Epigenetic regulatory complex of gene expression control

FIELD: medicine.

SUBSTANCE: recovered polypeptide complex is involved in epigenetic gene expression control in mammals. The complex contains the protein Blimpl or its homologue PRD1 having site-specific DNA-binding activity, and the protein PRMT5.

EFFECT: complex is able to regulate gene expression in cells, particularly in stem cells in mammals that is ensured by regulated R3 methylation in C-terminal regions of the histones H2A and H4.

12 cl, 8 dwg, 1 tbl, 5 ex

 

The SCOPE TO WHICH the INVENTION RELATES.

This invention relates to the field of epigenetic regulation of gene expression. In particular, this invention relates to compositions and methods that include histone-methyltransferase activity, which is aimed at the control of gene expression in vivo and in vitro.

BACKGROUND of INVENTION

Epigenetics refers to the transmission of information from cell or multicellular organism to its or his descendants in the absence of encoding this information in the nucleotide sequence of the genes. Epigenetic control is usually accomplished through chemical modification of the structure of DNA or chromatin. Gene expression can be slow, for example, methylation and acetylation of histones that are associated with genomic DNA. Methylation and histone acetylation, as a rule, are in the "tail" of the histone domain, which is located on the surface and has a resultant positive charge due to the prevalence of such amino acid residues like arginine (R) and lysine (K). Chemical modification of the "tail" of histone slows down the enzyme with the histone-methyltransferase activity (HMTase) and histone-acetyltransferase activity (HAT).

Epigenetic modification can occur at different periods of the normal development of the organism is, and during the transformation of normal cells into cancer cells. Such modifications often lead to the silencing or activation of certain genes. Documentary evidence convincingly confirms that cancer most cancer cells have abnormal epigenetic imprint DNA (Feinberg AP & Vogelstein B, (1983) Nature 1(5895): 89-92).

Stem cells are cells with the potential to intensive self-renewal and differentiation of precursor cells. Stem cells themselves are also a possible cause (possible source) of cancer. Stem cells can have a long life, during which they acquire genetic mutations and epigenetic modifications that may increase the propensity for malignant neoplasm. Assume that because stem cells occupy a niche that is so delicately balanced between participation in competitive proliferation and differentiation, a small but fundamental epigenetic changes can dramatically shift the balance towards the phenotype of cancer stem cells. Understanding why and how regulated epigenetic modifications is crucial for the understanding, detection and treatment of cancer and, in particular, the treatment (processing) of p is the same stem cells. Actually, it is believed that one of the features of recurrent and aggressive cancers, which are difficult to treat, is that tumors may contain cancer stem cells that do not respond to conventional medicines.

The transfer of a somatic cell (SCNT) is used for animal husbandry (for cloning or stem cell therapy), bioprospect proteins and for modeling disease (Wilmut I, Beaujean N, de Sousa PA, Dinnyes A, King TJ, Paterson LA, Wells DN, Young LE. (2002) Nature. Oct 10; 419(6907): 583-6). One of the problems associated with the efficiency and effectiveness of attempts SCNT, is that the genome of somatic cells contains intense and stable epigenetic marks that could prevent the successful reprogramming. In addition, the recipient egg may contain factors that cause epigenetic effects, which may also contribute to the failure of the process. Therefore, it is necessary to create compositions and methods for increasing the efficiency of SCNT and, therefore, those applications in Bioprocessing, which are simplified using this operation.

Specification of primordial (primary germ) germ cell (PCC, PGC) mouse provides an attractive experimental model to analyze the impact of epigenetic modifications in vivo. Pop is the isolation cells"founders" (special cells, founder-cells), about 45 PGC (PCC) first find E in mouse embryos (Ginsburg, M., Snow, MN. & McLaren, A. (1990) Development 110, 521-8). Then these PGC migrate and enter the genital tubercles of E ahead, where it continues further extensive epigenetic programming of embryonic cells. To E germ cells are profeso meiosis.

Significant epigenetic modifications occur immediately after the PGC specification, including methylation and acetylation tails of histones using HMTase (Nmcas) and HAT, respectively (Surani et al., 2004 (CSH Symposium); Seki et al., 2004; Lachner, M., O'sullivan, R.J. & Jenuwein, T. (2003) J Cell Sci 116, 2117-24, and Vaquero, A., Loyola, A. & Reinberg, D. (2003) Sci Aging Knowledge Environ 2003, RE4). Among the candidate genes putatively involved in the regulation of these epigenetic changes in PGC, there are HMTase (Nmtz), which belong to the family of proteins with conservative SET/PR domain.

Therefore, there is a need for reagents and methods to improve the control of epigenetic regulatory mechanisms in the cell. In particular, compositions (formulations) and methods, allowing better control the expression of genes in such a way as to affect the decision of the fate of cells in stem cells and in cancer cells.

The INVENTION

The first aspect of the invention includes the selected polypeptide complex, containing at least the least the first domain having a site - specific DNA-binding activity, and at least a second domain having the arginine-methyltransferase activity, and a second domain capable of metilirovanie arginine residue localized in the tail region of histone H2A.

In a specific embodiment of the invention the second domain is an arginine-methyltransferase activity, which provides symmetric NG,N G-demethylation arginine residue, properly localized at the position 3 in the tail region of histone H2A (H2AR3). Optionally, a second domain capable of, in addition to metilirovanie arginine residue localized in the tail of histone H4 arginine residue, properly localized at the position 3 in the tail region of histone H4 (H4R3). In one embodiment of the invention arginine-methyltransferase activity is contained in Prmt5 arginine-methyltransferase domain or its derivative, or its homologue.

According to the invention, the first domain can specifically be directed to linking with one or more consensus sequences in the genomic DNA of the mammal, which are involved in the control of gene expression. Usually, but not exclusively, such sites may be located in non-coding promoter regions, untranslated regions or introns. In a specific embodiment, the image is etenia DNA-binding domain according to the invention are able to bind with the binding site of type PRDI/Blimp1, having a consensus sequence of the four motives GGGAAAG, two are located in the 5' promoter region of the target gene, and two are located 3' from the site of the start of transcription. Accordingly, the DNA-binding domain contains Blimp1 protein, DNA-binding site of the polypeptide PRDI/Blimp1 or its homolog or a derivative thereof.

The second aspect of the invention includes nucleotide expressing vector design, which is applicable for the induction of expression of the polypeptide complex in a cell of the mammal, and the vector contains:

one or more coding sequences that are functionally associated with the promoter sequence,

where one or more coding sequences encode at least a first polypeptide domain that has a site-specific DNA-binding activity and at least a second polypeptide domain that has an arginine-methyltransferase activity, with the first domain specifically aimed at linking with one or more consensus sequences in the genomic DNA of the mammal, which are involved in the control of gene expression, and the second domain is an arginine-methyltransferase activity, which provides symmetric NG,N G-demethylation arginine residue localized in the polypeptide substrate.

According to a special variant of the invention is polypeptidyl substrate is a histone. Optionally, a second polypeptide domain capable of metilirovanie arginine residue located in position 3 in the "tail" region of histone H2A (H2AR3), as well as arginine residue located in the "tail" region of the histone H4.

Suitable expressing vectors include plasmids, Comedy, viral vectors and artificial chromosomes, such as YAC. Optionally, the promoter sequence, you can choose either a constitutive promoter or from an inducible promoter. Suitable inducible promoters include the well-described Tet - or Tamoxifen-regulated system. Alternative systems may include promoters that are sensitive to thermal shock.

In one embodiment of the invention expressing the vector contains an expression cassette in which the first coding sequence encodes a first polypeptide domain and the second coding sequence encodes a second polypeptide domain. Optionally, the first coding sequence encodes a polypeptide PRDI/Blimp1, and the second coding sequence encodes a polypeptide Prmt5. In particular embodiments of the invention can be preferably, the first and second coding sequences were separated by one or more intermediate sequences. One or more intermediate sequences can the t to contain, at least one portion of the inner landing ribosomes (IRES) in order to promote bicistronic expression of the first and second coding sequences in the cell. Expressing the vectors according to the invention may also contain one or more nucleotide sequences that encode a polypeptide selected from: a selective marker; marker of resistance to antibiotics; and gene-reporter.

The third aspect of the invention includes a method of controlling gene expression in a cell of a mammal, which consists in inducing the formation in the cell polypeptide complex containing at least a first domain having a site-specific DNA-binding activity, and at least a second domain having the arginine-methyltransferase activity, and a second domain capable of metilirovanie arginine residue localized in the "tail" region of histone H2A. In a special embodiment of the invention the formation of polypeptide complex is induced in the cell by induction of expression of the polypeptide PRDI/Blimp1, or its homologue or a derivative thereof, in the cell.

In a special embodiment of the invention the expression of the polypeptide PRDI/Blimp1 is induced in the cell via transfection of cells expressing the vector that encodes the polypeptide Blimp1, or its derivative or homolog. Optionally, the expression of the polypeptide PRDI/Blimp1 Indus is regulated in the cell via transfection of cells expressing vector, previously described. Typically, the cell of the mammal is a human cell tissue or cell line. In a special embodiment of the invention the mammal cells is a tumor or cancer cell or cell line. The method according to this aspect of the invention can be performed in vitro or in vivo.

In a specific embodiment of the invention, control of gene expression is the control of expression of one or more genes selected from the group consisting of: p-Mus; Dhx38; Pcdh7; Q8C9T7; Xylt1; DnaH1; Baip2; Nek7; Dusp2; ENSMUSG00000027041; Sirt4; and Blimp1. Induction of polypeptide complex in the cell can lead to a decrease in the expression of one or more of these genes.

A fourth aspect of the invention includes a method of promoting the self-renewal and inhibiting differentiation of a stem cell, which consists in inhibition of complex formation Blimp1/Prmt5 in stem cell. Optionally, a stem cell is a stem cell of a mammal, preferably human stem cells. In particular embodiments of the invention stem cells are selected from the group consisting of adult stem cells; stem cell precursor; and pluripotent stem cells. It is clear that the invention is in no way relates to reproductive human cloning or manipulation of the human is mi embryos and their use for reproductive cloning of human beings.

In a specific embodiment of this aspect of the invention, the inhibition of complex formation Blimp1/Prmt5 in stem cell is carried out by exposure of the cells with the compound, inhibiting (inhibitor) Blimp1, connection, inhibiting Prmt5, and/or a compound inhibiting complex Blimp1/Prmt5. Preferably, the inhibitor can be selected from low molecular weight inhibitor; molecules siPHK (small interfering RNA), which is associated with Blimp1 mRNA or Prmt5; of antisense oligonucleotide that binds to mRNA Blimp1 or Prmt5; and dominant-negative variant polypeptide Blimp1 or Prmt5.

Another aspect of the invention includes a method of monitoring the localization of Prmt5 in the cell, usually the localization of endogenous Prmt5, which consists in the induction of expression in the cell of a polypeptide Blimp1, thereby inducing formation of a complex of Blimp1/Prmt5 in the cell. Blimp1 induced in the cell can be either exogenous Blimp1 or endogenous Blimp1. Preferably, the cell can be a stem cell of a mammal.

Another aspect of the invention relates to the use of polypeptide complexes of the invention for the treatment of cancer and to cells, preferably cells of the mammal/human - contains the above-described vector expressing constructs.

DESCRIPTION of FIGURES

Figure 1 shows (a) a summary of the main events in the process specification is eficacia and development of mouse embryonic cells from A to E, and (b) analysis of expression of candidate genes domain SET/PR with PCR cDNA isolated cells from 2 representative cells of the founders (special cells, founder cells) PGC (gray) and 2 somatic cells (white). Black areas show the detection of expression in PGC and somatic cells.

Figure 2 shows that besieged by immunoprecipitate complex mouse Blimp1 shows arginine-methyltransferase activity, (a) Labeled Myc mouse Blimp1 or the corresponding control Express as specified in cells C. The ICC immunoprecipitate analyze Western blotting using antibodies against the protein of the ICC; (b) the same immunoprecipitate use in HMTase assays against purified histone Well; and recombinant H2A H2A (GNA). For each shows fluorogram (F) membrane and stained with a solution Ponco (R); (C) microeconomie labeled with radioisotope label GNA, on the x-axis shows the amino acids 1-14 GNA, on the y-axis shows [3N]is the inclusion of individual amino acid residues in the form of pulses per minute (cmp); and (d) alignment showing conservation of sequence at the N-terminal N4 and NA;

Figure 3 shows that the overlapping expression of Blimp1 and Prmt5 in germ cells leads to a specific pattern H2A/H4R3me, (a, b, c) Pattern of expression of Blimp1, Prmt5 and Prmt1 in PGC at various stages detect immuno what krasivaya antibodies, specific to Blimp1 (a), Prmt5 (b) and Prmt1, (C) germ cells detects as shown, using antibodies against stella/PGC7, Oct4 or TG1/SS1 combined (merged) image shown with DNA stained with DAPI; (d, e) Labeled Myc mouse Blimp1 or appropriate controls Express as specified in cells C, ICC, Prmt5 or Prmt1 immunoprecipitate analyze Western blotting using antibodies against Prmt5, ICC or Prmt1, the asterisk shows nonspecific signal; and (f) Methylation H2A/H4 R3 germ cells assessed by immunoablative in cells PGC at these various stages of development H4R3me2s antibodies, germ cells together stained with antibodies against stagespecific markers, namely Oct4 or TG1/SSEA1, combined (merged) image shown with DNA stained with DAPI, scale: 10 µm (scale is identical in all figures).

Figure 4 shows in vivo identification of Blimp1/Prmt5 binding elements with genomic locus Dhx38, (a) the provisions alleged Blimp1 binding sites near Dhx38 transcription start (TS) and the start codon (ATG), also shown amplificatoare sequence for ChIP analysis (a, b, C, D), (b) Interaction of endogenous Prmt5 with genomic DNA locus Dhx38 using ChIP analysis, the supernatant fraction (s) or nuclear fraction (n) of cell extracts of the selected cells of the genital tubercles E e is bionow precipitated by immunoprecipitating antibodies or Prmt5, or IgG as a control using genomic DNA of the "tail" (+) and water (-).

Figure 5 shows that the expression of Dhx38 is activated in embryonic cells during translocation Blimp1 and Prmt5 from the nucleus to the cytoplasm, resulting in lower levels of modification H2A/H4R3me2s, immunoablative (a) Dhx38, (b) Blimp1 and Prmt5, and (C) H2A/H4R3me2s carry on krisrose genital tubercles on these stages of development, germ cells detected using specific antibodies: stella/Pgc7, Oct4 or TG1/SSEA1, the merged image is shown with DNA stained with DAPI, scale: 10 µm (scale is identical in all the drawings).

Figure 6 shows the analysis of Blimp1, Prmt5 and Dhx38 in pluripotent EG cells and embryonal carcinoma cells (EC) (a) Immunoablative on Blimp1, Prmt5 and Dhx38 carry on EG cells, the merged image is shown with DNA, DAPI stained, note the inverse relationship between the expression of Dhx38 and Blimp1; (b) Western blotting of ES, EG or EC (P19) extracts for Blimp1 and Oct4; (C) Labeled Myc mice Express Blimp1 as specified in pluripotent P19 EC cells, Prmt5 immunoprecipitate analyzed by Western-blotting using antibodies to Prmt5, Blimp1 or Dhx38, and the levels of tubulin, showing equal loading on the track input, detect, using an antibody against tubulin, it should be noted repression Dhx38, when Blimp1 injected into the EU (P19) cells; (d) Povyshennymi H4R3me2s on Dhx38 locus in Myc-Blimp1 transfected EC (P19) cells analyzed by ChIP, cell extracts P19 cells precipitated by immunoprecipitating antibodies to either Myc or H4R3me2s, a, b, C, D belong to the areas in Dhx38 locus containing the binding sites Blimp1, as explained in figure 4.

7 shows (a) Immunofluorescent analysis of candidate genes domain SET/PR when using screening expression by the method of Poland in E shown in figure 1; immunoablative selected cells from A embryos with specific antibodies against specific histone methyltransferase, as indicated, germ cells detected using antibodies specific to germ cells, Oct4 or Stella/PGC7; (b) joint immunoablative Blimp1 and Prmt5 with appropriate antibodies in A PGC, germ cells have been labelled with the use of the expression tkanespecificescoe alkaline phosphatase (AP), the merged image is shown with DNA stained with DAPI, scale: 10 µm (scale is identical in all figures).

On Fig characteristics N4 R3me2s antibodies, arginine can be modified only metal group (a), or two methyl groups, which are located symmetrically (b) or asymmetrically (); antibody against H4 R3me2s (Abeam™) are first obtained using H4 synthetic peptide with R3 symmetrical di(e?)methylation, to verify its specificity performed Western blotting; (d) against histones and the calf thymus (N4, H3, H2A, H2B as well as) incubated in the presence and in the absence of a besieged by immunoprecipitate Myc-Blimp1, and (e) according to competitive analysis in relation H4 peptides, including unmodified, R3me2s and R3me2a, antibody clearly know symmetrically demetilirovanny peptide.

DETAILED description of the INVENTION

Before giving a detailed description of the invention, provides a number of definitions that will help to understand the invention. All reference materials cited in this description are entered by reference in its entirety. If not stated otherwise, all technical and scientific terms used herein have the meaning which it usually is for ordinary experts in the field of technology to which this invention relates.

The term "reprogramming" in this description refers to the stage of change or remove epigenetic modifications of the nucleus of the cell. Reprogramming contributes to the reduction in commiteeman cells and, therefore, the state of differentiation of cells in General and, in particular, the kernel. Essentially reprogramming consists of return somatic differentiated or commitirovannah cells to gene expression, epigenetic and functional status, characteristic for embryonic, embryonic or stem cells. Reprogramming of somatic nuclei CL is current is the preferred first stage in such methods, as SCNT, but it is also of interest for other methods, which are important to control cell differentiation, i.e. the ability for differentiation, differencirovanie potency.

The term "cancer" is used in this description to refer to tissue localized in the tumor (neoplasm, tumors) or having the properties associated with neoplasm (neoplasms, tumor). Tumors usually have characteristics that distinguish them from normal tissue and normal cells. Such characteristics include, but are not limited to the degree of malignancy, changes in cell morphology, irregularity of shape, reduced adhesiveness, ability to metastasize, elevated levels of angiogenesis, increased invasiveness of cells, decreased levels of apoptosis and, as a rule, increased malignancy cells. The terms corresponding to the term "cancer", and often is its synonyms include sarcoma, carcinoma, tumor, epithelioma, leukemia (leukemia), lymphoma, polyp, rebirth, neoplasma (neoplasia), etc.

The term "epigenetic modification" refers to chemical tagging (labeling) of the genome. Epigenetic marks can include DNA methylation (imprint), as well as methylation and acetylation of proteins associated with DNA, such as histones. The expression of GE is s, specific in relation to native parents (either from the mother or from the paternal chromosome), is often observed in mammals and is the result of epigenetic modifications. In the parental germ-line epigenetic modification can lead to stable silencing or stable gene activation.

"Bioprocessing refers to techniques in which living cells or their components used to produce the desired final product. In the context of the present invention epigenetic modifications in the cells can be used to enhance this ability of cells to use in Bioprocessing. Usually Bioprocessing methods include SCNT.

The terms "derivatives or homologues" domain DNA-binding and/or arginine-methyltransferase in this description refer to the mRNA and polypeptides that have sequence identity, almost similar to the molecules according to the invention, respectively. I believe that derivatives and homologues include orthologues sequences from other species and specimens, which, however, there is a high level functional equivalence. Under almost the same (similar) sequence identity to understand the level of similarity of sequences from approximately 50%, 60%, 70%, 80%, 90%, 95%, approximately, 99% identichnosti identity of sequences can be defined, using conventional methods (Henikoff and Henikoff, Pros. Natl. Acad. Sci. USA 1992; 89: of 10,915, and Altschul et al. Nucleic Acids Res. 1997; 25: 3389-3402). Or homologues of the polypeptides according to the invention can represent such sequences that can demonstrate the ability to gibridizatsiya with sequences according to this description, the terms high, medium or low hardness.

The term "expressing (expression) vector" ("expression vector") are used to refer to DNA molecules, which are either linear or ring, which can be integrated fragment of the sequence of another DNA. This (these) fragment(s) DNA may include additional segments that provide for transcription of the gene encoded by a fragment of a DNA sequence. Additional segments may include, but are not limited to promoters, transcription terminators, enhancers, the portions of the inner landing ribosomes, untranslated regions, polyadenylation signals, selective markers, originy replication, and the like. Expressing the vectors is often derived from plasmids, cosmid, viral vectors and artificial chromosomes in yeast, vectors are often recombinant molecules containing DNA sequences from multiple sources.

The expression "functionally linked", as applied to the sequences of the NC, for example, in expressing the vector, indicates that the sequences are arranged in such a way as to achieve the specific goals they are working together, namely, the promoter sequence promotes transcription initiation, which occurs with associated coding sequence to signal the termination of transcription.

"Polynucleotide" represents a single or double-strand (trevou, chain) covalently linked sequence of nucleotides in which the 3' and 5' ends of each nucleotide is connected phosphodieterase links. Polynucleotide may consist of deoxyribonucleotide bases or ribonucleotidic grounds. Polynucleotide include DNA and RNA and can be produced synthetically in vitro or isolated from natural sources. The size of polynucleotides usually expressed as the number of pairs (nucleotide) bases (base pairs, BP, bp) for double-strand of polynucleotide, or, in the case of single-stranded polynucleotides, as the number of nucleotides (nt). One thousand gel or nt equal kilobase (kb). Polynucleotide length of less than about 40 nucleotides, usually referred to as "oligonucleotides".

The term "promoter" in this description refers to the region in the gene with which transcription factors and/or RNA polymerase can (may) be contacted thereby to control the former is ressio associated coding sequence. Usually, but not always, the promoters localized in the 5' non-coding regions of genes, 5' of the codon of translation initiation. The promotor region of the gene may contain one or more consensus sequences, which are recognized as binding sites for specific in relation to sequence DNA-binding domain DNA-binding proteins. However, such binding sites may also be localized in areas outside of the promoter, for example, enhancer regions, which are located in introns or 3' coding sequence.

The term "isolated", when applied to the polypeptide or complex (Association) polypeptides, refers to polypeptide, which is separated from the body, which is its natural source. Preferably, the selected polypeptide is substantially free of other polypeptides, native to the proteome of the organism. Most preferably, the purity of the selected polypeptide comprised of at least 95%, more preferably more than 99%. In this context, it is assumed that the term "isolated" includes the same polypeptide in alternative physical forms, either in native form, in the form of denatured protein, a dimeric/multimeric form, in the form of a glycosylated, crystallized, or derivatizing protein. Ref is and "complex" ("Association") in this description includes examples, in which the first and second polypeptide domains in a single polypeptide chain, and in which the first and second domains are included in the individual polypeptide chains that are non-covalent bond connected to each other, and in which are formed posttranslational covalent bond linking the individual domains in one single functional element (unit).

In one embodiment, the present invention provides a new complex between Blimp1 and Prmt5, is able to regulate gene expression in mammalian cells by the mechanism of epigenetic control.

Usually somatic cells develop along the path of differentiation, evolving from a state of less specialized cells to more specialized or commitirovannah cells. Less specialized cells can demonstrate the ability to behave as stem cell precursors, giving rise to some different types of cells. A number of these different types of cells, for which this stem cell can serve as a precursor, commonly called "potentially" this stem cell. Therefore, pluripotent stem cells can act as precursors of many different types of differentiated cells. If the cell can differentiate into all the cell the body, it is a totipotent stem cell, if the cell can differentiate into most cell types, it is a pluripotent stem cell. Embryonic stem cells are usually called pluripotent because they can generate most types of mammalian cells, except extraembryonal tissues (i.e. the trophectoderm). The present invention includes a method of controlling selection of the fate of cells at the level of gene expression control. Protein complex according to the invention being expressed, or otherwise introduced into mammalian cells, to shift the fate of the cells in the other side of the choice of pluripotency. In contrast, inhibition of the activity of the protein complex according to the invention, or even one component, Blimp1, stem cells can shift the fate of cells in the direction of the choice of pluripotency and self-renewal.

Another related area of utility of the present invention is the treatment of cancer. Most, if not all, cancers are subjected to epigenetic changes, including largely deactivation and gene silencing of tumor suppressors and activation of oncogenes. Reactivation of genes tumor suppressor can reduce the intensity of the phenotype of the cancer, because it can suppress (negatively regulate) oncogenes. Therefore, the method is ontrol gene expression and selection of the fate of cells in vivo is a very promising direction in cancer therapy.

Maturation protein (Blimp1), induced by b-lymphocytes

Blimp1 is a protein with a length of 100 kDa, which contains five DNA-binding motifs zinc fingers (GENBANK registration: NM_007548). The human homologue of Blimp1 is called either PRDI-BF1, or PRDM1 (GENBANK registration: NM_000198). cDNA Blimp1 first allocated vycitalem (substractive) screening cell line b-cell lymphoma (BCL1) after treatment with cytokines IL-2 and IL-5. ectopic expression of Blimp1 enough to cause the final differentiation BCL1cells. It is believed that Blimp1 is a 'master regulator' (generic controller) final development of b-cells (J. Yu et al. (2000) Mol. Cell. Biol. 20(7): 2592-2603).

In humans, PRDI-BF1, the human ortholog of murine Blimp1, capable of forming a complex with H3 lysine-methyltransferase G9a. It is shown that this complex is able to induce silencing of the gene for human interferon-β (IFN-β) - mediated chromatin mechanism in the promotor region of the gene (Gyory I. et al. (2004) Nat. Imm. 5: 299-308).

It is shown that Blimp1 forms a complex with factors involved in epigenetic modifications. Suppose that the complex containing Blimp1 and listennow the deacetylase (HDAC), changes the structure of the nucleosome and inhibits the transcription of genes by deacetylation lysine residues on the tails of histone. Because of acetylases is of lysine residues effectively neutralizes their positive charge, the deacetylation returns the charge and leads to a modification of the structure of the nucleosome due to steric and other effects.

Known target Blimp1 include c-Myc, IFN-β, CD23, CD22, MHC (MHC) class II, BSAP (Pax 5), factor early b-cells and CIITA. All these genes undergoing transcriptional regression under the action of Blimp1. Transcription of the gene c-Myc is inhibited Blimp1 in the process of differentiation of b-cells and is an important target of Blimp1 in the cell lymphoma BCL1. In order Blimp1 inhibited the promoter of c-Myc, need different region of the molecule Blimp1, including N-terminal acidic domain, and a region between AA 90 and 464 (J. Yu et al., see above).

The oncoprotein c-Myc is important to control growth regulators, apoptosis and/or differentiation, and its dysregulation is also the reason for a wide range of tumors. The dysregulation of the expression of c-Myc in b cells often causes tumors. Chromosomal translocation gene with the ICC in the gene loci Ig present in the majority of Burkitt lymphoma and murine plasmacytoma (K.I. Lin et al. (2000) Mol. Cell Biol. (20)23: 8684-8695).

Mouse ES cells can be saved as pluripotent, self-renewing population using LIF/STAT3-dependent signal transmission. It was shown that STAT3 regulates the expression of the transcription factor (transcription factor) Myc. I also believe that adult stem cells requires activation of Myc. The method of RT-PCR (RT-PCR) analysis shows that t is inscripci Myc increases in ES cells. Usually for ES cells requires cultural environment, which includes LIF, otherwise ES cells tend rather to differentiation, rather than self-renewal. Found that the levels of Myc in ES cells are rapidly destroyed after the removal of LIF from the culture, it indicates that it may be necessary for differentiation of ES cells. Experiments suggest that one Myc can maintain the state of the ES cells (i.e. pluripotent phenotype at the level comparable with LIF, and when Myc is inactivated, the pool of stem cells decreases (P. Cartwright et al. (2005) Development 132: 885-896).

Protein Arginine-Methyltransferase 5 (Prmt5)

There are two types histonic methyltransferase (HMTase)that include any domain SET (Suvar3-9, Enhancer of Zeste, Trithorax), first discovered in proteins with lysine-specific methylases activity, or a domain with the arginine-specific methylases catalytic activity detected in PRMT. PRMT are divided into types I and II: type I PRMT catalyze monomethylamine and asymmetric di(e?)methylation of arginine residues, while type II PRMT catalyze the formation monomethylarsonic and symmetrically dimethylarsenic arginine residues. Of the six known PRMT only PRMT5 (GENBANK registration No: NM_006109 (human); NM_013768 (mouse)) behave as type II PRMT, which can target histones. Specifically, it is shown that PRMT5 is azulene-specific arginine residues in H3 and H4 N-terminal tails.

PRMT5 may be associated with complexes of chromatin remodeling on the basis of BRG1 and hBRM hSWI/SNF. In such PRMT5 complexes can stimulate the growth of cells and is independent of zakalivanie growth, Meteora the arginine residue 8 of histone H3 (H3R8), and thereby reducing the expression of genes, such as ST7 and NM23, which are known to participate in the suppression of tumors (Richard S. et al. (2005) Biochem. J. 388: 379-386). PRMT5 is also involved in transcriptional regression CYCLIN E and CAD software.

Complex Blimp1/Prmt5

The applicant of the present invention have begun to identify possible activity domain Blimp1 SET/PR, as no specific histone-methyltransferase activity was not related to Blimp1. The applicant has shown that Blimp1 can form a new complex with PRMT5 complex, which in vivo is retained in the line of differentiation of mouse embryonic cells before entry PGC in the genital tubercles, this suggests that Blimp1 constantly takes part in the sequence of generations of early embryonic mammalian cells. Further analysis, described in more detail below, shows that the new complex Blimp1/Prmt5 reports unique characteristic epigenetic characteristics due to the methylation of histones H2A and H4. I believe that this is the first example in which methylation of the tail of histone H2A shows how epigenetic regulatory mechanism. Further, xperiment, described in more detail below, show that whereas Prmt5 is present in pluripotent EG and ES cells, Blimp1 not.

Expression of Blimp1 in line pluripotent cells EC P19 leads to repression of the gene which is known to be expressed in pluripotent cells at a high level. Experiments suggest that the complex Blimp1/Prmt5 is an important regulator of gene expression and may have a significant impact on the choice of the fate of cells, in particular in respect of pluripotency and differentiation. For this reason, one variant of the present invention includes a mechanism of control genes, based on the use of different biological activity, as exemplified by Blimp1/Prmt5 in vitro or in vivo.

Not to commit himself to any theory, I believe that in this complex Blimp1 provides the function of targeting genes, as it has five DNA-binding domain in the form of zinc fingers. Prmt5 provides arginine-methyltransferase activity, which serves as HMTase localization on DNA, which leads to repression of gene expression. It is known that the human ortholog of Blimp1 associates with the site PRDI in the promoter region of the human IFN-β (Keller A.D. & Maniatis T. (1991) Genes Dev. 5: 868-879). As mentioned above, it is also known that Blimp1 is able to repress the expression of c-Myc. According to this invention and artificialy new subset of genes which, as shown, are specific targets of complex Blimp1/Prmt5 and the expression of which may be regulated by the new system. This subset includes genes with different functions, but it is believed to play an important role in the regulation of Potentate, cell cycle, differentiation, adhesion of cells, epigenetic reprogramming, and possibly also the suppression of the tumor.

According to the invention repressing complex Blimp1/Prmt5 correlates with high levels of H2A/H4R3me2s in germ cells. However, in the course of differentiation In cells into plasma cells Blimp1 manages G9a-dependent H3K9me2. Thus, Blimp1 is able to control the fate and properties of different cells through Association with different binding partners, and remodeling (patterns) chromatin may be the most important for these processes. Beyond the obvious importance of Blimp1 in the early stages of specification of germ cells in mice, the present invention demonstrates the additional participation of Blimp1 in the formation of a unique characteristic epigenetic characteristic chromatin observed in germ cells after PGC specification (FCL). However, Blimp1/Prmt5 is by PGC nuclei (FCL) and enters the cytoplasm after E when extensive programming complete (whole) genome detected in germ cells. Still the way understanding the link between complex Blimp1/Prmt5, symmetric methylation of arginine 3 H2A/H4 and subsequent epigenetic reprogramming of the complete genome of germ cells provides valuable insight into the mechanism (to understand the mechanism underlying this important process, and to understand how nuclear reprogramming is controlled within the cell.

The invention also provides an understanding of the role of Blimp1/Prmt5 in pluripotent embryonic (EG) cells of the gonads, which formation of PGC undoubtedly associated with the loss of Blimp1. The present invention provides a direct proof that Blimp1 key for repression generated and migrating PGC from purchasing explicitly pluripotent phenotype similar to stem cells. Therefore, agonists and antagonists of the activity of Blimp1/Prmt5 can play an important role in the containment of the choice of the fate of cells or away from pluripotent phenotype, either party to the pluripotent phenotype. In addition, the expression of Blimp1 in the cells provides a mechanism for blocking arginine-methyltransferase activity of Prmt5 in the nucleus and away from potential cytoplasmic substrates. This effect can be useful in the course of differentiation of stem cells and during the whole cell cycle in a given cell or cell line.

Specific small nucleotide molecules, which note shall apply in the invention as inhibitors of Blimp1 and/or Prmt5, are short fragments of double-strand RNA, known as small (short) interfering RNA (siRNA). Technology interfering RNA (iPHK, RNAi) allows selective activation of gene functions vivo. In the present invention iPHK (RNAi) can be used to suppress the expression of Blimp1 and/or Prmt5 in the cells. In this process double-strand mRNA are recognized and split cut by RNase, the result fragments iPHK (RNAi) with a length of 21-23 nucleotides. These RNAi include induced RNA silencing complex (RISC) and spin with this complex. Then isolated " antisense strand guides RISC to the mRNA containing the complementary sequence, which leads to endonucleolytic mRNA cleavage (Elbashir et al. (2001) Nature 411; 494-498). Therefore, this technology provides a method for targeting and cleavage Blimp1 mRNA and/or Prmt5 in somatic cells intended for use in Bioprocessing or in cases when you need to promote self-renewal of pluripotent phenotype. Methods of obtaining siPHK for Prmt5 described in the prior art (Richard S., see above). Examples of suitable sequences siPHK for targeting human PRMT5 include:

5' CTCATTTGCTGACAATGAA 3' [SEQ ID NO:1]

5' GGACCTGAGAGATGATATA 3' [SEQ ID NO:2]

5' GTTTCAAGAGGGAGTTCAT 3' [SEQ ID NO:3]

Complex Blimp1/Prmt5 can be used for the identifier is of other proteins and polypeptides, which interact with him in the cellular environment. Conventional methods of determining protein-protein interactions, such as dvuhserijnyj screening in yeast, can be used to identify potential agonists and antagonists of the interaction of complex Blimp1/Prmt5. Also in the field of the invention is the identification of small molecules that inhibit the Association of Blimp1 with Prmt5, for example, screening or disrupting the interaction with those domains Blimp1 known that they directly interact with other proteins (J. Yu et al. see above). Protein - protein interactions, or interactions, protein-small molecule, involving Blimp1, Prmt5 and/or complex Blimp1/Prmt5, can be studied using techniques such as BIAcore®studying molecular interactions using surface plasma resonance (BIAcore, Inc., Piscataway, NJ; see alsowww.biacore.com).

Screening of molecules and proteins on the binding of complex Blimp1/Prmt5 can be done by methods of automated high-throughput screening. Therefore, the invention includes methods of identifying molecules that interact with a complex of Blimp1/Prmt5, by detecting the positive interaction of the binding between the complex Blimp1/Prmt5 and molecule-target. You can apply additional stage screening to determine whether the identified positivenegative binding has pharmacological value - i.e. whether or not the molecule-target (target molecule) can reduce (reduce) the biological activity or function of Blimp1, Prmt5 and/or complex Blimp1/Prmt5. If the identified molecule with a positive decreasing effect, the molecule is classified as a 'hit' (hit or hit), and then it can be evaluated as a potential candidate drug. At this time, or earlier, you can take into account additional factors, such as absorption (adsorption, distribution, metabolism and secretion (ADME)profiles of bioavailability and toxicity of the molecule. If the molecule potential drugs satisfied pharmaceutical requirements, we believe that it is pharmaceutically compatible. You can make the appropriate arrangements for inspection activity in-vitro and in-vivo in accordance with standard methods known in the art.

EXAMPLES

Reagents and methods

The selection of embryos. Primordial germ cells isolated from embryos outbred MF1 mice at different stages of development. The day of the introduction of vaginal swab indicate E. cDNA libraries from single cells taken from previously published work (Saitou m, Barton S.. & Surani M.A. (2002) Nature 418, 293-300).

Immunoablative. Prepared embryos containing germ cells, treated with trypsin to obtain suspense and single cells. The cells are then left to settle on is covered with poly-L-lysine sections, fixed with 2% PFA (paraformaldehyde), washed three times by PBS and processed further. Whole embryonic genital tubercles in A cut, washed in PBS, fixed for two hours at 4°C in 4% PFA, washed in PBS and left to settle in a 20% sucrose solution at 4°C. They conclude in OST (BDH) and make crisisi. Single cells or slices permeablity in IF buffer (PBS; 0.1% of Triton; 10 mg/ml BSA). Incubation with primary antibody was performed at 4°C and then washed three times in IF buffer and incubated with secondary antibodies (Alexa 564, Alexa 488; Molecular probes) for two hours at room temperature and washed in PBS. Then the sections conclude on Wednesday Vectashields with DAPI (Vector laboratories). The immunofluorescence observed using a confocal microscope (BioRad radiance 2000. Use the following antibodies and breeding: PGC7 (T.Nakano; 1: 2500), Oct4 (BD Transduction Laboratories; 1: 200), TG1 (specific against murine germ cell monoclonal antibody against SSEA1; 1:1), Blimp1 (K.Calame; 1:10), Prmt5 (firm Upstate; 1:250), Prmt1 (Upstate, 1:200), H4R3me2s (Abeam; 1:1000), Dhx38/Prp16 (Proteintech Group; 1:200), Ezh2 (Upstate; 1:50), G9a (Abeam™; 1:100), Pfm1 (Abeam™; 1:50), Set1 (from W. Herr; 1:200).

Immunoprecipitation analyses and preparation of nuclear extracts. The coding region of murine Blimp1 amplified using RT-PCR and clone product in pcDNA3-MycHisA get the design pCMV-MycBlip1. Cells T or P19, transfected with either the original vector (called pCMV-Myc), or pCMV-MycBlimp1, washed PBS and are lysed in IP buffer containing 150 mm NaCl, 1% NP40, 0.1% of Triton, 50 mm Tris (Tris) pH 8.0 and full proteiny inhibitory cocktail (Roche).

In a typical reaction, thus using 2×107cells. Extract of whole cells incubated with 2 µg Myc antibody (New England Biolabs). Or use of antibodies or Prmt5 or Prmt1 (Upstate) overnight at 4°C. Then add 30 ál pellet the protein A/G sepharose and incubated for 2 hours at 4°C. the Pellets washed five times in IP buffer. Associated proteins elute by boiling in buffer, Lemli for samples. Nuclear extracts of ES cells, EG or P19 prepared in accordance with the manufacturer's instructions (set of nuclear extracts; Active Motif), and 25 μg of nuclear fractions used for the load.

In vitro tests with methyltransferase. Granules from immunoprecipitation analyses T cells transferout or pCMV-Myc or pCMV-MycBlimp1, process, optionally washing twice in HMTase buffer (25 mm NaCl, 25 mm Tris pH 8.8), and use HMTase analysis, described in18with minor modifications. Briefly, 1 µg H3 or H2A (Roche) or recombinant H2A (a kind gift from A. Brehm), as a substrate, and 2 µci of S-adenosyl-L-[methyl-3H]methionine ([3H]SAM; Amersham Biosciences), as a donor of methyl groups, incubated in a mixture of 20 μl of b is Fehr for HMTase analysis for three hours at 37°C. Proteins share at 18% gel for SDS-PAGE, transferred to PDVF membrane and visualize staining Ponco and fluorography. In vitro methylated GNA microconduit (determine the primary sequence of a short fragment) gradual degradation in Adminu (Protein and Nucleic acid Chemistry Facility, Cambridge University, UK), then define3H the inclusion of individual amino acids counting of scintillations. To study H2A/H4 specific methylation of H4, H3, H2A and H2B as well as (Roche) and incubated in the presence immunoassaying complex Blimp1 and SAM as described above and carried out Western blotting using H4R3me2s antibody (Abeam™, Cambridge, UK), which tested for their specificity competitive analysis (see Appendix, Fig).

Immunoprecipitate chromatin (ChIP)-cloning and ChIP. Suspension of single cells sew in 1% formaldehyde for 10 min at room temperature. Then destroy cells and nuclei are lysed in 50 mm Tris pH 8.0, 10 mm EDTA, 1% SDS, followed by centrifugation. The extract is subjected to thus as described above, by adding purified IgG (Santa Cruz) as a negative control. Then the pellets twice elute in 50 mm NaHCO3, 1% SDS and supernatant treated with proteinase K for 5 h at 65°C with subsequent treatment with a mixture of phenol/chloroform and precipitation (precipitation) alcohol. Then PRMT5 (Upstate) or H4R3m32 (Abeam™) ChIP samples analyze standard reactions the second PCR, using the following primers (1for (direct) ccaggaggggtttcatcaactg [SEQ ID NO:4] and 1rev (reverse) tgttaccgtctcacttggtgtttg [SEQ ED NO:5]; 2for acctcacaactgctgggattac [SEQ ID NO:6] and 2rev ttcgttttctgcgtccgtg [SEQ ID NO:7]; 3for tttgtcgcagtgtcttatcgtaac [SEQ ID NO:8] and 3rev taggaaggtgttggggaggg [SEQ ID NO:9]; 4for atgaggtttgagaagtgtggc [SEQ ID NO:10] and 4rev atcagcggtggtggtgacagc [SEQ ID NO:11]). In the case of the analysis ChIP cloning" spend two consecutive cycle thus, using antibodies against Myc. Then hold precipitation (deposition) of DNA that is "dull" on the ends of T4 DNA polymerase, and then are ligated to annealed JW102 and JW10325. Then the products of ligation of PCR-amplified with JW102 (one cycle 55°C 2 min; 72°C 5 min; 94°C 2 min and 20 cycles of 94°C 30 s; 55°C 30 s; 72°C 1 min, and finally one cycle of 72°C 5 min). PCR products clone in pGEM-T (Promega), colonies are screened for insertions by PCR and the products is sequenced by standard methods. Then spend software search using online sources of information on bioinformatics, such as Ensembl (http://www.ensembl.org).

Example 1: Determination of Blimp1 activity

Significant epigenetic modifications occur immediately after the specification of mouse PGC (PCC), including methylation and acetylation histonic all methyltransferases (HMTase) and acetyltransferase (HAT), respectively. Among the candidate genes that may be involved in the regulation of epigenetic changes in PGC, there are HMTase that belong to th the Wu proteins with conservative SET/PR domain. Analyze the expression of twenty-five genes containing the domain SET/PR, E PGC and in neighboring somatic cells, and find that Blimp1, G9a, Set1, Ezh2 and Pfm1 expressed in the embryonic region containing PGC (Fig.1b and Fig.7). However, only the expression of Blimp1 limited PGC in E, and its expression persists then in germ cells.

To study the activity domain Blimp1 SET/PR first establish that labeled Myc mouse Blimp1, after transient expression in cells C, can be effective thus, using antibodies against Myc (Figa). Then immunoprecipitate can be subjected to standard radioactive analysis of histone-methyltransferase activity on histone H3 (Rea, S. et al. (2000) Nature 406, 593-9). See a relatively weak signal corresponding to H3, but unexpectedly also detect a visible band corresponding to histones H2A and H4 (Fig.2b), and, by definition, Western blotting, the latter is present in the form of small impurities (low levels) in the preparation of H3 (data not shown). It was concluded that a weak signal on H3 can be caused by Blimp1-associated G9a, as previously reported for cells (Gyory et al., see above). However, germ cells do not show noticeable demetilirovania lysine 9 in histone H3 (NCO), which is the main modification attributed G9a, and on the specificity of the human PGC does not significantly influence the loss of G9a function. Therefore, it was decided to focus on the observed activity received by immunoprecipitating Blimp1 on H2A and H4 the histones.

Due to the novelty of the discovery of methylation tails of H2A it was decided to first check methyltransferase activity immunoprecipitate on the preparations of calf thymus and recombinant H2A, and it was found that he has a strong matilida activity to this histone (Fig.2b). To identify the target (target) amino acid(s) residue(s) H2A "tail"labeled radioactive tagged recombinant protein product analysis methyltransferase activity is subjected to stepwise degradation by Admino. The counting of scintillations at a fraction of the liberated amino acids detect radioactive tagging of rH2A R3 (Figs). The same results are obtained on the preparations of calf thymus and recombinant H4 (data not shown). This is a logical result, if we take into account the conservation of the amino acid sequence of the first N-terminal residues of histones H2A and H4 (Fig.2d). It is known that methylation of H4 R3 plays an important role in the regulation of transcription. However, these results predict the existence of additional new R3 methylation on histone H2A.

Example 2: Identification of complex Blimp1/Prmt5

As SET/PR domain associated with the histone-methyltransferase activity only on l is Zinovich residues, it would have been reasonable to assume that the arginine-matilida activity detected above could be caused by not Blimp1, a must be linked to another HMTase present in immunoprecipitates. Earlier it was reported that two protein arginine methyltransferase, Prmt1 and Prmt5, mediate methylation of histone H4 R3. Prmt1 is a class I arginine-methyltransferase, resulting in NG-monomethylaniline (Rme1) and asymmetric NG,N G-dimethylarginine (Rme2a) on different types of substrates. As mentioned above, Prmt5 belongs to class II arginine-methyltransferase, which is responsible for monomethylamine arginine (Rme1) and symmetric NG,N G-demethylation (Rme2s) (Fig) 20. To test whether these proteins may be associated with Blimp1 in vivo, the expression of analyze formed in PGC and neighboring somatic cells using a cDNA library of single cells described above. Found that Prmt1 is excluded from the PGC in E, whereas Prmt5 is present in PGC, and in somatic cells (data not shown). However, at the protein level Prmt5 shows nuclear staining and becomes highly enriched PGC compared with somatic cells from A and forth (Figa, b; Fig.S1b and see below). On the other hand, at these stages Prmt1 is detected mainly in the cytoplasm of germ cells (Figs).

Then decided to check what exactly is erment, Prmt5 or Prmt1, interacts Blimp1. Indeed, we found that the labeled Myc Blimp1 can be subjected to effective joint thus with endogenous Prmt5 in T cells (Fig.3d). The opposite is true, Prmt5 can also pull a labeled Myc Blimp1 (Fig.3d). In contrast, it is impossible to detect any interaction between labeled Myc Blimp1 and endogenous Prmt1 (Fig.3e). These experiments confirm that Blimp1 and Prmt5 can form a complex in T cells. Taking into account the overlapping expression of these proteins in the PGC (Figa, b; Fig.S1b), it is logical to imagine that Blimp1 and Prmt5 are parts of the same protein complex in PGC and that this complex can meet somewhere in another place in the development process or in normal and tumorous adult tissues.

Example 3: activity of the complex Blimp1/Prmt5 in vivo

Check the specificity of antibodies to H4R3me2s and show that it is effective recognize both histone H2A and H4 from calf thymus (Fig.8b, left figure, H2A and H4 are also present as impurities in drugs H3 and H2B as well as). In competitive analysis this antibody effectively titrated N4 (1-9C) peptide containing R3me2s (Fig.S2c). In addition, this antibody also recognizes the product Blimp1/Prmt5 HMTase analysis on the H4 and H2A (Fig.52b, right), thus providing additional evidence that the complex has symmetric the traveler dimethylurea activity of Prmt5, and not asymmetric dimethylurea activity of Prmt1.

When using antibodies specific to the modification of H2/H4R3me2s, PGC, isolated from early embryos, analyze immunohistochemical methods. In A H2A/H4R3me2s clearly observed in PGC and somatic cells (Fig.3f), but in A significantly higher accumulation of H2A/H4 R3me2s predominantly observed in germ cells (Fig.3f). However, when using another antibody that recognizes mono - and/or asymmetric demethylation H4R3 (H4R3me1 and H4R3me2a), observed that this modification in the PGC is E, but not in E (data not shown). Joint results with these two antibodies show increased H2A/H4R3me2s in PGC from E to E. These results demonstrate the presence of a specific characteristic properties of chromatin during development of germ cells, which are believed to be determined by the joint presence of Prmt5 and Blimp1. It is important to note that there are many additional modifications tails of histones, which contribute to the specific germ cell chromatin structure. Recently, it was shown that loss of function of Blimp1 leads to incorrect (aberrant) development of PGC-like cells of the founders, which cease to proliferate (Ohinata, Y. et al. (2005) Nature 5, 5).

Example 4: Identification of in vivo targets of complex Blimp1/Prmt5

As shown the wound is, Blimp1 can direct gene regulation during cell differentiation through recruitment (attraction, replenishment) factors interact to specific sites. To identify prospective targets Blimp1 use the cloning method with the chromatin identification, in which labeled Myc variant Blimp1 first sverkhekspressiya in T cells. Then spend immunoprecipitation nuclear extracts from these cells T antibodies to Myc and immunoprecipitated DNA is extracted, purified, sew on blunt ends using linkers and PCR-amplified and clone. Several clones are selected and analyzed by sequencing and subsequent BLAST analysis for mapping of the cloned inserts. Of the 32 clones 11 corresponds to areas of localized regulatory sequences near or in suitable regulatory sequences of known genes (see Table 1).

Table 1
Genehit (hit, hit)the intended function
Dhx38the region 5' of progress against transcriptionsignal transduction/cell cycle
Pcdh7obl is here 5' progress against transcription adhesion of cells
Q8C9T7intronregulation of chromatin
Xylt1Nitronmetabolism
DnaH1intronthe cytoskeleton/motility of sperm
Balp2intronsignal transmission/organization of the cytoskeleton
Nek71st introncell cycle regulation
Dusp2the region 5' of progress against transcriptionsignal transduction/cell cycle
ENSMUSG00000027041intronmetabolism
Sirt42nd intronmetabolism/regulation of transcription
Blimp13'UTRtranscription

Example 5: a Study of the control of gene expression Dhx38 using complex Blimp1/Prmt5

Among the identified possible targets Blimp1 to explore choose Dx38. Dhx38 is a conservative gene that encodes containing DEAH-box RNA helicase (also known as Prp16), which is necessary in C.elegans for posttranslational regulation of sex-determining genes when switching sperm into oocytes (Graham, P. L. & Kimble, J. (1993). Genetics 133, 919-31). After a more detailed study Dhx38 locus found that it contains four motifs GGGAAAG corresponding to the consensus binding site Blimp1: two in the 5' region and two in the 3' (downstream) region start site of transcription (Figa). Although the currently available antibody against Blimp1 works in the methods immunostaining, it cannot be used for effective thus Blimp1 (data not shown). Therefore, use of Prmt5, to determine whether Dhx38 target for complex Blimp1/Prmt5 in germ cells. ChIP analysis using Prmt5 antibody spend on PGC contained in suspensions of cells of the genital tubercles of E embryos phase, when Blimp1 and Prmt5 coexpressed in the nuclei of germ cells (see above). Indeed, it is found that Prmt5 can specifically pull nucleotides overlapping sequence from +7152 to +7541, covering exon 11 of the gene Dhx38, which contains Blimp1 consensus-binding site (Fig.4b). The other three alleged binding site is not associated with Prmt5 in our analysis ChIP. These results show that Prmt5 are recruited in Misha and Blimp1, such as Dhx38, thereby suggesting that the complex Blimp1/Prmt5 regulates the expression of these target genes in germ cells.

The expression/repression Dhx38 in PGC consider considering the fact that Dhx38 is the target complex Blimp1/Prmt5 in germ cells. Discovered that Dhx38 not detected in E and E (Figa). However, to A Dhx38 is activated in both women's and men's PGC (Figa)that strikingly exists in parallel with the delocalization of Prmt5 and limp1 from the nucleus to the cytoplasm of germ cells B E (Fig.5b). In E as Prmt5 and Blimp1 is not in the PGC nuclei (data not shown). Activation Dhx38 immediately precedes the siege of meiosis and mitosis in male and female germ cells, respectively. Therefore, there is an inverse relationship between the expression of Blimp1/Prmt5 and Dhx38. These results show that Blimp1 and Prmt5 can function in repression of transcription of target genes, such as Dhx38, in the germline. This repression, apparently, is removed, when germ cells are in the genital tubercle and as Blimp1 and Prmt5 undergo translocation from the nucleus to the cytoplasm. It should be noted that the arginine methylation in histone is associated mainly with activation of transcription, although recently associated with Prmt5 activity H3R8me was associated with reduced gene expression (S. Pal et al., see above). Further, since RA is its reported as Blimp1 and Prmt5 are transcription repressor substances, it is possible that the symmetric demethylation arginine residue associated with a complex of Blimp1/Prmt5 in germ cells presented in this description, will contribute to the repression of genes.

Example 6: Complex Blimp1-Prmt5 in pluripotent stem cells

To better understand the role of complex Blimp1/Prmt5, it was decided to explore pluripotent embryonic germ (EG) cells. EG can be obtained from the selected PGC in vitro and, therefore, they can be considered as the nearest cell line, equivalent to the PGC. It was found that EG cells are positive with respect to Prmt5, but in contrast to PGC, they do not Blimp1 (Figa, b). In accordance with these results, it was found that EG cells are also positive in relation to Dhx38, this suggests that the expression of this gene may be caused by the absence of Blimp1 (Figa, b). To restore the complex repression Blimp1/Prmt5 labeled Myc Blimp1 sverkhekspressiya in EG cells. However, these attempts lead to a strong cytotoxicity after 12 h of transfection of cells, whereas the viability of transfected using pCMV-Myc control EG cells are not disrupted (data not shown). Similar results were obtained also with pluripotent embryonic stem (ES) cells (data not shown).

Choose pluri atentie cells embryonal carcinoma (EC) mouse line P19, they also have signs of pluripotency similar to EG cells and ES cells. Indeed, in P19 cells, like the cells of ES/EG, observed the expression of Prmt5 and Dhx38, but not Blimp1 (Fig.6b with). Found, however, that these cells are tolerant to the expression of Blimp1, and therefore use the precipitation, which really confirmed that sverhagressivny Myc-Blimp1 interacts with Prmt5 in mouse EC cells (Figs). It should be noted that this is unstable (temporary) complex Blimp1/Prmt5 then causes down-regulation Dhx38 in P19 cells (Figs). The ChIP analysis confirms that this down-regulation Dhx38 accompanied by elevated levels of H2A/H4R3me2s in Dhx38 locus (Fig.6d). These results support the view that complex Blimp1/Prmt5 is responsible for repression of target genes, such as Dhx38, which is also likely in the PGC.

Although the specific variants of the invention disclosed in detail herein, this is done with the help of examples and only for the purpose of illustration. The above variants of the invention do not intend to limit the scope of the attached claims presented below. Applicants believe that various substitutions, changes and modifications are possible in the invention without departing from the essence and scope of the invention in accordance with the invention.

1. Selected polypeptide complex, which is involved in the epigenetic control of e is cpressey genes in a mammal, containing protein Blimpl or its homolog PRD1 with site-specific DNA-binding activity, and PRMT5 protein with arginine-methyltransferase activity, and PRMT5 protein capable of metilirovanie arginine residue located in position 3 in the N-terminal region of histone H2A.

2. The method of control of gene expression in the cell of a mammal, which consists in inducing the formation in the cell polypeptide complex, which is involved in epigenetic control of gene expression in a mammal containing protein Blimpl or its homolog PRD1 with site-specific DNA-binding activity, and PRMT5 protein with arginine-methyltransferase activity, and PRMT5 protein capable of metilirovanie arginine residue located in position 3 in the N-terminal region of histone H2A, and the control of gene expression leads to the control of expression of one or more genes contained in the group consisting of: p-Mus; Dhx38; Pcdh7; Q8C9T7; Xylt1; DnaH1; Baip2; Nek7; Dusp2; ENSMUSG00000027041; Sirt4; and Blimp1.

3. The method according to claim 2, characterized in that the formation of polypeptide complex induce cage induction of expression of a nucleic acid that encodes a polypeptide PRDI/Blimp1, in the cell.

4. The method according to claim 3, characterized in that the expression of a nucleic acid that encodes a polypeptide PRDI/Blimp1, induce in the cell by transfection of cells expressing etc) the rum, which encodes a polypeptide Blimp1.

5. The method according to claim 2, characterized in that the formation of polypeptide complex induce in the cell by transfection of cells expressing nucleotide vector, containing:
one or more encoding sequence functionally linked to the promoter sequence, one or more coding sequences encode at least a first polypeptide including Blimp1 protein or its homolog PRD1 with site-specific DNA-binding activity, and at least a second polypeptide comprising a protein PRJV1T5 with arginine-methyltransferase activity.

6. The method according to any of claim 2 to 5, characterized in that the cell of the mammal is a human cell.

7. The method according to any of claim 2 to 6, characterized in that the mammal cells is a tumor or cancer cell.

8. The method according to any of claim 2 to 7, characterized in that the method is carried out in vitro.

9. The method according to any of claim 2 to 7, characterized in that the method is carried out in vivo.

10. The method according to any of claim 2 to 9, characterized in that the induction polypeptide complex in the cell leads to a decrease in the expression of one or more genes presented in section 2.

11. The method of identifying molecules capable of exerting an antagonistic effect on the biological active is th polypeptide complex according to claim 1, includes determining, shows whether the connection candidate binding interaction with PRDI/Blimp1, PRMT5 and/or complex PRDI/Blimp-PRMT5, and identification of such compounds as molecules that interact with a complex of PRDI/Blimp1-PRMT5, characterized in that the connection that is associated with PRDI/Blimp1, PRMT5 and/or complex PRDI/Blimp-PRMT5 and which inhibits the biological activity or function of the complex PRDI/Blimp1-PRMT5 according to claim 1, identify as antagonistic molecules.



 

Same patents:

FIELD: chemistry.

SUBSTANCE: method involves preparation of a sample, presumably containing at least one type of RNA (target) to undergo reverse transcription and at least one type of RNA different from the target; treatment thereof with polynucleotide phosphorylase Thermus thermophilus (Tth PNPhase) at temperature 60-75°C and micromolar concentration of magnesium, carried out after annealing the analysed sample with a protective oligonucleotide lying on the 3'-side of the section to undergo reverse transcription, and forming a hybrid with the target which is stable in incubation conditions; and a reverse transcription reaction which is carried out with the reaction mixture obtained at the preliminary treatment step, without further purification thereof.

EFFECT: high specificity of reverse transcription.

6 cl, 7 dwg, 11 ex

FIELD: chemistry.

SUBSTANCE: method involves introduction into a plant body of nucleic acids whose sequences code fragments with desaturase and elongase activity.

EFFECT: method increases content of polyunsaturated fatty acids in transgenic plants.

1 c, 33 dwg, 21 tbl, 60 ex

FIELD: medicine.

SUBSTANCE: what is described is fatty acid synthetase of a sequence presented in the description. What is specified is a polynucleotide coding such synthetase. What is presented is a vector containing such polynucleotide. Besides, what is also described is a transformed microbial organism containing such vector or polynucleotide. The transformed microbial organism is used to produce fatty acids. What is offered is a method for producing a lipid or a fatty acid that involves transformant cell culture followed by recovering the lipid or the fatty acid from such cells. What is described is a method for assessment of ability to form fatty acids based on the measurement of an expression level of fatty acid synthetase having a nucleotide sequence of specified polynucleotide. Also, there is presented a method for selection of microbial lipid-producing organisms that is based on the comparison of the expression levels of specified gene in a reference and tested microbial organism.

EFFECT: invention provides producing high-yield fatty acids.

17 cl, 1 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: invention represents a method of DGAT counting. The method involves contacting stable and reproduced micelles containing at least one DGAT substratum with microsomes containing DGAT, and evaluating triglyceride formation in a reaction mixture produced as described above provided micelles contain phosphatidyl serine and phosphatidyl choline. Also, the invention refers to a method for identifying the fact whether a compound being tested is able to modulate DGAT activity, and said method involves contacting the stable and reproduced micelles containing at least one DGAT substratum with microsomes containing DGAT in the presence and absence of the compound being tested, and evaluating triglyceride formation in the reaction mixture produced as described above and in which the change in triglyceride formation in the presence of the compound being tested specifies that said compound is able to modulate DGAT activity provided micelles contain phosphatidyl serine and phosphatidyl choline.

EFFECT: invention allows fast, simply and effective DGAT counting.

26 cl, 2 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: invention concerns nucleic acid molecules including the glycolising fusion designs containing catalytic domain of beta-1,4-N-acetylglucosaminyl transferase III or beta-1,4-galactosyl transferase, and resident polypeptide domain of Golgi complex responsible for localisation in Golgi complex, as well as their applications in host cell glycolisation modification.

EFFECT: invention allows producing polypeptides with the improved therapeutic properties, including antibodies with higher Fc-receptor binding and enhanced effector function.

21 cl, 37 dwg, 2 tbl, 7 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention pertains to biotechnology. The invention describes a method of producing a modified vitamin K dependent polypeptide which involves modification of activation peptide which includes at least part of an amino acid sequence of another vitamin K dependent polypeptide and where the said part is at least 3 adjacent amino acids of activation peptide FVII, or 5 adjacent amino acids of activation peptide FX, or 5 adjacent amino acids of activation peptide FIX provided that QSFNDFTR peptide is excluded, or 8 adjacent amino acids of activation prothrombin peptide, or an extension on adjacent amino acids of the activation peptide of the second vitamin K dependent polypeptide which has length at least equal to 15% of the total length of the amino acid sequence of the activation peptide of the second vitamin K dependent polypeptide, in which the second vitamin K dependent polypeptide is selected from a group consisting of protein Z, GAS6 and protein S, and where the second vitamin K dependent polypeptide has longer half-life in plasma. The invention discloses a modified vitamin K dependent polypeptide obtained using the described method and having coagulation activity.

EFFECT: invention enables production of modified vitamin K dependent polypeptides with longer half-life in plasma.

40 cl, 2 dwg, 4 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: genetically modified microorganisms having DNA encoding polypeptide involved in biosynthesis of macrolide compound of pladienolida, and DNA encoding polypeptide having hydroxylase activity aimed at pladyenolides hydroxylation in 16-position are proposed. The invention enables to produce effectively macrolide compound hydroxylated in the 16-position, directly in a single microorganism.

EFFECT: obtained compound has a high antitumor activity and can be used to develop anticancer drugs.

17 cl, 4 dwg, 7 tbl, 18 ex

FIELD: agriculture.

SUBSTANCE: nucleotide sequences, which code polypeptides of resistance to glyphosate are used in structures of DNA or expression cassettes for transformation or expression in organisms, including microorganisms and plants.

EFFECT: transformed organisms become resistant to herbicide.

17 cl, 5 dwg, 11 tbl, 23 ex

FIELD: medicine.

SUBSTANCE: trans-sialydase enzyme has been recovered from a unicell Trypanosoma congolense. Trans-sialydase is characterised by one of the following amivo acid sequences: SEQ ID NO:2, SEQ ID NO:4 or a sequence being 75% identical with one of said sequences.

EFFECT: extended range of enzymes with trans-sialydase activity.

6 cl, 3 dwg, 1 tbl, 6 ex

FIELD: agriculture.

SUBSTANCE: genetic modification of wheat in the form of mutation in gene SBEIIa with reduction of level of its activity.

EFFECT: grain with high content of amylose in its starch; wheat with reduced level of SBEIIb-activity with grain with non-wrinkled phenotype, with relatively high content of amylose.

62 cl, 28 dwg, 12 tbl, 16 ex

FIELD: chemistry.

SUBSTANCE: invention relates to biotechnology and a method of producing polyunsaturated fatty acids in seeds of transgenic plants. The method involves introducing into a plant, nucleic acids whose sequences code enzymes having Δ-6-desaturase, Δ-6-elongase, Δ-5-desaturase, Δ-5-elongase, Δ-4-desaturase and Δ-12-desaturase activity.

EFFECT: method increases content of polyunsaturated fatty acids in seeds of transgenic plants.

1 cl, 33 dwg, 24 tbl, 61 ex

FIELD: chemistry.

SUBSTANCE: described are methods of producing simvastatin. In one version, the method is realised by reacting monocalin J and acyl thioester, which donates an acyl group to the C8 hydroxyl group of monacolin J in the presence of LovD acyltransferase; and LovD acyltransferase and regioselective acylation of the C8 hydroxyl group of monocalin J with LovD acyltransferase using the acyl group of acyl thioester. In the second version, the method is realised by reacting lovastatin and acyl thioester, which donates an acyl group to the C8 hydroxyl group of monacolin J in the presence of LovD acyltransferase and LovD acyltransferase and effect of LovD acyltransferase which leads to hydrolysis of lovastatin to monocalin J and using the acyl group of acyl thioester for regioselective acylation of the C8 hydroxyl group of monocalin J.

EFFECT: invention widens the range of the means of producing simvastatin.

12 cl, 24 dwg, 5 tbl, 4 ex

FIELD: medicine.

SUBSTANCE: what is described is fatty acid synthetase of a sequence presented in the description. What is specified is a polynucleotide coding such synthetase. What is presented is a vector containing such polynucleotide. Besides, what is also described is a transformed microbial organism containing such vector or polynucleotide. The transformed microbial organism is used to produce fatty acids. What is offered is a method for producing a lipid or a fatty acid that involves transformant cell culture followed by recovering the lipid or the fatty acid from such cells. What is described is a method for assessment of ability to form fatty acids based on the measurement of an expression level of fatty acid synthetase having a nucleotide sequence of specified polynucleotide. Also, there is presented a method for selection of microbial lipid-producing organisms that is based on the comparison of the expression levels of specified gene in a reference and tested microbial organism.

EFFECT: invention provides producing high-yield fatty acids.

17 cl, 1 dwg, 2 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: claimed is version of neutral metaloproteinase of wild type Bacillus, which has, at least, 80% identity with sequence, presented in description and having mutations in amino acid sequence in positions, also described in description. Described is method of ferment obtaining, which includes transformation of host-cell by vector, which contains polynucleotide, which codes one of metaloproteinase versions, and culturing of transformed cell in suitable conditions. Described are purifying composition, which contains claimed ferment, and method of fabric and textile purification, which includes stage of bringing surface and/or product from fabric or textile into contact with purifying composition.

EFFECT: claimed invention makes it possible to expand spectrum of means applied for surfaces purification, products of fabric or textile.

28 cl, 12 tbl, 35 dwg, 29 ex

FIELD: medicine.

SUBSTANCE: genetically modified microorganisms having DNA encoding polypeptide involved in biosynthesis of macrolide compound of pladienolida, and DNA encoding polypeptide having hydroxylase activity aimed at pladyenolides hydroxylation in 16-position are proposed. The invention enables to produce effectively macrolide compound hydroxylated in the 16-position, directly in a single microorganism.

EFFECT: obtained compound has a high antitumor activity and can be used to develop anticancer drugs.

17 cl, 4 dwg, 7 tbl, 18 ex

FIELD: agriculture.

SUBSTANCE: nucleotide sequences, which code polypeptides of resistance to glyphosate are used in structures of DNA or expression cassettes for transformation or expression in organisms, including microorganisms and plants.

EFFECT: transformed organisms become resistant to herbicide.

17 cl, 5 dwg, 11 tbl, 23 ex

FIELD: medicine.

SUBSTANCE: trans-sialydase enzyme has been recovered from a unicell Trypanosoma congolense. Trans-sialydase is characterised by one of the following amivo acid sequences: SEQ ID NO:2, SEQ ID NO:4 or a sequence being 75% identical with one of said sequences.

EFFECT: extended range of enzymes with trans-sialydase activity.

6 cl, 3 dwg, 1 tbl, 6 ex

FIELD: chemistry; biochemistry.

SUBSTANCE: invention relates to biotechnology and is a method of producing staphylokinase using an OXY-1 cassette with sequence SEQ ID No. 1. The cassette is part of two plasmids with international inventory numbers BPL-0020 and BPL-0021, which are transformed strains of bacteria E. coli for producing staphylokinase.

EFFECT: possibility of obtaining highly effective staphylokinase.

16 cl, 11 dwg, 4 ex

FIELD: medicine.

SUBSTANCE: there is offered method for identification and/or verification of inhibitors of receptor tyrosine kinases that involves application of a new test system which represents a yeast host cell containing an expression vector including a nucleic acid sequence that encodes fused protein essentially consisting of a complete cytoplasmic part of analysed receptor tyrosine kinase and the dimerisation domain and, if necessary, in addition including anchoring sequence for fused protein in a membrane wherein expression of fused protein conduces to termination of cell proliferation. The method provides production of specified host cells being in contact with a candidate compound and identification of inhibitors of tested tyrosine kinase activity as a result of cultivation on the assumption that inhibition of tyrosine kinase activity with a candidate compound causes restoration of proliferation process.

EFFECT: prospected application of the invention is related to development of selective therapeutic, including anticancer, agents.

13 cl, 5 dwg, 2 ex

FIELD: technological processes; medicine.

SUBSTANCE: variant contains one or several modifications in the area, which is limited by amino acids 16-153 of sphingosinekinase of wild type. Invention also stipulates the molecule of nucleonic acid that contains sequence that codes this sphingosinekinase. According to the present invention, sphingosinekinase may be used for prophylactics or treatment of decease of mammals, which is characterised with abnormal, unwanted or other improper activity of cells.

EFFECT: preparation of new sphingosinekinase with reduced catalytic activity.

24 cl, 15 dwg, 4 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: invention refers to a probe for detecting and a kit (versions) for detecting target nucleic acid, a spacer applicable to be attached to a target-specific probe sequence and a method for detecting any interaction of said probe and target nucleic acid. The probe comprises: a binding group which enables binding the probe and a particle-like substrate surface; a spacer; and a target-specific oligonucleotide probe sequence. The spacer comprises: the oligonucleotide spacer of at least 20 nucleotides between the target-specific oligonucleotide probe sequence and the substance-bound group, containing the homopolymer polythymine spacer and the heteropolymer spacer of repeated nucleotide links specified in a group consisting of TTG, TTTG, AAG, AAC, AAAG and AAAC; and optionally the carbon spacer of 12 - 30 carbon links between the target-specific oligonucleotide probe sequence and the substance-bound group.

EFFECT: invention enables detecting target nucleic acid and increasing the signal-noise relation in the kits.

25 cl, 4 dwg, 42 tbl, 12 ex

Up!