quantitative determination of a fluorescent signal.

EFFECT: provided method and set make it possible to more accurately and reliably detect and calculate viable microorganisms of Legionella pneumophila type, having excluded natural fluorescence of microorganisms from calculation.

6 cl, 2 dwg, 6 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: invention refers to medicine and describes a method for assessing oral bioflora involving measuring the levels of arginolytic bacteria wherein the levels of arginolytic bacteria are assessed by measuring the levels of ammonium formation in deposit and measuring the levels of cariesogenic bacteria wherein the levels of cariesogenic bacteria are assessed by measuring the levels of lactate formation. What is also described is a method for oral health improvement and a method for oral cosmetic improvement.

EFFECT: invention provides fast and simple methods for assessing oral bioflora.

7 cl, 2 tbl, 3 ex, 4 dwg

FIELD: biotechnology.

SUBSTANCE: invention discloses a method of identification of the elements which have the ability to terminate the transcripts. To identify the termination sequences a reporter system is used intended for transient transfection in the culture of cells and containing bicistronic matrix. The matrix has the following structure: located under the common promoter one after another open frames of reading the marker proteins of cistron 1 and cistron 2, after the last cistron the known transcription terminator is incorporated; between the cistrons the stop codons are incorporated and a site for internal initiation of translation (IRES); the element tested on the ability to terminate the transcripts is incorporated between the stop codons of the cistron 1 and the site for internal initiation of translation, the gene of resistance to antibiotic, which is located in the body of the plasmid, for selection of cells containing this plasmid.

EFFECT: method can be used for rapid screening of elements for the ability to break off the transcripts and construct the transgenic constructions containing effectively functioning regulatory elements, when creation of the expression vectors in biotechnology, agriculture, medicine.

2 dwg, 3 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to produce removable water-insoluble ion-exchange coatings on standard steel MALDI targets, and also on steel, glass, ceramic or plastic inserts into a MALDI target, compatible with performance of the further MALDI analysis. The surface of the MALDI target is coated with a water-organic solution of an ionogenic polymer and nitrocellulose and then dried, at the same time after usage such coatings are removed with water-alcohol solutions. Also the method is proposed to increase sensitivity of MALDI MS analysis of oligonucleotides using the produced coating. Water solutions containing oligonucleotides are applied into prepared surfaces. After several seconds the supernatant is removed, and the surface is washed with water or a dissolved water ammonia buffer. On the same points they apply the MALDI matrix, into solution of which the previously immobilised oligonucleotides transfer. After drying of the MALDI matrix the analysis is performed from the same substrate. The method makes it possible to produce DNA-binding surfaces, with an easily removed disposable water-insoluble surface film.

EFFECT: using such coating makes it possible to simplify the stage of removal of admixtures that interfere with MALDI MS analysis and to increase its speed and sensitivity.

2 cl, 4 dwg, 5 ex

FIELD: medicine.

SUBSTANCE: there are presented specific oligonucleotide primers for identifying a variable DNA fragment of the equinia agent strains possessing activity in an amplification reaction having the following structure: 5' - CCG TTG TCC TTC GTG TTC AT - 3' - BmVAT5-Ch2s 5' - AGC ACA CAT TCG CCG TCC T - 3' - BmVAT5-Ch2as. The invention may be used in medicine for detection of the differentiation DNA fragment BMAA0107 comprised of a genotyping diagram of the equinia agent Burkholderia mallei both for practical healthcare, Federal Service on Surveillance for Consumer rights protection and human well-being, and for research investigations.

EFFECT: higher primer activity.

3 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: primers are complementary to a differentiation fragment BMA10247-A0137 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and has the following structure: 5'-GCTGCTTCGCCCACTTCG-3'-BmVAT8-Ch2s 5'-AGCATCGGATTTCATCGTCGTC-3-BmVAT8-Ch2as. The presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA10247-A0137 of the equinia agent.

EFFECT: higher primer activity.

3 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: primers are complementary to a differentiation fragment BMA2089 of an equinia agent genome, possess activity of upstream and downstream primers in an amplification reaction and has the following structure: 5'-CACCCTGTTTAGGACGGAG-3' - BmVAT3-Ch1s 5'-GATTGCGTGAACACGAAG-3' - BmVAT3-Ch1as. The presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA2089 of the equinia agent.

EFFECT: higher primer activity.

3 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: primers are complementary to a differentiation fragment BMA10247-A1008 of an equinia agent genome possess activity of upstream and downstream primers in an amplification reaction and has the following structure: 5'-CGAACCCACACGAGCCTA-3' - BmVAT9-Ch2s 5'-GCGAAGATTCCGAAGATGC-3' - BmVAT9-Ch2as. The presented invention may be used in practical healthcare for detection of the differentiation DNA fragment BMA 10247_A1008 of the equinia agent.

EFFECT: higher primer activity.

3 dwg, 3 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: invention refers to biotechnology, molecular biology, molecular epidemiology. There are presented oligonucleotide primers for B. mallei genetic typing by polymerase chain reaction.

EFFECT: invention may be used in medicine for detecting an equinia agent.

3 dwg, 3 ex

Up!