Isolated microbial strain of lactobacillus plantarum tensia dsm 21380 as antimicrobial and hypotensive probiotic, food product and composition containing said microorganism, and use of said microorganism to obtain hypotensive medicinal agent, method of inhibiting pathogens and secondary lactic bacteria in food product

FIELD: chemistry.

SUBSTANCE: invention relates to microbiology and biotechnology and can be used in food industry and medicine. The microbial strain of Lactobacillus plantarum Tensia DSM 21380 produces conjugated linoleic acid (CLA), hydrogen peroxide (H2O2), nitrogen monoxide (NO), contains plantaricin encoding genes and has antioxidant activity. This strain and its liophilised form are used to prepare an antimicrobial and hypotensive probiotic, a dairy product and a medicinal agent which lowers blood pressure. The strain and its liophilised form are also used to increase polyamine turnover in the body, to attain a dominant position among intestinal lactic bacteria in the gastrointestinal tract and to prolong the shelf life of a dairy product.

EFFECT: use of the invention enables to lower blood pressure, suppress undesirable microflora and inhibit oxidative processes.

12 cl, 8 dwg, 31 tbl, 7 ex

 

The technical FIELD TO WHICH the INVENTION RELATES.

The present invention relates to a new microorganism and its use. The invention relates to the field of biotechnology and is used in food industry and medicine. More specifically, an object of the present invention is an antimicrobial and anti-hypertensive strain of probiotic microorganisms Lactobacillus. plantarum Tensia DSM 21380. The present invention relates to the use of this strain in the composition of functional food, such as cheese, and for receiving antihypertensive medication.

The LEVEL of TECHNOLOGY

Lactic acid bacteria are used to produce fermented food products, used for centuries. In the past decades, lactobacilli are widely used as probiotics. Probiotics are live microorganisms that are part of the microflora of the human body, which, when introduced in sufficient quantity, benefit the health of the media. Usually probiotics are used to create healthy food. The food product may be attributed to functional products, if in addition to the sufficient amount of nutrients it contains some natural supplements (pre - and probiotics), which beneficially affect one or more target functional systems of the body is ZMA, improving the health and well-being, and/or reducing the risk of disease.

Probiotic products may be conventional products (yogurt, cottage cheese, soft cheeses) or dietary supplements (lyophilized microbial culture).

In the European countries several probiotics marketed as products that are beneficial to health.

Antimicrobial probiotics

Antimicrobial probiotics used against opportunistic microorganisms and foodborne pathogens such as Salmonella, are described in patent applications. In WO 2008/039531 (Little Columet Holdings KKC) described strains of Lactobacillus acidophilus, L. bulgaricus, L. casei, L. paracasei, L. fermentum, L. plantanum, L. rhamnosus, L. salivarius, Bifidobacterium bifidum, B. infantis, B. animalis subsp. lactis, B. longum, Streptococcus thermophilus, Enterococcus faecalis and E. faecium. Oral administration of these strains contributes to the suppression of Campylobacter jejuni, E. coli, S. aureus, Vibrio cholerae, Bacteroides sp, Clostridium sp, Klebsiella sp, Listeria sp, Proteus sp. Salmonella sp, Shigella sp and Veillonella sp in the digestive tract.

In the patent application WO 2008/016214 (Bioneer Corporation) describes a strain of Lactobacillus gasseri BNR17 having antimicrobial activity against E. coli, S. aureus, S. typhimurium, B. cereus, l. monocylogenes and P. mirabilis.

Specialists in this field are faced with the problem of side effects of lactic acid bacteria (NSLAB), appearing in the ripening process of cheese on its quality. These germs can cause unwanted proteolysis, the effect of various undesirable taste and loss of product quality cheese.

Attempts in the ripening process of cheese to influence the number of NSLAB pH regulators, antioxidants and preservatives (NaCl) failed. Add in the cheese of various antimicrobial substances (lactic or acetic acid, H2About2), leading to the emergence of bacteria-antagonists, including probiotic lactobacilli was also ineffective. Probiotic lactobacilli that produce H2O2were described by several authors (Ouwehand AC. Westerlund, Antimicrobial components of lactic acid bacteria. In: Lactic acid bacteria: microbiological and functional aspects. Eds. Salminen, S; Wright, A, .Ouwehand, AC. 2004, pp.375-395, New York, Marcel Dekker; Hiitt, P., Shchepetova, J., Loeivukene, K, Kullisaar, T., Mikelsaar, M. Antagonistic activity of probiotic lactobacilli and bifidobacteria against entero - and uropathogens. J. Appl. Environ., 2006, 100, 1324-1332).

Lactobacillus human and plant origin do not adapt to atypical environment, cheese, rich in protein and fats, and low in carbohydrates. As a consequence, there is only a small amount of cheese containing probiotic lactobacilli (Gardiner, G, Ross, R.P, Collins, 1.H, Fitzgerald, G, and Stanton. C. Development of a probiotic cheddar cheese containing human-derived Lactobacillus paracasei strains, Appl. Environ. Environ., 30 1998, 64,. 6: 2192-2199; Ross, R P, Fitzgerald, G, F, Collins, J K, O'sullivan, G C, Stanton, G. Process for the manufacture of probiotic cheese, U.S. patent 6872411, patent application WO 99/62348 AI), in which the added probiotic bacteria retain their ability to cause vegetative bro is the (WO 2002/05665, WO 2000/60948, Consejo Superior de Investigaciones Cientificas). The same applies to similar groups of antimicrobial substances containing colicins, which mainly attack the representatives of the same genus and species (Heinaru A, Tallmeister E. Colicin susceptibility of shigellas and coli bacteria related to episomal resistance and colicinogenicity or dissociation into S-R forms. Geneetika, 1971, 7, 5, 113-122 (Rus. lang.)). As a result, they have the potential for use as substances that suppress side lactobacilli.

Develop plantaricin is regulated by several genes, some of which occur from time to time, some regularly. Consequently meet phenotypic differences in the development of plantaricin. The locus of the genome associated with development of bacteriocin, was described in the strain 11 Lactobacillus plantarum. Two of these genes operon, which bears the name plnEFI and plnJKLR, have each pair of genes pInEF and pInJK encoding two small cationic bacteriocinogenic peptide glycine-dual type leader sequence (Diep, D.., Havarstein, L.S. & Nes, 1.F. Characterization of the locus responsible for the bacteriocin production in Lactobacillus plantarum C11. J Bacterial 1996, 178, 4472-4483). Inventions relating to the strain of L. plantarum, which can suppress NSLAB, and to possess a full set applanation-coding genes EF and JK, does not exist.

Hypotensive probiotics

Many people suffer from metabolic syndrome, symptoms of which include overweight, obesity, increased the blood pressure, the increase of glucose in the blood, and some other risk markers of atherosclerosis. Foods rich in fats (including cheese), are not harmless, as these products can increase the risk of atherosclerosis, inflammation, type II diabetes and/or lipid peroxidation (Raff M., T. Tholstrup, Basu, S., Nonboe P., Sorensen MT, Straarup EM. 138.509-514. A diet rich in conjugated linoleic acid and butter increases lipid peroxidation but does not affect atherosclerotic, inflammatory, or diabetic risk markers in healthy young men (American Society for Nutrition J. Nutr. 2008, 138:509-514).

Conjugated linoleic acid (CLA) refers to two natural isomers of 18-carbohydrate linoleic acid (LA, cis-9, cis-12-18:2). CLA is formed in the process of natural biohydrogenation and oxidation. The CLA isomers are formed in the process of biohydrogenation linoleic acid in the first stomach of ruminants and in the process vaccinology acid in the breast. In optimal doses, the isomers of conjugated linoleic acid (CLA) have a high potential for improving health: they possess antimicrobial, antitumorigenic, antidiabetic, anti-allergenic effect and prevent obesity. A hypotensive effect was also studied by several research groups (Inoue K., Okada F., Ito R., Kato, S., Sasaki, S., Nakajima, S., Uno A, Saijo Y, Sata f, Yoshimura Y., Kishi R. and H. Nakazawa, Perfluorooctane sulfonate (PFOS) and related perfluorinated compounds in human maternal and cord blood samples: assessment of PFOS exposure in a usceptible population during pregnancy. Environ. Health Perspect. 112 (2004), str-1207).

However, the addition of CLA in food in large quantities is problematic. During research it was found that the consumption of 5 grams of CLA per day leads to increased lipid peroxidation (LPO), which is expressed in high concentrations (83%) 8-isoprostaglandin F2(Raff M., T. Tholstrup, Basu, S., Nonboe P., Sorensen MT, Straarup EM. 138.509-514. A diet rich in conjugated linoleic acid and butter increases lipid peroxidation but does not affect atherosclerotic, inflammatory, or diabetic risk markers in healthy young men American Society for Nutrition 1. Nutr. 2008, 138:509-514).

The best solution is to use a strain of lactic acid bacteria with the ability to limit the production of CLA and physiologically antioxidant properties. Inclusion in food physiologically important antioxidant LAB allowed us to control the increase of lipid peroxidation (LPO) and increase bioprosthetic fat-rich foods, such as cheese. Lactobacillus fermentum 1VIE-3 described in the patent Estonia EE University of Tartu, and in scientific articles, there was an important physiological antioxidant activity (Kullisaar T, Zilmer M, Mikelsaar M, Vihalemm T, Annuk H, Kairane With, Kilk A Two antioxidative lactobacilli strains as promising probiotics. Int.; J. Food Environ., 2002, 72, 215-224; Kullisaar, T., Songisepp, E., Mikelsaar, M., Zilmer, K., Vihalemm, T., Zilmer, M. Antioxidative probiotic fermented goats' milk decreases oxidative stress-mediated atherogenicity in human subjects. Br. J. Nutr., 2003, 90, 449-456; Truusalu, K., Naaber, P., Kullisaar, T., Tamm, N., Mikelsaar, R-H., Zilmer, K., Rehema, A, Zilmer, M., Mikelsaar, M. The influence of antibcterial and antioxidative probiotic lactobacilli on gut mucosa in a mouse model of Salmonella infection. Microbial Ecology in Health and Disease 2004, 16:4, 180-187).

The concentration of polyamines in human blood and urine varies depending on food consumption with different contents of polyamines, and also depending on the producers of endogenous polyamino in the human intestinal microflora, such as E. coli and some anaerobic bacteria (M. Marino Maifreni M, Moret, S., Rondinini G. The capacity of Enterobacteriaceae sp. to produce biogenic amines in cheese. Letters of Microbiology, 2000, 31, 169-173). Some foods contain polyamine in relatively high concentrations, for example oranges contain significant amounts of putrescine 1330 ág/100 g (E. Larque" Sabater-Molina M., Zamora S. Biological significance of dietary polyamines. Nutrition, 2007, 23, 87-95.). Strains of lactobacilli, which are capable of producing a moderate amount of CLA and polyamines, and at the same time possess physiologically significant antioxidantsoto, have not yet been described.

Blood pressure is regulated such substances as nitrogen monoxide (NO), products of lipid peroxidation (LPO), oxidized low-density lipoprotein and components of the glutathione redox system (GSSGIGSH), which regulates the stiffness of the blood vessels and affects their vasoconstriction.

In addition, increased levels of LPO, ox-LDL, GSSGIGSH is a risk factor for development of atherosclerosis. The metabolism of acetylated spermidine provides on the additional vasodilating properties (low blood pressure) due to its acetylated form and normal form polyamine (Myung CS, Blankenship JW, Meerdink DJ. A mechanism of vasodilatory action of polyamines and acetylpolyamines: possible involvement of their Ca2+ antagonistic properties, J Pharm Phannacol. 2000, 52:695-707).

Some of the peptides contained in milk, have the ability to lower blood pressure by suppressing angiotensin-converting enzyme I (ACE) (Meisel, N. & Bocklemann, W. Bioactive peptides encrypted m milk proteins: proteolytic activation and tropho-functional properties. In: Proceedings of the sixth symposium on lactic acid bacteria: genetics, metabolism and applications. 19-23 September. Veldhoven (W.N.Konings, O.P.Kuipers, and 1. Huis in't Veld., eds.) Kluver Academic Publishers, the Netherlands. 1999. pp.207-215 (1999)).

The nitric monoxide NO belongs to bioactive substances, has several useful properties, such as antimicrobial and anti-inflammatory action, as well as the ability to lower blood pressure (Janeway CA, Travers P, Walport M, Shlomchik, M1. 2005. Immunobiology: The Immune System in Health and Disease. New York, NY: Garland Science Publishing). NO effect on blood pressure in different ways, for example by relaxing the smooth muscle of blood vessels, inhibiting ACE or the development of endogenous protection mechanisms (pre-adaptation) (Jones SP, Bolli R. The ubiquitous role of nitric oxide in cardioprotection. J Mol Cell Cardio 12006; 40: 16-23).

Today, there are only a few related inventions probiotic microorganisms, which produce endogenous or contribute to endogenous development NO. Lactic acid bacteria, promote endogenous development NO described in the patent is the application of Estonia IT A and ITS 200200231 (Valio Ltd.). In the patent application IT A described strain Lhelveticus CMF-16H, DSM 13137 with photolytic effect, which produces di - and tripeptides. These di - and tripeptides derived from casein due to the lactic fermentation, collected by nanofiltration and then add in food products, including fermentation of milk, which allows you to create a product containing protivogipertonicheskoe peptides. In the patent application EE described strain L. heiveticus CMF-16H 15, DSM 13137, which in addition to the ability to produce di - and tripeptides, is also able to stimulate the production of NO in the two cell lines (in enterocytes of mice and humans). This strain helps to reduce blood pressure through the production of peptides and NO. The proposal of otmechaet that bacterial cells were not the only producers of NO (page 13, lines 8-9).

In U.S. patent US 7183108 (Compagnie Gervais Danone, 2007) described a strain of Lactobacillus casei, possessing anti-inflammatory properties due to the increase in NO production (NO is produced proinflammatory cytokines and activated enterocytes), and vice versa - bacterial production of NO is inhibited when the enterocytes is already activated by proinflammatory cytokine and bacterial lipopolysaccharides.

Korhonen and others in 2001 (Korhpnen To, Reijonen TM, Remes K, Malmstrom K, Klaukka T, Korppi M. Reasons for and 'costs of hospitalization for paediatric asthma: A prospctive I-year follow-up in a population-based setting. Pediatr Allergy Immunol 2001:12:331338) showed that Lactobacillus rhamnosus GG could stimulate NO production by cells of the intestinal epithelium or through induction of proinflammatory cytosine. These authors have pointed to possible preferred relationship between LOG output and production of NO.

In the European patent EP 0951290 (Laboratories Standa S.A., 2002) described produces NO propionibacteria added to the composition for NO production in the gastrointestinal tract, presumably in the enterocytes. There Lactobacillus farciminis referred to as a negative example of producing low amounts of NO. In U.S. patent US 7294337 (national Institute of agronomic research, 2007) however, it was shown that L. farciminis can produce NO in quantities sufficient for anti-inflammatory effect and the suppression of pain after stretching in the abdominal cavity.

It was found that the strain L. fermentum LF1 could produce NO aerobically in MRS broth nutrient medium without the presence of a culture of human cells. The strain L. plantarum DSM9843 (LP2), tested by the same authors, could not act similarly in contrast to our strain L.Plantarum Tensia DSM 21380 (JXu, .W.Verstraete. Evaluation of nitric oxide production by lactobacilli L Appl. Environ. Biotechnol., 2001, 56:504-507). Introduction to the human body strain as a probiotic with the above properties allows you to control blood pressure due to the strain of barabati is W ith NO and NO property to influence the level of blood pressure as explained above.

In addition to low survival in foods, selection of probiotic bacteria is caused by the problem of low survival of strains with the passage of the gastrointestinal tract. Thus, a need to know such probiotic bacteria that can survive in the upper and in the lower part of the gastrointestinal tract. In international patent application WO 91/05850 (University of Tartu and others, 1989) described a strain of 1. plantarum 38 as suitable to regulate the microflora of the large intestine in the case of bacterial dysbiosis. In the European patent EP 0554418 B1 (Probi AB, 1998) described the positive properties of the strain L. plantarum 299 (DSM 6595) to form colonies in the intestines of humans and the use of this strain in the composition of the liquid oat drink, used for surgical patients to prevent internal infection. In international patent application WO 2007/003917 A1 (Matforsk AS, et al., 2006) described a strain of Lactobacillus plantarum DSM 16997 (DSM 17320) and 1 strain. pentosus (DSMI7321) as the microbes that cause fermentation in meat products. The authors of this proposal argue that these strains can function as probiotics, regulating the internal microflora of man by suppressing harmful bacteria and also symbionts Escherichia coli. To confirm this statement in the application presents the results of in vitro experiments. However, in the application nepredstavlenii evidence in vivo suppression of pathogens (i.e. on the experimental model with the animal). In addition, not demonstrated the suppression side of lactic acid bacteria (NSLAB), although the application is described that NSLAB survive in the environment (sausages) at low pH levels. Without evidence in the application argues that the probiotic strains have immune stimulating properties and can reduce the risk of sepsis after surgery, as well as improve the health of patients.

In the patent Estonia EE B1 (Probi AB, 2003) described the use of Lactobacillus plantarum 299v (DSM 9843) for the treatment of infections of the urinary tract, because the strain is able to bind to the epithelium of the large intestine due to its mannose-specific adhesin, and compete with harmful pathogens in the urinary tract at the site of attachment. According to the results of the analysis of REA (restriction enzyme) all of the above strains differ from each other and from Lactobacillus plantarum Tensia DSM 21380 a clear profile of chromosomes.

DISCLOSURE of INVENTIONS

The present invention relates to a new isolated microorganism strain Lactobacillus plantarum Tensia DSM 21380 used as an antimicrobial and antihypertensive probiotic, food (dairy products, for example products of fermentation or cheese) and compositions containing the above-mentioned microorganisms, and also to use is itaniu mentioned microorganisms for the production of antihypertensive medicines. The invention also relates to a method for suppressing pathogens and side laktobakterii in food products and to a method of increasing the shelf life of food products by the use of Lactobacillus plantarum Tensia DSM 21380.

Lactobacillus plantarum Tensia DSM 21380 as antimicrobial probiotic produces antimicrobial substances - lactic acid, acetic acid, CLA, NO, H2O2and has plantaricin - II b class paired genes EF and JK encoding antimicrobial patterns. Through its metabolites Lactobacillus plantarum DSM 21380 suppresses in vitro experiment side lactobacilli and enteric pathogens. This strain is able to grow and dominate among the lactic acid bacteria at low temperatures and in a state of carbohydrate deficiency (e.g., cheese).

In addition to antimicrobial activity of Lactobacillus plantarum Tensia DSM 21380 is also hypotensive and antioxidant probiotic by developing NO, CLA and antioksidantnoi, in the in vitro experiment produces a small amount of polyamines tiramina and putrescine and prevails in the intestinal volunteers after three weeks of eating cheese containing Lactobacillus plantarum Tensia DSM 21380. Property of Lactobacillus plantarum Tensia DSM 21380 to organize a colony in the human intestine was found in samples of faeces as on the profile of electrophoresis in denaturing gradient gel, and the traditional ways, adopted in bacteriology. Lactobacillus plantarum Tensia DSM 21380 significantly boosts the metabolism of putrescine and acetylated spermidine in the human body, which is accompanied by a decrease in systolic and diastolic blood pressure.

DESCRIPTION STRAIN

The object of the invention, a strain of microorganism Lactobacillus plantarum Tensia DSM 21380, was isolated from feces samples of a healthy child during a comparative study of the microflora of Estonian and Swedish children. The microorganism L. plantarum Tensia DSM 21380 allocated by planting solution faeces of healthy one-year-old Estonian children (10-2-10-7in phosphate buffer solution with 0.04% of thioglycolic acid; pH 7.2). The solution was sown in prepared MRS agar medium (Oxoid) and were cultured microaerobic at 37°C.

The strain, which is an object of the invention was selected according to the characteristic colony morphology and implantable to Lactobacillus sp. Preliminary and a more precise identification was carried out by the methods described below.

The fact that microbial strain Lactobacillus plantarum Tensia DSM 21380 isolated from intestinal tract of a healthy child, confirms its GRAS status (recognized as entirely safe), that is this strain of microorganisms safe for the human body and is suitable for oral administration.

The microorganism Lactobacillus plantarum strain Tensia was deposited in the German the second collection of microorganisms and cell cultures 16.04.2008 under the registration number DSM 21380.

Cultural and morphological characteristics were detected after cultivation in MRS agar and MRS broth medium (OXOID). Cells of Lactobacillus plantarum Tensia DSM 21380 are gram-positive, risperadone sticks of the correct form, occurring singly, in a pair or in short chains.

Physiological and biochemical characteristics

Cultivation of the strain was carried out in MRS broth nutrient medium within 24-48 hours microaerobic, then a broth culture medium occurred homogeneous turbidity growth. Colonies on plates containing MRS agar after 48 hours of growth at 37°C in microaerobic conditions (atmosphere of CO2/O2/N2: 10/5/85) are round, 2-2 .5 mm in diameter, solid, convex, and white.

Optimum temperature for growth is 37°C, the strain reproduces also at the temperature of 15°C and 45°C. the Optimal pH level of the environment of growth - 6.5.

The strain Lactobacillus plantarum Tensia DSM 21380 is catalase and oxidecontaining, optional heterofermentative, does not produce gas from glucose and does not cause hydrolysis of arginine. The strain Lactobacillus plantarum Tensia DSM 21380 was identified on the basis of biochemical activity with a set of API 50CHL (bioMerieux, France) as Lactobacillus plantarum (match type strain: excellent, ID % - 99.9, T index - 0.86).

Comparison with the aforementioned Lactobacillus plantarum ATCC 14917 confirmed prior and is entification API 50CHL.

The hydrocarbon profile of Lactobacillus plantarum Tensia DSM 21380 according to API 50 CHL following: positive reaction on the ribose, L-arabinose, galactose, D-glucose, D-fructose, D-mannose, mannitol, methyl-D-mannoside, methyl-D-glucoside, N-acetyl-glucosamine, amygdalin, arbutin, esculin, salicin, cellobiose, maltose, lactose, melibiose, D-arabinose, sucrose, trehalose, melezitose, D-raffinose, β-gentiobiose, D-turanose, gluconate; weak reaction for starch.

According to the test set API ZYM (bioMerieux, France), Lactobacillus plantarum Tensia DSM 21380 has leucine, arylamidase-, acid-phosphatase, and gluconate-, β-gluconase and acetoin activity. Was weak reaction to the valine arylamidase, naphthol-AS-BI-phosphohydrolase, β-galactosidase, cystine Arriondas, esterase (C4), esterase (C8), N-30 acetyl-glucosaminidase.

Molecular identification of Lactobacillus plantarum Tensia DSM 21380 was confirmed using polymerase chain reaction internal transcribed spacer regions (ITS-PCR in comparison with the aforementioned Lactobacillus plantarum ATCC 14917 (1)).

Way. Identification of the strain was confirmed using polymerase chain reaction internal transcribed spacer regions (ITS-PCR in comparison with the aforementioned Lactobacillus plantarum ATCC 14917).

The isolation of DNA from Lactobacillus was performed using lysozyme (Serva, Sweden; 20 mg/ml), mutanolysin (Sigma; 0.5 mg/ml) and p the cross-sections K-proteinase (Fermentas, Lithuania; 14.6 mg/ml).

Amplification of DNA was performed in 1×Taq buffer solution polymerase, which included 1,5U of Taq polymerase (Fermentas, Lithuania), 0.5 μm of each primer (16S-1500F and 23S-32R; DNA Technology AS), 200 μm of deoxynucleotide of triphosphates (Amersham Pharmacia Biotech, Germany), 2 mm MgCh and 2 μm studied DNA.

Then, the PCR product (PCR) was limited to using Taq 1 restrictase (Fermentas, Lithuania). The PCR products were separated by 2% agarose gel in 1×TBE-buffer; voltage 100 Century Vendingowe patterns visualized under ultraviolet light and is associated with the said strain of L. plantarum ATCC 14917.

Molecular "fingerprints" of Lactobacillus plantarum Tensia DSM 21380 were compared with the mentioned strain of L. plantarum by gel electrophoresis pulsed field (pFGE) (Figure 2).

Way. For the procedure gel electrophoresis pulsed field (PFGE) strains of lactobacilli were grown in MRS broth medium at 37°C for 24 hours. Cells were washed in SE buffer solution (75 mm NaCl, 25 mm EDTA, pH=7.4), the density of cells was reduced to 1.5 (OD600). The isolation of the DNA from the isolated Lactobacillus performed in EC buffer solution (50 mm EDTA (pH 8.5), 0.5% Na-laurylsarcosine, 0.2%'Na-diacetate 2 mg/ml lysozyme, 10 units of mutanolysin), and then in buffer solution containing 1 mg/ml of solution proteinase K (100 mm EDTA-1% sarcosyl - 30 0.2% dezoksiholatom, pH 8.0). Lysed samples were washed in TE buffer solution and divide by 2 mm, to the which then was extracted during the night enzymes 50 Not I (Bio-Rad). Electrophoresis was performed in a CHEF-DR II (Bio-Rad) for 22 hours at 14°C. Vendingowe patterns were visualized under UV illuminator.

Antibiotic resistance

Way. Lactobacillus plantarum Tensia DSM 21380 was tested with strips of antibiotics E-test (AB Biodisk, Solna). MIC (minimum inhibitory concentration) was set according to the epidemiological reference values recommended by the European Commission (EUC).

Table 1
The stability of Lactobacillus plantarum Tensia DSM 21380 to antibiotics
MIC*, ug/mlMIC*, ug/mlWatch MIC* resistance to antibiotics of the European Commission (EUC), µg/ml
AntibioticL. plantarum Tensia DSM 21380L. plantarum Tensia DSM 21379
Ampicillin0.250.194
Gentamicin1.5164
Streptomycin 16664
Erythromycin0.190.254
Clindamycin0.0320.0162
Tetracycline8632
Chloramphenical228
Cipro/Ofloxacin32324
Quinopristin/dalfopristin114
* minimum inhibitory concentration

The strain Lactobacillus plantarum Tensia DSM 21380 did not show resistance to antibiotics in use many of the most important antimicrobials.

Several great MIC for ciprofloxacin was observed in the normal state for the source of the strains described previously. Because of this, it's probably the original type strain (Vankerckhoven , Huys G, Vancanneyt M, Yael, KlareI, Romond M-B, Entenza J M, Moreillon P, D. Wind R, Knol J, Wiertz E, Pot Century, Vaughan E.E, Kahlmeter G, Goossens H. Biosafety assessment of probiotics used for human consumption: recommendations from the EUPROSAFE project. Trends in Food Science & Technology, 2008; 19: 102e114) and horizontal transfer of antibiotic resistant genes of Lactobacillus planlarum Tensia DSM 21380 while using strain as a probiotic cannot be predicted.

Functional properties

The profile of metabolites

Way. The profile of metabolites was determined by the method of gas chromatography (Hewlett Packard 6890) after incubation in microarray environment within 24 and 48 hours (table 2). The strain L. plantarum was grown microaerobic in MRS agar for 48 hours (10% CO2). Suspension (McFarland 4.0 standard turbinate, 109 CFU/ml) cultures of lactobacilli were prepared in 0.9% NaCl solution. 1.0 ml of this suspension was placed in 9.0 ml of MRS broth medium. The concentration of metabolites (mmol) were determined using a capillary column HP-INNOWax (15 m × 0.25 mm, 0.15 μm). Temperature of the column: 60°C 1 min, 20°C/min to 120°C 10 min; detector (FID) 350°C.

Electrochemical measurements of H2About2performed with intact cells 24 hours of age in 500 ál of MRS broth nutrient medium using the analyzer free radicals Apollo 4000 (WPI, Berlin, Germany) and electrode type ISO-HP02 and ISO-NOP.

The signal electrodes ISO-HP02 registered for 5-7 minutes. Determined average signaled experimental point was measured in four independent parallel and each parallel was measured twice. The concentration of H2O2was determined according to the calibration curve correlation with the strength of the signal electrodes.

Table 2
The amount of acetic acid, lactic acid and succinic acid (mmol/l), secreted by Lactobacillus plantarum Tensia DSM 21380 in MRS broth nutrient medium when microaerobic cultivation for 24 and 48 hours and the concentration of H2O2(ág/ml) of intact cells
L. plantarumAcetic acid (mmol/l)Lactic acid (mmol/l)Succinic acid (mmol/l)H2O2(µg/ml)
24 hours48 h24 hours48 h24h48h24h intact cells
Tensia DSM 213 801,41.7to 112.2129.20.60.6196.4±128.8
DSM213792.12.4133.3186.60.60.6288.9±175.8

Lactobacillus plantarum Tensia DSM 21380 produces a significant amount of acetic acid, lactic acid and hydrogen peroxide. The concentration of the latter as measured by analyzer Apollo, however, is slightly lower than the control strain.

Antimicrobial activity against pathogens and side lactobacilli

Lactobacillusplantarum Tensia DSM 21380 manifests in the in vitro experiment in MRS agar medium antagonistic activity against the side of lactobacilli and some intestinal pathogens (table 3). This property allows the use of strain to extend shelf life of food products.

Table 3
Antimicrobial activity of Lactobacillus plantarum Tensia DSM 21380 against pathogens and side of lactobacilli in modified MRS agar medium (zone of inhibition of growth of pathogens, mm)
PathogenThe zone of inhibition of growth, mm
Side lactic acid bacteria (NSLAB) 8.6±4.07
Listeria monocytogenes ATCC5177425.1±1.7
Yersinia enterocolitica13.5±1.7
Salmonella enteritidis25.2±1.5
S. enterica serovar Typhimurium22.8±0.1
Shigella sonnei25.1±1.6
Escherichia coli29.8±3.7
Enterobacter sakazakii18.5:±3.6 1
Campylobacterjejuni12.9'±5.2

Antimicrobial activity of Lactobacillus plantarum Tensia DSM 21380 in the in vitro experiment laboratory conditions as determined by the procedure of coating material on a nutrient medium in the form of strips (determination of antimicrobial effect of metabolites) was greatest against E. coli, followed by suppression of growth of Salmonella sp., Shigella sp and Listeria sp. The lowest antimicrobial activity of Lactobacillus plantarum Tensia DSM 21380 was against other laktobakterii (NSLAB).

Antimicrobial activity of Lactobacillus plantarum Tensia DSM 21380) at 4°C against psychrophilic pathogens

It is important to identify the antimicrobial effect of strains of microorganisms used as an auxiliary starter, against the psi is refiling of foodborne pathogens at 4°C (i.e. at a storage temperature of food).

Way. The procedure for staining bands were used to identify the antimicrobial properties of Lactobacillus sp (Hutt R, Shchepetova J, Loivukene K, Kullisaar T, Mikelsaar M. Antagonistic activity of probiotic lactobacilli and bifidobacteria against entero - and uropathogens. J Appi Environ. 2006; 100 (6): 1324-32).

The zone of inhibition of growth of pathogens was measured in millimeters. As Hutt et al. (2006), we calculated the arithmetic mean and its variance, and calculated the standard deviation in accordance with the results of samples used, and on this basis it was revealed antagonistic action of strains (mm) in the following form: at 4°C - below <14.6; average 14.6-21.4; strong >21.4. All experiments were repeated at least three times, independently from each other.

Table 3A
Antagonistically action (mm) L. plantarum Tensia DSM 21380) according to the method of dyeing strips at 4°C incubation for 3 weeks
PathogenL. plantarum Tensia DSM 21380)
Listeria monocytogenes ATCC 1393218.8±1.0
Lisleria monocytogenes ATCC 5177418.5±3.0
Y. enterocolitica (clinical strain)9.0±2.9
Zone of inhibition (mm): weak <14.6; average 14.6-21.4; strong >21,4

Metabolites of L. plantarum Tensia DSM 21380) ways to inhibit the viability of psychrophilic L. monocytogenes and Y. enterocolitica at 4°C.

Influence of growth conditions and incubation temperature on the antimicrobial properties of L. plantarum Tensia DSM 21380)

Way. To assess the effect of growth conditions and temperature on the production of antimicrobial components by L. plantarum Tensia DSM 21380) used different incubation temperatures (15°C; 30°C and 37°C) and different growth conditions (MRS broth and typical milk for cheese production). Lactobacilli were grown at incubation temperatures of 30°C and 37°C for 20-22 hours at 15°C for 30 days (model "cheese").

Antagonistic properties were identified within the 10-day intervals.

Experiments with natural supernatant (pH range 3.65-3.85) and neutralized supernatant (pH range 6.0±0.15) was carried out independently from each other to eliminate the influence of organic acids. The antimicrobial effect was detected when testing by the method of diffusion in agar (Jimenez-Diaz R., Rios-Sanchez R., Desmazeaud M., Ruiz-Barba J.L. and Piard, J.-C. (1993) Plantaricins S and T, Two New Bacteriocins Produced by Lactobacillus plantarum LPCO10 Isolated from a Green Olive Fermentation. Appl. Environ. Environ. 59, 1416-1424) strain Listeria monocytogenes ATCC 51774 ATCC 13932.

Table 3B
The effect of different incubation temperatures (30°C and 37°C) and pH supernatant (natural: 3.65 3.85...and neutralized: pH 6.0±0.15) L. plantarum Tensia grown in MRS antagonistic action against monocytogenes Listeria (inhibition of growth of pathogens in mm)
Strain30°C37°C
naturalneutralnaturalneutral
L. plantarum Tensia DSM 21380)5.1±1.4#3.7±2.6#5.4±0.5§4.2±2.0§
L. plantarum DSM 213791.1±2.11.1±2.11.4±2.21.4±2.3
#p=0.03;§p=0.04

Supernatant of L. plantarum Tensia DSM 21380), vareschi in milk for 20-22 hours at 30°C and 37°C, had no antagonistic effect on the test infvvs L. monocytogenes.

The effect of bacteriocins produced lactoba what indexes stronger in acid medium, as in this case, when all antimicrobial components produced by bacteria, acted synergistically. The optimal range of bacteriocins is considered pH 5.0 7.0...(Atrih, A., Rekhif N., Moir A.J.G., Lebrihi A. and Lefebvre, G. (2001) Mode of action, purification and amino acid sequnce of plantaricin C19, an anti-Listeria bacteriocin produced by Lactobacillus plantarum C19. Intern. Journal of Food Environ. 68, 93-104; Mezaini A., Chihib N.-E., Bouras A.D., Nedjar-Arroume, N. and Hornez, J.P. (2009) Antibacterial Activity of Some Lactic Acid Bacteria Isolated from an Algerian Dairy Product. J. of Environ. And Public Health. 1-6).

The antimicrobial effect of the supernatant of L. plantarum Tensia DSM 21380), verschage in MRS broth, and depends on the pH of the antimicrobial action of natural supernatant (pH 3.65 3.85...) against the tested strains of Listeria sp was significantly better than that for the neutralized supernatant (table 3B).

The antimicrobial effect of the supernatant of L. plantarum Tensia DSM 21380), verschage in MRS broth depends on the incubation temperature, and is stronger at 37°C (table 3B).

Table 3C
The influence of low incubation temperature (15°C) and different growth conditions (MRS and milk) on antimicrobial activity against Listeria sp within 30 days incubation in MRS broth and milk (inhibition of growth of pathogens in mm)
Ø the AMM MRSMilk
Day 10Day 20Day 30Day 10Day 20Day 30
L. plantarum Tensia5.6±0.85.8±1.37.1±1.403.0±2.36.0±0.7
L. plantarum DSM 2137900.6±1.11.9±2.602.2±2.80

Supernatant of L. plantarum Tensia DSM 21380), vareschi at 15°C in MRS broth, had an antagonistic effect starting with the first dimension (10th day incubation). Antimicrobial properties against Listeria sp supernatant of L. plantarum Tensia DSM 21380), separated from milk, was observed starting from the 20th day incubation, and antimicrobial activity of the supernatant remained and were slightly increased when approaching the end of the incubation period. Antimicrobial properties supernatant of strains isolated from milk were significantly weaker (p<0.01)in comparison with lactobacilli supernatant, virossa in MRS broth.

The bacteriocins-genes of Lactobacillus plantarum Tensia DSM 21380

Way. Definition in Lactobacillus plantarum Tensia DSM 21380 the bacteriocins-coding genes was based on Lactobacillus plantarum WCFS1 genes plnE, plnF plnJ and plnK. These genes encode prior peptides of bacteriocin (Lactobacillus plantarum WCFS1 genome annotation - Kleerebezem et al., 2003. Complete genome sequence of Lactobacillus plantarum WCFSI. Proc Natl Acad Sci USA. 2003 Feb. 18; 100 (4): 19905). Primers for PCR were designed using Primer Express®. The annotated genome of Lactobacillus plantarulli WCFS1 was downloaded from the browser of NCBI genomes (http://vmw.ncbi.nlm.nih.gov/Genomes).

These primers were designed as E1F, E1R, F1F, FIR, JIF, UCN, K2F, K2R (see sequence listing) and used in a PCR reaction was allowed to receive positive signals for all of the mentioned sequences. The strain L. plantarum BAA-793 NCIMB 8826 was used as a positive control, and the strain L. plantarum DSM 21379 - as a negative control.

Table 4
The presence of extended-spectrum PCR products in the genomic DNA bacteriocins-coding genes plnE, plnF, plnJ and plnK Lactobacillus plantarum DSM 21380
Genes
plnEplnFplnJ plnK
L. plantarum BAA-793 (NCIMB 8826)++++
L. plantarum Tensia DSM 21380++++
L. plantarum DSM 21379++--

Antagonistic activity of L. plantarum Tensia DSM 21380 compared with other antimicrobial agents is also based on the above-mentioned gene products, such as antimicrobial peptides. Peptides E&F and J&K must be expressed at the same time for maximum response by dipeptides.

Production by microorganisms of the strain L.plantarum Tensia DSM 21380 of linoleic acid with conjugated double bonds (CLA)

Way. The production of linoleic acid with conjugated double bonds (CLA) was determined in MRS broth culture medium (de Mann-Rogosa-Sharpe, Oxoid, UK) and skimmed milk using spectrophotometric measurements.

MRS broth nutrient medium39.9 mg/l (moderate)
Skim milk 19.2 mg/l (moderate)
Cheese3.0±0.3 mg/g

Production of nitrogen monoxide L. plantarum Tensia DSM 21380

Way # 1. Measurements of the amount of produced nitric monoxide were performed with intact cells 24 hours of age 500 MK MRS broth nutrient medium with the analyzer free radicals Apollo 4000 (WPI, Berlin, Germany) and electrode type ISO-NOP. Signals from the electrodes were recorded for 5-7 minutes. Determined average signal strength. Each experimental point was measured in four different Parallels and each parallel was measured twice. The NO concentration was determined according to the correlation of the calibration curves with the power of the signal electrodes.

Table 5A
The number NO (μm)produced by L. plantarum Tensia DSM 21380
The number of strainNO concentration (µm)
L. plantarum Tensia DSM 213802.6±0.8
L. plantarum DSM 213792.7±1.2
L. coprophilus2.1±1.1
L. plantarum2.1±0.9
L. paracasei ssp paracasei strain number 11.3±0.8
L. paracasei ssp paracasei strain number 21.8±0.9
L. paracasei ssp paracasei strain number 32.8±1.6
L. buchneri2.0±1.1

L. plantarum Tensia DSM 21380 was one of the best producers of NO compared to 8 other strains of Lactobacillus sp.

Method No. 2. The formation of nitric oxide was measured in microbial cells with age in 24 hours, incubated in 10 ml of MRS broth containing 3 or 20 mg NaNO3.

The measurements were carried out using the analyzer free radikalov Apollo 4000 as described above.

Table 5B
StrainThe concentration of NaNO3NO concentration (μm) in MRS broth
MRS broth0.0±0.0
L. plantarum Tensia DSM 21380MRS broth-0.1±0.0
3 mg NaNO34.5±0.9
30 mg NaNO3L. plantarum DSM 21379MRS broth0.7±0.4
3 mg NaNO34.1±5.3
30 mg NaNO35.4±6.0

The number NO, sformirovannogo L. plantarum Tensia DSM21380 depends on the concentration of NaNO3in the carrier.

Permitted concentration NaNOs in salt or preferowanych products is 300 mg/kg, and the cheese 150 mg/kg (http : //www.riigiteataja.ee/ert/act.jsp?id=12937247).

Antioxidant effect of Lactobacillus plantarum Tensia DSM 21380

Way. To determine the TAA and TAS microbial cells strain L. plantarum Tensia DSM 21380 was placed in MRS broth medium (Oxoid, U.K.) for 24 hours at 37°C. bacterial cells were collected by centrifugation (1500 RPM for 10 min) at 4°C, and the precipitate was washed in isotonic solution (4°C) and suspended in 1.15% KCl (Sigma, USA). The density of the suspension was OD 600 of 1.1×109 bacterial cells ml-1.

Total antioxidant activity was evaluated by testing with linoleic acid (LK-test) (Kullisaar, T., Songisepp, Mikelsaar M, Zilmer, K, Vihalemm T, Zilmer, M. British J of Nutrition. Antioxidant probiotic fermented milk decreases oxidative stress-mediated atherogenicity in human. 2003, 90, 2, 449-456), and total antioxidant status was measured by means of an industrial set (TAS Randox Laboratories Ltd., UK) (table 6).

Table 6Total antioxidant activity (TAA) and total antioxidant status (TAS) of Lactobacillus plantarum Tensia DSM 21380StrainTAA (%)TAS (mmol/l)L. plantarum Tensia DSM 2138022±50.05±0.02L. plantarum DSM 2137926±1.20.13±0.04

The values of TAA and TAS strain L. plantarum Tensia DSM 21380 were slightly lower than the strain L. plantarum DSM 21379.

Values of L. plantarum Tensia DSM 21380 were lower compared with the values of antioxidant strain L. fermentum ME-3 (DSMI4241) (IU-3, TAA: 29±0.7; TAS: 0,16±0,03).

In vitro production of polyamines by the microorganism strain Lactobacillus plantarum Tensia DSM 21380

Way. Microbial strains suspended in physiological solution in accordance with McFarland standard turbinate (109 CF units/ml), 0.5 ml suspension of each strain was planted in decarboxylating medium (4.5 ml) and incubated for 4 days at 37°C (Bover-20 Cid et al., 1999).

To determine VA 200 ál of medium was used for GC analysis by a modified method of Nikovici (Nakovich, L. Analysis of biogenic amines by GCIFID and GC/MS. Thesis, Virginia polytechnic institute, USA. 2003).

GC analysis was performed using the chromatographic getanalyzer is and HP 6890 Series GC System, with a capillary column HP-5 190911-413 (30 m XO.34 mm ; 0.25 ~m). Temperature of the column: 160°C 1 min, 20°C/min 280°C 15 min; detector (FID) 300°C.

Table 7
In vitro concentration of polyamines in decarboxylating environment
SamplePolyamine and biogenic amines
ArginineGlutamineLysineOrnithineHistidine
Putres
CIN
CadaverinPutrescineKaDeWe
Rin
PutrescineCadaverinPutrescineCadaverinHistamine
L. plantarum Tensia DSM 21380000000.30.5 0.60
L. plantarum DSM 2137900.41.20.500.41.900
E. coli ATCC 70033618.41.712.318.41.82401599.33.5105.1

L. plantarum Tensia DSM 21380 produces a small amount of polyamine putrescine from ornithine. Of biogenic amines were seen signs of cadaverine. Production of histamine was not registered.

BRIEF DESCRIPTION of DRAWINGS

Figure 1. Molecular identification of Lactobacillus plantarum Tensia DSM 21380 by ITS-PCR

1. L. plantarum DSM 21379

2. L. plantarum Tensia DSM 21380

3. L. plantarum CRL 972 (ATCC 14917)

M - 100 bp marker (Fermentas)

Figure 2. Molecular "fingerprints" of L. plantarum Tensia DSM 21380 compared with the control strain L. plantarum (gel electrophoresis pulsed field PFGE)

1. Marker Lambda Ladder PFG (New England Bio Labs, Inc.)

2. L. plantarum Tensia DSM 21380

3. L. planlarum DSM 21379 (control)

Figure 3. The presence of L plantarum Tensia DSM 21380 cheese-DGGE method.

Testing cheeses by DGGE gel electrophoresis (cheese with probiotic supplements, the control cheese, cheese with prebiotic supplements).

1. Cheese nr 529

2. The control cheese

3. Cheese No. 5

4. The strain L. plantarum number 1

5. Cheese No. 9-1

6. L. plantarum DSM 21379

7. Cheese No. 19

8. The strain L. plantarum number 1

9. Cheese nr 9-2

10. L. plantarum DSM 21379

11. L. plantarum Tensia DSM 21380 cheese

12. L. plantarum Tensia DSM 21380 pure culture

13. Cheese No. 4

14. Cheese No. 12

15. The strain L. paracasei number 1

16. L. plantarum DSM 21379

Figa, 4b, 4C. The definition of the genus lactobacilli by means of a cluster analysis Pearson UPMAG in group L. plantarum Tensia DSM 21380.

5 Lowering systolic blood pressure (the end of the experiment compared with the values of systolic blood pressure at the beginning of the experiment).

(a) Positive correlation with minimum increase in the number of lactobacilli after consumption of cheese containing L. plantarum Tensia DSM 21380 (r=0.631, p=0.044, n=11);

(b) correlation with the increase of putrescine in the urine of volunteers after the consumption of cheese containing L. plantarum Tensia DSM 21380 compared with the values at the beginning of the experiment (r=0.631, p=0.037, n=11).

The IMPLEMENTATION of the INVENTION

Example 1. Suppression of microbes NSLAB in the food product

Experiment with Estonian cheese

Way. The microorganism Lactobacillus plantarum Tensia DSM 21380 added to milk to produce cheese Dairy Cooperative E-Piim (datawedge 3×108 CFU/vat), then the milk was spaziali (25 min). Crud cut (25 min), heated (34°C, 15 min), dried (25 min), pressed, pressed (1 hour), salted solution (12°C; 20% NaCl; pH 4,7) 20 hours, pressed and dried (8 hours), Packed in plastic and left to ripen at 12°C at least 4 weeks.

Table 8
The content of lactobacilli in cheese containing L. plantarum Tensia DSM 21380 on the 28th day of ripening
Cheese containing L. plantarum Tensia DSM 21380Counter Aulnay cheese pH 5.1Cheese containing L. plantarum Tensia DSM 21380The control cheese
Day 3Day 283 monthsDay 3Day 283 months
Lactobacillus sp1099×1056×1055×1085×107ND108 107
L. vlantarum1092×1036×1055×1085×107NDNDND
L. caseiND8×105NDNDNDNDNDND
L. buchneriND105NDNDNDNDNDND
OHOL*NDNDNDNDNDND2×103ND
* OHOL - mandatory homofermentative Lactobacillus
ND - not determined

The number of L. plantarum was 10 times higher in cheese containing L. plantarum Tensia DSM 21380, by the 28th day compared to the control cheese. While in the control cheese was present homofermentative lactobacilli strains of L. casei and L. buchneri, all of the above species was absent in cheese containing L. plantarum Tensia DSM 21380. Thus, the strain Lactobacillus plantarum Tensia DSM 21380 able to inhibit NSLAB in cheese and suppress microbiota contained therein. The latter can be represented by pathogens found in food after cooking. As a consequence, the addition of L. plantarum Tensia DSM 21380 can prolong the shelf life of the food product.

The antimicrobial effect of L. plantarum Tensia DSM 21380 against Listeria monocytogenes in the environment of cheese

Suppression of NSLAB microbes in cheese Lactobacillus plantarum Tensia DSM 21380 described in example 1 in table 8.

The following illustrates the survival of Lactobacillus plantarum Tensia DSM 21380 cheese and increase the metabolic activity of Lactobacillus plantarum Tensia DSM 21380 in the process of maturing cheese and shelf life when added to milk for cheese making in dried form (batch 13)

The concentration of L. plantarum Tensia in dried yeast9×1010CFU/g
The concentration of L. plantarum Tensia in m is loke for cheese making 2×104CFU/ml
The concentration of L. plantarum Tensia in fresh milk after salting105CFU/g
The concentration of L. plantarum Tensia cheese on the 15th day of ripening106CFU/g
The concentration of L. plantarum Tensia cheese 1 month maturing1×107CFU/g
The concentration of L. plantarum Tensia cheese 1.5 months maturation1×108CFU/g
The concentration of L. plantarum Tensia cheese 4 months of ripening3×106CFU/g

The study aimed at identifying the antimicrobial activity of L. plantarum Tensia DSM 21380 against Listeria monocytogenes in the environment of the cheese.

Way # 1. There were prepared six experimental cheese like Edam laboratory size. Two control cheese had no microbial additives. Two cheese contained the pathogen Listeria monocytogenes was ATSS 13932 and two cheese contain as L. plantarum Tensia DSM 21380, and Listeria monocytogenes. Pasteurized milk was saseen 1% cheese starter culture S (CSK Food Enrichment, Holland) and the test microbes subjected rennet clotting at 32°C (cheese rennet FROMASE 2200 TL granulate). The crud was cut, heated (37-38°C), and

h is violated, pressed, dried and cured, coated and withrawals at 15°C for 30 days. The number of TENSIA fresh cheese was 105CFU/g L. monocytogenes 104CFU/u.

For microbiological analysis of cheese samples samples were aseptically taken from the center of the cheese block. To cheese samples was added 0.9% NaCl (1:9), homogenized in a blender (MiniMix, Interscience, France), serially diluted and 0.1 ml of each solution was saseen in MRS agar for detection of the number of lactobacilli. We used the method previously saturated environment Listeria chromogenic agar to determine the number of Listeria monocytogenes (Oxoid, England).

Identification of the content of fatty acids with short-chain in the experimental cheeses

10 ml of distilled water was added to the samples of cheese (10 g)was gomogenizirovannogo in a blender, removed or esterificados. Were measured by the quantitative content of acetic, propionic, butyric, walerianowo, nylon, succinic and lactic acids by gas chromatograph (HP 6890 Series GC System). Used capillary column HP-INNOWax (15 m × 0.25 mm, 0.15 μm). Program the temperature of the column: I 60°C 1 min, 10 min, and II 20°C/min to 120°C 80°C 1 min, 8 min 25°C/min to 120°C, detector (FID) at 250°C.

Used digital pH meter E (Evikon MCI, Estonia) to determine the pH of the cheeses. the pH was measured in three parts cornago block.

Count the number L. plantarum Tensia DSM 21380 increased during ripening for 2 pieces. In L. monocytogenes was not detected significant changes in the control cheese. In the test cheese containing Listeria monocytogenes and L. plantarum Tensia DSM 21380, the number of L. monocytogenes was reduced to very low values, i.e. up to 2.4 i log101 g of cheese (table 8A).

Table 8A
Survival of Listeria monocytogenes (CFU log10/g) in the experimental cheeses during maturation
Additive in the experimental cheeseThe number of L. monocytogenes CFU log10/g
Day 0DayDay 20Day 30
L. plantarum Tensia DSM 21380 L. monocytogenes3.2±0.32.9±0.22.6±0.92.4±0.6
L. monocytogenes4.2±0.64.0±0.94.8±2.24.2±0.2

The addition of L. plantarum Tensia DSM 21380 was manifested in the increase in the content of succinic acid during ripening of cheeses (table 8B).

Positive the th correlation between the number of lactic acid bacteria and acetic and succinic acids, and a negative correlation between Listeria and lactic acid was shown in cheese containing L. plantarum Tensia DSM 21380 + L. monocytogenes.

Table 8B
The content of fatty acids with short chain (g/kg), the pH value and the number of L. plantarum Tensia DSM 21380 and L. monocytogenes ATCC 13932 within 30 days of ripening experimental cheeses
ParametersCheese containing L. plantarum Tensia DSM 21380Cheese containing L. plantarum Tensia DSM 21380+Z. monocytogenesCheese containing L. monocytogenes
Fatty acids containing
the following short chain g/kg
Acetic acid0.38±0.010.3±0.060.22±0.18
Propionic acid0.11±0.000.11±0.000.03±0.06
Butyric acid0.09±0.090.03±0.010.02±0.00
Hexanoic acid0.05 is 0.04 0.03±0.010.02±0.01
Lactic acid15.37±0.5814.34±0.8814.14±2.38
Succinic acid0.93±0.200.88±0.370.36±0.11
Survival among added
different microbes log10/g and pH
L. plantarum Tensia DSM 213807.7±0.17.8±0.00-
L. monocytogenes-2.4±0.64.2±0.2
pH4.9±0.34.8±0.44.8±0.2

In the study of antimicrobial activity of Lactobacillus sp on Wednesday agar investigated Lactobacillus had no direct contact with the pathogen or strain of lactobacilli used as the target microbe against which its antagonistic activity was directed. Antagonistic activity, is registered as an inhibitor of growth of the pathogen was based on the metabolites (including various organic acids, including the UKS the ing, lactic and succinic acid), which penetrate into the midst of the agar during the growth of L. plantarum Tensia DSM 21380.

In foods, including dairy products pitsane (cheese), viability nezavisnih lactic acid bacteria and/or other pollutants raw milk is inhibited by the metabolites of lactobacilli, as well as direct contact with the strain of probiotic lactobacilli. Direct contact with the target microbes can stimulate at low pH values, caused by organic acids, the synthesis of other antimicrobial components (bacteriocins) (Aasen I.M., Moretro So, Katia T., Axelsson L. and Storro I. (2000). Influence of complex nutrients, temperture and pH on bacteriocin production by Lactobacillus sakei CCUG 42687. Appl. Environ. Biotechnol. 53, 159-166).

The profile of fatty acids with short-chain L. plantarum DSM 21380 Tensia and the existence of antimicrobial activity of strain helps to inhibit Listeria sp. in the food environment.

Support antimicrobial properties in the cheese provides suppression of alleged foodborne pathogens caused by Tensia.

The determination of the number of Lactobacillus plantarum Tensia DSM 21380 cheese way DGGE

Way. Microbial DNA was isolated from cheese using mini kit QIAamp DNA (QIAGEN) and amplified with primers 968-GC-f(GGGAACGCGAAGAACCTTA-GC), 1401-r (CGGTGTGTACAAGACCC).

The PCR products were separarely by DGGE electrophoresis in 30-60% arylamide-containing gel with use of the cation techniques Dcode™ System (Bio-Rad, Hercules, California) (Figure 3).

Determination of biogenic amines in cheese containing L. plantarum Tensia DSM 21380

Way. Cheese was extracted samples (20 ml of 50% solution of methanol was added to 10 g of cheese and kept for 1 hour at 45°C., cooled to 30°C and centrifuged, and 200 μl of the upper layer was taken for GC analysis by the modified method of Nikovici (Nakovich, L. 2003 Analysis of biogenic amines by GC/FID and GC/MS), the experiment was performed at the Department of Microbiology of Tartu University.

GC analysis was performed using chromatographic analyzer HP 6890 Series GC System with capillary column NR 1909IJ-413 (30 m × 0.32 mm; 0.25 µm). Temperature of the column: 160°C 1 min, 20°C/min 280°C 15 min; detector (FID) 350°C.

Table 9
Biogenic amines and polyamine in test-cheese containing L. plantarum Tensia DSM 21380 (industrial research)
SampleThe number of viable organisms strain contained in the cheese (CFU/g) on 3-4 day after preparationAmines (mg/kg)The number of viable organisms L. plantarum Tensia DSM 21380 in ripened cheese
TyraminePutrescine Cadaverine
L. plantarum Tensia DSM' 21380, 1. party6.5×1080.691.320106
The control cheese 1. party-2.311.820-
L. plantarum Tensia DSM 21380 2. party4.5×1062.657.460
The control cheese 2. party-5.641.840107
L. plantarum Tensia DSM 21380, 3. party2×1065.497.290108
The control cheese 3. party-000-

L. plantarum Tensia DSM 21380 verbatime the 0.69-5.49 mg tiramina of 1 kg of cheese and a smaller number of putrescine: 1.32-7.46 mg/kg

Example 2. A study of the safety of Lactobacillus plantarum Tensia DSM 21380 (experiment with NIH mice)

For recognition of probiotic strains and products containing these strains, the Estonian Council on animal health and food safety, their use must be proven.

Way. In experimental models in mice NIH 3 groups of mice fed different cheeses within 30 days (control cheese without additives and cheese containing Lactobacillus plantarum Tensia DSM 21380). The condition of the mice remained good, the use of cheese caused an increase in body mass during the experiment was not registered any changes in the condition of the fur and the digestion. Also was not observed displacement controlled strains or other microbes in the blood or organs. During morphological and histological studies of the liver and spleen did not reveal pathological changes that confirms the safety of Lactobacillus plantarum Tensia DSM 21380.

Example 3. The effect of Lactobacillus plantarum Tensia DSM 21380 contained in the cheese, the indexes of blood and intestinal microflora of healthy volunteers

In order to conduct clinical studies (randomized blind transition, placebo-controlled) was to evaluate the effect and safety of cheese containing antimicrobial Lactobacillus plantarum Tensia DSM 21380, on the intestinal microflora of healthy volunteers.

Uch is the participants and methods: participants were healthy volunteers, men and women, 12 men (M/F 5/7; 21-43 years). For exclusion from the experiment volunteers with diabetes they were determined glucose level and glycosylated hemoglobin HbAlc in the serum. Test samples of cheese contained the strain Lactobacillus plantarum Tensia DSM 21380 (number of viable organisms g CFU/g cheese). Before use, the test samples of cheese stood with Lactobacillus plantarum DSM 21380 Tensia within 30 days at 12°C. as a control was used ordinary Estonian cheese without additives. The study was randomized blind transitional placebo controlled. It began with a 3-week consumption of volunteers test samples of cheese, followed by a 2-week breeding season, after which the control cheese was used within 3 weeks. Dose of 50 g/day.

Table 10
Clinical data in healthy volunteers after consumption of probiotic cheese containing L. plantarum Tensia DSM 21380
Probiotic cheese with L.plantarum Tensia DSM 21380The control cheeseValues of P
Initial level After exposureInitial levelAfter exposure
The body mass index (kg/m2)24.1±3.624.2±3.623.8±3.523.9±3.60.625/0.399
Catolicas
some pressure (mm Hg)
112.9±10.4107.1±10.4110.3±8.3109.3±9.40.016/0.655
Diastolic
some pressure (mm Hg)
78.8±7.174.3±8.874.8±5.275.7±8.30.021/0.668

The body mass index (kg/m2): 19-25 kg/m2- normal, 26-30 kg/m2- overweight, and over 30 is obese.

Systolic and diastolic blood pressure was significantly lower after 3 weeks of consumption of cheese containing probiotic L. plantarum Tensia DSM 21380 (5×108 CFU/g × 50 g). Three-week consumption of cheese containing strain Tensia DSM 21380, not increased body mass index.

The effect of Lactobacillus plantarum Tensia DSM 21380 intestinal flora

Way. Used method of qualitative analysis microflora faeces and species of lactobacilli, developed at the Department of Microbiology of Tartu University (Mikelsaar ME, Valjaots ME, Lenzner AA. Anaerobe fuhalts - und Wandmikroflora des Magen-DarmKanals. Die Nahrung, 1984, 23, 6/7, 727-733; Sepp, E., Julge K, Vasar m, Naaber p, Bjorksten Century, Mikelsaar M, Intestinal microflora of Estonian and Swedish infants. Acta Paediatrica, 1997, 86, 956-961).

Table 11
The number of lactobacilli in the faeces of healthy volunteers (Log10CFU/g faeces)
Cheese containing L. plantarum Tensia DSM 21380The control cheeseBy P-values of paired t-test BL1 vsPRO/BL2vsPL
BLI Mean ± stdev range (median)PRO Mean ± stdev range (median)BL2 Mean ± stdev range (median)PL Mean ± stdev range (median)
Total number
in lactoba
clear Cultivation
5.1 ±1.96.7±1.05.7±1.4 4.0-ND0.025/
0-6 .3 (5.9)4.9-8.6 (6.7)8.6 (5.)
Total number
in lactoba
clear FISH
8.4±0.18.4±0.38.4±0.38.3±0.30.748/0.244
8.1-8.6(8.4)7.9-9.1 (8.3)8.0-8.8 (8.3)7.6-9.0 (8.2)
L. plantarum* range/average prevalence0-5 .3(0)0 - 8.6 (5.9)0-4 .3 (0)ND0.006/ND
3/1210/12§2/12

The total number of lactic acid bacteria and the prevalence of L. plantarum in the faeces of the volunteers had increased (p=0.006).

Table 12
The prevalence of L. plantarum as a species in the faeces of the volunteers at the beginning of the experiment (BL1), after consumption of probiotic cheese (PRO) and after recovery period (BL2)
GroupBL1PROBL2
Group 1 (n=12)3/1210/122/12
Group 2 (n=12)2/123/124/12

The growth of microorganisms of the species L. plantarum was registered (Fischer exact test, 3/12 vs 10112, 20 p=0.006) in the group who consumed cheese with L. plantarum Tensia DSM 21380.

Thus, the L. plantarum Tensia DSM has a positive effect on the microflora of the digestive tract of the person by increasing the number of healthy lactobacilli. Surprisingly, with increasing number optional heterofermentative lactobacilli (FHEL; 4.7±1.3 vs. 5.7±1.3, p=0.029) enzyme group, belongs to L. plantarum Tensia DSM 21380, was seen growth in the number of necessarily heterofermentative lactobacilli (OHOL) (4.6±1.1 vs. 5.7±1.5, p=0.014). Thus, the L. plantarum Tensia DSM 21380 greatly helps to stabilize the microflora of the digestive tract.

Molecular methods for determining the number of lactobacilli in the faeces of the volunteers (fluorescent in situ hybridization, FISH)

Way. Samples of faeces were diluted in a ratio of 1/10 in PBS with buttom solution. Microbial cells were fixed in 4% solution formaldehy the a and kept at 4°C. FISH was carried out according to the method Harmsen Lab with a sample of 158 marked dye Cy 3. Marked microbial cells were counted by fluorescence microscopy. The results of the study are presented in Table 11 together with the results of bacteriological tests.

In accordance with the results of FISH (method, which also registers the dead cells), the number of lactobacilli remained virtually unchanged.

The DGGE profile of lactic acid bacteria contained in the faeces of the volunteers who consumed cheese containing L. plantarum Tensia DSM 21380.

Way. Subsequently, the PCR products were separarely by DGGE electrophoresis in 30-60% arylamide-containing gel method Dcode™ System (Bio-Rad, Hercules, California). Gels were analyzed using the software BioNumerics 2.5 (Applied Maths, Belgium) according to the correlation of Pisoni (Heilig HG, Zoetendal EG, Vaughan HER, Marteau P, Akkermans, ADL, de Vos WM. Molecular diversity of Lactobacillus ssp. and other Lactic acid bacteria in the human intestine as determined by specific amplification of 16S ribosomal DNA. Appl Envir Environ 2002; 68: 114-123). Photographs of the gel (Figa, 4b, 4C) shows the profile of the dominant species of lactobacilli in the faeces of the volunteers in accordance with 16S gdnc amplification. Using software UMPAG it was possible to analyze the estimated matrix of similarities between different gels, i.e. to determine a significant difference (>20%) between different gels/different tests.

Table 13
Changes in lactoflora in group L. plantarum Tensia DSM 21380 in clinical trials
PeopleDay 0Day 21Day 35Day 56
1XXX
2XXX
4XXX
5XXX
7XX
8XXX
10X X
12XXXX
16XXXX
17XX
18XX
21XX

Table 13 shows that in the group of L. plantarum Tensia DSM 21380 10 people from 12 to 21 days of testing in the system congenital follow changes occurred (p<0.05).

The corresponding results were observed in the study colonies of L. plantarum bacteriological method. 4 people changes remained stable even after 2 weeks.

The content of polyamines and biogenic amines in the urine of volunteers

To estimate biogenic amines before and after eating cheese containing L. plantarum Tensia DSM 21380, as well as in the stabilization PE is iodine, used samples of morning urine, analizirovalis by the method of gas chromatography.

Way. Urine samples were derivateservlet with propylchloride to conduct GC analysis using a modified method Uganda (Ugland HG;Krough M, Rasmussen KE: Aqueousalkylchloroformate derivatization and solid-phase microextraction: determination of amphetamines in urine by capillary gas chromatography. J Chromatography In Biomed Sci Appl 1997, 701:29-38).

GC analyses were performed using chromatographic analyzer HP 6890 Series GC System (Hewlett Packard, Avondale, PA, USA)capillary column HP-5 1909IJ-433 (30 m × 0.25 mm; 0.25 µm). Temperature of the column: 150°C 1 min, 20°C/min to 280°C for 5 min; detector (FID) 250°C. the Concentration of biogenic amines were determined by 5 mmol/mol creatinine.

Table 14
The content of polyamines in the morning urine of volunteers, ypotrebljaushih L. plantarum Tensia DSM 21380 (mmol/mol creatinine)
Probiotic cheese with doaway L. plantarum Tensia DSM21380The control cheeseValues of P
BL1 Mean ± stdev range (median)PRO Mean ± stdev range (median)BL2 Mean ± stdev range (median)/td> PL Mean ± stdev range (median)Paired t-mecm BL1 vs PRO 1BL2 vs PL
Put0.110±0.1390.090±0.1200.073±0.1100.027±0.0240.496/0.275
0-0 .4670-0 .3960-0-
(0.046)(0.041)0.384 (0.037)0.055 (0.037)
acPut0.607±0.5580.567±0.4310.817±1.0270.573±0.3910.510/0.677
0-2 .1590.191-1.7580.091-3.9160.182-1.403
(0.478)(0.430)(0.550)(0.486)
DAP0.148±0.1250.056±0.0840.090±0.1630.061±0.0990.016/0.844
0-0 .205 (0)0-0 .432 (0)0-0 .246 (0)
(0.159)
acSpd0.181±0.1370.227±0.1420.197±0.1480.258±0.2210.016/0.244
0-0 .4280.053-0.4930.039-0.4950.041-0.686
(0.144)(0.182).195)(0.186)
Cad0.012±0.0260.038±0.0620.041±0.0770.015±0.0370.125/0
0-0 .084 (0)0-0 .156 (0)0-0 .248 (0)0-0 .123(0)
BL1 - initial level 1 at the beginning of the experiment, PRO - after administration of the probiotic, BL2 - initial level 2, recovery; Put putrescine, acPut - N-acetylputrescine - N-acetylpyrazine, DAP - 1.3-diaminopropane, acSpd - N8 - acutisperma the Dean, Cad - cadaverin

Consumption of probiotic cheese containing L. plantarum Tensia DSM 21380, increased the content of acetylated spermidine in the urine of volunteers by the end of the probiotic period, indicating an improvement of metabolism in the blood and tissues. The DAP concentration in urine decreased.

Correlation

It was found a decrease in systolic blood pressure associated with an increase in the number of lactobacilli and an increase of putrescine in the urine.

Security

After the experiment, the values of systemic markers of inflammation (U-CRP, ultrahosting CRP and leukocytes) has not changed and was within normal values (table 15). Change the value of IgE marker allergies were noted.

Consumption of probiotic cheese was not the cause of changes in the number of WBC (leukogram): the ratio of cells to the end of the experiment remained unchanged compared with the original values.

Table 15
Inflammatory markers at the beginning and at the end of the experiment
Probiotic cheese with L. plantarum Tensia DSM 21380The control cheese Values of PDefault values
ToAfterToAfter
U-CRP, mg/l1.1±0.61.0±0.31.4±0.91.6±1.30.3/0.9<5 mg/l
Total number
in leukocytes ×109/l
5.2±0.85.6±1.35.1±1.15.5±1.10.6/0.144-10×109/l

Consumption of probiotic cheese containing L. plantarum Tensia DSM 21380, did not cause discomfort in the abdomen (abdominal pain, gas, bloating or increased body mass index, glucose, lipids.

Thus, in healthy people eating cheese containing Lactobacillus plantarum Tensia DSM 21380, does not cause inflammation, allergic sensitisation and does not cause damage to organs.

Table 15A
Biochemical is the cue parameters of blood serum from healthy volunteers after consumption of cheese, containing L. plantarum DSM 21380
Probiotic cheeseThe control cheeseThe values of P (BL1 vs BL2, PRO vs PL)
BL1PROBL2PL
Glucose, mol/l4.5±0.74.6±0.54.6±0.64.7±0.50.922/0.289 (1.0, 0.48)
2.8-5.53.6-5.53.9-6.03.8-5.9
(4.5)(4.5)(4.5)(4.8)
Total cholesterol, mol/l4.6±0.94.6±1.14.2±0.64.5±0.90.828/0.102
3.2-6.63.1-7.23.1-5.12.8-6.3(0.003, 0.671)
(4.55)(4.4)(4.1)(4.4)
HDL-cholesterol, mol/l1.7±0.51.7±0.31.6±0.41.7±0.40.628/0.433
1.0-2.61.1-2.30.9-2.31.2-2.5(0.444, 0.623)
(1.7)(1.6)(1.7)(1.6)
LDL-cholesterol, mol/l2.7±0.82.8±1.12.6±0.72.6±0.70.296/0.827
1.4-4.31.5-5.71.5-3.71.2-4.3(0.336, 0.271)
(2.7)(2.5)(2.4)(2.5)
Triglycer
water, mol/l
1.0±0.50.9±0.41.2±0.70.978/0.140
0.5-2.80.4-2.10.5-1.80.5-2.6(0.306, 0.428)
(0.8)(1.0)(0.8)(0.9)

Consumption of cheese containing L. plantarum TENSIA DSM 21380, did not lead to undesirable changes in the content of glucose in serum or in parameters of lipid metabolism (table 15A). Values of total cholesterol and fractions of cholesterol (HDL-cholesterol, LDL-cholesterol and triglycerides) remained within normal limits.

Example 4. The effect of Lactobacillus plantarum DSM 21380 contained in the cheese, on the blood of older healthy people

During clinical studies (randomized blind transition, placebo-controlled) evaluated the safety and effect of cheese containing Lactobacillus plantarum DSM 21380, blood counts elderly healthy volunteers.

Participants and methods. The experiment participants were healthy volunteers, men and women, 21 men (M and W, 2/19, 61-84 years). For exclusion from the experiment volunteers with diabetes was determined from oven glucose and glycosylated hemoglobin HbAlc in the serum. Test samples of cheese contained the strain Lactobacillus plantarum Tensia DSM 21380 (number of viable organisms 2×107CFU/g cheese). Before use, the test samples of cheese stood with Lactobacillus plantarum DSM 21380 Tensia within 30 days at 12°C. as a control was used ordinary Estonian cheese without additives. The study was randomized blind transitional placebo controlled. It began with a 3-week consumption of volunteers test samples of cheese, followed by a 2-week breeding season, after which the control cheese was used within 3 weeks. Dose of 50 g/day.

27.6±4.1
Table 16
Clinical characteristics of healthy volunteers after consumption of cheese containing probiotic L. plantarum Tensia DSM 21380
Probiotic cheese with L. plantarum Tensia DSM 21380The control cheeseValues of P
Initial levelAfter exposureInitial levelAfter exposure
The body mass index (kg/m2)27.5±4.227.5±4.027.6±4.20.723/0.793
Systolic pressure (mm Hg)138.1±16.6132.2±16.2138.7±21.4135.2±21.10.038/0.185
Diastolic
some pressure (mm RT. Art.)
77.2±7.773.1±8.076.4±8.974.8±9.20.004/0.246
The body mass index (kg/m2): 19-25 kg/m2- normal, 26-30 kg/m2- overweight, and over 30 is obese.

In elderly volunteers noted a decrease in blood pressure (systolic and diastolic) after 3 weeks of eating cheese with probiotic L. plantarum Tensia DSM 21380 (2×107CFU/g × 50 g).

At the same time, the consumption of cheese with a relatively high fat diet did not lead to increased body mass index in older volunteers (table 16).

Security

Eating cheese with probiotic L. plantarum DSM 21380, the elderly did not cause discomfort in the abdomen (abdominal pain, gazoo is adowanie, flatulence). After the experiment, the values of systemic markers of inflammation (U-CRP, leukocytes) has not changed and was within normal values (table 17).

Table 17
Inflammatory markers in the blood of healthy elderly volunteers at the beginning and at the end of the experiment
Cheese containing probiotic L. plantarum Tensia DSM 21380The control cheeseValues of PDefault values
ToAfterToAfter
U-CRP, mg/L0.13/0.810.13/0.810.13/0.80.13/0.810.13/0.81< 5mg/L
Total number
in lenoci
comrade ×109/l
5.1±1.34.9±1.35.0±1.65.5±1.10.33/0.33 4-10×109/l

There was also no marked deviations in the values of IgE marker allergies or renal or hepatic markers (serum creatinine, blood, albumin, alanintransferzy (ALAT), aspartate aminotransferase (ASAT)). When comparing the level of cholesterol in the period of consumption of cheese in period with placebo, there was a significant decrease in this indicator after the consumption of cheese containing L. plantarum DSM 21380.

The increase of glucose in the serum of up to 0.3 after consumption of probiotic cheese was undesirable effect, but in comparison with the period of placebo, the change was not statistically significant (table 18) and remained within normal values.

Table 18
Biochemical parameters of blood serum from healthy elderly volunteers after consumption of cheese containing L. plantarum DSM 21380
Probiotic cheeseThe control cheeseThe values of P (BL1 vsBL2, PROvsPL)
BL1PROBL2PL
Glucose, mmol/l5.1±0.55.4±0.55.3±0.55.4±0.40.036/0.144
(0.212, 0.757)
Total cholesterol, mmol/l5.7±0.85.6±0.85.9±0.95.7±0.80.343/0.198
(0.044, 0.087)
HDL-cholesterol, mmol/l1.7±0.41.6±0.41.7±0.41.7±0.50.411/0.514
(0.073, 0.118)
LDL-cholesterol, mmol/l3.9±0.83.8±0.74.1±0.93.8±0.70.557/0.052
(0.075, 0.9187)
Triglycer
dy, mmol/l
1.1±0.61.1±0.6 1.2±0.51.1±0.50.380/0.394
(0.411, 0.097)

Thus, the consumption of cheese containing Lactobacillus plantarum Tensia DSM 21380, does not cause inflammation, allergic sensitization and does not cause damage to organs.

Table 18A
Biogenic amines older volunteers in a morning urine (nmol/mol moron) during the study after the consumption of cheese containing L. plantarum Tensia DSM 21380
Probiotic treatmentThe monitoring periodValues of P
BL1
Value ± the range of student (average)
PRO
Value ± the range of student (average)
BL2
Value ± the range of student (average)
PL
Value ± the range of student (average)
KaDeWe
Rin
0000NA/td>
Tyramine0.006±0.0280.010±0.0440.061±0.2740.001±0.0051.0/0.37
0-0 .129 (0)0-0 .201 (0)0-1 .256 (0)0-0 .025 (0)(1.0, 1.0)
Histamine0000NA
BL1 - 1 basis, with volunteers, PRO - after probiotic treatment, BL 2 - basis 2, recovery, PL - after treatment placebo

Consumption of cheese containing L. plantarum TENSIA, did not cause growth in the concentration of biogenic amines (cadaverine, histamine, tiramina) in the urine of elderly volunteers (table 18A).

Consumption of cheese containing L. plantarum TENSIA, in a daily dose of 1.5×108CFU increased the value of cultured lactic acid bacteria (5,2 log10CFU/g when volunteers vs 6,9 log10CFU/g after 3 weeks of probiotic treatment, p=0.012) (table 18B).

Table 18B
The number of lactobacilli (value ± coefficient Stuent/range/mean) in the feces of older volunteers in the study after the consumption of cheese containing L. plantarum Tensia DSM 21380
Probiotic treatmentThe monitoring periodA value of P
BL1 Is ± range of student (average)PRO Value ± the range of student (average)BL2 Is ± range of student (average)PL Value ± the range of student (average)
Total number
in lactobacilli CFU/g
5.2±2.76.9±1.45.4±2.96.1±2.00.012/0.252
0-8 .3 (6.3)4.3-10.0 (6.3)0-9 .7 (5.7)0-9 .1(0.850, 0.245)
(6.5)
L. plantarum3.1±3.25.2 ±2.91.1±3.03.2±3.30.079/0.119
0-8 .3 (3.8)0-8 .3 (6.2)0-9 .6 (0.0)0-9 .1(0.083, 0.222)
(3.5)
L. plantarum TENSIA*-5.3±2.9ND
0-8 .3(6.3)
* Identification of PCR in real time according to a certain sequence of strain L. plantarum Tensia

Probiotic treatment has increased the prevalence of L. plantarum in the faeces (10/21 against 17/21 people), but the change was minor. However, the increase in the number of L. plantarum was in negative correlation with the decrease sistolicheskogo blood pressure (r=-0.463, p=0.046) during treatment with probiotic cheese.

L. plantarum TENSIA was detected in 81% of study participants by molecular methods in samples of faeces after probiotic treatment. However, after a 2-week washout period strain was not detected in the faeces of the participants by the traditional method of cultivation, combined with RAPD-PCR.

After a 3-week consumption of cheese containing L. plantarum TENSIA, were not found significant changes in the content of polyamines in the morning urine of volunteers, although there was a trend to higher values of putrescine (table 18C). However, the decrease in systolic blood pressure was correlated with the increase of putrescine (r=-0.448, p=0.042).

Table 18C
Polyamine in elderly volunteers in a morning urine (nmol/mol creatinine) during the study after the consumption of cheese, containing the his L. plantarum Tensia DSM 21380
Probiotic treatmentThe monitoring period
BL1
Value ± the range of student (average)
PRO
Value ± the range of student (average)
BL2
Value ± the range of student (average)
PL
Value ± the range of student (average)
The values of R BL1 vs PRO/BL2 vs PL (BL1 vs BL2, PRO vs PL)
Put0.87±0.780.94±0.761.63±2.571.16±1.620.452/0.137
0-3 .300.071-2.360.233-12.430.14-7.81(0.065, 0.759)
(0.645)(0.565)(0.928)(0.717)
acPut2.58±5.721.96±2.531.48±1.893.50±6.48 0.609/0.374
0.17-26.00.23-10.20.15-7.710.13-23.70(0.973, 0.633)
(0.82)(1.101)(0.64)(0.72)
acSpd0.02±0.100.02±0.100.06±0.280.06±0.271.0/1.0
0-0 .47 (0)0-0 .47 (0)0-1 .30 (0)0-1 .24 (0)(1.0, 1.0)
BL1 - 1 basis, with volunteers, PRO - after probiotic treatment, BL 2 - basis 2, recovery, PL - after treatment with placebo, Put putrescine, acPut - N-acetylpyrazine, acSpd - N8-acutisperma

Conclusion. The effect of lowering blood pressure when consumed cheese containing L. plantarum Tensia DSM 21380, may have potential application for monitoring blood pressure in the elderly.

Example 5. Effect of yogurt containing Lactobacillus plantarum Tensia DSM 21380, on the parameters of blood serum and intestinal microflora of healthy volunteers

Task clinches the th studies (randomized cross-placebo controlled double-blind study) was to determine the safety and effect of yogurt, containing Lactobacillus plantarum Tensia DSM 21380, on the parameters of blood serum and intestinal microflora of healthy volunteers (international registration number of clinical trials ISRCTN68198472).

Objects and methods. Participants were 25 healthy volunteers of both sexes (M/F 9/16; 31.4±10.0 years). Glucose and Glucose and glycosylated hemoglobin (HbAlc) was detected from serum to avoid possible latent diabetes.

The test yoghurt contained a strain ofLactobacillus plantarumTensia DSM 21380 (5×106-107microbial cells/ml). The probiotic yogurt without additives served as the control.

Survival of Lactobacillus plantarum Tensia DSM 21380 in yogurt and increase the metabolic activity of Lactobacillus plantarum Tensia DSM 21380 in yogurt and shelf life when added to milk for yogurt in dried form.

The test yoghurt was prepared using freeze-dried culture of Lactobacillus plantarum Tensia as an auxiliary additive probiotic dose of 1 g/1 ton of milk. Yogurt was made traditionally. The yogurt was Packed in the Cup 150 g and stored at a temperature of +4°C. the survival of the probiotic strain Lactobacillus plantarum Tensia was assessed during the shelf life of yogurt.

Lactobacillus plantarum Tensia (CFU/g)
Lyophile the new leaven 1×1011
Day 7 after manufacturing1×106
Day 22 after manufacturing2×106
Day 26 after manufacturing2×106

The study began with a 3-week consumption of the test yoghurt. After a washout period, the study participants consumed the control yoghurt daily for 3 weeks at a dose of 108-5×109microbial cells.

Security

After completion of the study important human systematic markers of inflammation (ultracentrally C-reactive protein and total number of leukocytes) have not changed and were within the normal range (table 19). No was also observed anomalies in important allergic marker IgE.

Table 19
Markers of inflammation before and after studies
Probiotic yogurt containing L. plantarum TensiaThe control yogurtThe values of R basis vs. Samples of otecheskii basis vs. The control yogurtDefault values
ToAfterToAfter
U-CRP, mg/l0.7±1.01.1±1.31.2±1.51.2±1.40.782/0.306<5 mg/L
The total number of cells ×10%5.8±1.26.2±1.36.0±1.46.2±1.20.101/0.4114-10×109/L

Three-week intake of probiotic yogurt does not have any negative impact on parameters of lipid metabolism (table 20). Values of total cholesterol and holestirinovye fractions (HDL, LDL-cholesterol and triglycerides) remained within normal limits.

Table 20
Biochemical parameters of blood serum from healthy volunteers after
consumption of yogurt containing L. plantarum Tensia DSM 21380
Probiotic yogurtThe control yogurtValues of P
BL1PROBL2PL(L1 vs BL2, PRO vs PL)
Glucose, mmol/l5.1±0.55.4±0.55.3±0.55.4±0.40.036/0.144
(0.212,0.757)
Total cholesterol, mmol/l4.7±0.74.8±0.75.0±0.64.7±0.,60.315/0.020
(0.018, 0.271
HDL-cholesterol, mmol/l5.0±1.1 5.0±1.25.1±1.45.0±1.00.808/0.411
(0.676,0.411)
LDL-cholesterol, mmol/l1.7±0.31.6±0.41.6±0.41.6±0.40.158/0.432
(0.412, 0.747)
Triglycerides, mmol/l3.1±1.13.2±1.03.2±1.23.1±1.00.396/0.230
(0.449; 0.170)
BL1 - in the beginning of the study, PRO - after consumption of probiotic yogurt, BL2 - recovery

After the pot is ellenia probiotic yogurt was observed a slight increase of glucose in blood serum (from 5.1 to 5.4 p value = 0036), which, however, remained within the normal range (3.3 to 5.5 mmol/l). Therefore, we can conclude that yogurt containing Lactobacillus plantarum Tensia DSM 21380, does not lead to systemic inflammation, increased allergic sensitivity or weakening of the main bodies.

Example 6. Preparation of lyophilized powderLactobacillus plantarumTensia DSM 21380.

Method.Dried powder of L.plantarumTensia DSM 21380 was obtained in the following way. The strain L.plantarumTensia DSM 21380 sowed from the source culture in the bioreactor Bioflo 415 (New Brunswick Scientific) and were cultured at 37°C for 24 hours in an environment MRS. The pH value of the medium was maintained at 6.25. When the bacterial culture reached a maximum mass density, the content of the reactor was pumped into a high-speed laboratory centrifuge Z 41 (Carl Padberg Zentrifugenbau GmbH). The biomass was separated from the medium at 20,000 rpm, removed under sterile conditions from the cylinder centrifuge and mixed with cryoprotectants (2% skim milk and 5% sucrose). Biomass with cryoprotectant was dried (installation of freeze drying Christ Delta 2-24 LSC, John Morris Scientific) for 24 to 48 hours. Dried biomass was removed under sterile conditions from a ditch and crushed into powder. Freeze-dried bacterial culture was Packed in clean, closed containers and left when stored on the e at temperatures from -18°C to 25°C. In order to obtain the desired number of viable cells of dietary lactose or microcrystalline cellulose were added as filler.

Example 7. The effect of dietary supplements containing Lactobacillus plantarum Tensia DSM 21380, indexes of blood and intestinal microflora of healthy volunteers.

Randomized placebo controlled parallel study (international registration number of clinical studies ISRCTN24502121) was conducted to evaluate the safety of food supplements with Lactobacillus plantarum Tensia DSM 21380. The study was conducted on 35 human volunteers of both sexes, consuming probiotic dietary Supplement (daily dose Tensia 1010CFU) or placebo for 4 weeks. Consumption of probiotic dietary Supplement containing a strain of L. plantarum Tensia was well tolerated by the volunteers, as in the process study found no adverse gastrointestinal effects (there were no gastrointestinal discomfort like abdominal pain, flatulence, or bloating, no negative changes in the values of systemic markers of inflammation, there was no allergic sensitization, there was no damage to the main bodies, there was also no undesirable changes in the level of glucose in serum or lipid metabolism). Controlled the initial strain L. plantarum Tensia was revealed by survey participants by RAPD-PCR in samples of faeces after probiotic treatment in the range of 4.0-6.0×1010CFU.

1. Isolated microorganism strain Lactobacillus plantarum Tensia DSM 21380 generating conjugate linolevuyu acid (CLA), hydrogen peroxide (H2O2), nitric monoxide (NO), which has antioxidant activity and genes plnE, plnF, plnJ, plnK, coding plantaricin.

2. The microorganism strain according to claim 1 in lyophilized form.

3. Said strain of microorganism according to any one of claims 1 and 2 for the preparation of antimicrobial and antihypertensive probiotic.

4. Said strain of microorganism according to any one of claims 1 and 2 to achieve a dominant position among intestinal lactobacilli in the gastrointestinal tract after consumption of a dairy product prepared by using the above-mentioned microorganism.

5. Said strain of microorganism according to any one of claims 1 and 2 to increase the turnover of polyamines in the body.

6. Said strain of microorganism according to any one of claims 1 and 2 for the preparation of drugs that lower blood pressure.

7. Said strain of microorganism according to any one of claims 1 and 2 to extend the shelf life of dairy products.

8. the label mentioned microorganism strain according to any one of claims 1 and 2 to suppress contaminating microflora in dairy products, where called microbes are nezavisne Lactobacillus and/or pathogens originating from raw milk and/or pathogens, periodically polluting food after cooking.

9. Said strain of microorganism of claim 8, and dairy product is a fermented milk product, cheeses, cottage cheese, cheese, yogurt, ice cream, butter, cheese.

10. Dairy product containing the microorganism according to any one of claims 1 and 2.

11. Dairy product of claim 10, and dairy product is a fermented milk product, cheese, pressed cottage cheese, cottage cheese, yogurt, ice cream, butter, processed cheese.

12. A composition comprising a microorganism according to any one of claims 1 and 2 for the preparation of antimicrobial and antihypertensive dairy product or medication lowering blood pressure.



 

Same patents:

FIELD: biotechnologies.

SUBSTANCE: method is proposed to detect pathogenic strains and isolates of bacteria Pasteurella multocida with the help of PCR. The method may be used in veterinary microbiology for diagnostics of pasteurellosis of farm animals. The method includes isolation of cultures of microorganisms from a pathological material on artificial nutrient media, completion of PCR with synthetic oligonucleotide primers SEQ ID NO:1 - 5' atgatgtcggcatgaatttctcagc 3' and SEQ ID NO:2 - 5' aacatagccagcgccagcaatgt 3'. The product of amplification is transferred to gel, and the completed reaction is assessed. To set PCR, a suspension of microorganisms is used on sterile distilled water without isolation of DNA. PCR is performed in 1 round. In case of positive reaction, a fragment is synthesised, corresponding to the size of 534 bps.

EFFECT: invention makes it possible to efficiently detect pathogenic strains and isolates of a bacteria Pasteurella multocida.

3 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: method includes biotransformation of phenylmethylsulfide with the help of cells Gordonia terrae VKPM AS-1897, which are free or immobilised in cryogel matrix on the basis of polyvinyl alcohol, and the process is carried out in a medium containing n- hexadecane or glycerin, accordingly.

EFFECT: invention makes it possible to increase chemical yield and optical purity of (R)-phenylmethyl sulfoxide and to redyce concentrations of n-hexadecane.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: chemistry.

SUBSTANCE: invention relates to field of biochemistry. Sewage water with increased content of phenol compounds 300 - 1200 mg/l, content of sulfide-ions to 64.1 mg/l and content of sulfate-ions to 401.4 mg/l and 1843.7 mg/l in case of sparging with air, is passed through column type reactor. Reactor contains adsorbent - petroleum coke, onto which cells of strain of aerobic bacteria Pseudomonas putida 131 All-Russian collection of industrial microorganisms B-10894 are immobilised. Orthophosphoric acid or its salts are preliminarily dissolved in sewage water as biogenic additive in order to obtain pH 7-8, optimal for phenol destruction by bacteria strain.

EFFECT: invention ensures increased quality of purification of sewage water, which contain sulfide-ions and sulfate-ions, from phenol compounds to 0-50 mg/l.

1 dwg, 8 tbl, 7 ex

FIELD: biotechnologies.

SUBSTANCE: invention may be used to extract carotenoids, in particular, deinoxanthine, which is used to develop new antioxidant and radioprotector preparations to increase adaptation capabilities of humans and aminals, prevention and treatment of diseases. The method provides for extraction of carotenoids from the bacterial mass Deinococcus radiodurans by the mixture acetone : ethanol (at the 1:1 ratio). Separation of carotenoids with extraction of deinoxanthine on preparative columns of a liquid low-pressure chromatograph, where the sorbent is hydroxyapatite, and the eluent - ethanol.

EFFECT: invention makes it possible to increase quantity and quality of extracted deinoxanthine.

2 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: invention relates to the field of microbiology and genetic engineering. A new yeast strain Yarrowia lipolytica RNCIM Y-3600 has been produced - a producer of cell-bound lipase.

EFFECT: higher activity.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Trichoderma harzianum Rifai, having L-lysine-alpha-oxidase activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number RNCIM F-180 and may be used in agricultural biotechnology and plant growing.

EFFECT: invention makes it possible to reduce losses of decorative and vegetable crops.

2 ex

FIELD: agriculture.

SUBSTANCE: method to stimulate growth and to protect small-fruit crops against diseases caused fungic pathogens includes treatment of plants with a biopreparation in a liquid form by soaking roots of seedlings prior to planting, or their sprinkling after planting, or sprinkling of plants in the period of vegetation and fruiting, or sprinkling of soil around plants with its further soaking with water. The biopreparation is a mixture of strains of bacteria B. subtilis VKPM B-10641, B. amyloliquefaciens VLPM B-10642, B. licheniformis VKPM B-10561 and B. licheniformis VKPM B-10562 or a mixture of strains of bacteria B. subtilis VKPM B-10641, B. amyloliquefaciens VKPM B-10642 and B. licheniformis VKPM B-10562 with a titre of each strain of not less than 105 CFU/ml in the form of a water suspension.

EFFECT: invention provides for higher protection of small-fruit crops against diseases caused by fungic pathogens, due to use of a mixture of strains of different types of bacteria of Bacillus type, having higher antagonistic activity, and also provision of the possibility of stimulation of growth of small-fruit crops.

5 cl, 10 tbl, 8 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Lactobacillus gallinarum I-12, having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPM V - 10134 and may be used in production, for instance, of such cultured milk foods, as kefir, acidophilic milk, acidophilic-yeast milk.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

FIELD: biotechnology.

SUBSTANCE: method of increasing the productivity of the bacteria E.coli lies in preparation of a suspension of microorganisms, stirring it in the process of cultivation in the presence of a magnetic magnesium isotope sulfate 25Mg in an amount of 2.2 mmol/l.

EFFECT: increased stimulation of cell growth of bacteria Ecoli.

4 dwg, 4 tbl

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-27 with high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10091 and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnology.

SUBSTANCE: strain of Enterococcus hirae "И"-29 with high antagonistic activity, deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under registration number of RNCIM B-10088, and can be used in production, for example, of fermented milk products such as kefir, cottage cheese or fermented baked milk.

EFFECT: invention enables to obtain a strain with high antagonistic activity and a high rate of milk fermentation.

3 ex

FIELD: biotechnologies.

SUBSTANCE: invention may be used to extract carotenoids, in particular, deinoxanthine, which is used to develop new antioxidant and radioprotector preparations to increase adaptation capabilities of humans and aminals, prevention and treatment of diseases. The method provides for extraction of carotenoids from the bacterial mass Deinococcus radiodurans by the mixture acetone : ethanol (at the 1:1 ratio). Separation of carotenoids with extraction of deinoxanthine on preparative columns of a liquid low-pressure chromatograph, where the sorbent is hydroxyapatite, and the eluent - ethanol.

EFFECT: invention makes it possible to increase quantity and quality of extracted deinoxanthine.

2 dwg, 1 tbl, 4 ex

FIELD: biotechnologies.

SUBSTANCE: probiotic lacto-amylovorin is produced by means of depth growth of the strain Lactobacillus amylovorus RNCIM B-6253 on the liquid nutrient medium, which contains the following: corn extract - 10 ± 0.01 ml, lactose - 20 ± 0.005 g, chemically deposited chalk - 0.5 ± 0.01 g, triple-substituted citric-acid sodium - 7.5 ± 0.05 g, 3-water acetous sodium - 2 ± 0.01 g, iron sulfate - 0.1± 0.001 g, 5-water manganese sulfate - 0.16 ± 0.002 g, hydrolysate of dry nonfat milk - up to l. Subsequent extraction of the target product in liquid condition or in the form of a dry powder is carried out with preliminary addition of a stabiliser to a cultural liquid or to a protective medium used when producing the probiotic in the form of the dry powder. The stabiliser is selected from: sodium metabisulfite, sodium hydrosulfite and ascorbic acid.

EFFECT: invention provides for stable production of a probiotic with high values of a titre of antimicrobial bodies not only in a cultural liquid, but also after its treatment required for production of different pharmaceutical forms of a preparation.

3 cl, 2 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: bacteria strain Planomicrobium koreense 78k, is extracted from soils and provides for production of site-specific endonuclease PkrI, which recognises and splits both chains of nucleotide sequence of DNA, which contains three or four C5-methylcytosine bases in recognition site 5'-GCNAGC-3' with formation of a single-nucleotide 3'-protruding end. The strain is deposited in the Russian National Collection of Industrial Microorganisms FGUP GosNIIgenetika under the number B-10627. The provided strain may be used for extraction of the new site-specific endonuclease PkrI, which may be applied in detection and splitting of methylated DNA sections.

EFFECT: production of site-specific endonuclease PkrI.

3 dwg, 3 ex

FIELD: biotechnologies.

SUBSTANCE: invention represents a bacteria strain Microbacterium testaceum 17B, deposited under the number RNCIM B-10628 in the Russian National Collection of Industrial Microorganisms FGUP GosNIIgenetika, being the producent of the site-specific endonuclease MteI. The invention makes it possible to produce the site-specific endonuclease, which recognises and splits both chains of the nucleotide DNA sequence 5'-G(m5C)G(m5C)NG(m5C)G(m5C)-3'/3'-(m5C)G(m5C)GN(m5C)G(m5C)G-5', where m5C-5-methylcytosine, with production of the single-nucleotide 5'-protruding end, and does not split the methylated DNA sequence 5'-G(m5C)NG(m5C)-3'/3'-(m5C)GN(m5C)G-5'.

EFFECT: method improvement.

2 dwg, 1 tbl, 3 ex

FIELD: biotechnologies.

SUBSTANCE: strain Enterococcus hirae BC - 37 having high antagonistic activity is deposited in the Russian National Collection of Industrial Microorganisms (RNCIM) under the registration number VKPMV-10090 and may be used, for instance, in production of such cultured milk foods as kefir, cottage cheese or ryazhenka.

EFFECT: invention makes it possible to produce a strain having high antagonistic activity and high speed of milk turning sour.

3 ex

Up!