Symbiontic strain of corynebacteriae diphtheriae tox - no108, used to produce immunomodulator giving rise to non-specific resistance to infectious bacterial and viral diseases in farm animals

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology. The symbiontic strain of Corynebacterium diphtheriae tox " No.108 is isolated from a bacteria carrier - a tonsillitis patient at IKB No.1 Moscow. The strain is harmless, non-reactogenic, does not possess allergic properties, antigens of which increase resistance of the microorganism to infectious diseases. The strain of Corynebacterium diphtheriae tox" No.108 is deposited in the National Collection of Normal Microflora of the G.N. Gabrichevsky Moscow Research Institute of Epidemiology and Microbiology under registration number 381.

EFFECT: invention enables to create non-specific resistance of farm animals to infectious bacterial and viral diseases.

4 tbl, 5 ex

 

The invention relates to biotechnology, in particular to the symbiotic strain of Corynebacterium diphtheriae, which can be used as a biomaterial to obtain drug - immunomodulator intended for the prevention and treatment of infectious diseases of farm animals.

Bacterial preparations - probiotics are used in veterinary medicine for the treatment and prevention of many infectious diseases. It is widely known application of bifidobacteria, lactobacilli, E. coli, enterococci and other representatives of normal microflora of humans and animals for the preparation of probiotics, dietary supplements for the prevention and treatment mainly intestinal infection and dysbiosis of the gastrointestinal tract (GIT) [1, 2, 3, 4]. Known immunomodulators from strains of Corynebacterium Corynebacterium Krestovnikova - Troitskaya risk No. 225 and risk No. 226, which are not widely used in practice [5, 6]. Preparations from strains coryneform bacteria enhance the immunological potency of the body. Vaccines from karinakarina bacteria increase the resistance of the body against various forms of malignancy: leukemia, stomach cancer, breast cancer and ovarian cancer. These strains are not reactogenna and have low allergenicity. One of the hypothetical mechanisms of action of these vaccines is the activation of CL is the exact immunity specifically normal To the cell, thanks to the activity of which is the elimination of suppressor cells. An experimental study of the vaccine in laboratory animals and treatment of cancer patients - volunteers the vaccines of this type coryneform bacteria [7]. The essence of this method is to separate the cultivation of two strains coryneform bacteria on solid modified nutrient medium, in flushing grown crops sodium chloride, communicating by breeding the same solution (Na Cl) crops up to a certain concentration and the Union of the two suspensions in equal volume. Then the combined suspension was warming on a water bath to 80°C for one hour, after which the sterile solution was poured into the vials, which were then sealed. Obtained in this way, the drug serves as an immunomodulator for immune cancer patients.

However, the method of obtaining non-specific inactivated liquid immunostimulant from coryneform bacteria (Corynebacterium Krestovnikova - Troitskaya) represents the biomass of whole cells of the two strains coryneform bacteria isolated from the blood of cancer patients. This kind of Corynebacterium refers to karinanonim the corynebacteria, which are not symbiotic, and therefore, the preparations of which are probiotic. Proposed is appropriate strains have small, but allergic swistami, their immunogenet tested on laboratory animals and patients volunteers (patients with oncological diseases), which was vacciniavirus his other autosummary.

A known strain of bacteria Rodococcus equi, VIEW N 2, used as an immunostimulant in the manufacture of bacterial vaccines. The strain with the introduction of bacterial vaccine against salmonellosis sheep reduces the reactogenicity of Salmonella and stimulates the body's production of antibodies against the pathogen. The strain was tested with a positive result in the manufacture protivoallergennoy vaccines [8].

It is also known to use pseudobacteremia sticks Corinebacterium parvum to obtain acetylated extracts having an immunostimulating action and increases resistance to infections of viral origin. This kind of Corynebacterium refers to karinanonim the corynebacteria, which are not symbiotic, and the preparation of them is a probiotic [9].

The present invention is the identification of symbiotic strain of Corynebacterium diphtheriae tox-No. 108 with the aim of obtaining a safe drug, immunomodulator, whose use in the prevention and treatment of infectious diseases increases nonspecific resistance of young animals (calves and piglets) and EOI is in libraries animals farm animals, and never have harmful side effects.

The technical result from the implementation of the invention is to provide nonspecific resistance of farm animals against infectious diseases of bacterial and viral nature, which allows to reduce the incidence of food animals to reduce the use of other drugs, including reactogenic vaccines and antibiotics, leading to sensitization of the organism, secondary immunodeficiencies, violations of the microecology of the gut (dysbiosis) and to increase the density of the circulation of highly pathogenic antibiotic-resistant strains of microorganisms. In addition, the introduction of immunomodulator in the body of animals contributes to the production of ecologically safe meat product and offers a safe scheme of the manufacturing process.

The strain Corynebacterium diphtheriae tox-(nontoxigenic) No. 108 selected from bacteriocytes - sick with tonsillitis in IKB No. 1 in Moscow.

The proposed strain of Corynebacterium diphtheriae tox-No. 108 deposited in the Public collections of microorganisms of the normal microflora (HCNM) FBSI "MNIII them. Hingamisega of the CPS No. 381.

The strain Corynebacterium diphtheriae tox-No. 108 has the following morphological and physiological characteristics.

According to the determinant of bacteria Burgi [10] and Guidance 4.2.698-98 98 "Laboratory the diagnosis and nontoxigenic and toxigenic corynebacteria diphtheria" [11] the cells of the strain Corynebacterium diphtheriae tox -No. 108 belong to the mind Corynebacteriim diphtheriae, the toxin is not produced. Cells are on whey agar after 18 hours of growth polymorph wand length from 1 to 5 microns, with a thickness from 0.3 to 0.6 microns.

Beef broth with the addition of bovine serum cells represent after 18 h of growth with aeration uniform stick of length from 0.8 to 3 μm, thickness from 0.3 to 0.6 microns.

On trovano-tellurite dense cells grow in the form of smooth, black-and-gray colonies on the broth in a test tube in the form of small granules precipitated.

When planting prick on Wednesday Pisa is formed by a blackening of the medium, in the course of the injection and around him formed a distinctive "cloud" dark brown at a distance of 1 cm from the surface.

Relation to oxygen. Facultative aerobe. Optimum growth at 37°C.

Relation to carbohydrates. Decomposes glucose, starch, no splits sucrose.

A sample of chitinase - positive, urease - negative.

Serological properties. Not thepirouette agglutinating sera 1-11

serovariants (scheme Suslova).

Strain .diphtheriae tox-No. 108 is stored in a dried state in the vials at +4°C (in the refrigerator). As filler during the drying of the culture is used usual Saharsa-gelatin medium (SG). Multiplies the strain on the open-hearth furnace agar, soda is containing 10% bovine serum, for 18 h at 37°C.

Attitude to the phages. By typing colinearly scheme Medtravel belongs to the group of three pagevar K.

Example No. 1. Obtaining drug - immunomodulator from strain .diphtheriae tox-No. 108.

Strain .diphtheriae tox-No. 108 is grown for 16 h on a dense nutrient medium on the basis of fish hydrolysate with added bovine serum at 37°C. Then the culture of the wash liquid nutrient medium on the basis of the hydrolysate of casein and after 5 h of cultivation make working containers with the same liquid nutrient medium. Spend the cultivation of biomass with constant stirring at 37°C for 16 hours Microbial cells precipitated by centrifugation at 5000 g for 20 min and washed three times with saline by centrifugation mode 5000 g for 20 minutes of Wet sediment was weighed, suspended in buffered physiological solution with a pH of 7.2 to a cell concentration of 5%. Then whole cells disintegrate on ultrasonic setup for 20 min at a frequency of 20 kHz, the amplitude of 14 μm and cooling (ice or water) to 30°C. is Obtained after ultrasonic treatment homogeneous suspension of desintegrate centrifuged at 5000 g for 20 min, with the aim of separating intact cells and their fragments from the cell wall.

the workpieces are removed, the supernatant centrifuged at 14000 g for 20 minutes the Precipitate, representing a preparation of cell walls, resuspended in physiological solution and again centrifuged at 14000 g for 20 minutes Laundering cell walls from impurities cytoplasm and the nutrient medium was repeated 3 times. The washed cell wall resuspending in distilled water, the resulting stock solution was sterilized at a temperature of 100°C, and subjected to freeze-drying. The obtained dry product powder whitish, after dilution in saline solution forms a suspension.

The ability to use strain .diphtheriae tox-No. 108 in the preparation immunomodulator, creating nonspecific resistance of animals against infectious diseases of bacterial and viral nature in farm animals, the following examples.

Example 2. Clinical characteristics of the state of immunoresistance in immunized calves, and the calves born from immunized cows. Antigenic activity and safety of immunomodulator drug, obtained from strain .diphtheriae tox-No. 108 shown in table 1.

Table 1
Group the animals QtyMonitoring of calves (1-4 months)
caseillhealthyaverage daily gain for 3 months (g)
abs /%
Calves at the age of 3-4 months
Healthy calves immunized drug
Healthy calves unimmunized drug (control)
350/01/2,831/97,0745
1709/5,334/20,0127/74,7656
Healthy pregnant cows
Calves born from cows immunized drug
Calves born from cows, unimmunized drug (control)
400/02/5,0 38/95,0736
17023/13,53/1,8144/84,7530

After immunization with a preparation derived from a strain .diphtheriae tox-No. 108, pregnant cows and calves he manifests himself as absolutely harmless (toxiciy, reactogenic, easily portable, with no local reactions). Survival of immunized calves is 100%, while in the control group of non-immunized calves mortality of young animals reaches 5.3 and 13.5%. A similar pattern is observed in the incidence rates, the average gain in vaccinated animals is higher than in animals from the control unimmunized group. The use of the immunomodulator of the symbiotic strain .diphtheriae tox-No. 108 for prophylactic immunization of animals reduces the incidence of infections, mortality, increases average daily weight gain.

Example No. 3. One of the factors indicators of nonspecific resistance of the organism is active it is ravilov, which represent the first line of defense against the introduction of pathogens of various infections. The enhancement of nonspecific activity of neutrophils is presented in table 2.

Table 2
Neutrophil phagocytosisNst - test
spontaneousinduced
To immunization35,6±10,2%0,2±0,10,29±0,1
After immunization60,0±12,0%1,7±0,481,6±0,3

The increase in non-specific anti-infective resistance after immunization of animals with the preparation from strain .diphtheriae tox-No. 108 is reflected in the increased activity of the surface receptors of immune cells in the test neutrophilic yeast phagocytosis and NBT - test). It should be noted that in addition to the direct functions of the phagocytic activity of the neutrophils do in the body a number of other important functions that are directly related to the process of nonspecific protection of the s. Thus, immunomodulator from strain .diphtheriae tox-No. 108 stimulates the increase of the functional importance of neutrophils.

Example No. 4. Indicators of the effectiveness of prophylactic immunization of sows drug, obtained from strain .diphtheriae tox-No. 108, shown in table 3.

Table 3
№ p/pGroupSowsPigs
number of goalsscheme of vaccination *number of newborn pigletsthe number of sows with graftingaverage weight (kg)
newborn2-mon
1Experienced - immunized sows14TTD+14051,2719,2
TTD+
Medication
(4 µg)+
Medication
(4 µg)
2Control non-immunized sows14TTD+14121,2117,7
The PD+
TTD
* PPD - complex vaccine against salmonellosis, pasterelles and Enterococcus infection of pigs associated inactivated.

As can be seen from table No. 3 sows the experimental group was immunotherapies scheme vaccine PPD with the replacement of the last vaccination on immunomodulator, with re-vaccination drug 7 days prior to farrowing. Control group animals had vaccination vaccine PPD in the usual way 3-fold. Observation of newborn piglets was performed within 3 months, the number of newborn piglets in the experimental and control group was equal to 140 and 141 heads respectively. The incidence of sows in the experimental and control groups for the study period (2 months) is not registered. Shows the harmlessness of the drug, lack of post-vaccination reactions, its good tolerability. Good physiological condition of adult animals in the experimental group confirmed additional replanting piglets 5-vaccinated sows, while in the control group similar sows was 2. The average weight of newborn piglets in both groups was the same and amounted to 1.27 kg in the experimental and 1.26 kg in the control. By 2 months of age registered the increase of the weight of the piglets from the experimental group 1.5 kg higher than in the control.

Thus, it is shown harmlessness of the drug immunomodulator derived from strain .diphtheriae tox-No. 108, cancellation single immunization of sows vaccine PPD, improving overall health immunized sows and piglets from them, as evidenced by the increase in their weight gain to 2-months of age compared with piglets in the control group.

Example No. 5. Health indicators piglets up to 2 months of age in experiment (2-fold vaccinated immunomodulator) and in the control (unvaccinated immunomodulator) groups *. The effectiveness of preventive immunization of piglets drug immunomodulator derived from strain .diphtheriae tox-No. 108, shown in table 4.

Table 4
No.
p/p
GroupNumber of heads of newborn piglets (%)Number of goals (%) under 2 months of ageAverage weight (kg) pigletsThe fold increase in weight gain
diedsurvivednew the railway. to 2-months age
1piglets from immunized sows: experimental double the introduction of the drug - immunomodulator77(100)2(3)75(97)1,2721,717
2(400 mg + 400 mg)
control unimmunized
71(100)22(31)49(69)1,2619,215,2
3control piglets, unimmunized from non-immunized sows144(100)19(14)125(8)1,2117,714,6
* double introduction immunomodulator after 14 and 21 days after farrowing at a dose of 400 mcg subcutaneously.

In the experimental group 77 heads of piglets born from immunized sows were vaccinated according to the scheme: vaccine PPD and drug - immunomodulator with intervalo the 7 days. The 1st control group consisted of 71 newborn Piglet from immunized drug sows, without subsequent administration of the immunomodulator. In the 2nd control group comprised 144 newborn piglets from non-immunized sows, which is the same as in the first group, further immunomodulator was not introduced.

Double immunization (after farrowing) piglets significantly (from 11%to 28%) improved by 2 months of age, the survival rate of piglets from the experimental group (97%) compared to non-immunized pigs (control 1-69% and control 2-86%).

Double the introduction of the drug - immunomodulator newborn piglets helps to improve their overall health, which is reflected in a significant average weight gain for 2-months of age compared to the pigs of the control group (by 2.54 kg).

The given examples show that the use of the invention in veterinary medicine will reduce the incidence of food animals to reduce the use of other drugs, including reactogenic vaccines and antibiotics, leading to sensitization of the organism, secondary immunodeficiencies, violations of the microecology of the gut (dysbiosis) and to increase the density of the circulation of highly pathogenic antibiotic-resistant strains of microorganisms.

Thus, immunization CE is isconsistently animals harmless drug immunomodulator, prepared from strain .diphtheriae tox-No. 108, will contribute to the increase in the output of natural organic target product - meat and milk are safe for human consumption and without allergic component in its composition. The use of drug - immunomodulator in prophylaxis reduces the occurrence (especially in autumn and winter outbreaks) infectious epidemics, to exclude side effects of immunization of animals (intoxication, allergic reactions, immune suppression, and so on), which, as a rule, are identified with the use of specific vaccines, etiotropic drugs and antibiotic drugs.

References

1. EN 2314819 C1, 20.01.2008.

2. EN 2233320 C2, 27.04.2003.

3. EN 2284354 C2, 27.09.2006.

4. EN 2067114 C1, 27.09.1996.

5. EN 2027755 C1, 27.01.1995.

6. EN 2027756 C1,27.01.1995.

7. EN 2127119 C1, 10.03.1999.

8. EN 2092551 C1, 12.10.1997.

9. SU 710503, 18.01.1980.

10. Bergey''s Mannual of determinative Bacteriology - 9th, 1994.

11. HOWTO 4.2.698-98 "Laboratory diagnosis nontoxigenic and toxigenic corynebacteria diphtheria".

Symbiotic strain of Corynebacterium diphtheriae tox No. 108 deposited in the Public collections of microorganisms of the normal microflora (HCNM) FBSI "MNIII them. Hingamisega Rospotrebnadzor" No. 381, used for cooking immunomodulator, creating aspecific the massive resistance against infectious diseases of bacterial and viral nature in farm animals.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry. Sewage water with increased content of phenol compounds 300 - 1200 mg/l, content of sulfide-ions to 64.1 mg/l and content of sulfate-ions to 401.4 mg/l and 1843.7 mg/l in case of sparging with air, is passed through column type reactor. Reactor contains adsorbent - petroleum coke, onto which cells of strain of aerobic bacteria Pseudomonas putida 131 All-Russian collection of industrial microorganisms B-10894 are immobilised. Orthophosphoric acid or its salts are preliminarily dissolved in sewage water as biogenic additive in order to obtain pH 7-8, optimal for phenol destruction by bacteria strain.

EFFECT: invention ensures increased quality of purification of sewage water, which contain sulfide-ions and sulfate-ions, from phenol compounds to 0-50 mg/l.

1 dwg, 8 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: invention may be used to extract carotenoids, in particular, deinoxanthine, which is used to develop new antioxidant and radioprotector preparations to increase adaptation capabilities of humans and aminals, prevention and treatment of diseases. The method provides for extraction of carotenoids from the bacterial mass Deinococcus radiodurans by the mixture acetone : ethanol (at the 1:1 ratio). Separation of carotenoids with extraction of deinoxanthine on preparative columns of a liquid low-pressure chromatograph, where the sorbent is hydroxyapatite, and the eluent - ethanol.

EFFECT: invention makes it possible to increase quantity and quality of extracted deinoxanthine.

2 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention relates to the field of microbiology and genetic engineering. A new yeast strain Yarrowia lipolytica RNCIM Y-3600 has been produced - a producer of cell-bound lipase.

EFFECT: higher activity.

3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

FIELD: agriculture.

SUBSTANCE: method to stimulate growth and to protect small-fruit crops against diseases caused fungic pathogens includes treatment of plants with a biopreparation in a liquid form by soaking roots of seedlings prior to planting, or their sprinkling after planting, or sprinkling of plants in the period of vegetation and fruiting, or sprinkling of soil around plants with its further soaking with water. The biopreparation is a mixture of strains of bacteria B. subtilis VKPM B-10641, B. amyloliquefaciens VLPM B-10642, B. licheniformis VKPM B-10561 and B. licheniformis VKPM B-10562 or a mixture of strains of bacteria B. subtilis VKPM B-10641, B. amyloliquefaciens VKPM B-10642 and B. licheniformis VKPM B-10562 with a titre of each strain of not less than 105 CFU/ml in the form of a water suspension.

EFFECT: invention provides for higher protection of small-fruit crops against diseases caused by fungic pathogens, due to use of a mixture of strains of different types of bacteria of Bacillus type, having higher antagonistic activity, and also provision of the possibility of stimulation of growth of small-fruit crops.

5 cl, 10 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: method of increasing the productivity of the bacteria E.coli lies in preparation of a suspension of microorganisms, stirring it in the process of cultivation in the presence of a magnetic magnesium isotope sulfate 25Mg in an amount of 2.2 mmol/l.

EFFECT: increased stimulation of cell growth of bacteria Ecoli.

4 dwg, 4 tbl

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnologies.

SUBSTANCE: invention may be used to extract carotenoids, in particular, deinoxanthine, which is used to develop new antioxidant and radioprotector preparations to increase adaptation capabilities of humans and aminals, prevention and treatment of diseases. The method provides for extraction of carotenoids from the bacterial mass Deinococcus radiodurans by the mixture acetone : ethanol (at the 1:1 ratio). Separation of carotenoids with extraction of deinoxanthine on preparative columns of a liquid low-pressure chromatograph, where the sorbent is hydroxyapatite, and the eluent - ethanol.

EFFECT: invention makes it possible to increase quantity and quality of extracted deinoxanthine.

2 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: probiotic lacto-amylovorin is produced by means of depth growth of the strain Lactobacillus amylovorus RNCIM B-6253 on the liquid nutrient medium, which contains the following: corn extract - 10 ± 0.01 ml, lactose - 20 ± 0.005 g, chemically deposited chalk - 0.5 ± 0.01 g, triple-substituted citric-acid sodium - 7.5 ± 0.05 g, 3-water acetous sodium - 2 ± 0.01 g, iron sulfate - 0.1± 0.001 g, 5-water manganese sulfate - 0.16 ± 0.002 g, hydrolysate of dry nonfat milk - up to l. Subsequent extraction of the target product in liquid condition or in the form of a dry powder is carried out with preliminary addition of a stabiliser to a cultural liquid or to a protective medium used when producing the probiotic in the form of the dry powder. The stabiliser is selected from: sodium metabisulfite, sodium hydrosulfite and ascorbic acid.

EFFECT: invention provides for stable production of a probiotic with high values of a titre of antimicrobial bodies not only in a cultural liquid, but also after its treatment required for production of different pharmaceutical forms of a preparation.

3 cl, 2 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: bacteria strain Planomicrobium koreense 78k, is extracted from soils and provides for production of site-specific endonuclease PkrI, which recognises and splits both chains of nucleotide sequence of DNA, which contains three or four C5-methylcytosine bases in recognition site 5'-GCNAGC-3' with formation of a single-nucleotide 3'-protruding end. The strain is deposited in the Russian National Collection of Industrial Microorganisms FGUP GosNIIgenetika under the number B-10627. The provided strain may be used for extraction of the new site-specific endonuclease PkrI, which may be applied in detection and splitting of methylated DNA sections.

EFFECT: production of site-specific endonuclease PkrI.

3 dwg, 3 ex

FIELD: medicine.

SUBSTANCE: for the purpose of producing a probiotic preparation, a biomass of the symbiontic strain Corynebacterium diphtheriae tox No. 2 of Federal State Institution L.A. Tarasevich State Institution of Standardization and Control is cultured in a liquid nutrient medium; microbial cells are deposited by centrifugation, washed to precipitate whole cells by centrifugation; the cells are suspended in a sodium chloride solution. Then, the cells are disintegrated at temperature 25-30°C for 15 min at frequency 20 kHz and amplitude 14 mcm; the desintegrant is centrifugated at 5000 g; and the remained whole cells are removed. The prepared precipitation is centrifugated at 14000 g for 20 min. to produce precipitated corpuscular antigens of cell walls of lipopeptidopolysaccharide corynebacteria which is resuspended and disintegrated at temperature 25-30°C for 5 min. at frequency 20 kHz and amplitude 14 mcm. Then the preparation is diluted to the concentration of 225-275 mcg/ml, sterilised and lyophilised.

EFFECT: use of the invention enables producing the safe and effective preparation of corpuscular antigens providing creating specific and non-specific immunity to tuberculosis.

2 cl, 2 dwg, 2 tbl, 3 ex

Up!