Agonist notch3 antibodies and application thereof for treating notch3-associated diseases

FIELD: medicine.

SUBSTANCE: there are offered: there are offered: an agonist antibody or its functionally active fragment which specifically bind to an epitope containing the first domain Lin 12 Notch3 and activate the signal pathway Notch3. What is described is a labelled antibody and a humanised antibody of their basis. There are offered: a coding nucleic acid, a cell for producing the antibody containing said NA, as well as an expression vector. What is described is a method for producing the antibody by cell cultivation. What is disclosed is applying the antibody for preparing a drug for treating a Notch3-associated disease or disorder. What is described is applying the antibody for diagnosing the Notch3-associated disease or disorder.

EFFECT: use of the invention can find application in medicine in treating and diagnosing the CADASIL diseases.

26 cl, 11 dwg, 6 tbl, 11 ex

 

CROSS REFERENCES TO RELATED APPLICATIONS

This application claims priority based on provisional application U.S. No. 60/852861, filed October 19, 2006, and provisional application U.S. No. 60/879218, filed January 6, 2007, the descriptions of which are incorporated herein by reference in its entirety.

The technical FIELD of the INVENTION

The present invention relates to an agonistic antibody against Notch3 and to their application to improve, treat, cure or prevention of Notch3-associated diseases or disorders.

The LEVEL of TECHNOLOGY

Gene Notch was first described in 1917, when it was discovered that the canvas wings strain of fruit fliesDrosophila melanogasterhave notches (Morgan, Am Nat 51:513 (1917)). Almost seventy years later, the gene was cloned and found that it encodes a cell surface receptor that plays a key role in the development of many types of cells and tissues of Drosophila (Wharton et al., Cell 43:567 (1985)). It was soon discovered that the Notch signaling pathway is a mechanism mediated by the contacting of the cells, and evolution is conservative from Drosophila to man. Found that Notch receptors are involved in many cellular processes such as differentiation, solution of cell death, the maintenance of stem cells, motor activity cell proliferation and apoptosis in different cell types in the ECCE development and tissue homeostasis (review can be found in Artavanis-Tsakonas, et al., Science 268:225 (1995)).

In mammals found four receptor protein Notch (denoted Notch1-Notch4) and five corresponding ligands (denoted Delta-like ligand-1 (DLL-1), Delta-like ligand-3 (DLL-3), Delta-like ligand-4 (DLL-4), Jagged-1 and Jagged-2). The genes of the Notch receptor mammals encode proteins with a size of ~300 kDa, which are oxidized during transport to the cell surface and exist in the form of heterodimers. Extracellular fragment of Notch receptor contains thirty-four epidermal growth factor (EGF)-like repeats and three repeat enriched with cysteine Notch/LIN12. The connection between the two split subunits is carried out with the participation of the sequences located in the N-terminal and C-terminal region of the cleavage site, and these two subunits are domains heterodimerization Notch (HD) (Wharton, et al., Cell 43:567 (1985); Kidd, et al., Mol Cell Biol 6:3431 (1986); Kopczynski et al., Genes Dev 2:1723 (1988); Yochem et al., Nature 335:547 (1988)).

At present it is not clear how Notch signaling pathway is regulated by different receptors or five ligands differ in the contribution to the signal transmission or regulation. Differences in the signal transmission and/or regulation may be determined by the nature of their expression in different tissues or in different environmental conditions. It is shown that ligand Notch proteins, including Jagged/Serrate and Delta/Delta-like, SP is able to specifically contact area EGF repeat and to induce receptor-mediated signaling pathway Notch (review published Bray, Nature Rev Mol Cell Biol. 7:678 (2006), and Kadesch, Exp Cell Res. 260:1 (2000)). From EGF repeats 10th-12threquired for binding of ligand to the receptor Notch and the other repeats of EGF can enhance the interaction of the receptor with ligand (Xu, et al., J Biol Chem. 280:30158 (2005); Shimizu, et al., Biochem Biophys Res Comm. 276:385 (2000)). Although replays LIN12 domain and the dimerization does not participate directly in the binding of the ligand, they play an important role in maintaining the heterodimeric protein complex, preventing the ligand-independent splitting under the action of proteases and activation receptor (Sanche-Irizarry, et al., Mol Cell Biol. 24:9265 (2004); Vardar et al., Biochem. 42:7061 (2003)).

Self-maintenance and the determination of the metabolic pathway of normal stem cells from many tissues, including the tissues of the intestines and nervous tissue, dependent on Notch signaling pathway (Fre, et al., Nature, 435: 964 (2005); van Es et al., Nature, 435: 959 (2005); Androutsellis-Theotokis et al., Nature, 442: 823 (2006)). Therefore, agonistic antibody Notch3 can be used for the treatment of degenerative diseases. CADASIL (cerebral autosomal dominant arteriopathy with subcortical infarcts and leucoencephalopathy) causing stroke and dementia, characterized by the symptoms of which include subcortical ischemic events and multi-infarct dementia. Discovered that CADASIL is associated with the localization of the mutant gene on chromosome 19 (Joutel et al., Nature 383:707 (1996)). Joutel et al. identified patients who CADASIL mutations, which cause serious disruption of the gene Notch 3, therefore, patients with CADASIL may have a defective Notch3 protein. Unfortunately, this disease is highly debilitating and often lethal, remains largely undiagnosed or wrongly diagnosed as multiple sclerosis and Alzheimer's disease. Ongoing studies tend to show that this condition is far more widespread than thought at first.

Another example of Notch3-associated disease is a family hemiplegic migraine (FHM), a dominant-autosomal form of migraine with harbinger epileptic seizure related disorder, situated in the same part of chromosome 19 that Notch3 gene. It should be noted that more than 30% of patients suffering from CADASIL, also suffer from migraines with harbinger epileptic seizure. However, the latter disease is only about 5% of the population, and the results obtained indicate that Notch3 gene is involved in the mechanism of this condition. Likewise, family paroxetina ataxia is associated with the gene located in the same part of chromosome 19, and we can conclude that Notch3 is involved in the development of this condition. Other conditions and diseases associated with Notch3 include all the I's syndrome Alagille (Flynn, et al., J Pathol 204:55 (2004)).

Currently conducting research to identify other diseases and conditions associated with lack of expression and/or Notch3 signaling pathway. Since there are a large number of human diseases associated with signaling by Notch 3, it is important to identify new ways to prevent and treat these diseases. The present invention offers new agonistic antibodies against Notch3, which can be used to meet the needs of medicine.

The INVENTION

The present invention offers new agonistic antibodies and fragments thereof that specifically bind to an epitope of human Notch3 receptor in LIN12 domain. Another aspect of the present invention includes the epitope-binding site and antibodies that bind the same epitope as the antibody of the present invention. Antibodies of the present invention activated Notch3-mediated signaling pathway via receptor Notch3 independently of ligand binding.

This invention provides amino acid sequences of variable regions of heavy and light chains of antibodies and the corresponding nucleotide sequence. Another embodiment of the present invention includes sequences of CDRs of these antibodies.

Another embodiment n the present invention includes cell lines and vectors, bearing sequences of the antibodies of the present invention.

The present invention also includes the epitope recognized agonistic antibodies of the present invention. In addition, the present invention includes antibodies that bind the epitope. Embodiments include epitope Notch3 containing Lin12 domain, the sequence of which at least 80%, 85%, 90% or 95% identical to SEQ ID NO:10. More specifically, the epitope Notch3 contains SEQ ID NO:11. The present invention includes agonistic antibodies that bind the epitope.

Another embodiment of the present invention relates to the use of these antibodies in the manufacture of a medicament or composition for the treatment of Notch3-associated diseases and disorders associated with, for example, inactivation of the receptor.

Another embodiment of the present invention relates to the use of these antibodies for the treatment of Notch3-associated diseases or disorders associated with, for example, inactivation of the receptor, including compensation for these defects, for example, through activation of Notch3 signaling pathway independently of ligand binding. Notch3-associated disorders may include, without limitation, CADASIL, familial hemiplegic migraine (FHM), family paroxetine ataxia syndrome Alagille and the other is the development of degenerative diseases.

BRIEF DESCRIPTION of FIGURES

1 shows the amino acid sequence of Notch3. The plot of the EGF repeat extends from amino acid residue 43 to amino acid residue 1383; LIN12 domain extends from amino acid residue 1384 to amino acid residue 1503; and dimerization domain extends from amino acid residue 1504 to amino acid residue 1640.

Figure 2 (A-H) shows a comparative picture of the amino acid sequences of human Notch1, notch2 is, Notch3 and Notch4.

Figure 3 shows the percentage of identity Notch 1, Notch 2, Notch 3 and Notch 4.

On figa and 4B depict the sequence of variable regions of heavy and light chain of monoclonal antibody MAb 256A-13 against Notch3 (SEQ ID NO: 2), and sections CDRs are underlined.

Figure 5 shows the results of luciferase reporter analysis of example 5, showing the activating action of MAb against Notch3 receptor Notch3.

Figure 6 shows the effect of agonistic antibodies Notch3 on metalloprotease cleavage of Notch3.

Figure 7 shows epitope mapping of the binding site 256A-13 of hybrid structures of proteins Notch3-Fc.

On Fig comparative image obtained by recombinant method sequence that encodes a leader peptide Notch3, and native sequence that encodes a leader peptide Notch3 (access number in NCBI GenBank: NM_00035), demonstrating that recombinant sequence encoding a leader peptide Notch, bring about changes in nucleotide composition (8A) and causes changes translated amino acid sequence (8B). On figs depicted LIN12 domain, and fig.8D shows the epitope subdomain LIN12.

Figure 9 shows a receiving structure with swapped domains by PCR-SOE. Rectangles with arrows indicate the PCR primers. Unfilled rectangles refer to the sequence of Notch3. The shaded rectangles are the sequence of Notch1.

Figure 10 depicts the amino acid sequence used for epitope mapping of LIN12 domain of Notch3 MAb 256A-13.

Figure 11 depicts alanine scanning peptide used for linear epitope mapping 256A-13.

DETAILED description of the INVENTION

The invention described here is not limited to particular methods, schemes, cell lines, vectors or agents, as they may vary. In addition, as used in this document terminology is intended only to describe specific embodiments and does not restrict the scope of the present invention. In this description and in the accompanying claims, unless the context indicates otherwise, the singular includes the plural,for example, the term "a host cell" includes the aggregate of such host cells. Unless otherwise noted, all used here is the technical and scientific terms, as well as all abbreviations have traditional values, known to those of ordinary skill in the scope of this invention. In this description provides examples of the methods, devices and materials when carrying out the present invention it is possible to use any methods and materials similar or equivalent described.

All the above mentioned patents and publications incorporated in this description by reference to the extent permitted by law for the description and disclosure of the indicated proteins, enzymes, vectors, host cells and methods suitable for use in the present invention. However, the information contained herein should not be construed as an admission that the present invention gives the right to treat this information as the prior art and to oppose it to the previous invention.

Definition

The terms used in the text of this application, should be interpreted in their traditional values, known to ordinary skilled in the art. However, the following terms are the authors of this application propose to use in particular the following values.

The phrase "almost identical" with respect to the sequence of polypeptide chain antibodies may indicate that the sequence of the anti-Christ. ate, at least 70%, or 80%, or 90%, or 95%identical to the comparable polypeptide sequence. In relation to the nucleotide sequence of this term may mean that the nucleotide sequence at least 85%, or 90%, or 95%, or 97% identical to the compared nucleotide sequence.

The term "identity" or "homology" should be understood as the percentage of amino acid residues in the sequence candidate, identical residues of the sequence, with which compare the sequence-candidate determined after aligning the sequences and introducing gaps, if necessary to achieve the maximum percent identity of the whole sequence, and conservative substitutions are not considered as part of the identity sequence. N - or C-terminal extension or insertion should not be construed as reducing identity or homology. The alignments and computer programs for their implementation are well known in this field. The sequence identity can be determined using a program for analyzing sequences.

The term "antibody" is used in its broadest sense, namely, it covers monoclonal antibodies (including full-size monoclonal antibodies), polyclonal antibodies, and specyficzne antibodies (for example, bispecific antibodies), and antibody fragments having the desired biological activity. Antibodies (Ab) and immunoglobulins (Ig) are glycoproteins that have the same structural features. While antibodies have binding specificity towards a particular target, the antibodies include antibodies and other antibody-like molecules, not having specificity towards the target. Antibodies of this invention can be any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgG1, IgG2, IgG3, IgG4, IgA1 and IgA2) or subclass. Native antibodies and immunoglobulins, as a rule, are heterotetrameric glycoproteins of approximately 150000 daltons, which consist of two identical light (L) chains and two identical heavy (H) chains. Each heavy chain contains at one end a variable domain (VH), followed by a number of constant domains. Each light chain contains at one end a variable domain (VL), and on the other end of the constant domain.

In this description, the term "antibody against Notch3" refers to an antibody that specifically binds to human Notch3, activating signaling pathway Notch 3 regardless of the ligand.

The term "variable" as applied to the domain of the antibody indicates that the sequence is kotoryj plots variable domains differ greatly among different antibodies and are responsible for specific binding of specific antibodies with a specific target. However, throughout the variable domains of antibodies, the variability is not evenly distributed. It is concentrated in three segments called plots, complementarity determining (CDR; i.e., CDR1, CDR2 and CDR3), or hypervariable sites, which are present in variable domains, both light and heavy chains. More conservative fragments of variable domains are called the frame sections (FR). All the variable domains of native heavy and light chains contain four sections FR, which, as a rule, are β-folded configuration and are connected by three CDRs, forming a loop-like connection and, in some cases, part of the β-folded structure. CDR of one chain are held together in close proximity by the FR plots and together with other CDR circuits are involved in the formation of the binding site of the antibody with the target (see Kabat, et al. Sequences of Proteins of Immunological Interest, National Institute of Health, Bethesda, Md. (1987)). Unless otherwise specified, in this specification, the numbering of amino acid residues of the immunoglobulin used a system of numbering amino acid residues of the immunoglobulin Kabat, et al.

The term "antibody fragment" refers to a fragment of the full-length antibody, generally the area, linking the target, or to the variable area. Examples of fragments of antibodies include fragments F(ab), F(ab'), F(ab')2and Fv. The phrase "function is optional fragment or analog of the" antibody refers to the connection, with quantitative biological activity that is similar to the biological activity of full-length antibodies. For example, a Functional fragment or analog of an antibody against Notch3 able to contact the Notch3 receptor, preventing or significantly reducing the ability of the receptor to contact with ligands or to initiate signal transmission. In this description, the term "functional fragment" as applied to the antibody belongs to the fragments Fv, F(ab) and F(ab')2. Fragment of "Fv" is a dimer composed of the variable domain of one heavy and variable domain of one light chain, located in close non-covalent linkages (dimer VH-VL). In this configuration, the three CDRs of each variable domain interact, forming a binding site on a target on the surface of the dimer VH-VL. Together, the six CDR determine the ability of the antibodies specifically bind to a target. However, even a single variable domain (or half of an Fv, containing only three CDRs specific to the target) has the ability to recognize and bind the target, albeit with a lower affinity than the entire binding site.

Antibody fragments "single-chain Fv" or "sFv" contain VHand VLdomains of antibodies, and these domains are in the same polypeptide chain. Generally, the Fv polypeptide also soda is separated by a polypeptide linker between domains V Hand VLthat enables the sFv to form the structure required for binding of the target.

The term "diately" refers to small fragments of antibodies containing two antigen-binding site, and these fragments in a single polypeptide chains contain variable domain of the heavy chain (VH)connected to the variable domain of the light chain (VL). By applying a linker that is too short to allow you to mate the two domains located on the same chain, the domains are forced to pair with complementary domains of another chain forming two antigen-binding sites.

Fragment F(ab) contains the constant domain of the light chain and the first constant domain (CH1) of the heavy chain. Fragments F(ab') differ from the fragments F(ab) the addition of a few residues at the carboxyl end of the domain SN heavy chain including one or more cysteine residues in the hinge area of the antibodies. Fragments F(ab') obtained by cleavage of the disulfide bond formed by the cysteine residues of the hinge section, the product of cleavage by pepsin F(ab')2. Specialists in this area and other known chemical ways of connecting fragments of antibodies.

The term "monoclonal antibody" in the present description refers to an antibody obtained from a population of almost homogeneous antibodies, so what. from the population, the individual antibodies which are identical except for possible natural mutations that may be present in minor amounts. Monoclonal antibodies in accordance with the present description include "chimeric" antibodies (immunoglobulins)in which a portion of the heavy and/or light chain is identical with or homologous to corresponding sequence in antibodies derived from an animal of a particular species or belonging to a particular class or subclass of antibody, and the remainder of the chain (chain) is identical with or homologous to corresponding sequence in antibodies derived from another animal species or belonging to another class or subclass antibodies as well as fragments of such antibodies that possess the desired biological activity (U.S. patent No. 4816567; and Morrison, et al., Proc Natl Acad Sci USA 81:6851 (1984)). Monoclonal antibodies have a high specificity and directed against a single target area. In addition, in contrast to conventional (polyclonal) antibody preparations that typically consist of different antibodies directed against different determinants (epitopes), each monoclonal antibody is directed against one of the determinants of the target. In addition to specificity advantage of monoclonal antibodies is the possibility of their synthesis in hybridoma culture that is allows to avoid contamination of other immunoglobulins. The definition of "monoclonal" indicates that the antibody obtained from an almost homogeneous population of antibodies, and should not be interpreted as belonging to any particular method of obtaining. For example, monoclonal antibodies suitable for use in the present invention, can be isolated from phage libraries of antibodies using well known methods. The original monoclonal antibodies for use in accordance with the present invention can be obtained by using the hybridoma method first described by Kohler, et al, Nature 256:495 (1975)or using recombinant methods.

"Humanized" forms of inhuman (e.g., murine) antibodies are chimeric immunoglobulins, chains of immunoglobulins or fragments thereof (such as Fv, Fab, Fab', F(ab')2or other target-binding suppositionally of antibodies)that contain minimal sequence nonhuman immunoglobulin. As a rule, almost all variable domains gumanitarnogo antibodies from at least one or, more often, two contain all or almost all areas CDR corresponding non-human immunoglobulin and all or almost all of the FR plots, the corresponding matrix sequence of a human immunoglobulin. Humanitariannet antibody may also contain, at IU is e, the constant part of the plot (Fc) of an immunoglobulin, typically selected from human matrix immunoglobulin.

The terms "cell", "cell line" and "cell culture" include the offspring. It should be understood that not all offspring can be identical to the parent cells by DNA content due to the presence of deliberate or inadvertent mutations. In the scope of the present invention also includes variant offspring with the same function or biological properties as the original transformed cell. "Cell bosses"used in the present invention, are typically prokaryotic or eukaryotic cells.

"Transformation" cell organism, cells or cell lines using DNA is carried out by introducing DNA into the target cell or in the form of an extrachromosomal element or by integration into the chromosome by using a process that preserves the ability of DNA to replicate. "Transfection of cells or organism the DNA molecule is the absorption of DNA, for example, the expression vector, cell or organism, regardless of whether expressed whether in fact any of the coding sequence or not. The terms "transfusiona a host cell" and "transformed a host cell" refers to a cell, to the which the introduced DNA. Cell, called a host cell can be prokaryotic or eukaryotic. Typical prokaryotic cell hosts include various strains of E. coli. A typical eukaryotic cell hosts are mammalian cells, such as cells of the ovary of the Chinese hamster and human cells. The introduced DNA sequence may belong to the same species, as a host cell, or to another species, or it may be a hybrid DNA sequence containing several alien and several homologous DNA.

The term "vector" refers to the construction of DNA containing the DNA sequence is functionally linked to a suitable control sequence capable of expression of the DNA in a suitable host. Such control sequences include a promoter, providing transcription, an optional sequence of operator control such transcription, a sequence encoding suitable sites for the binding of mRNA by the ribosome, and sequences that control the termination of transcription and translation. The vector may be a plasmid, a phage particle, or simply a potential genomic insert. After transformation into a suitable host, the vector may replicate and function independently of the t genome of the host, or in some cases, it may integrate into the genome itself. In the present description, the terms "plasmid" and "vector" are sometimes used interchangeably as the plasmid is the most commonly used form of vector. However, it is assumed that the invention includes other known in this field, forms of vectors which serve equivalent functions.

"Mammal"to be treated may be any animal belonging to the class of mammals, and includes human, manual and farm animals, non-human primates, and wild animals, sport animals or Pets, such as dogs, horses, cats, cows and other

The term "marker" in this description refers to detectivemisa connection or detectable composition, which can be conjugated directly or via other connections to the molecule or protein such as an antibody. The token itself may be detektivami (e.g., radioisotope labels or fluorescent labels) or, in the case of an enzyme marker that can catalyze detective chemical modification of the substrate compound or substrate composition.

In this description, the term "solid phase" means a non-aqueous basis, which may stick EN is Italo of the present invention. Examples of solid phases included in the scope of the present invention include phase obtained partially or entirely of glass (e.g., glass, controlled pore size), polysaccharides (e.g., agarose), polyacrylamides, polystyrene, polyvinyl alcohol and silicone compounds. In some embodiments, depending on the context, the solid phase can be well analytical tablet; in other embodiments the solid phase can be a column for purification (for example, a column for affinity chromatography).

In this description, the term "Notch3-oposredovannoe violation" refers to a condition or disease characterized by defective or decreased expression of Notch3 receptor, namely the term may include state, associated with degenerative diseases, such as CADASIL, FHM, family paroxetina ataxia syndrome Allegra and other degenerative diseases.

The NOTCH3 receptor as an immunogen, causing the formation of antibodies

Soluble target or their fragments can be used as immunogens to generate antibodies. The antibody directed against the interest of the target. Preferably, the target is biologically important polypeptide, and the introduction of the antibody to a mammal suffering from diseases or disorders, which may have a beneficial therapeutic effect in a mammal. As immunogen to generate antibodies can be used whole cells. The immunogen can be obtained using recombinant or synthetic methods. The immunogen can also be distinguished from a natural source.

In the case of transmembrane molecules, such as receptors, as immunogen you can use fragments thereof (e.g., the extracellular domain of the receptor). Alternatively, as the immunogen can be used cells expressing transmembrane molecules. Such cells can be obtained from a natural source (for example, from a line of cancer cells) or by transformation of the original cells using recombinant methods for enhanced expression of transmembrane molecules. Professionals in this field are known and other forms of immunogens that can be used to generate antibodies.

Alternatively, a gene or cDNA encoding a human Notch3 receptor, can be cloned into a plasmid or other expression vector and Express in any expression system using methods well known to specialists in this field. Methods cloning and expression of the Notch3 receptor and its nucleotide coding sequences described in the literature (see, for example, U.S. patent No. 5821332 and 5759546). Due to the degeneracy of the genetic code can be used is W ith a large number of nucleotide sequences, encoding the receptor protein or the polypeptide Notch3. The nucleotide sequence can be varied by selecting combinations based on possible codon. These combinations receive in accordance with the triplet genetic code used in the nucleotide sequence that encodes a natural receptor Notch3, and you can consider all the variations. Any of these polypeptides can be used for immunization of an animal with the purpose of obtaining antibodies that bind the human Notch3 receptor.

Due to the high conservative amino acid sequence of Notch3 as immunogens to generate antibodies can also be used recombinant Notch3 proteins of other species. Comparison of human and mouse Notch3 shows that over 90% of the amino acid sequences of the two species are identical.

Immunogenic receptor Notch3 if necessary, you can Express in the form of a hybrid protein containing the Notch3 receptor, coupled with hybridization fragment. Hybridization fragment often facilitates protein purification, for example, allows you to isolate and purify the hybrid protein by the method of affinity chromatography, and, in addition, it can also be used to enhance immunogenicity. Hybrid proteins can be obtained by culturing recombinante the cells, transformed hybrid nucleotide sequence that encodes a protein with attached at the carboxy or amino-end of the hybridization fragment. Hybridization fragments may include, without limitation, sections Fc antibodies, glutathione-S-transferase, β-galactosidase, polyhistidine fragment capable of contact with a divalent metal ion, and binding protein maltose.

Recombinant receptor Notch3 protein, as described in example 1, is used to immunize mice in order to obtain hybridomas producing monoclonal antibodies of the present invention. Examples of polypeptides include full-size sequence of SEQ ID NO:1 and fragments or variants.

Antibodies

Antibodies of the present invention can be obtained using any suitable method known in this field. Antibodies of the present invention may comprise polyclonal antibodies. Methods of obtaining polyclonal antibodies known to experienced professionals (Harlow, et al., Antibodies: a Laboratory Manual, Cold spring Harbor Laboratory Press, 2nd ed. (1988)), the contents of this publication are included in the present description by reference in its entirety).

For example, as described in example 1, the immunogen can enter different animal hosts, including without limitation, rabbits, mice, to us and others, inducyruya the production of sera containing polyclonal antibodies specific to the antigen. The introduction of the immunogen may include one or more immunizing injection means and, if necessary, adjuvant. To enhance the immunological response, you can use different adjuvants, which depend on the type of the owner and shall include, without limitation, beta-blockers (complete and incomplete), mineral gels such as aluminum hydroxide, surface active substances such as lysolecithin, plutonomy polyols, polyanion, peptides, oil emulsions, hemocyanin lymph snails, dinitrophenol, and potentially useful human adjuvants such as BCG (Bacillus Calmette-guérin (BCG) andCorynebacterium parvum. Other examples of suitable adjuvants include adjuvant MPL-TDM (monophosphoryl lipid A, synthetic dikarenakan trehalose). Schemes of immunization are well known in this field and can be any known in the field in ways that cause an immune response selected from an animal host. Adjuvants well known in this field.

Typically, the immunogen (together with adjuvant or without adjuvant) is administered to the mammal by multiple subcutaneous or intraperitoneal injection, either intramuscularly or intravenously. The immunogen may include himself polypeptide Notch3, a hybrid protein or its variants. Depending on the nature of the polypeptide (i.e. the degree of hydrophobicity, degree of hydrophilicity, stability, total charge, isoelectric point, and others), it is sometimes useful to konjugierte the immunogen protein, which obviously is immunogenic for the immunized mammal. Such conjugation is carried out either by chemical methods by derivatization of the active chemical functional groups on the subject conjugation immunogen or immunogenic proteins with formation of covalent bonds, or by using methods for hybrid proteins, or other methods known to experts in this field. Examples of such immunogenic proteins include, without limitation, hemocyanin lymph snails, ovalbumin, serum albumin, bovine thyroglobulin, inhibitor soybean trypsin, and various peptides T-helper cells. As described above, to enhance the immune response can be used with different adjuvants.

Antibodies of the present invention include monoclonal antibodies. Monoclonal antibodies are antibodies that recognize a single antigenic site. Their uniform specificity makes monoclonal antibodies much more useful than polyclonal antibodies, which usually contain antibodies that recognize several different ant the genetic plots. Monoclonal antibodies can be obtained using hybridoma technology, such as described in Kohler, et al., Nature 256:495 (1975); U.S. Patent No. 4376110; Harlow, et al., Antibodies: A Laboratory Manual, Cold spring Harbor Laboratory Press, 2nd ed. (1988) and Hammerling, et al., Monoclonal Antibodies and T-Cell Hybridomas, Elsevier (1981), methods of recombinant DNA or other techniques known to experts in this field. Other examples of methods that can be used to obtain monoclonal antibodies include, without limitation, the method is a hybrid of human B-cells (Kosbor et al., Immunology Today 4:72 (1983); Cole, et al., Proc Natl Acad Sci USA 80:2026 (1983)), and the method EBV-hybrid (Cole, et al., Monoclonal Antibodies and Cancer Therapy, pp. 77-96, Alan R. Liss (1985)). Such antibodies can refer to any class of immunoglobulins, including IgG, IgM, IgE, IgA, IgD, and any subclass. Hybridoma producing MAb of the present invention, can be cultivated in vitro or in vivo.

In the hybridoma method, host, such as a mouse, humanitariannet mouse, a mouse with a human immune system, hamster, rabbit, camel, or any other suitable animal host are subjected to immunization to induce formation of lymphocytes that produce or are capable of producing antibodies that specifically bind to the protein used for immunization. Alternatively, the lymphocytes can immunize in vitro. Then lymphocytes hybridized with myeloma cells using a suitable the th hybridize agent, such as polyethylene glycol, and get a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, pp.59-103 (1986)).

As a rule, to obtain hybridomas producing antibodies, use either peripheral blood lymphocytes ("PBL"), if desired human cells or spleen cells or lymph node, if there are cells of a mammal other than man. Then lymphocytes hybridized with immortalizing cell line using a suitable hybridize agent, such as polyethylene glycol, and get a hybridoma cell (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, pp. 59-103 (1986)). An immortalized cell line, as a rule, are transformed mammalian cells, particularly myeloma cells of rodent, bovine or human. Usually use a line of myeloma cells rat or mouse. Hybridoma cells can be grown in a suitable culture medium that preferably contains one or more substances that inhibit the growth or survival dehybridization immortalized cells. For example, if the parental cells do not contain the enzyme hypoxanthineguanine-phosphoribosyltransferase (HGPRT or HPRT), the culture medium for the hybridomas typically contains gipoksantin, aminopterin and thymidine ("medium HAT"), substances that prevent the growth of HGPRT-deficient cells.

Preference is sustained fashion termed cell lines are lines which effectively hybridize, maintain stable high-level production of antibodies selected antibody-producing cells, and are sensitive to this environment, as a HAT. To these myeloma cell lines are cell line murine myeloma, for example, derived from murine tumors MOPC-21 and MPC-11, which can be obtained from the Salk Institute Cell Distribution Center, San Diego, Calif. U.S. Application No., and cells SP2/0 or X63-Ag8-653, which can be obtained from the American type culture collection, Rockville, Md. USA. Also described that for obtaining human monoclonal antibodies can be used cell line human myeloma and mouse-human heteromyinae (Kozbor, J Immunol 133:3001 (1984); Brodeur, et al., Monoclonal Antibody Production Techniques and Applications, Marcel Dekker, Inc., pp.51-63 (1987)). In addition, you can use the cell line of mouse myeloma NSO (Europeiska collection of cell cultures, Salisbury, Wilshire, UK).

Culture medium in which hybridoma is grown cells examined for the presence of monoclonal antibodies against Notch3. The binding specificity of monoclonal antibodies produced by hybridoma cells may be determined by the method thus or by analysis of binding in vitro, such as radioimmunological assay (RIA) or ELISA assay (ELISA). Such methods are known in this area and belong to the sphere is ompetency relevant professionals. Affinity binding of monoclonal antibodies against Notch3 can be defined, for example, through analysis of Scatchard (Munson, et al., Anal Biochem 107:220 (1980)).

After identification of hybridoma cells that produce antibodies with the desired specificity, affinity and/or activity, the clones can be subclinical method of serial dilutions and grown by standard methods (Goding, Monoclonal Antibodies: Principles and Practice, Academic Press, pp.59-103 (1986)). Suitable for this purpose culture medium include, for example, modified by Dulbecco Wednesday Needle (D-MEM) or medium RPMI-1640. In addition, the hybridoma cells can be grown in vivo in the animal body in the form of ascitic tumors.

Monoclonal antibodies secreted by the subclones can be separated or distinguished from the culture medium, ascitic fluid, or serum by conventional methods of purification of immunoglobulins, such as, for example, the use of protein a-sepharose, chromatography on hydroxyapatite, exclusion gel chromatography, gel electrophoresis, dialysis, or affinity chromatography.

In this area there are a number of methods for obtaining monoclonal antibodies and, therefore, this invention is not limited only to their production in hybridomas. For example, monoclonal antibodies can be obtained using methods of recombinant DNA, such as described is haunted in U.S. patent No. 4816567. In this context, the term "monoclonal antibody" refers to an antibody obtained from a single eukaryotic, phage or prokaryotic clone. DNA encoding the monoclonal antibodies of this invention can be easily isolated and sequenced using conventional methods (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chains of murine antibodies, or such chains of human, humanized or other sources) (Innis, et al. In PCR Protocols. A Guide to Methods and Applications, Academic (1990), Sanger, et al., Proc Natl Acad Sci 74:5463 (1977)). Cell hybridoma serve as a source of DNA. After DNA extraction can be placed into expression vectors, which are then transferout cell host, such as E. coli cells, NSO cells, simian COS cells, cells of the Chinese hamster ovary (CHO), or myeloma cells that do not normally produce immunoglobulin protein, providing a synthesis of monoclonal antibodies in the recombinant cell host. DNA also can be modified, for example, by introducing sequences encoding the constant domains of human heavy and light chains instead of the homologous murine sequences (U.S. patent No. 4816567; Morrison, et al., Proc Natl Acad Sci USA 81:6851 (1984)) or by covalent joining sequence, the coding of immunoglobu is h, full-length or partial sequence that encodes a polypeptide other than an immunoglobulin. So, other than immunoglobulin polypeptide can be used instead of the constant domains of the antibodies of the present invention or instead of the variable domains of one antigen-binding site of the antibodies of the present invention with obtaining a chimeric bivalent antibody.

Antibodies may be monovalent. Methods of obtaining monovalent antibodies are well known in this field. For example, one method involves recombinant expression of the light chain and modified heavy chain of the immunoglobulin. Typically, a heavy chain shortened at any point of the plot Fc to prevent cross-linking the heavy chains. Alternatively, to prevent cross-linking, the relevant cysteine residues are substituted with other amino acid residues or removed.

Fragments of antibodies that recognize specific epitopes, can be obtained using known methods. Typically, such fragments produced by proteolytic cleavage of intact antibodies (see, e.g., Morimoto, et al., J Biochem Biophys Methods 24:107 (1992); Brennan, et al., Science 229:81 (1985)). For example, Fab fragments and F(ab')2the present invention can be obtained by proteolytic cleavage of immunoglobulin molecules, using such fer the coefficients, as papain (to obtain Fab fragments) or pepsin (to obtain fragments F(ab')2). Fragments F(ab')2contain variable area, constant area light chain and the CH1 domain of the heavy chain. However, these fragments can be directly produced by recombinant cell host. For example, antibody fragments can be isolated from ragovoy library of antibodies. Alternatively, the fragments F(ab')2-SH can directly select from E. coli and chemically combine with obtaining fragments F(ab')2(Carter, et al., Bio/Technology 10:163 (1992)). In accordance with another approach, the fragments F(ab')2you can directly select from the culture of the recombinant host cells. Qualified professionals and other known methods of obtaining fragments of antibodies. In other selected embodiments, the antibody is a single-chain Fv fragment (Fv) (patent application PCT WO 93/16185).

In some cases, includes the use of antibodies in humans in vivo and detectiona analyses in vitro, it is preferable to use chimeric, humanized or human antibodies. A chimeric antibody is a molecule in which different fragments of antibodies derived from animals of different species, such as the antibody containing the variable plot murine monoclonal antibody and a constant area of the human them is noglobulin. Methods of obtaining chimeric antibodies are known in this field. See, for example, Morrison, Science 229:1202 (1985); Oi et al., BioTechniques 4:214 (1986); Gillies, et al., J Immunol Methods 125:191 (1989); U.S. patent No. 5807715; 4816567; and 4816397, which is incorporated into this description by reference in its entirety.

Humanitariannet antibody has a higher degree of homology to the human immunoglobulin than monoclonal antibodies derived from animals. Humanization is a method of obtaining a chimeric antibodies, in which the fragment has been replaced by corresponding non-human sequence, substantially less than an intact human variable domain. Humanized antibodies are antibody molecules containing substances that occur in animals other than the human species, which bind the target antigen and contain one or more hypervariable sites (CDR) non-human species and frame sections (FR) molecules of human immunoglobulin. Often, to alter, preferably improve, antigen binding, the frame remains in the human frame sections are substituted with the corresponding residues of the antibodies in the donor CDR. These replacement frame section is determined using well known in the field of methods, for example by modeling the interactions of residues of the CDR and framework Uch is SDA, identifying the remains of the skeleton of the site involved in the binding to the antigen, and compare sequences, allowing to identify unusual remnants of the frame section in the specific provisions. See, for example, U.S. patent No. 5585089; Riechmann, et al., Nature 332:323 (1988), which is fully incorporated into this description by reference. Antibodies can humanize using a variety of methods known in this field, such as CDR grafting (EP 239400; PCT publication WO 91/09967; U.S. patent No. 5225539; 5530101; and 5585089), coating or application of a new coating (EP 592106; EP 519596; Padlan, Molecular Immunology 28:489 (1991); Studnicka et al., Protein Engineering 7:805 (1994); Roguska, et al., Proc Natl Acad Sci USA 91:969 (1994)) and shuffling circuit (U.S. patent No. 5565332).

As a rule, humanitariannet antibody contains one or more amino acid residues from a superhuman source. Such inhuman amino acid residues, which are typically taken from an "import" variable domain, often referred to as "import" residues. Humanization basically can be performed according to the method of Winter and co-authors (Jones, et al., Nature 321:522 (1986); Riechmann, et al., Nature 332:323 (1988); Verhoeyen, et al., Science 239:1534 (1988)) through the use of nonhuman CDR or CDR sequences instead of the corresponding sequences of a human antibody. Accordingly, such "humanized" antibodies are chimeric anti the La (U.S. patent No. 4816567), in which the fragment has been replaced by corresponding non-human sequence, substantially less than an intact human variable domain. In fact, humanized antibodies are typically human antibodies in which some CDR residues and, optionally, some FR residues replaced by similar parts of rodent antibodies.

In addition, it is important to humanized antibodies retain high affinity for the antigen and other useful biological properties. To achieve this objective, in accordance with the preferred method, humanized antibodies obtained after the analysis of the original sequences and various conceptual humanized products using three-dimensional models of the source and humanized sequences. Three-dimensional models of immunoglobulins are widely available and well-known experts in this field. There are computer programs which illustrate and display probable three-dimensional conformational structures of selected immunoglobulin sequence candidates. The analysis of the images allows to make a conclusion about the possible role of certain residues in the functioning of the immunoglobulin sequences of the candidate, i.e. to identify residues that affect production ability is here immunoglobulin candidate to bind antigen. Using this method, you can select and combine the remains of FR recipient and import sequences so as to maximize the desirable characteristics of the antibodies, such as increased affinity for the target antigen (antigens), although the direct and the strongest influence on the binding of antigen have CDR residues.

When obtaining humanized antibodies choice of human variable domains, both light and heavy chains, is important to reduce antigenicity. In accordance with the so-called method of "best match" sequence of the variable domain of the non-human antibodies are subjected to screening against a library of known human sequences of the variable domains. Then the human sequence that best matches the nonhuman original antibodies accept as human FR gumanitarnogo antibody (Sims et al., J Immunol 151:2296 (1993); Chothia, et al., J Mol Biol 196:901 (1987)). In another method uses a particular frame plot derived from a consensus sequence of all human antibodies of a particular subgroup of light or heavy chains. The same frame area can be used for several different humanized antibodies (Carter, et al., Proc Natl Acad Sci USA 89:4285 (1992);Presta, et al., J Immunol 151:2623 (1993)).

For therapeutic treatment of patients-people it is desirable to use a fully human antibody. Human antibodies can be obtained by using a number of well-known in the field of methods, which include the above-described methods of phage display using libraries of antibodies derived from the sequences of human immunoglobulins. Cm. also U.S. patent No. 4444887 and 4716111; and PCT publication WO 98/46645, WO 98/50433, WO 98/24893, WO 98/16654, WO 96/34096, WO 96/33735, and WO 91/10741; which are incorporated in this description by reference in its entirety. To obtain human monoclonal antibodies can also use methods Cole, et al. and Boerder, et al. (Cole, et al., Monoclonal Antibodies and Cancer Therapy, Alan R. Riss (1985); and Boerner, et al., J Immunol 147:86 (1991)).

Human antibodies can also be obtained using transgenic mice that fail to Express functional endogenous immunoglobulins, but can Express the genes of the human immunoglobulin. For example, the set of genes of the heavy and light chains of the immunoglobulin can be entered randomly or by homologous recombination in embryonic stem cells of the mouse. An alternative to embryonic stem cells mouse in addition to the genes of the human heavy and light chains can introduce genes of the human variable area, constant participants of the a-and D-phase. Genes of murine heavy and light chain immunoglobulin can result in non-functional condition separately or simultaneously with the introduction of the locus of human immunoglobulin by homologous recombination. In particular, homologous deletion of the site JH prevents production of homologous antibodies. Modified embryonic stem cells are grown and injected by means of microinjection into blastocysts, receiving chimeric mice. Then chimeric mice crossed and receive homozygous offspring expressing human antibodies. See, for example, Jakobovitis, et al., Proc Natl Acad Sci USA 90:2551 (1993); Jakobovitis, et al., Nature 362:255 (1993); Bruggermann et al., Year in Immunol 7:33 (1993); Duchosal, et al., Nature 355:258 (1992)). Transgenic mice subjected to immunization in the usual way with a selected antigen, for example a full-size polypeptide of this invention or its fragment. Monoclonal antibodies directed against the antigen can be obtained from the immunized transgenic mice using conventional hybridoma technology. The transgenes of human immunoglobulins contained in transgenic mice, are rearrangeable in the process of differentiation of B-cells and then switch class and somatic mutations. Thus, using this method it is possible to obtain antibodies of IgG, IgA, IgM and IgE, are suitable for therapeutic applications. The review of the specified technology is the technology of obtaining human antibodies can be found in Lonberg, et al., Int Rev Immunol 13:65-93 (1995). A detailed discussion of this technology for obtaining human antibodies and human monoclonal antibodies, and methods of obtaining such antibodies can be found, for example, in PCT publications WO 98/24893; WO 92/01047; WO 96/34096; WO 96/33735; European patent No. 0598877; U.S. patents№№ 5413923; 5625126; 5633425; 5569825; 5661016; 5545806; 5814318; 5885793; 5916771; and 5939598, which are included in this description in its entirety. In addition, companies such as Abgenix, Inc. (Freemont, Calif.), Genpharm (San Jose, Calif.) and Medarex, Inc. (Princeton, N.J.) can be manufactured to order human antibodies against a selected antigen using technology similar to that described above.

In addition, a human MAb can be obtained by immunization of mice that were transplanted human peripheral blood leukocytes, splenocytes or bone marrow (for example, methods XTL Trioma). Completely human antibodies which recognize a selected epitope can be obtained by using a method called "guided selection". In this way the selected nonhuman monoclonal antibody, such as a mouse antibody, is used to control the selection of a completely human antibody recognizing the same epitope (Jespers, et al., Bio/technology 12:899 (1988)).

In addition, antibodies against the polypeptides of the present invention, in turn, can be used to obtain antiidiotypic ant the phone, that "mimic" polypeptides of the present invention, using methods well-known to specialists in this field (see, for example, Greenspan, et al., FASEB J 7:437 (1989); Nissinoff, J Immunol 147:2429 (1991)). For example, antibodies that bind to the polypeptide and inhibit the competitive multimerization polypeptide and/or binding polypeptide of the present invention with a ligand, can be used to obtain antiidiotype that "mimic" multimerization polypeptide and/or binding domain and, as a consequence, bind to the polypeptide and/or its ligand and neutralize them. Such neutralizing antiidiotype or Fab fragments of such antiidiotype can be used in therapeutic regimens to neutralize ligand polypeptide. For example, such antiidiotypic antibodies can be used for binding of the polypeptide of the present invention, and/or to bind its ligands/receptors, thus blocking its biological activity.

Antibodies of the present invention can be bispecific antibodies. Bispecific antibodies are monoclonal, preferably human or humanized antibodies that can specifically bind at least two different antigens. In the present invention one of specificdate binding can be directed is and Notch3, and one on the other antigen, and preferably represents a protein cell surface receptor, receptor subunit, tissue-specific antigen, a viral protein, viral envelope protein, a bacterial protein, or bacterial surface protein and other

Methods of obtaining bispecific antibodies are well known. Typically, the recombinant method of obtaining bispecific antibodies based on simultaneous expression of two pairs of heavy/light chains of immunoglobulin, where the two heavy chains have different specificity (Milstein, et al., Nature 305:537 (1983)). Due to the random rearrangement of the heavy and light chains of immunoglobulin, these hybridoma (quadrigemina) can produce a mixture of ten different antibody molecules, of which only one has the correct bispecific structure. The selection of the correct molecule is usually carried out by the method of affinity chromatography. Such methods are described in WO 93/08829 and Traunecker, et al., EMBO J 10:3655 (1991).

The variable domains of the antibodies with the desired binding specificity (areas in which the antibody combines with the antigen) can be hybridizing sequences of the constant domains of immunoglobulins. For hybridization, it is preferable to use the constant domain of the heavy chain of immunoglobulin containing at least a portion of the hinged section, portions of CH2 and CH3. He m which may contain the first constant domain of the heavy chain (CH1), includes site necessary for binding to the light chain is present at least in one of the hybrids. DNA encoding the hybrid heavy chain immunoglobulin and, if desired, the light chain immunoglobulin, are inserted into separate expression vectors, which together transferout in a suitable host organism. A more detailed description of the methods of obtaining bispecific antibodies can be found, for example, Suresh et al., Meth In Enzym 121:210 (1986).

Heteroconjugate antibodies are also included in the scope of the present invention. Heteroconjugate antibodies consist of two covalently linked antibodies. Such antibodies, for example, can be used to target immune system cells to unwanted cells (U.S. patent No. 4676980). Such antibodies can be obtained in vitro using methods known in the field of synthetic protein chemistry, for example using cross-linking reagents. For example, immunotoxins can be obtained by using a disulfide exchange reaction or by formation of a thioester linkages. Examples of reagents suitable for such reactions include aminothiols and methyl-4-mercaptopyrimidine and reagents disclosed, for example, in U.S. patent No. 4676980.

You can also get single-domain antibodies against Notch3. Methods of obtaining such antibodies are described in WO9425591 for example, ant the body, derived from the heavy chain Ig Camelidae, in addition, US20030130496 describes the allocation of single-domain full-sized human antibodies from phage libraries.

In addition, it is possible to obtain single-stranded peptide binding molecules that contain connected sites Fv heavy and light chain. Single-chain antibody (scFv), and the retrieval method described in U.S. patent No. 4946778. Alternatively, using similar methods, you can construct and Express the Fab. All fully or partially human antibodies are less immunogenic than fully murine MAb, and fragments and single-chain antibodies are less immunogenic.

Antibodies or antibody fragments can be isolated from phage libraries of antibodies obtained using the techniques described in McCafferty et al., Nature 348:552 (1990). Clarkson, et al., Nature 352:624 (1991) and Marks et al., J Mol Biol 222:581 (1991)describe, respectively, the secretion of mouse and human antibodies using phage libraries. Subsequent publications describe the obtaining of high affinity (nm range) human antibodies by shuffling circuits (Marks, et al., Bio/Technology 10:779 (1992)), as well as combinatorial infection and recombination in vivo as a way of obtaining very large phage libraries (Waterhouse et al., Nuc Acids Res 21:2265 (1993)). These methods are viable alternatives to traditional GI is reanim methods of producing monoclonal antibodies.

In addition, you can modify DNA, for example, by introducing sequences encoding human constant domains of the heavy and light chains, instead of the homologous murine sequences (U.S. patent No. 4816567; Morrison, et al., Proc Natl Acad Sci USA 81:6851 (1984)).

Another alternative when getting a hybrid is the use of more electric hybridization than chemical hybridization. This method is well developed. Instead hybridization transformation of B-cells with obtaining immortalized cells can be carried out, for example, using Epstein-Barr or transforming gene. See, for example, "Continuously Proliferating Human Cell Lines Synthesizing Antibody of Predetermined Specificity," Zurawaki, et al., in Monoclonal Antibodies, ed. by Kennett, et al, Plenum Press, pp.19-33. (1980)). MAb against Notch3 can be obtained by immunization of rodents (e.g. mice, rats, hamsters and Guinea pigs) Notch3 protein, a hybrid protein or its fragments expressed in eukaryotic or prokaryotic systems. For immunization can be used, and other animals, such as non-human primates, transgenic mice expressing immunoglobulins, and mice with severe combined immunodeficiency (SCID), which were transplanted human B-lymphocytes. Hybridoma can be obtained using traditional methods by hybridization of B-lymphocytes the myeloma cells of immunized animals (for example, Sp2/0 and NSO), as previously described (Kohler, et al., Nature 256:495 (1975)). In addition, antibodies against Notch3 can be obtained after screening a recombinant single-chain Fv or Fab libraries In human lymphocytes using phage display. The specificity of MAb against Notch3 can be analyzed using the methods of ELISA, Western Western blot turns, or other immunochemical methods. The inhibitory activity of antibodies to activate complement can be estimated using hemolytic assays classical pathway of complement with the use of sensitized red blood cells chickens or sheep. Hybridoma of the positive holes clone by the serial dilution method. Antibodies to purify and analyze their specificity to human Notch3 using the above methods.

Identification of antibodies against NOTCH3

The present invention provides agonistic monoclonal antibodies that activate Notch3-mediated signaling pathway independently of ligand. In particular, antibodies of the present invention associated with Notch3 and activate it. Antibodies of the present invention include an antibody, denoted 256A-13. The present invention also includes antibodies that bind to the same epitope as 256A-13.

Antibodies candidates against Notch3 analyzed by immunoassay methods is verdiano assay (ELISA), Western Western blot turns, or other immunochemical methods. The analyses used to characterize the specific antibodies described in the examples.

Antibodies of the present invention include, without limitation, polyclonal, monoclonal, monovalent, bispecific, heteroconjugate, polyspecific, human, humanized or chimeric antibodies, single-chain antibodies, single domain antibodies, Fab fragments, fragments F(ab'), fragments obtained using expression libraries Fab, antiidiotypic (anti-Id) antibodies (including, e.g., anti-Id antibodies against the antibodies of the present invention), and epitope-binding fragments of the above antibodies.

The antibody can be a human antigen-binding antibody fragments of the present invention, which include, without limitation, Fab, Fab' and F(ab')2, Fd, single-chain Fv (scFv), single-chain antibodies, disulfide-linked Fv (sdFv) and single domain antibodies containing either a VL or VH domain. Antigen-binding antibody fragments, including single-chain antibodies, can only contain variable plot (plots), or variable plot in conjunction with the whole of the hinge parts, domains, CH1, CH2 and CH3 or their parts. The present invention also encompasses antigen-svyazyvayus the fragments, containing any combination of variable plot (plots) with a hinged section, domains, CH1, CH2 and CH3. Antibodies of this invention can be derived from any animal source, including birds and mammals. Preferably, the antibodies may be derived from human, non-human Primate, rodent, such as mouse and rat), donkey, sheep, rabbit, goat, Guinea pig, camel, horse, or chicken.

In this description, "human" antibodies include antibodies having the amino acid sequence of a human immunoglobulin, including antibodies isolated from libraries of human immunoglobulin or from animals transgenic for one or more human immunoglobulins, and not expressing endogenous immunoglobulins, as opisane below and, for example, in U.S. patent No. 5939598, Kucherlapati, et al.

Antibodies of the present invention can be monospecificity, bispecific, trapezitinae or polyspecificity. Polyspecific antibodies may be specific for different epitopes of the Notch3, or they can be specific to Notch3 and heterologous epitope, such as a heterologous polypeptide or solid-phase carrier. See, for example, PCT publication WO 93/17715; WO 92/08802; WO 91/00360; WO 92/05793; Tutt, et al., J Immunol 147:60 (1991); U.S. patent№№ 4474893; 4714681; 4925648; 5573920; 5601819; Kostelny, et al., J Immunol 148:1547 (199).

Antibodies of the present invention can be described or characterized in terms of the epitope (epitope) or fragment (fragments) Notch3, which they recognize and specifically bind. The epitope (epitope) or polypeptide fragment (fragments) can be described as specified in this document, for example, by N-terminal and C-terminal positions, by number of contiguous amino acid residues, or they can be found in the tables and drawings.

Antibodies of the present invention can also be described or characterized with respect to their cross-reactivity. In the scope of the present invention also includes antibodies that bind polypeptides Notch3 and are at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 65%, at least 60%, at least 55%, at least 50% identical Notch3 (identity calculated using known in the field and described in this document). Antibodies against Notch3 can also contact other proteins, such as antibodies against Notch3 from species other than the species, against whom used antibody against Notch3, with KDmay be less than approximately 10-7M, less than about 10-6M, or less than approx the tion 10 -5M.

In some embodiments the antibodies of the present invention may cross-interact with monkey homologues of human Notch3 and their respective epitopes. In one embodiment of the above-mentioned ability to cross-interaction refers to one specific antigenic or immunogenic to the polypeptide or to a combination of (combinations of) specific antigenic and/or immunogenic polypeptides disclosed in this specification.

The present invention also encompasses antibodies that bind polypeptides encoded by polynucleotides that in tough conditions hybridize with polynucleotides, encoding Notch3. Antibodies of the present invention may also be described or characterized from the point of view of the affinity of the binding relative to the polypeptide of the present invention. Preferred affinity binding is characterized by an equilibrium dissociation constant or KDbeing in the range from 10-8up to 10-15M, from 10-8up to 10-12M, from 10-8up to 10-10M, or 10-10up to 10-12M. the invention also provides antibodies that inhibit competitive antibody binding to the epitope of the present invention, which is determined using any known in this field method for determining competitive binding, for example, with the aid of the described here immunological analyses. In preferred embodiments, the antibody competitively inhibits binding to the epitope by at least 95%, at least 90%, at least 85%, at least 80%, at least 75%, at least 70%, at least 60%or at least 50%.

Vectors and cells of the host

In another aspect the present invention provides a selected nucleotide sequence encoding the variant antibodies, as described herein, the vector constructs containing the nucleotide sequence encoding the antibody of the present invention, the cells of the host containing the vector, and recombinant methods for producing antibodies.

To get the variant antibodies by recombinant method, encoding its nucleic acid is isolated and inserted into a replication competent vector for further cloning (amplification of the DNA) or expression. DNA encoding the variant antibodies can be easily isolated and sequenced using conventional methods (e.g., by using oligonucleotide probes that can specifically bind to genes encoding the heavy and light chain variant antibodies). To obtain cell lines expressing antibodies of the present invention, it is possible to use standard techniques for cloning and transformation.

Ve the Torah

There are many vectors. Typically, the vector contains, without limitation, one or more of the sequences, comprising: a signal sequence, the starting point of replication, one or more marker genes, an enhancer, a promoter, and the sequence termination of transcription. Recombinant expression vectors containing the nucleotide sequence encoding the antibody of the present invention, can be obtained using well known methods. The expression vectors containing the nucleotide sequence is functionally associated with the appropriate nucleotide sequences that regulate transcription or translation, for example, obtained from mammalian genes, microbes, viruses, or insects. Examples of regulatory sequences include promoters for transcription, operators, enhancers, binding sites of the ribosomal mRNA and/or other suitable sequences that control the initiation and termination of transcription and translation. Nucleotide sequences are "functionally linked"when the regulatory sequence is in functional connection with the sequence that encodes the corresponding polypeptide. Thus, the nucleotide sequence of the promoter functionally linked, for example, the sequence is, encoding heavy chain antibodies, if the nucleotide sequence of the promoter regulates the transcription of the corresponding nucleotide sequence.

In addition, the expression vectors may contain sequences encoding appropriate signal peptides that are in nature not associated with the sequences encoding the heavy and/or light chain antibodies. For example, the nucleotide sequence encoding a signal peptide (secretory leader sequence), can be linked in reading frame sequence that encodes the polypeptide, so that the antibody secretarials in periplasmatic space or environment. Signal peptide that is functional in the intended cells masters, enhances extracellular secretion of the corresponding antibodies. The signal peptide can be chipped off from the polypeptide upon secretion of the antibody from the cell. Examples of such secretory signals are well known and include, for example, the signals described in U.S. patent No. 5698435; 5698417; and 6204023.

The vector may be a plasmid vector, single-stranded or double-stranded phage vector, or single-stranded or double-stranded RNA or DNA vector. Such vectors can be entered into cells in the form of polynucleotides using well-known methods introduction the Oia DNA and RNA in cells. Phage and viral vectors can also be entered in the cells in packaged or encapsulated using well-known methods of infection and transduction. Viral vectors can be competent or defective replication. In the latter case, the replication of the virus usually occurs only in complementing cells masters. In addition, to obtain the protein you can use a cell-free system broadcast using RNAS derived from the DNA structures of the present invention. Such vectors may include the nucleotide sequence encoding the constant portion of the molecule antibodies (see, for example, PCT publication WO 86/05807 and WO 89/01036; and U.S. patent No. 5122464), this vector can be cloned variable domain antibodies with subsequent expression of the heavy or light chain.

Cell host

Antibodies of the present invention it is possible to Express in any suitable cell host. In the present invention as host cells can be used prokaryotic, yeast or higher eukarioticalkie cells, examples of which include, without limitation, microorganisms such as bacteria (e.g. E. coli, B. subtilis)transformed by DNA recombinant bacteriophage expression vectors based on the plasmid or kosmidou DNA containing successively the tee, encoding the antibody; yeast (for example Saccharomyces, Pichia)transformed by recombinant yeast expression vectors containing sequences encoding the antibody; system of insect cells infected with recombinant virus expression vectors (e.g. Baculovirus)containing the sequence encoding the antibody; systems of plant cells infected with recombinant virus expression vectors (e.g., cauliflower mosaic virus, CaMV; tobacco mosaic virus, TMV)or transformed with recombinant plasmid expression vectors (e.g., Ti plasmid)containing the sequence encoding the antibody; or mammalian cells (such as COS cells, CHO, BHK, 293, 3T3)carrying the recombinant expression constructs containing promoters derived from the genome of mammalian cells (for example, the promoter metallothionein) or from mammalian viruses (e.g., the late promoter of adenovirus; the promoter of the vaccinia virus 7.5K).

Prokaryotes, suitable for use as host cells of the present invention include gram-negative or gram-positive organisms, such as E. coli, B. subtilis, Enterobacter, Erwinia, Klebsiella, Proteus, Salmonella, Serratia and Shigella, as well as Bacilli, Pseudomonas and Streptomyces. Preferred for cloning host E. coli is E. coli 294 (TCC 31446), although you can use other strains, such as E. coli B, E. coli X1776 (ATCC 31537), and E. coli W3110 (ATCC 27325). The examples are illustrative rather than limiting.

The expression vectors used in prokaryotic cells-owners, usually contain one or more marker genes phenotypic selection. Marker gene phenotypic selection represents, for example, a gene encoding a protein that is responsible for resistance to antibiotics or for the satisfaction of autotrophic requirements. Examples of expression vectors that can be used in prokaryotic cells-hosts include vectors derived from commercially available plasmids such as pKK223-3 (Pharmacia Fine Chemicals, Uppsala, Sweden), pGEM1 (Promega Biotec, Madison, Wisconsin., USA) and a series of pET vectors (Novagen, Madison, Wisconsin, USA) and pRSET (Invitrogen, Carlsbad, CA) (Studier, J Mol Biol 219:37 (1991); Schoepfer, Gene 124:83 (1993)). Promoter sequences commonly used in expression vectors recombinant prokaryotic host cells include T7, (Rosenberg, et al., Gene 56:125 (1987)), β-lactamase (penicillinase), lactose promoter (Chang, et al., Nature 275:615 (1978); Goeddel, et al., Nature 281:544 (1979)), the system promotors tryptophan (trp) (Goeddel, et al., Nucl Acids Res 8:4057 (1980)) and the tac promoter (Sambrook, et al., Molecular Cloning, A Laboratory Manual, 2nd ed., Cold Spring Harbor Laboratory (1990)).

Yeast or hyphomycetes, suitable for use in the present invention, on the require-organisms of the genera Saccharomyces, Pichia, Actinomycetes, Kluyveromyces, Schizosaccharomyces, Candida, Trichoderma, Neurospora, and such hyphomycetes, as Neurospora, Penicillium, Tolypocladium, and Aspergillus. Yeast vectors usually contain a sequence of early replication of the yeast 2µ plasmid, the sequence of Autonomous replication (ARS), promoter plot, sequence, polyadenylation sequence, termination of transcription and marker gene selection. Promoter sequence suitable for yeast vectors include, among others, promoters of metallothionein, 3-phosphoglycerate (Hitzeman, et al., J Biol Chem 255:2073 (1980)) or other glycolytic enzymes (Holland, et al., Biochem 17:4900 (1978)), such as enolase, glyceraldehyde-3-phosphate dehydrogenase, glucokinase, piruvatcarboksilazy, phosphofructokinase, glucose-6-fortismere, 3-phosphoglyceromutase, piruwatkinaza, triazolopyrimidine, phosphoglucomutase and glucokinase. Other vectors and promoters suitable for carrying out expression in yeast, is also described in Fleer, et al., Gene 107:285 (1991). Other promoters and vectors suitable for yeast transformation yeast are well known in this field. Methods of transformation of yeast is widely known. An example of such a method is described in Hinnen, et al., Proc Natl Acad Sci 75:1929 (1978). The method of Hinnen based on selection of transformants Trp+ in selective medium.

For expression of recombinant antibodies t is the train you can use the system for cell cultures of the host mammals or insects. In principle, you can use any culture of higher eukaryotic cells such as vertebrates and invertebrates. Examples of invertebrate cells include cells of plants and insects (Luckow, et al., Bio/Technology 6:47 (1988); Miller, et al., Genetics Engineering, Setlow et al., eds. Vol. 8, pp. 277-9, Plenam Publishing (1986); Mseda, et al., Nature 315:592 (1985)). For example, to obtain heterologous systems, you can use the Baculovirus system. In systems of insects for the expression of foreign genes as an expression vector, you can use the nuclear polyhedrosis virus scoops of California alfalfa (AcNPV). The virus is grown in cells of Spodoptera frugiperda. The sequence encoding the antibody can be cloned separately in essentially areas (e.g., the polyhedrin gene) of the virus under the control of an AcNPV promoter (for example the polyhedrin promoter). Other identified hosts include Aedes, Drosophila melanogaster and Bombyx mori. A number of viral strains for transfection is publicly available, for example, a variant L-1 AcNPV and strain Bm-5 Bombyx mori NPV, which can be used as a virus in accordance with the present invention, particularly for transfection of cells Spodoptera frugiperda. In addition, as host cells can also be used for the culture of plant cells of cotton, maize, potato, soybean, Petunia, tomato, and tobacco.

The use of cells of vertebrates, and that the same propagation of vertebrate cells in culture (tissue culture) are routine procedures. Cm. Tissue Culture, Kruse, et al., eds., Academic Press (1973). Examples of suitable cell lines host mammalian cells are monkey kidney; kidney cells of a human embryo; kidney cells baby hamster; the cells of the Chinese hamster ovary/-DHFR (CHO, Urlaub, et al., Proc Natl Acad Sci USA 77:4216 (1980)); mouse Sertoli cells; carcinoma cells human cervical (HELA)cells of the kidney of the dog; human lung cells; liver cells human; tumor cells of the mammary gland of the mouse; and NSO cells.

Cell owners transform the above vectors to ensure the production of antibodies and cultured in conventional nutrient medium, modified, zavisimosti circumstances, so as to induce the promoter sequence controlling transcription and translation, to make the selection of transformants, or amplifying the target genes encoding the target sequence. Commonly used promoter and enhancer sequence derived from virus polyoma, adenovirus 2, monkey virus 40 (SV40), and human cytomegalovirus (CMV). The DNA sequence of the genome of SV40 virus can be used for other genetic elements used for the expression of the sequence of the structural gene in the cells of the host mammal, which include the replication origin SV40 early and late promoter, enhancer, the point of splicing and polyadenylation sites. Especially useful are the viral early and late promoters, because both can be easily obtained from a viral genome as a fragment, which can also contain the viral replication origin. Typical expression vectors for use in the cells of the host mammal are commercially available.

Cell owners used to obtain variants of the antibodies of the present invention, can be grown in different environments. For culturing the host cells can be used commercially available medium such as ham's F10 (Sigma, St Louis, MO), minimal essential medium (MEM, Sigma, St Louis, MO), RPMI-1640 (Sigma, St Louis, MO) and modified by Dulbecco Wednesday Needle (DMEM, Sigma, St Louis, MO). Moreover, as culture media for the host cells can be used any of the media described in Ham et al., Meth Enzymol 58:44 (1979), Barnes, et al., Anal Biochem 102:255 (1980), and in U.S. patents№№ 4767704; 4657866; 4560655; 5122469; 5712163; or 6048728. If necessary, any of these media may be supplemented with hormones and/or other growth factors (such as insulin, transferrin, or epidermal growth factor), salts (such as X-chlorides, where X is sodium, calcium, magnesium, and phosphate), buffers (such as HEPES), nucleotides (such as adenosine and thymidine), antibiotics (such as a drug GENTAMYCINTM), trace elements (neo the organic compounds, the final concentrations which are typically in the micromolar range), and glucose or an equivalent energy source. May also be present in relevant concentrations of any other necessary additives, known to specialists in this field. The expression is carried out in culture conditions, including temperature, pH, etc. that were previously used for the selected host cells and known to those of ordinary skill in this field.

Polynucleotide encoding antibodies

This invention also provides polynucleotide or nucleic acid, for example DNA containing the nucleotide sequence encoding the antibody of the present invention, and fragments thereof. Examples of polynucleotides include polynucleotides that encode the chains of antibodies containing one or more of the described in this document amino acid sequence. This invention also covers polynucleotides that hybridize under tough conditions or in conditions of low stringency with polynucleotide encoding the antibody of the present invention.

Get polynucleotide and to determine their nucleotide sequence by using any known in the field of fashion. For example, if the nucleotide sequence of the antibody is known, poly is ucleotide, encoding the antibody may be assembled from chemically synthesized oligonucleotides (e.g., as described in Kutmeier, et al., Bio/Techniques 17:242 (1994)), in short, this method involves the synthesis of overlapping oligonucleotides containing fragments of the sequence encoding the antibody, annealing and ligation of these oligonucleotides, and then amplification legirovannykh oligonucleotides by PCR.

Alternatively, polynucleotide encoding the antibody can be obtained from nucleic acid isolated from a suitable source. If a clone containing a nucleic acid encoding a particular antibody is not available, but the sequence of the molecule of the antibody is known, a nucleic acid encoding the immunoglobulin, can be synthesized chemically or obtained from a suitable source (such as a cDNA library of antibodies or cDNA library, derived from, or nucleic acid, preferably poly A+RNA, isolated from, any tissue or cells expressing the antibody, such as cell hybridoma selected for expression of the antibodies of the present invention) by amplification by PCR using synthetic primers capable of gibridizatsiya with 3'- and 5'-ends of the sequence or by cloning using oligonucleotide probe specific to specific is sledovatelnot, to identify, for example, a cDNA clone from a cDNA library that encodes the antibody. Then amplificatoare nucleic acid obtained by the method of PCR can be cloned in replication competent vectors cloning using any known in the field of methods.

After determining the nucleotide sequence and corresponding amino acid sequence of the antibody has the nucleotide sequence of the antibody can be modified using well known in the field of methods of modification of the nucleotide sequence, such as, for example, methods of recombinant DNA-directed mutagenesis, PCR, and others (see, for example, the techniques described in Sambrook, et al., Molecular Cloning, A Laboratory Manual, 2nd ed, Cold Spring Harbor Laboratory (1990); and Ausubel, et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons (1998), which are incorporated in this description by reference in its entirety), to obtain antibodies with different amino acid sequences, for example, to make amino acid substitutions, deletions and/or insertions.

In a specific embodiment, the amino acid sequence of the variable domains of the heavy and/or light chain can be analyzed to identify sequences of CDR using well-known methods, for example, by comparison with known amino acid sequences of other vari is belnyj areas of heavy and light chains, to determine the hypervariable regions of the sequence. Using routine methods of recombinant DNA, one or more CDR you can insert in frame areas, such as in the human frame sections to humanize the inhuman antibody, as described above. The frame parts can be a natural or a consensus of frame sections, preferably, a human skeleton plots (enumeration human frame sections can be found, e.g., Chothia, et al., J Mol Biol 278: 457 (1998)). Preferably, polynucleotide resulting from the combination of the frame sections and CDRs encodes an antibody that specifically binds the polypeptide of the present invention. Preferably, as indicated above, the frame sections can be done one or more amino acid substitutions, which, preferably, improve binding of the antibody to the antigen. In addition, such methods can be used to perform substitutions or deletions of one or more cysteine residues of the variable segment, involved in the formation of interchain disulfide bonds, with the receipt of antibody molecules that have lost one or more interchain disulfide bonds. Other modifications of polynucleotides included in the scope of the present invention and fall within the purview of those skilled in about the region.

In addition, you can use the methods developed for "chimeric antibodies" (Morrison, et al., Proc Natl Acad Sci 81:851 (1984); Neuberger, et al., Nature 312:604 (1984); Takeda, et al., Nature 314:452 (1985)) by splicing the genes of a mouse antibody molecule with a corresponding specificity to the antigen genes and molecules of human antibodies with the corresponding biological activity. As stated above, the chimeric antibody is a molecule that contains fragments derived from different species, such as variable plot of a murine MAb and a constant area of the human immunoglobulin, an example of such molecules is humanitariannet antibody.

Alternatively, techniques described for obtaining single-chain antibodies (U.S. patent No. 4946778; Bird, Science 242:423 (1988); Huston, et al., Proc Natl Acad Sci USA 85:5879 (1988); and Ward, et al., Nature 334:544 (1989))can be adapted to obtain single-chain antibodies. Single-chain antibodies produced by the connection of the fragments Fv plots heavy and light chain through amino acid bridge with obtaining single-chain polypeptide. You can also use the methods in the Assembly of functional Fv fragments in E. coli (Skerra, et al., Science 242:1038 (1988)).

Methods for producing antibodies against NOTCH3

Antibodies of this invention can be obtained by means known in the field of methods for the synthesis of antibodies, in particular, by chemical the ski synthesis, or, preferably, by using methods of recombinant expression.

To make recombinant expression of the antibodies of the present invention, or fragment, derivative or analog (e.g., heavy or light chain of the antibody of the present invention or single-chain antibodies of the present invention), it is necessary to construct the expression vector containing polynucleotide that encodes the antibody or antibody fragment. After receiving polynucleotide encoding the antibody molecule using recombinant DNA technology it is possible to obtain a vector that provides products antibodies. Construct the expression vector containing the sequence encoding the antibody, and appropriate sequences that control transcription and translation. These methods include, for example, methods of DNA recombination in vitro, synthetic methods, and genetic recombination in vivo.

The expression vector is transferred into the cell host using traditional methods, then transfetsirovannyh cells cultivated in the usual way, receiving the antibody of the present invention. In one aspect of this invention, the vectors encoding the heavy and light chains, it is possible to Express in the cell host with obtaining a whole immunoglobulin molecules, as described below.

As described above, for the expression of m is of the antibody molecules of the present invention can use a number of systems of host-expression vector. These systems host-expression vector represent the means by which you can produce and then clear interest coding sequences, but they also represent cells which, after transformation or transfection of the appropriate nucleotide coding sequence that can Express the antibody molecule of the present invention in situ. For expression of recombinant antibody molecules, in particular for the expression of whole recombinant antibody molecules typically use bacterial cells such as E. coli, and eukaryotic cells. For example, mammalian cells such as CHO, in combination with a vector containing, for example, the major intermediate early gene promoter from human cytomegalovirus is an effective expression system antibodies (Foecking et al., Gene 45:101 (1986); Cockett, et al., Bio/Technology 8:2 (1990)).

In addition, you can choose the strain host cell that modulates the expression of the introduced sequences, or modifies and processes the gene product in the desired manner. Such modifications (e.g., glycosylation) and processing (e.g., cleavage) of protein products may have a large impact on the functioning of the protein. Different cell owners have characteristic and specific mechanisms for post-translational process the nga and modification of proteins and gene products. To ensure the correct modification and processing of the expressed foreign protein, it is necessary to choose the appropriate cell line or system owners. For this purpose you can use eukaryotic cells-owners who have a cellular mechanism for ensuring that the appropriate processing of the primary transcript, as well as the corresponding glycosylation and phosphorylation of the gene product. These cells are the owners of mammals include, without limitation, cells, CHO, COS, 293, 3T3, or myeloma cells.

In order to achieve long-term production of recombinant proteins with high yield, it is preferable to use a stable expression. For example, by genetic engineering it is possible to obtain a cell line stably expressing the antibody molecule. Cell owners preferable to not transform the expression vectors that contain viral starting point of replication, and DNA containing the appropriate elements of the regulation of expression (such as promoter, enhancer, sequences, transcription termination, polyadenylation sites, and others) and marker selection. After the introduction of foreign DNA recombinant cells are left to grow for one to two days in an enriched environment, which then change the environment for breeding. Marker selection present in the recombinant plasmid, pride the resistance to the conditions of breeding, allows the plasmid is stably integrated into the cell's chromosomes and grow cells before the formation of foci, which in turn can be cloned and grow with obtaining cell lines. This method can be successfully used to obtain cell lines expressing the antibody molecule. Such recombinant cell lines, in particular, can be used for screening and analysis of compounds that directly or indirectly interact with the antibody molecule.

You can use a number of breeding systems, including, without limitation, the use of genes timedancing of herpes simplex virus (Wigler, et al., Cell 11:223 (1977)), gipoksantin-guanine-phosphoribosyltransferase (Szybalska et al., Proc Natl Acad Sci USA 48:202 (1992)), and adenine-phosphoribosyltransferase (Lowy, et al., Cell 22:817 (1980)) in combination with tk-, hgprt - or aprt-cells, respectively. In addition, selection can be done based on resistance to antimetabolites using the following genes: dhfr, which confers resistance to methotrexate (Wigler, et al., Proc Natl Acad Sci USA 77:357 (1980); O'hare et al., Proc Natl Acad Sci USA 78:1527 (1981)); gpt, which confers resistance to mycophenolate acid (Mulligan, et al., Proc Natl Acad Sci USA 78:2072 (1981)); neo, which confers resistance to the aminoglycoside G-418 (Wu, et al., Biotherapy 3:87 (1991)); and hygro, which confers resistance to hygromycin (Santerre, et al., Gene 30:147 (1984)). For breeding is desirable is th recombinant clone, you can use the methods widely known in the field of recombinant DNA technology, such methods are described, for example, in Ausubel, et al., eds., Current Protocols in Molecular Biology, John Wiley & Sons (1993); Kriegler, Gene Transfer and Expression, A Laboratory Manual, Stockton Press (1990); and in chapters 12 and 13, Dracopoli et al., eds, Current Protocols in Human Genetics, John Wiley & Sons (1994); Colberre-Garapin, et al., J Mol Biol 150:1 (1981), which are incorporated in this description by reference in its entirety.

The level of expression of antibody molecules can be improved by amplification of the vector (a review of published Bebbington, et al., "The use of vectors based on gene amplification for the expression of cloned genes in mammalian cells," in DNA Cloning, Vol.3. Academic Press (1987)). If the marker of the vector system expressing antibody is capable of amplificates, raising the level of inhibitor present in culture of host cell leads to an increase in the number of copies of the marker gene. Because amplificatory area associated with the gene of the antibody, production of the antibody will also increase (Crouse et al., Mol Cell Biol 3:257 (1983)).

Cell host can work together to transliterate two expression vectors of the present invention, where the first vector encodes a polypeptide that is part of the heavy chain and the second vector encodes a polypeptide that is part of the light chain. Two vectors can contain identical markers selection, providing the same level of expression of the polypeptides of the heavy and light chains. Alternatively, you can use one century is the PR, which encodes and provides the expression of the polypeptides and heavy and light chain. In such cases, to avoid an excess of toxic free heavy chain sequence encoding a light chain should be placed before the sequence that encodes a heavy chain (Proudfoot, Nature 322:52 (1986); Kohler, Proc Natl Acad Sci USA 77:2197 (1980)). Sequences encoding the heavy and light chains may contain cDNA or genomic DNA.

After receiving the antibody molecules of the present invention by products in the body of the animal, chemical synthesis or recombinant expression, it can be cleaned using any known in the field of method of purification of immunoglobulin molecules, such as chromatography (e.g. ion exchange, affinity, particularly based on the fact that the affinity for the specific antigen greater than the binding affinity to protein A and size-exclusion chromatography), centrifugation, the use of the difference in solubilities, or using any other standard method of purification of proteins. In addition, to facilitate cleaning, the antibodies of the present invention or fragments thereof can be hybridizing with heterologous polypeptide sequences described herein or known in this field.

The present invention encompasses antibodies, hybridisable with the polypeptide with Ryoko is Benanti methods, or conjugated to the polypeptide by chemical methods (conjugation can be both covalent and non-covalent). Hybridisable or conjugated to the antibodies of the present invention can be used to facilitate purification. See, for example, PCT publication WO 93/21232; EP 439095; Naramura et al., Immunol Lett 39:91 (1994); U.S. patent No. 5474981; Gillies, et al., Proc Natl Acad Sci USA 89:1428 (1992); Fell et al., J Immunol 146:2446 (1991), which are incorporated in this description by reference in its entirety.

To facilitate cleaning, the antibodies of the present invention or fragments thereof can also be hybridizat to marker sequences, such as peptides. In preferred embodiments the marker amino acid sequence is exegetically peptide, for example, the token supplied in the vector pQE (QIAGEN, Inc., Chatsworth, CA), but you can use other sequences, many of which are commercially available. As described in Gentz, et al., Proc Natl Acad Sci USA 86:821 (1989), for traditional hybrid protein purification using, for example, hexastylis. Other peptide markers used for purification include, without limitation, the token "HA", which corresponds to the epitope of the ha protein of influenza virus (Wilson, et al., Cell 37:767 (1984)) and the marker flag.

Purification of antibodies

When using recombinant techniques variant antibodies m which can be produced in the intracellular or periplasmatic space or secretariats directly into the environment. If the variant antibody is produced inside the cell, in the first stage, by centrifugation or ultrafiltration can remove the dispersed debris, consisting of either host cells or from lysed fragments. Carter, et al., Bio/Technology 10:163 (1992) describe the method of selection of antibodies that are secreted into periplasmatic space of E. coli. Briefly, the cell mass is thawed in the presence of sodium acetate (pH 3.5), EDTA and phenylmethylsulfonyl (PMSF) over about 30 minutes. Cell debris can be removed by centrifugation. If the variant antibody is secreted into the medium, supernatant such expression systems first concentrated using a commercially available filters for concentrating proteins, such as devices for ultrafiltration Amicon or Millipore Pellicon. At all the above stages can be used protease inhibitors such as PMSF to inhibit proteolysis and antibiotics to prevent the random growth of contaminating organisms.

The composition of the antibody obtained from the cell can be cleaned, for example, chromatography on hydroxyapatite, gel electrophoresis, dialysis, and affinity chromatography, with affinity chromatography is the preferred method of cleaning. The possibility of using protein A in quality is TBE affinity ligand depends on the species and isotype of the Fc domain of immunoglobulin, present in the variant antibodies. Protein A can be used for purification of the antibody containing heavy chain of human IgG1, IgG2 or IgG4 (Lindmark, et al., J Immunol Meth 62:1 (1983)). To clear all mouse isotypes and for human IgG3 recommend the use of protein G (Guss, et al., EMBO J 5:1567 (1986)). As the base to which is attached an affine ligand, often use the agarose, but you can use other bases. Mechanically stable base, such as glass with controlled pore size or poly(Stradivari)benzene, allow the use of higher flow rates and shorter processing time than the agarose. If the antibody contains a CH3 domain, use for cleaning resin Bakerbond ABXTM (J. T. Baker; Phillipsburg, N.J.). You can also use other methods of protein purification such as fractionation on ionoobmennoi column, ethanol precipitation, HPLC on reversed phase chromatography on silica, chromatography on heparin-containing SEPHAROSETM, chromatography on anyone - or cation-exchange resin (for example, on a column with poliasparaginovaya acid), chromatofocusing, SDS-PAGE, and precipitation with ammonium sulfate, depending on the received variant antibodies.

After the preliminary stage (stages) purification of a mixture containing interest option antibodies and impurities that can lead gnut chromatography hydrophobic interactions at low pH values, using elution buffer having a pH in the range of 2.5 to 4.5, preferably at low salt concentrations (e.g., approximately in the range of 0-0 .25 M).

The pharmaceutical composition

Therapeutic compositions of the polypeptide or antibody can be obtained for storage in the form of lyophilised compositions or aqueous solutions by mixing the polypeptide having the desired degree of purity with optional pharmaceutically acceptable carriers, excipients or stabilizers typically used in this area (they all have the common name "excipients"), which include, sautereau means, stabilizing means, preservatives, tools, giving the solution isotonicity, non-ionic detergents, antioxidants and other heterogeneous additives. Cm. Remington''s Pharmaceutical Sciences, 16th edition, Osol, Ed. (1980). Such additives should be non-toxic to recipients at the used doses and concentrations.

Tabularasa tools help to maintain pH in the range close to physiological conditions. Preferably they are present in concentrations ranging from approximately 2 mm to approximately 50 mm. Tabularasa products suitable for use in the present invention include organic and inorganic acids and their salts, such as citrate buffers (EmOC is emer, a mixture of citrate monolatry and disodium citrate, a mixture of citric acid and trisodium citrate, a mixture of citric acid and citrate monolatry and others), succinate buffers (for example, a mixture of succinic acid and succinate of moonacre, for example, a mixture of succinic acid and sodium hydroxide, a mixture of succinic acid and succinate disodium and others), tartrate buffers (for example, a mixture of tartaric acid and sodium tartrate, a mixture of tartaric acid and tartrate of potassium, a mixture of tartaric acid and sodium hydroxide, and others), fumaric buffers (for example, a mixture of fumaric acid and fumarata of monolatry and others), fumaric buffers (for example, a mixture of fumaric acid and fumarata of moonacre, a mixture of fumaric acid and fumarata disodium, a mixture fumarata of monolatry and fumarata disodium and others), gluconate buffers (for example, a mixture of gluconic acid and sodium gluconate, a mixture of gluconic acid and sodium hydroxide, a mixture of gluconic acid and gluconate potassium, and others), oxalate buffer (for example, a mixture of oxalic acid and sodium oxalate mixture, oxalic acid and sodium hydroxide, the mixture of oxalic acid and potassium oxalate and others), lactate buffers (e.g., a mixture of lactic acid and sodium lactate, a mixture of milk acid and sodium hydroxide, a mixture of lactic acid and lactate potassium and others) and acetate buffers (e.g., a mixture of acetic acid and sodium acetate, a mixture of vinegar is Oh acid and sodium hydroxide, and others). You can also mention phosphate buffers, his-tag buffers and salts of trimethylamine, such as Tris.

To slow the growth of microbes, it is possible to add preservatives in amounts ranging from 0.2% to 1% (wt./vol.). Preservatives suitable for use in the present invention include phenol, benzyl alcohol, meta-cresol, methylparaben, propylparaben, octadecyltrimethylammonium chloride, benzalkonium halides (e.g. chloride, bromide, iodide, chloride of hexane and alkylarene, such as methyl or propyl paraben, catechol, resorcinol, cyclohexanol and 3-pentanol.

To ensure isotonicity liquid compositions of the present invention, it is possible to add funds, giving the solution isotonicity, sometimes referred to as "stabilizers", which include polyhydric sugar alcohols, preferably, the sugar alcohols containing three or more hydroxyl groups such as glycerin, erythritol, Arabic, xylitol, sorbitol and mannitol.

Stabilizers belong to the broad category of excipients, which unites substances with different functions, from agents-fillers additives that solubilize therapeutic agent or prevent its denaturation or adhesion to the wall of the container. Typical stabilizers include polyhydric sugar alcohols listed is ISE); amino acids such as arginine, lysine, glycine, glutamine, asparagine, histidine, alanine, ornithine, L-leucine, 2-phenylalanine, glutamic acid, threonine and other organic sugars or sugar alcohols such as lactose, trehalose, stachyose, mannitol, sorbitol, xylitol, ribitol, monoset, galactitol, glycerin and the like, including, cyclic alcohols such as Inositol; polyethylene glycol; amino acid polymers; sulfur-containing reducing agents such as urea, glutathione, thioctic acid, thioglycolate sodium, diglycerin, alpha-monothioglycerol and sodium thiosulfate; low molecular weight polypeptides (i.e. < 10 residues); proteins such as human serum albumin, bovine serum albumin, gelatin or immunoglobulins; hydrophilic polymers such as polyvinylpyrrolidone, monosaccharides, such as xylose, mannose, fructose, glucose; disaccharides, such as lactose, maltose, sucrose, and trisaccharide, such as raffinose; and polysaccharides, such as dextran. The stabilizers can be present in amounts of from 0.1 to 10000 mass relative to the mass of active protein.

Non-ionic surfactants or detergents (also known as a "moisturizer") can be added to help solubilize therapeutic tools, as well as to protect therapeutic protein of the aggregated, caused by mixing, these funds also prevent protein denaturation that occurs when the impact on the composition of the surface pressure shift. Suitable nonionic surfactants include Polysorbate (20, 80, and others), poloxamer (184, 188, and others), polyols Pluronic.RTM., simple monetary of polyoxyethylene and sorbitan (TWEEN-20®, TWEEN-80®, and others). Nonionic surfactants may be present in amounts ranging from about 0.05 mg/ml to about 1.0 mg/ml, preferably from about 0.07 mg/ml to about 0.2 mg/ml

Other heterogeneous excipients include agents, fillers (e.g. starch), chelating means (e.g., EDTA), antioxidants (e.g. ascorbic acid, methionine, vitamin E) and the cosolvent. The composition of the present invention may also contain several active compounds, if necessary to treat specific symptoms, preferably such compounds have complementary activities that do not adversely impact on each other. For example, it is sometimes desirable to use additional immunosuppressive agent. Such molecules may be present in combination in amounts effective to achieve the intended purpose. The active ingredients can reach is arranged in a microcapsule, obtained, for example, by koatservatsii or interfacial polymerization in the case hydroxymethylcellulose or gelatin microcapsules and poly(methylmethacrylate) microcapsules, respectively, in colloidal systems drug delivery (such as liposomes, albumen microspheres, microemulsions, nanoparticles and nanocapsules), or in microemulsion. Such methods are described in Remington''s Pharmaceutical Sciences, 16th edition, Osal, Ed. (1980).

Compositions intended for insertion in vivo, must be sterile. Sterilization can be easily realized, for example, by filtration through sterile filtration membranes. You can use drugs with a slow release. Suitable examples of drugs with a slow release include semi-permeable matrices of solid hydrophobic polymers containing the variant antibodies, the data matrix can be in the form of shaped articles, such as films or microcapsules. Examples of matrices with a slow release include polyesters, hydrogels such as poly(2-hydroxyethylmethacrylate), poly(vinyl alcohol)), polylactide (U.S. patent No. 3773919), copolymers of L-glutamic acid and ethyl-L-glutamate, nadogradili the ethylene vinyl acetate-degrading copolymers of lactic acid and glycolic acid, such as LUPRON DEPOTTM(suitable for the of nycci microspheres, consisting of a copolymer of lactic acid and glycolic acid and leuprolide acetate), and poly-D-(-)-3-hydroxipropionic acid. While polymers such as ethylene vinyl acetate and lactic acid-glycolic acid that can release molecules within 100 days, certain hydrogels release proteins for shorter periods. If enclosed in a capsule antibodies remain in the body for a long time, they can denaturing or aggregate under the influence of moisture at 37°C, which can lead to loss of biological activity and possible changes in immunogenicity. Depending on the mechanism involved, you can use rational strategies of stabilization. For example, if it is shown that the mechanism of aggregation involves the formation of intermolecular S-S in ridiculing interaction, the drug can be stabilized by modifying sulfhydryl residues, lyophilization from acidic solutions, controlling moisture content, use of appropriate additives, and developing specific polymer matrix compositions.

The amount of therapeutic polypeptide, antibody or its fragment effective to treat specific disorders or conditions, depends on the nature of the violation or condition and can be determined using standard CL the technical methods. If possible, before testing on humans, it is desirable to obtain a curve dose-response for the pharmaceutical compositions of the present invention, first in vitro and then in suitable animal model systems.

In the preferred embodiment the aqueous solution of therapeutic polypeptide, antibody or fragment is administered by subcutaneous injection. Each dose can vary from about 0.5 μg to about 50 μg per kilogram of body weight, or, more preferably, from about 3 μg to about 30 μg per kilogram of body weight.

The dosing regime for subcutaneous injection may vary from once a month to daily injection, depending on the number of clinical factors, including the type of disease, severity of disease and the susceptibility of the subject to therapeutic agent.

Therapeutic application of antibodies against NOTCH3

Antibodies of the present invention is to be used for the treatment of mammals. In one embodiment the antibody is administered non-human mammal, for example, in order to obtain preclinical data. Examples of non-human mammal to be treated, include non-human primates, dogs, cats, rodents and other mammals, which conduct preclinical tests. Takamiyama can be used to obtain animal models of the disease, subject to treatment with an antibody, or for toxicity studies of interest antibodies. In all the described embodiments of the studies on the effect of increasing doses can be performed on the mammal.

Antibody, administered alone or in combination with another factor (or factors), can be used as a therapeutic agent. The present invention relates to methods for treating antibodies, which include the introduction of the antibodies of the present invention to an animal, mammal or human, for the treatment of Notch3-mediated diseases, disorders or conditions. An animal or a subject can be a mammal, in need of specific treatment, such as a mammal, who has been diagnosed with a specific violation, for example, associated with Notch3. Antibodies directed against Notch3, can be used to treat degenerative diseases and other Notch3-associated diseases, including CADASIL, FHM, syndrome Alagille, neurological and degenerative disorders in mammals, such as, without limitation, cows, pigs, horses, chickens, cats, dogs, non-human primates and others, as well as in humans. For example, by introducing a therapeutically acceptable dose of antibody or antibodies against Notch3 of the present invention, or a mixture of antibodies of the present invention, or op is Tania with other antibodies from different sources, the symptoms can be improved or prevented from undergoing the treatment of a mammal, especially man.

Therapeutic compounds of this invention include, without limitation, antibodies of the present invention (including fragments, analogs and derivatives, as described herein) and nucleic acids encoding antibodies of the present invention, as described below (including fragments, analogs and derivatives, as well as antiidiotypic antibodies, as described in this document). Antibodies of this invention can be used to treat, suppress or prevent diseases, disorders or conditions associated with aberrant expression and/or activity Notch3, which include, without limitation, any one or more of the diseases, disorders or conditions described in this document. Treatment and/or prevention of diseases, disorders or conditions associated with aberrant expression and/or activity Notch3, includes, without limitation, alleviating at least one symptom associated with those diseases, disorders or conditions. Antibodies of this invention can be introduced into the composition of pharmaceutically acceptable compositions using methods known in this field or described in this document.

Antibodies against Notc3 of the present invention can be used for therapeutic treatment of several diseases. The present invention provides a method of prophylaxis or treatment of Notch3-mediated diseases in mammals. This method includes the administration to a mammal effective to prevent or treat diseases of the number of antibodies against Notch3. Antibody against Notch3 binds to Notch3 and inhibits its function. Notch3 signaling pathway is associated with various diseases, such as CADASAL, FHM, family paroxetina ataxia syndrome Alagille and other degenerative diseases, and neurological disorders (Joutel et al., Nature 383:707 (1996); Flynn, et al., J Pathol 204:55 (2004)). Suppose that antibodies against Notch3 can be used effectively for treatment of the above diseases.

The number of antibodies that are effective for the treatment, inhibition, and prevention of diseases or disorders associated with aberrant expression and/or activity Notch3, can be identified using standard clinical methods. The dose depends on the type of disease to be treated, the severity and course of the disease, from the purpose for which preventive or therapeutic injected antibody, previous therapy, the patient's clinical presentation and response to the antibody, and the attending physician. To improve the condition of the disease, the antibody can be entered in the mode of treatment, depending on the disease, for example, in one or more of osah within one to several days, or dose antibodies can be entered periodically over a long period of time to suppress the development of the disease and prevent relapse. In addition, the optimal spacing of doses can be determined using in vitro tests. The exact dose to be used in the composition also depends on the method of administration, the severity of the disease or disorders, and installed in accordance with the opinion of the attending physician and the status of each patient. Effective dose can be determined on the basis of the curves dose-response in vitro or animal model systems.

Antibodies are administered to a patient at a dose, which is usually from 0.1 mg/kg to 150 mg/kg of body weight of the patient. Preferably, the dose, administered to a patient is between 0.1 mg/kg to 20 mg/kg of body weight of the patient, more preferably from 1 mg/kg to 10 mg/kg of body weight of the patient. As a rule, human antibodies have a longer half-life in the human body than antibodies from other species due to the immune response to the foreign polypeptides. As a rule, human antibodies can often be used in lower doses and enter them possible. In addition, the dose and frequency of administration of antibodies of the present invention can be reduced by increasing consumption and penetration into tissues (e.g. brain) of the antibodies by modifications such as, for example, lipigesic who I am. When multiple administrations over several days or longer, depending on the condition, processing continues until the desired suppression of disease symptoms. However, you can use other dosing regimens. The result of this therapy is easily monitored by conventional techniques and assays.

The composition of the variant antibodies can be obtained, dose and type in accordance with a successful medical practice. The factors taken into account in this context include the specific violation is subject to treatment, the particular mammal to be treated, the clinical condition of the individual patient, the cause of the violation, the section of the delivery means, the route of administration, mode of administration and other factors known to doctors. "Therapeutically effective amount" enter option of antibodies depends on such factors and represents the minimum amount necessary for the prevention, improvement or treatment of disease or impairment. Variant antibodies can optionally be included in the composition along with one or more tools, currently used for the prevention or treatment considered violations. The effective amount of such other funds depends on the amount of antibody present in the composition, the type of disorder or treatment method is Oia, as well as other factors mentioned above. Typically, they are used in the same doses using the same techniques as described earlier in this document, or in amounts comprising from about 1 to 99% from the previously used dose.

Antibodies of this invention can be entered separately or in combination with other types of treatment.

In a preferred aspect, the antibody is practically cleaned (for example, practically does not contain substances that limit its effect or cause undesirable side effects).

Known different delivery systems that can be used for the introduction of the antibodies of the present invention, including by injection, for example, contains the connection liposomes, microparticles, microcapsules, recombinant cells capable of Express the compound, receptor-mediated endocytosis (see, for example, Wu, et al., J Biol Chem 262:4429 (1987)), design a nucleic acid comprising retroviral or other vector, etc.

Antibody against Notch3 you can enter the mammal in any acceptable way. Methods of administration include, without limitation, parenteral, subcutaneous, intraperitoneal, intra-lungs, vnutrenniy, epidural, inhalation and ingestion, and, if it is necessary to immunosuppressive treatment, introduction to the plot astonishment the fabric. Parenteral infusions include intramuscular, intradermal, intravenous, intraarterial, or intraperitoneal administration. Antibodies or compositions can be entered using any conventional method, for example by infusion or bolus injection, by absorption through epithelial or skin-mucous lining (such as the mucous membrane of the mouth, rectal and intestinal mucosa, and others), and they can be administered together with other biologically active agents. The administration can be systemic or local. In addition, it is sometimes desirable to introduce therapeutic antibodies or compositions of the present invention into the Central nervous system by any suitable method, including intraventricular and vnutriobolochechnoe introduction; intraventricular introduction can be accomplished using intraventricular catheter, for example, is attached to the tank, such as an Ommaya reservoir. The antibody can also be administered by pulse infusion, particularly with decreasing doses of antibodies. Preferably, the introduction is carried out by injection, most preferably intravenous or subcutaneous injection, in part, depending on whether the introduction is brief or chronic.

In addition, you can use pulmonary introduction, for example, by the application of the Oia nebulizer or atomizer and composition, contains a tool that provides aerosolization. The antibody can also be entered in the lungs of a patient in the form of a dry powder composition (see, for example, U.S. patent No. 6514496).

In a specific embodiment, it may be desirable to introduce therapeutic antibodies or compositions of the invention locally to the area in need of treatment; this can be achieved, for example, without limitation, local infusion, local application, injection, via a catheter, via a spark or through the implant, and the specified implant consists of a porous, non-porous or gel-like substances, and includes a membrane, such as silicone membranes, or fibers. Preferably, when the introduction of the antibodies of the present invention should be careful when using substances, in which the protein is not absorbed.

In another embodiment, the antibody can be delivered in the vesicles, in particular, in a liposome (see Langer, Science 249:1527 (1990); Treat et al., in Liposomes in therapy of Infectious Disease and Cancer, Lopez-Berestein, et al., eds., pp. 353-365 (1989); Lopez-Berestein, ibid., pp. 317-27; see generally ibid.).

In the following embodiment, the antibody can be delivered in a system with controlled release. In one embodiment can use the blower (see Langer, Science 249:1527 (1990); Sefton, CRC Crit Ref Biomed Eng 14:201 (1987); Buchwald, et al., Surgery 88:507 (1980); Saudek, et al., N Engl J Med 321:574 (1989)). In another vopl the conversion, you can use polymer materials (see Medical Applications of Controlled Release, Langer, et al., eds., CRC Press (1974); Controlled Drug Bioavailability, Drug Product Design and Performance, Smolen, et al., eds., Wiley (1984); Ranger et al., J Macromol Sci Rev Macromol Chem 23:61 (1983); see also Levy, et al., Science 228:190 (1985); During et al., Ann Neurol 25:351 (1989); Howard, et al., J Neurosurg 71:105 (1989)). In the following embodiment of the system of controlled release can be placed near therapeutic target.

The present invention also provides pharmaceutical compositions. Such compositions contain a therapeutically effective amount of the antibody and a physiologically acceptable carrier. In a specific embodiment, the term "physiologically acceptable" refers to a means, approved by the control authority of the Federal government or the state government or listed in the U.S. Pharmacopoeia or other well-known Pharmacopoeia for use in animals, and more particularly in humans. The term "carrier" refers to a diluent, adjuvant, excipient or environment, which is administered with a therapeutic agent. Such physiological media can be a sterile liquid such as water and oils, including those of petroleum, animal, vegetable or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil and the like, Water is a preferred carrier when the pharmaceutical composition is administered is nutrivene. Saline solutions and aqueous dextrose and glycerol can also be used as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene glycol, water, ethanol and the like, If necessary, the composition may also contain minor quantities of moisturizer or emulsifying means, or tabularasa funds. These compositions can be in the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, compositions with delayed release, etc. of the Composition may be in the form of suppositories with traditional binders and carriers such as triglycerides. Oral compositions can include standard carriers such as mannitol, lactose, starch, magnesium stearate, saccharin sodium, cellulose, sodium carbonate, etc. with pharmaceutical category of purity. Examples of suitable carriers are described in "Remington''s Pharmaceutical Sciences, E. W. Martin. Such compositions contain an effective amount of the antibody, preferably in purified form, together with the number of media suitable for obtaining forms for the appropriate introduction of the patient. the song must conform to the method of administration.

In one embodiment of the composition was prepared in accordance with routine methods as a pharmaceutical composition adapted for intravenous administration to humans. Typically, compositions for intravenous administration are solutions in sterile isotonic aqueous buffer. If necessary, the composition may also contain solubilizers tool and local anesthetic, such as lignocaine to reduce pain at the injection site. Typically, the ingredients are supplied separately or in mixtures in the form of a unit dosage forms, for example as a dry lyophilized powder or water-free concentrate in a hermetically sealed container such as a vial or package-Sasha, indicating the number of active funds. If the composition is administered by infusion, it can be dosed using the bottle for infusion, containing sterile water or sterile saline solution, pharmaceutical grade purity. If the composition is administered by injection, may be provided vial with sterile water for injection or sterile saline solution for mixing the ingredients before the introduction. This invention also provides a pharmaceutical package or kit containing one or more containers filled with one or more ingredients of pharmace the political compositions of the present invention. With such container (containers) may not necessarily be a notice in the form prescribed by a government Agency monitoring the manufacture, use or sale of pharmaceuticals or biological products, which suggests that the authority authorizes the manufacture, use or sale means for the introduction of man.

Industrial products

In another embodiment, the invention provides industrial products containing substances used for the treatment of the above disorders. Industrial product includes a container and a label. Suitable products include, for example, bottles, vials, syringes, and test tubes. Containers can be made of different materials, for example glass or plastic. The container contains a composition effective to prevent or treat the condition, and may have a hole for sterile access (for example, the container may be a bag of intravenous solution or vial having a stopper which can be pierced by a needle for subcutaneous injection). The active agent in the composition is an antibody. The label on the container or attached to the container indicates that the composition is intended for treatment of a particular condition. Industrial product may further is compulsory to include a second container, containing pharmaceutically acceptable buffer, such as phosphate buffered saline and dextrose. It may also include other components that are necessary from the point of view of the producer and the consumer, including other buffers, diluents, filters, needles, syringes and instructions for the package inserts with instructions for use.

Gene therapy based on antibodies

In another aspect, the invention provides a method of gene therapy, in which nucleic acids comprising sequences encoding antibodies or functional derivatives is administered to treat, suppress or prevent diseases or disorders associated with aberrant expression and/or activity of Notch3. Gene therapy refers to therapy by introducing the subject expressed or can be expressed nucleic acid. In this embodiment of the present invention nucleic acids produce coded for a protein that mediates a therapeutic effect. In accordance with the present invention can use any of the available methods of gene therapy. Examples of methods are described below.

General reviews of the methods of gene therapy can be found in Goldspiel et al., Clinical Pharmacy 12:488 (1993); Wu, et al., Biotherapy 3:87 (1991); Tolstoshev, Ann Rev Pharmacol Toxicol 32:573 (1993); Mulligan, Science 260:926 (1993); Morgan, et al., Ann Rev Bioche 62:191 (1993); May, TIBTECH 11:155 (1993).

In one aspect, the compound comprises a nucleotide sequence encoding the antibody, and these nucleotide sequences are part of expression vectors that provide the expression of the antibody or fragments or chimeric proteins based on antibodies, or heavy or light chains of the antibody in a suitable host. In particular, such nucleotide sequences include promoters, functionally associated with the site coding for the antibody and the indicated promoter is either inducible or constitutive, and, optionally, tissue-specific.

In another specific embodiment of the use of the nucleic acid molecule in which the sequence encoding the antibody, as well as any other necessary sequence paired with sites that stimulate homologous recombination at the target site of the genome, providing, thus, vnutricherepnuyu expression of nucleic acids encoding antibody (Koller, et al., Proc Natl Acad Sci USA 86:8932 (1989); and Zijlstra, et al., Nature 342:435 (1989)). In specific embodiments of expressing the antibody molecule is a single-chain antibody; alternatively, the nucleotide sequence containing the sequence encoding heavy and light chains of the antibodies, or fragments thereof.

Delivery of nucleic acid to the slot, the patient may be either direct, in which the patient is directly injected nucleic acid or vectors carrying nucleic acid, or indirect, in which cells are first transformed nucleic acid in vitro, then transplanted to the patient. The described methods is known as gene therapy in vivo or ex vivo, respectively.

In a particular embodiment the nucleotide sequence is directly injected into the body, where they are expressed and produce the encoded product. This introduction can be done using any of numerous methods known in this field, for example by including it into the appropriate expression vector nucleic acid, followed by its introduction so that the sequence become intracellular, e.g., by infection with defective or weakened by retroviruses or other viral vectors (see U.S. patent No. 4980286), or by direct injection of naked DNA, or by microparticle bombardment (e.g., using a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or the transforming means, the conclusion in liposomes, microparticles or microcapsules, or by introduction of nucleotide sequence-related peptide, are able to penetrate into the core, or entered by the I nucleotide sequences, related ligand, is able to undergo receptor-mediated endocytosis (see, for example, Wu, et al., J Biol Chem 262:4429 (1987)) (which can be used to target cell types specifically expressing the receptors) and others In another embodiment it is possible to obtain complexes of nucleic acid-ligand, where the ligand contains transmit viral peptide that Deplete endosome and allowing the nucleic acid to avoid lysosomal degradation. In the following embodiment, nucleic acid, as a result of its focus on specific receptor that can specifically absorbed by cells in vivo and expressed (see, for example, PCT publication WO 92/06180; WO 92/22635; WO92/20316; WO93/14188, WO 93/20221). Alternative nucleic acid can enter into the cell and embedded in the DNA of the host cell and subsequent expression by homologous recombination (Koller, et al., Proc Natl Acad Sci USA 86:8932 (1989); and Zijlstra, et al., Nature 342:435 (1989)).

In a particular embodiment of the use of viral vectors, which contain a nucleotide sequence encoding the antibody of the present invention. For example, you can use retroviral vector (see Miller, et al., Meth Enzymol 217:581 (1993)). These retroviral vectors contain the components necessary for the correct installation of the viral genome and integration into the DNA of the host cell. The nucleotide sequence encoding the antibody, rednaznachena for use in gene therapy clone in one or more vectors, which facilitates delivery of the gene to the patient. More detailed information about retroviral vectors can be found in Boesen et al., Biotherapy 6:291 (1994), which describes the use of retroviral vectors for delivery mdrl gene in hematopoietic stem cells to make these cells more resistant to chemotherapy. Other references illustrating the use of retroviral vectors in gene therapy are: Clowes, et al., J Clin Invest 93:644 (1994); Kiem et al., Blood 83:1467 (1994); Salmons et al., Human Gene Therapy 4:129 (1993); and Grossman, et al., Curr Opin Gen and Dev 3:110 (1993).

In the present invention can also be used adenoviruses. In accordance with the present invention adenoviruses are especially effective delivery of antibodies to the epithelium of the respiratory tract. In nature adenoviruses infect the epithelium of the respiratory tract. Other targets for delivery systems based on adenoviruses are the liver, Central nervous system, endothelial cells and muscles. The advantage of adenoviruses is that they are able to infect non-dividing cells. Kozarsky, et al., Curr Opin Gen Dev 3:499 (1993) published a review of gene therapy based on adenoviruses. Bout, et al., Human Gene Therapy 5:3 (1994) demonstrated the use of adenovirus vectors for gene transfer in the epithelium of the respiratory tract rhesus. Other cases of the use of adenoviruses in Genn is th therapy described in Rosenfeld, et al., Science 252:431 (1991); Rosenfeld, et al., Cell 68:143 (1992); Mastrangeli et al., J Clin Invest 91:225 (1993); PCT publication WO94/12649; and Wang, et al., Gene Therapy 2:775 (1995). For use in gene therapy are also offered adeno-associated virus (AAV) (Walsh, et al., Proc Soc Exp Biol Med 204:289 (1993); U.S. patent No. 5436146; 6632670; and 6642051).

Another approach to gene therapy involves transferring a gene to cells in tissue culture by such methods as electroporation, lipofection, transfection mediated by calcium phosphate or viral infection. Generally, the method of transfer includes the transfer cell marker selection. The cells are then subjected to selection, selecting cells, absorbing and expressing portable gene. These cells are subsequently administered to the patient.

In this embodiment the nucleic acid is introduced into the cell prior to introduction into the body, receiving recombinant cell. This introduction can be done using any known in the field of fashion, which includes, without limitation, transfection, electroporation, microinjection, infection with a viral or bacterial vector containing the nucleotide sequence, hybridization of cells, chromosome-mediated gene transfer mediated by micropores gene transfer, spheroplast hybridization, etc. In this area there are many ways of introducing foreign genes into cells (see, for example, Loefler, et al., Meth Enzymol 217:599 (1993); Cohen, et al., Meth Enzymol 217:618 (1993); Cline, Pharmac Ther 29:69 (1985)), which can be used in accordance with the present invention, provided that they do not violate the important functions associated with the development and physiological functions of the cells of the recipient. The method should provide a stable transfection of nucleic acids into the cell so that the nucleic acid can be expressed by the cell and preferably heritable and can be expressed by the progeny of this cell.

The obtained recombinant cells can be delivered to the patient by various methods known in this field. Recombinant blood cells (e.g., hematopoietic stem cells or precursors of hematopoietic cells) are preferably administered intravenously. The number of cells necessary for the application depends on the desired effect, patient state, and others, and can be determined by a specialist in this field.

Cells into which you can enter the nucleic acid for the purposes of gene therapy encompass any desired available types of cells and include, without limitation, epithelial cells, endothelial cells, keratinocytes, fibroblasts, muscle cells, hepatocytes; blood cells such as T-lymphocytes, B-lymphocytes, monocytes, macrophages, neutrophils, eosinophils, megakaryocytes, granulocytes; various with the volove cells or precursor cells, in particular, hematopoietic stem cells and precursors of hematopoietic cells such as those derived from bone marrow, umbilical cord blood, peripheral blood, fetal liver and other

In one embodiment, the cell used for gene therapy is autologous with respect to the patient. The nucleotide sequence encoding the antibody of the present invention, is introduced into cells to provide their expression by the cells or their progeny, after which recombinant cells are introduced into the body, receiving a therapeutic effect. In a particular embodiment of the use of stem cells or precursor cells. In accordance with this embodiment of the present invention can use any stem cells and/or precursor cells, which can be selected and maintained in vitro (see, for example PCT publication WO 94/08598; Stemple, et al., Cell 71:973 (1992); Rheinwald, Meth Cell Bio 21A:229 (1980); Pittelkow, et al., Mayo Clinic Proc 61:771 (1986)).

EXAMPLES

Example 1. Getting immunogen: a hybrid protein of the extracellular domain of NOTCH3-FC

Monoclonal antibodies against Notch3, specifically linking the LIN12/dimerization domain (hereafter referred to as "LD") human Notch3, get, using as immunogen recombinant hybrid protein Notch3-Fc containing LD Notch3, carboxyl end of which is attached a plot of the gamma 1 Fc, namely, it is unigen is a hybrid protein (Notch3 LD/Fc) contains amino acid residues 1378-1640 LD Notch3 (see figure 1) and the human fragment γ1Fc. Control antibody receive, using as immunogen a plot of repeat Notch3 EGF containing amino acid residues 43-1377.

The sequence of the Notch3 protein analyzed by interactive research program obespechenie and services (Motif Search, http://motif.genome.ip/). RNA in human liver and pancreas (Ambion, Inc. Austin, TX) is used as a matrix for the synthesis of the first chain cDNA using standard commercially available kit for cDNA synthesis. cDNA encoding a LD Notch3, and the site of the EGF repeat, amplified by PCR in the presence of betaine (1-2 M) and DMSO (5%). Synthesized by PCR a DNA fragment Notch3-LD (~0,8 so) and the DNA fragment repeat Notch3-EGF (~4 so) clone into expression vectors, containing His-γ1Fc, in the commercially available vector pSec or commercially available vector pCD3.1 that carry different antibiotic markers. In the cloning receive two expression plasmids, one of which expresses a hybrid protein Notch3-LD/Fc, and the other expresses a hybrid protein Notch3-EGF/Fc.

In order to facilitate the construction of plasmids and to increase the expression of different recombinant proteins, Notch 3, get oligonucleotides corresponding to the leader peptide sequence containing the first 135 couples the basis of any nucleotide sequence, encoding Notch3. The resulting oligonucleotides contain some changes in the provisions of ambiguous coding, leading to a reduction in GC content. All changes in nucleotide sequences are silent, i.e. not lead to changes in the amino acid sequence (figa and 8B). After annealing the oligonucleotides recombinant sequence encoding a leader peptide, combined with the remainder of the coding sequence by PCR-SOE (Ho, et al., Gene 77:51 (1989); Horton, et al., BioTechniques 8:528 (1990)) (see Fig.9). The obtained sequence encoding a leader peptide, used in the construction of the expression of Notch3-LD/Fc and Notch3. Thus, both Fc hybrid protein contains a signal peptide linked to the N-end of the human sequence γ1Fc connected with the end.

The expression of hybrid proteins Notch3-EGF/Fc and Notch3-LD/Fc confirmed by transient transfection of plasmids the expression of Notch3 in cells T ATSC No. CRL-11268, Manassas, VA) and Cho (Invitrogen, Carlsbad, CA), respectively. Before transfection, the cells are cultivated in a nutrient medium DMEM (Invitrogen, Carlsbad, CA)containing 10% fetal calf serum (FCS), 2 mm glutamine and 1× solution of essential amino acids, and then sown in the amount of approximately 3-5×105cells per well in 6-well plate and grown for approximately 24 hours. Three microgram the and of each plasmid expression carrier hybrid Notch3 protein, transferout in the cells of each well using the system for transfection with Lipofectamine 2000 (Invitrogen, Carlsbad, CA) according to manufacturer's instructions. After transfection cells were cultured in fresh culture medium in the incubator CO2for approximately 40-48 hours, and then analyze the expression of a hybrid protein Notch3. Alternatively, after transfection, the cells are cultivated in a nutrient medium for 3-4 hours after which the medium is changed to DMEM containing 2% FCS, and cultured for approximately 60-66 hours, after which the conditioned medium was separated and analyzed by secretory protein.

Stable cell lines receive for Notch3-LD/Fc (vector His-Fcγ/pSec)and Notch3-EGF/Fc (vector His-Fcγ/pSec). Each plasmid transferout in CHO cells. After transfection, the cells are cultivated in a nutrient medium DMEM overnight, then the environment changed to a medium containing 800 μg/ml of hygromycin, and cultured for at least two weeks, while cells that do not contain plasmids the expression of Notch3, will not perish under the action of antibiotics. Air-conditioned environment of stable cell lines analyzed by the method of Western blotting.

Stable or transtorno transfetsirovannyh cells to analyze the expression and secretion of the hybrid protein Notch3-LD/Fc or Notch3-EGF/Fc. Transfetsirovannyh cell is, collected from cups for cultivation, washed once with saline, phosphate buffered (PBS), resuspended in deionized water, mixed with an equal volume of 2× buffer for loading the protein sample (BioRad, Hercules, CA) and then heated at about 100°C for 10 minutes. The secretory protein analyzed, using air-conditioned environment, mixed with an equal volume of 2× buffer for loading the protein sample, and heated at 100°C for 10 minutes. The samples are divided by the method of SDS-PAGE using 4-15% gradient. Proteins are transferred from the gel to PVDF membrane (BioRad, Hercules, CA), which block the 5% non-fat dry milk in PBST (PBS containing 0.05% TWEEN-20®) for at least one hour before transfer protein.

Hybrid proteins Notch3-EGF/Fc and Notch3-LD/Fc detected by incubation with γFc-specific HRP-conjugated antibody (Sigma, St Louis, MO) in blocking buffer for one hour at room temperature. The membrane was washed with PBST three times and are using a chemiluminescent substrate.

To clear hybrid Notch3 protein domain/Fc, stable cell lines CHO, as described above, were cultured in DMEM containing 2% FCS, for a period of not more than 5 days. Collect one liter of conditioned medium and subjected to its affinity chromatography on a column containing beads with immobilized protein A. the Column was washed with the PBS, associated proteins elute in 50 mm citrate buffer (pH 2,8), and the pH adjusted to neutral values by adding 1 M buffer Tris-HCl (pH 8). The purity of the protein is determined by gel analysis of protein by the method of SDS-PAGE using 4-15% gradient. The protein concentration is determined using Kumasi blue in accordance with the manufacturer's instructions (Pierce, Rockford, IL). Using this method get milligramme amount of purified protein Notch3-LD/Fc and Notch3-EGF/Fc, which is used for immunization and analysis of binding using ELISA method.

Example 2. Receiving Mab against NOTCH3

Male A/J mice (Harlan, Houston, TX) age 8-12 weeks subcutaneously injected with 25 μg Notch3-EGF/Fc or Notch3-LD/Fc in complete Freund's adjuvant (Difco Laboratories, Detroit, MI) in 200 μl PBS. Two weeks after injection and three days before killing the mice again injected intraperitoneally 25 μg of the same antigen in PBS. In the case of each hybrid from the spleen of immunized mice receive a suspension of individual cells, which are used for hybridization with myeloma cells Sp2/0; 5×108cells Sp2/0 and 5×108the spleen cells hybridized in a medium containing 50% polyethylene glycol (MW 1450) (Kodak, Rochester, NY) and 5% dimethyl sulfoxide (Sigma, St. Louis, MO). Then the cell concentration was adjusted to 1.5×105the spleen cells per 200 μl of the suspension in Iscove medium (Invitrogen, Carlsbad, CA)supplemented with 10% fetal bovine serum, 100 units/ml pen is Zilina, 100 µg/ml streptomycin, 0.1 ám gipoksantina, 0.4 µm of aminopterin and 16 μm thymidine. In each well approximately sixty 96-well plates add two hundred microliters cell suspension. After about ten days of culture supernatant separated and analyzed by antibody-binding activity by ELISA method.

96-well flat-bottomed plates to microanalysis Immulon II (Dynatech Laboratories, Chantilly, VA) cover, using 100 µl of Notch3-EGF/Fc or Notch3-LD/Fc (0.1 ág/ml) (PBS)containing 1× phenol red and 3-4 drops of pHix/liter (Pierce, Rockford, IL)and incubated over night at room temperature. After removal of the coating solution by shaking off the tablet, to each well add 200 ál of blocking buffer containing 2% BSA in PBST and 0.1% thimerosal, and incubated for one hour to block nonspecific binding. Then the wells are washed with PBST. Fifty microlitres culture supernatant from each well containing hybrid, collected and mixed with 50 ál of blocking buffer and then added to individual wells of microtiter plates. After one hour incubation, the wells are washed with PBST. Then the associated mouse antibodies detected by interacting with conjugated with horseradish peroxidase (HRP) Fc-specific goat antibodies against mouse IgG (Jackson ImmunoResearch Laboratories, West Grove, PA). In wells add the solution is of ubstrate HRP, containing 0.1% 3,3,5,5-tetramethylbenzidine and 0,0003% of hydrogen peroxide, after which staining develops within 30 minutes. The reaction is completed by adding 50 ml of 2 M H2SO4/well. The OD values at 450 nm read using a tablet-ELISA reader (Molecular Devices, Sunnyvale, CA).

185 selected and analyzed a hybrid one hybridoma clone obtained from mice immunized with Notch3-LD/Fc, generates an agonistic antibody against Notch3 256A-13, which further characterize. Method ELISA performed using supernatant of hybridoma clone producing MAb 256A-13. The results show high binding activity with respect to a purified hybrid protein Notch3 LD/FC, which was used for immunization, and the absence of binding with human Notch1-LD/Fc (LIN/dimerization domain, heriditary with a plot of Fc on the carboxyl end) or control human Fc protein (data not shown) (table 1).

Table 1
The OD values for 256A-13 obtained by the method of ELISA using hybridoma supernatant
Protein-targetNotch3 LD/FC
Hybridoma supernatantControl IgG1 Mab 256A-13

Average0,0192,828
The standard deviation0,0020,047

Hybridoma clone, the positive results of the primary screening ELISA, further isolated by sorting individual colonies and conduct secondary analysis of ELISA, as described above, to confirm the ability to specifically bind to a selected immunogen. Approved hybridoma clone grown in culture on a larger scale. Monoclonal antibodies (MAb) was isolated from the environment of these large-scale cultures using affinity column with protein A. Then agonistic MAb against Notch3 is characterized by cellular assays binding, microscopy, Western blotting and FACS analysis.

Example 3. Cellular analyses of binding of Mab against NOTCH3

For conducting cell assays binding used to characterize MAb against Notch3 requires cloning the full open reading frame of human Notch3 in the vector, in this case, pcDNA3.1/Hygro (Invitrogen, Carlsbad, CA). Plot encoding Notch3, synthesize RT-PCR using RNA tumor human liver (Ambion, Inc., Autin, TX) as matrix. The resulting construct plasmids Notch3/Hygro, expresses full-Notch3 protein, as shown in figure 1. A stable cell line expressing Notch3, produced by transfection of plasmid constructs Notch3/Hygro in 293T cells (ATCC no CRL-11268) using a set of Lipofectamine 2000 according to the method described in example 1. After transfection, the cells are cultivated in a nutrient medium DMEM overnight, then re-seeded in culture medium containing 200 μg/ml of hygromycin, and cultured for 12-14 days. Separate colonies sorted and grown in separate wells sufficient to increase the number of cell clones. Stable 293T clones resistant to hygromycin breeding and expressing high levels of Notch3 protein, identified by Western blotting and fluorescence electron microscopy using polyclonal antibodies against Notch3 (R&D Systems, Minneapolis, MN).

Plasmid expression of a fragment of Notch3, containing only Notch LIN12/dimerization domain (LD) and transmembrane (TM) domain, also design the PCR and subcloning in the vector pcDNA3.1.

Human cell line Sup-T1 (ATCC no CRL-1942), in their natural state expressing Notch3 also analyzed using Western blotting. Cells Sup-T1 grown in RPMI1640 medium containing 10% fetal calf serum, 2 mm glutamine and 1 is the solution of essential amino acids.

Cellular analysis of antibody binding sites is done using FMATTM(fluorescent macroscopically screening with high-throughput) using system 8100 HTS (Applied Biosystems, Foster City, CA) according to manufacturer's instructions. Cell lines, in their natural state expressing Notch3 or stable transfetsirovannyh constructs the expression of Notch3, seeded in 96-well plates. Alternatively, transtorno transfetsirovannyh cells 293T or CHO seeded in 96-well plate. Cells were seeded with a density of 30000-50000 cells per well. After 20-24 hours in the wells add MAb against Notch3 and the reaction buffer 1× PBS and incubated one hour at 37°C. After removal of the primary antibody to the wells add Cy-5-conjugated antibodies against mouse IgG.

Cellular analysis of binding antibodies also performed using cell sorting device with activation of fluorescence (FACS), using generated inside the stable cell line 293T/Notch3 and two cancer lines, human cell line Sup-T1 and A2780 (UK ECACC catalogue number 93112519), both in their natural state expressing Notch3 (data not shown). Cells are first incubated with Mab against Notch3 in 1× PBS. After three washes, the cells incubated with secondary antibody conjugated with a fluorescent molecule. Cells resuspended, fixed in 1× PBS 0.1% solution pair is ormaldehyde and analyze method FACS (BD Sciences, Palo Alto, CA). The results show that 256A-13 binds to a receptor Notch3, expressed or using recombinant plasmid constructions, or as the native protein in cultured cells (table 2). Transtorno transfetsirovannyh 293T cells containing plasmid Notch3/Hygro, also paint immunofluorescent dye, as described above, and analyzed by fluorescence microscopy.

Table 2
The results of cell analysis of binding activity 256A-13 method FACS, expressed as mean values of fluorescence intensity
Control IgG1256A-13
Notch3/Hygro24,1632,2
Sup-T124,5155,44

Cellular analyses FMAT and FACS confirm that MAb 256A-13 really link the Notch3 receptor, expressed or using recombinant plasmid constructions, or as the native protein in cultured cells (table 2 and table 3).

Table 3
Total results cellular analysis of binding activity of MAb against Notch3 method FMAT
AntibodyControl IgG1256A-13
Notch3 (full-size)The binding is missingWeak binding
Notch3-LDTMThe binding is missingStrong binding

A positive signal binding obtained in the analysis method FMAT, considerably higher than the signal received from the control IgG1 and other negative hybridoma clones (p>0,01). The values of the link control IgG1 considered to be background. The 293T cells, transtorno transfetsirovannyh the plasmid Notch3/Hygro, also paint immunofluorescent dye, as described above, and analyzed by fluorescence microscopy.

The affinity of binding of MAb 256A-13 analyzed using the Biacore system (Biacore Inc., Piscataway, NJ). Antibody directly immobilized on the chip by condensation of amine (level immobilization: 200 RU), after which protein Notch3-LD/Fc (antigen) is injected into 5 different concentrations (ranging from 37.5 to 120 nm over time of the Association in the interval 5-8 minutes and the time of dissociation in the interval the Le from 1 to 2 hours). As a rolling buffer and buffer for sample using PBS containing 5 mm Ca2+. The surface of the chip regenerate 10 mm glycine, pH 2. The antibody is characterized using the double repetition. Table 4 shows statistical significance, standard errors, and the estimated value of the kinetic dissociation constants (KD). The antibody has a high affinity characterized by a KD 280 PM, and low speed reverse reaction. Standard errors and Chi-square have low values and good agreement (dynamic curve not shown).

Table 4
Analysis of the affinity of binding of MAb 256A-13 using Biacore
SampleKD [PW]ka [M-1with-1]SE (ka)Kd [-1]SE (kd)χ2
A-132804,e0,981,18E-51,e-70,392
KD: dissociation constant 256A-13 and Notch3-LD/Fc. Ka: speed link 256A-13 with Notch3-LD/Fc (or skorostyami reaction). Kd: dissociation rate 256A-13 from Notch3-LD/Fc (or the rate of the reverse reaction). SE: standard error.

Example 4. Analysis of binding activity 256A-13 by the method of Western blotting

Western blotting performed to determine the binding activity of 256A-13 in respect of the Notch3 receptor in denaturing conditions, and the levels of expression of Notch3 and other related Notch proteins in cell lines mammals. Purified hybrid protein Notch3-LD/Fc unite with buffer for protein loading. The protein samples are also obtained from transtorno or stably transfected cells described in example 1, which are collected from cups for cultivation, washed once with PBS, resuspended in the buffer to the total cell extract protein (Pierce, Rockford, IL) and heated at 100°C for 10 minutes after adding equal volume of 2× buffer for loading the protein sample. All samples separated by electrophoresis in a 4-15% gradient SDS-PAGE. Proteins are transferred from the gel to PVDF membrane, and 256A-13 applied to the membrane for Western blotting as the primary detectiong antibodies. Secondary antibody conjugated with HRP, used for detecting and generating a signal using chemiluminescent substrate, as described above. Antibodies against human Fc, V5 tag, Notch3 and Notch1, used as a positive control, the floor is up from Invitrogen, R&D Systems, Santa Cruz Biotechnologies, and Orbigen.

Analysis by the method of Western blotting demonstrates that MAb 256A-13 binds to Notch3-LD/Fc under denaturing conditions, as well as in the native conformation of the molecule, as shown by analyses by ELISA and FACS.

Example 5. The analysis of the functional capabilities 256A-13 using luciferase reporter

A. Plasmid construction

Using sequencing test sequence constructs for expression of full-Notch3 described above in example 3, and confirm its identity to the published sequence, depicted in figure 1. The expression of Notch3 confirmed by transient transfection and Western blotting as described in example 4.

To get a luciferase reporter plasmid for the Notch signaling pathway, synthesize two complementary oligonucleotide primers containing tandem repeats of the binding of CBF1 motif, which have the following sequence:

5'GCTCGAGCTCGTGGGAAAATACCGTGGGAAAATGAACCGTGGGAAAATCTCGTGG (SEQ ID NO 12)

5'GCTCGAGATTTTCCCACGAGATTTTCCCACGGTTC (SEQ ID NO 13)

The two resulting oligonucleotide primer is annealed at 65°C in 100 mm NaCl at a concentration of each oligonucleotide 4 mm. After annealing to each other extend primers by PCR. The PCR product clone in the commercially available vector. The method of sequencing test arise is ku, which contains four tandem repeat binding of CBF1 motif and two flanking XhoI site. Insert cut out using XhoI, and below are ligated sequence that encodes a yellowish-red luciferase reporter. After analysis of luciferase reporter and sequencing of plasmid clones with eight repetitions binding motif CBF1 select and designate CBF1-Luc.

B. obtaining a stable cell line

Two stable cell lines receive for functional assays using cell lines of the kidneys of human embryos (HEK293). One cell line contains Notch3-expressing plasmid and reporter plasmid CBF1-Luc, integrated in the nuclear genome. This cell line is produced by joint transfection Notch3/hygromycin and plasmids CBF1-LUC in 293T cells using LipoFectamine 2000 according to manufacturer's instructions. Stable transfetsirovannyh cell clones subjected to selection against 200 µg/ml hygromycin in culture medium DMEM, and screened by analysis of luciferase reporter and a Western blot. The cell line with a relatively high level of expression of the Notch3 receptor (according to the Western blot and luciferase activity are selected for use in functional assays and denote NC85.

C. Analysis of luciferase reporter using only the tile is to with overexpression of Notch3

Cells NC85 cultivated in the presence of MAb 256-A13 within 24-48 hours. Then the medium is removed by aspiration, the cells are lysed in 1× buffer for passive lysis (E1501, Promega, Madison, WI), and analyze luciferase activity using the system for analysis of luciferase in accordance with the manufacturer's instructions (E1501, Promega, Madison, Wl), using a luminometer TD-20/20 (Turner Designs Instrument, Sunnyvale, CA). As shown in figure 5, cells NC85, cultured in the presence of MAb 256-A13, the luciferase activity is almost 4 times higher than in the presence of a control antibody G3. Analysis of luciferase reporter shows that MAb 256-A13 causes severe reduction in the activity of luciferase in the absence of binding of the ligand, in contrast, agonistic antibodies against Notch3 MAb 256A-4 and 256A-8 (figure 5).

Example 8. Mapping of the binding epitope 256A-13

A. Strategy for epitope mapping and the rational use of structures hybrid single-domain proteins Notch3 and Fc

LIN12/domains heterodimerization Notch3, also called LIN12 domain dimerization Notch3 (Notch3-LD), consist of three LIN12 domain, 1thLIN12 (L1), 2thLIN12 (L2) and 3rdLIN12 (L3) (see figure 10). Get five structures in the expression of a hybrid protein single domain Notch3/Fc (Fig.7) and performed Western blotting to determine which domain is sufficient for binding of MAb 256A-13. After transient transfection of supernatant, soda is containing secreted hybrid single-domain proteins Notch3/Fc, analyze the method of SDS-PAGE. The results show that MAb 256A-13 is associated only with Notch3-L1 and not associated with other domains. The ELISA analysis also shows that MAb 256A-13 strongly binds to Notch3-L1, weakly binds to Notch3-L3 and is not associated with other domains (table 5).

Table 5
Summary the results of Western blotting and ELISA, obtained using MAb 256A-13 against the designs of hybrid proteins Notch3-domain/Fc
The results of the Western blotThe values of the ELISA OD
MAb256A-13Antibody against human Fc256A-13Antibody against human Fc
Notch3-LD/Fcpositive bandpositive band1,8821,557
Notch3-L1/Fcpositive bandpositive band 1,7971,364
Notch3-L2/Fcno bandpositive band0,0151,337
Notch3-L3/Fcno bandpositive band1,0541,425
Notch3-D1/Fcno bandpositive band0,0151,608
Notch3-D2/Fcno bandpositive band0,0151,628

A. identification of the binding epitope (epitope) by shuffling subdomains

First, agonistic MAb against Notch3, 256A-13, associated with the LIN12/dimerization domain (LD) Notch3, but not with homologous human LIN12/dimerization domain Notch1 (table 5). Secondly, MAb against Notch3 binds to denatured Notch3 Western-blotting as described in examples 4 and 8, showing that 256A-13 binds to one epitope or different epitopes, independently from each other. Thirdly, Notch3 and Notch1 them who are about 55% homology of amino acid sequences in LIN12/dimerization domain, therefore, we can conclude that shuffling subdomains between Notch3 and Notch1 in this section does not violate the conformation of the protein. Notch1 cDNA-LD amplified using standard PCR methods. The first circuit matrix synthesize cDNA using total RNA from cells PA-1 (ATCC no CRL-1572). A sequence encoding a leader peptide Kappa-chain of human IgG, amplified by PCR, attached to the 5'-end of Notch1-LD-PCR-SOE and subcloning in His-γ1 Fc/pSec.

Table 6
The values of the ELISA OD obtained for MAb 256A-13 and control IgG1, bind to the Notch3-LD/Fc or Notch1-LD/Fc
Notch1-LD/FcNotch3-LD/Fc
AverageThe standard deviationAverageThe standard deviation
256A-130,0940,0074,0000
Control IgG1of 0.0660,006,063 0,006

B. Obtaining structures of hybrid proteins with the shuffling of domains

Using the results of ELISA analysis presented above in section A, the target domain 1wowdomain LIN12, or L1, optionally divided into three subdomains and shuffle them separately with their respective subdomains Notch1-L1. Design with the shuffling of domains obtained by PCR-SOE (Ho, et al., Gene 77:51 (1989); Horton, et al., BioTechniques 8:528 (1990)), as shown in figures 9 and 10. The PCR reactions and PCR-SOE performed using 1 M betaine and 5% DMSO, are added to the reaction mixture. The end product of PCR-SOE subcloning and its consistency is checked by sequencing. Plasmid clone with the correct sequence of the insert split NheI and XhoI and cut out the insert, which is subjected to purification in the gel and subcloning. Five designs with shuffling subdomains Notch3/Notch1 shown in Fig.7. To facilitate epitope mapping, construction, shuffling of domains as the leader peptide is used, signal peptide Kappa chain of human IgG. Amino acid sequence of structures subdomains shown in figure 10.

C. Expression of a hybrid protein with the permutation subdomains Notch3/Notch1

Plasmids with permutation domains Notch3/Notch1-LD transtorno transferout in CHO cells using LipoFectamine 2000. Cells CHO h who live in culture medium DMEM, containing 10% FCS, in the amount of 0.8-1×106cells per well in 6-well plate and kept in the incubator CO2during the night before transfection. After transfection, the cells recover in the medium for about 3 hours, then the medium is changed to DMEM containing 2% FCS, and cultured for three days. The conditioned medium is collected and centrifuged at 3500 rpm for 10 minutes. The supernatant containing protein Notch3-LD with relocation domains greater from CHO cells, collecting and preparing medicines for analyses linking methods Western blotting and ELISA. ELISA showed that all hybrid proteins with permutation domains expressed and secreted into the conditioned medium (table 4), as confirmed by the results of the Western blot (data not shown). The ELISA results obtained using antibodies against human Fc as detectiong antibodies show that all proteins expressed in air-conditioned environment. As a control using human IgG/Fc. Initial concentration of human IgG/Fc applied in each well is 100 ng.

D. analysis of the binding epitope ELISA method

96-well flat-bottomed plates to microanalysis Immulon II (Dynatech Laboratories, Chantilly, VA) coated with antibody against human Fc (Jackson ImmunoResearch) way to relax is of 100 μl of antibody solution (0.1 ág/ml) in phosphate buffered saline (PBS), containing 1× phenol red and 3-4 drops of pHix/liter (Pierce, Rockford, IL)and incubated over night at room temperature. After removal of the coating solution by shaking off the tablet, to each well add 200 ál of blocking buffer containing 2% BSA in PBST and 0.1% thimerosal, and incubated for one hour to block nonspecific binding. Then the wells are washed with PBST. Fifty microlitres above the conditioned medium from each transfection design Notch3/Notch1 with moving domains is collected, mixed with 50 ál of blocking buffer and added to individual wells titration microplate. After incubation for one hour Notch3 protein/Notch1-LD with relocation domains is captured caused by antibody against the Fc, and then the wells are washed with PBST. MAb against Notch3 and control MAb corresponding isotype subjected to serial dilutions of the blocking buffer, as described above, after which each well add 50 ál of diluted MAb and analyzed the binding with the associated Notch3 protein/Notch1 with permutation domains. For detection using conjugated with horseradish peroxidase (HRP) Fc-specific goat antibodies against mouse IgG. In wells add HRP substrate solution containing 0.1% 3,3,5,5-tetramethylbenzidine and 0,0003% of hydrogen peroxide, after which staining develops within 30 minutes. Reaction C is versaut by adding 50 ml of 2 M H 2SO4/well. The OD values at 450 nm read using ELISA reader. Design with swapped domains and clusters of mutations analyzed in a similar manner using the above ELISA method.

Analyses linking method ELISA using MAb 256A-13 against proteins with swapped domains show that the permutation 1wowsubdomain of the domain of Notch3-L1 (L1) does not affect the binding, suggesting that 256A-13 is not associated with this site. On the other hand, the permutation 2wowand 3itsubdomains of Notch3-L1 significantly reduce binding. Therefore, these two subdomains contain the epitope (epitope)that communicates with MAb 256A-13 (figure 10). Conversely, according to ELISA, used as negative control antibody corresponding isotype, G3, not associated with any hybrid protein, obtained by permutation domains (figure 10). The above analysis allows us to conclude that 1thdomain LIN12 necessary for the binding of MAb 256A-13, especially the section that contains the 2thand 3rdsubdomains.

To further map the specific epitope that binds MAb 256A-13, 2thand 3rdthe subdomains of the domain of Notch3-L1 is divided into five amino acid clusters that move with the corresponding amino acid residues Notch1 (figure 10). The analysis of binding using ELISA method showing the characteristic, that the permutation of the DRE (sequence Notch3) in SQL (the sequence of Notch1) eliminates binding activity according to the ELISA, indicating that only this epitope is required for the binding of MAb 256A-13 in the domain of Notch3-L1.

Point analysis of the amino acid residues required for binding of MAb 256A-13, is carried out by di-alanine scanning peptide. Alanine peptides served epitope DRE, mapped by amino acid changes. The peptide is synthesized in the form of spots and cross-linked to nylon membrane substrate. The binding of an antibody to stain analyzed by the method of the dot-blotting. As a control IgG1 use MAb G3. The peptide sequence is represented at 11.

Example 9. Sequencing Mab against NOTCH3

Because of the binding properties of antibodies are entirely determined by the variable parts of the heavy and light chain variable sequence 256A-13 is sequenced after referring to the subtype. Subtype of IgG antibodies is determined using set mouse monoclonal antibodies Isostrip (Roche Diagnostics, Indianapolis, IN). The results show that 256A-13 has a heavy chain IgG1and light chain Kappa.

Sequences of variable regions of heavy and light chain decode by RT-PCR and cDNA cloning. Total RNA from hybridoma clones 256A-13 allocate using the of abortion practices RNeasy Mini in accordance with the manufacturer's instructions (Qiagen Sciences, Valencia, CA). The first chain cDNA synthesized using the RNA matrix and set Superscriptase III. Variable areas of light and heavy chain cDNA amplified by PCR on the basis of the first chain cDNA using degenerate direct primers corresponding to the 5'-end of the coding section murine chain Kappa, and reverse primer, coinciding with a constant section in connection with the 3'end of the variable segment, or using degenerate direct primers corresponding to the 5'-end of the coding section murine heavy chain, and a reverse primer corresponding to the constant section of the murine heavy chain. The PCR product clone in the commercially available vector, and is sequenced by Lone Star Lab (Houston, TX). The nucleotide sequence is analyzed using computer software DNAStar (DNASTAR, Inc., Madison, Wl). When determining the sequence of each MAb against Notch3 use sequences of several clones of PCR, derived from a single hybridoma clone.

Variable plot heavy chain Mab 256A-13 contains 121 amino acid residue, and variable area light chain contains 102 amino acid residue (figa and 4B).

Example 10. The effect of agonistic antibodies against NOTCH3 on splitting NOTCH3 under metalloprotease

Activation of the Notch receptor comprises a ligand-induced assalone under metalloprotease on kolomanbrunnen area (S2) with the formation of extracellular subunit. This splitting is a necessary condition for S3 cleavage with release of activated intracellular plot Notch. To determine whether agonistic antibodies can induce ligand-independent sequential activation events Notch comprising two proteolytic cleavage, 293T cells stably expressing recombinant Notch3 receptor (cells NC85), treated with either G3 or 256-A13. Soluble extracellular subunit, resulting from proteolytic cleavage and coming into the culture medium, detected by ELISA method using associated with solid surface antibodies that recognize the product of cleavage of Notch3. As shown in Fig.6, agonistic MAb against Notch3 significantly increases the intake of soluble extracellular subunits Notch3 in air-conditioned environment, in contrast to the control antibody G3.

Example 12. Diagnosis NOTCH3-associated diseases

To diagnose other Notch3-associated diseases, it is possible to sequence the Notch3 gene from patient samples, or to perform immunohistochemical analysis in order to identify the reduced expression of Notch3 receptor in the tissue of the patient. In addition, you can select and cultivate the cells of the patient, presumably with Notch3-associate of Zabol is a cation, and to investigate the influence of the agonistic antibodies of the present invention to Notch3 signaling pathway.

For professionals in this field are obvious, or specialists in this field can be set using no more than routine experimentation, numerous equivalents to the specific embodiments of the present invention described in this document. Such equivalents are included in the scope the following claims.

1. A monoclonal antibody that specifically binds to amino acids 1384-1503 amino acid sequence of Notch3 (SEQ ID NO:1), where the antibody contains a sequence of variable heavy (VH) chain comprising the sequence SEQ ID NO:4, SEQ ID NO:5 and SEQ ID NO:6, and the sequence of the variable light (VL) chain comprising the sequence SEQ ID NO:7, SEQ ID NO:8 and SEQ ID NO:9, or a functionally active fragment.

2. The antibody or fragment according to claim 1, where the sequence of the VH chain comprises the sequence of SEQ ID NO:2.

3. The antibody or fragment according to claim 1, where the sequence of the VL chain comprises the sequence of SEQ ID NO:3.

4. The antibody or fragment according to claim 2, where the sequence of the VL chain comprises the sequence of SEQ ID NO:3.

5. The antibody or fragment according to claim 1, where the antibody or fragment specifically binds to an epitope comprising the sequence of SEQ ID NO:10.

6. Antibodies is or its fragment according to claim 1, where the antibody or fragment specifically binds to an epitope comprising the sequence of SEQ ID NO:11.

7. The antibody or fragment according to claim 1, where the antibody or fragment has a binding affinity for the binding, which is characterized by a Kd of 10-8up to 10-10M

8. The antibody or fragment according to claim 1, where the antibody or fragment activates Notch3-mediated signaling pathway.

9. The labeled antibody or fragment that specifically bind to amino acids 1384-1503 amino acid sequence of Notch3 (SEQ ID NO:1)comprising the antibody or fragment according to any one of claims 1 to 8, and label.

10. Humanitariannet antibody or fragment that specifically bind to amino acids 1384-1503 amino acid sequence of Notch3 (SEQ ID NO:1), which is humanitarianlaw form of the antibody or its fragment according to claim 4.

11. Humanitariannet antibody or fragment of claim 10, where the antibody or fragment specifically binds to an epitope comprising the sequence of SEQ ID NO:10.

12. Humanitariannet antibody or fragment of claim 10, where the antibody or fragment specifically binds to an epitope comprising the sequence of SEQ ID NO:11.

13. Humanitariannet antibody or fragment of claim 10, where humanitariannet antibody or fragment has a binding affinity for the binding, which is characterized by a Kd of 10-8up to 10-10is.

14. Humanitariannet antibody or fragment of claim 10, where humanitariannet antibody or fragment activates Notch3-mediated signaling pathway.

15. Nucleic acid encoding the antibody or fragment according to claim 1.

16. The expression vector containing the nucleic acid according to item 15.

17. The cell containing the nucleic acid according to item 15 or the vector according to clause 16, where the cell is capable of producing the antibody or fragment according to claim 1.

18. A method of producing an antibody or its fragment comprising culturing cells under 17 under conditions suitable for producing antibodies and selection produced antibody or its fragment.

19. Nucleic acid encoding humanitariannet antibody or fragment of claim 10.

20. The expression vector containing the nucleic acid according to claim 19.

21. The cell containing the nucleic acid according to claim 19 or a vector according to claim 20, where the cell is capable of producing the antibody or fragment of claim 10.

22. A method of producing an antibody or its fragment, comprising culturing the cell according to item 21 under conditions suitable for producing antibodies and selection produced antibody or its fragment.

23. The use of the antibody or its fragment according to any one of claims 1 to 14 for the manufacture of a medicinal product for the treatment of Notch3-associated diseases or disorders.

24. Application pop, where the disease is a neurodegenerative disease.

25. The application of item 23, where the disease is a CADASIL, familial hemiplegic migraine (FHM), family paroxetine ataxia or syndrome Alagille.

26. The use of the antibody or its fragment according to any one of claims 1 to 14 for the diagnosis of Notch3-associated diseases.



 

Same patents:

FIELD: medicine.

SUBSTANCE: invention refers to biochemistry and represents versions of antibodies binding human anaplastic lymphoma kinase (ALK) protein. There are also presented: versions of radiolabelled or toxin antibodies; a DNA sequence coding the antibody, an expression vector containing the DNA sequence; a host cell transformed by the vector, a method for producing the antibody by cell cultivation, as well as using the antibody for preparing a drug for treating cancer or tumours.

EFFECT: invention may be effectively used for treating tumour or cancer.

32 cl, 5 dwg, 2 tbl, 5 ex

FIELD: medicine.

SUBSTANCE: there are disclosed new completely human VAP-1 binding antibodies containing three polypeptides CDR of heavy and light chains, and their VAP-1-binding fragments. There are also presented nucleic acids coding VAP-1 antibodies or their fragments, expression vectors and host cells including these nucleic acids for recombinant expression of VAP-1 antibodies. There is described a method for producing a completely human antibody by transformation of the proper host by the expression vector and cultivation with the antibodies to be collected and purified. There are also disclosed pharmaceutical compositions containing said antibodies, and their therapeutic application - for treating VAP-1-mediated inflammatory diseases in the patients.

EFFECT: method improvement.

21 cl, 20 dwg, 4 tbl, 10 ex

FIELD: chemistry.

SUBSTANCE: cellobiohydrolase polypeptide is selected from a group consisting of: a polypeptide containing an amino acid sequence having at least 95% identity to SEQ ID NO:6 and having cellobiohydrolase activity and an fragment a), having cellobiohydrolase activity. Such polypeptides can be obtained using a recombinant technique using suitable polynucleotides, expression vectors and host cells.

EFFECT: invention can be used in production of fermentable sugars and bioethanol from lignocellulose material via enzymatic conversion.

32 cl,15 dwg, 31 tbl, 32 ex

FIELD: chemistry.

SUBSTANCE: fused proteins contain an endoglucanase nucleus amino acid sequence having at least 95% identity to SEQ ID NO:2, fused with an amino acid sequence containing a linker and a cellulose-binding domain (CBD), having at least 95% identity to SEQ ID NO:15. Such fused proteins can be obtained via a recombinant technique using suitable polynucleotides, expression vectors and host cells.

EFFECT: invention provides cellulase, having low activity with respect to restaining, and can be used to treat cellulose material; disclosed fused proteins and enzyme preparations based thereon can be used to prepare detergent compositions or for improving quality of animal feed.

26 cl, 8 dwg, 10 tbl, 10 ex

FIELD: chemistry.

SUBSTANCE: invention is an isolated nucleic acid comprising a canine RNA polymerase I regulatory sequence and containing (i) at least 250 or at least 350 or at least 450 adjoining nucleotides or an entire nucleotide sequence, which is in form of SEQ ID NO:26, (ii) a nucleotide which is at least 80% identical to said nucleotide sequence (i) or includes a complementary or reverse complementary (i) or (ii) sequence. The nucleotide sequence (i) or (ii) is operably linked to cDNA which encodes influenza virus vRNA, and when produced in MDCK cells, is capable of directing expression of said influenza virus vRNA. The present invention also describes expression vectors and cells containing such nucleic acids, as well as methods of using such nucleic acids to obtain influenza viruses, including infectious influenza viruses.

EFFECT: canine plasmid rescue system pol I enables to obtain recombinant influenza viruses in a canine cell culture with high titre.

25 cl, 16 dwg, 7 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: there are offered: recovered polynucleotides and polypeptides for binding human EGFR as a part of an antibody, a vector and a host cell for antibody expression, a method for producing an anti-EGFR antibody and an antibody fragment, the anti-EGFR antibody and the antibody fragment. There are discussed a composition containing the anti-EGFR antibody or its fragment, as well as applying the antibody and its fragment for treating EGFR-associated disorders. Besides, there are described versions of glycosylation of the anti-EGFR antibody or its fragment.

EFFECT: invention can find further application in therapy of various EGFR-mediated diseases.

30 cl, 6 ex, 32 dwg, 39 tbl

FIELD: medicine.

SUBSTANCE: what is disclosed is a DNA plasmid for delivery and expression of an antigen, an epitope, an immunogen, a peptide or a polypeptide under the interest. The DNA plasmid contains a cartridge of kanamycin resistance (KanaR) gene wherein the promoter KanaR is modified. The DNA plasmid shows high expression and stability. There are also described a composition containing such DNA plasmid, and methods for immune system stimulation in an animal and immune response induction in an animal with the use of the composition containing the DNA plasmid.

EFFECT: invention is applicable for producing effective DNA vaccines.

18 cl, 21 dwg, 4 tbl, 2 ex

FIELD: medicine.

SUBSTANCE: compound contains IL-15 indirectly bound by covalent links with a polypeptide containing a sushi domain of an extra-cellular region of the alpha IL-15R subunit.

EFFECT: invention allows inducing and stimulating activation and proliferation of said cells, and effectively treating the conditions and diseases which requires higher activity of IL-15.

44 cl, 42 dwg, 4 tbl, 1 ex

FIELD: medicine.

SUBSTANCE: passage vector contains fused DNA under control of a fused promoter. Fused DNA consists of a DNA fragment coding protein antigen M. tuberculosis, and a gene DNA fragment coding an amino acid sequence under accession number GenBank No.L22858. The double promoter consists of a polyhedrin promoter and a CMV promoter. What is also described is a vaccine for tuberculosis containing a recombinant nuclear polyhedrosis virus Autographa californica (AcNPV) as an active agent. The recombinant AcNPV contains a sequence coming into the vector described above.

EFFECT: more effective use in medicine.

6 cl, 15 dwg, 1 tbl, 13 ex

FIELD: medicine.

SUBSTANCE: group of inventions refers to medicine and concerns recombinant viral vaccines. Substance of the inventions involves recombinant viral vaccines containing a recombinant poxvirus vector which expresses in vivo at least one heterological sequence of a nucleotide which codes an antigen and one 1H-imidazo [4,5-c] quinoline-4-amine derivative with said poxvirus vector being MVA. Particularly, the presented invention discloses the combined vaccines which combine the recombinant viral vectors MVA containing a nucleotide coding one or more HPV antigens which are able to intensify the immune response which is observed in in vivo under said recombinant viral vectors.

EFFECT: advantage of the group of inventions consists in intensifying the immune responses.

18 cl, 2 ex, 10 dwg

FIELD: medicine.

SUBSTANCE: there are disclosed new completely human VAP-1 binding antibodies containing three polypeptides CDR of heavy and light chains, and their VAP-1-binding fragments. There are also presented nucleic acids coding VAP-1 antibodies or their fragments, expression vectors and host cells including these nucleic acids for recombinant expression of VAP-1 antibodies. There is described a method for producing a completely human antibody by transformation of the proper host by the expression vector and cultivation with the antibodies to be collected and purified. There are also disclosed pharmaceutical compositions containing said antibodies, and their therapeutic application - for treating VAP-1-mediated inflammatory diseases in the patients.

EFFECT: method improvement.

21 cl, 20 dwg, 4 tbl, 10 ex

FIELD: medicine.

SUBSTANCE: there are offered versions of: a SSMA monoclonal antibody and its antigen-binding fragment which are bound with a mark or a cytotoxic agent. There are described versions of a pharmaceutical composition and a diagnostic kit based on such antibodies. There are disclosed methods for identification in vitro of tumour cells, as well as for diagnostic identification of tumour cells based on such antibodies. What is described is an isolated polynucleotide for producing monoclonal antibodies.

EFFECT: using the invention provides the antibodies which can bind SSMA in its native form on the surface of tumour cells, are bound with LNCAP, but are not bound with cells with lost SSMA expression that can find further application in prostate cancer therapy.

15 cl, 21 dwg, 3 tbl, 18 ex

FIELD: medicine.

SUBSTANCE: invention represents a human monoclonal antibody or its fragment which specifically binds with primate GM-CSF and neutralise it. There are also presented a polynucleotide molecule, a pharmaceutical composition, application of the monoclonal antibody.

EFFECT: invention may be used for neutralising higher or undesired activity of primate GM-CSF.

22 cl, 34 dwg, 5 tbl, 11 ex

FIELD: medicine.

SUBSTANCE: there are offered: recovered polynucleotides and polypeptides for binding human EGFR as a part of an antibody, a vector and a host cell for antibody expression, a method for producing an anti-EGFR antibody and an antibody fragment, the anti-EGFR antibody and the antibody fragment. There are discussed a composition containing the anti-EGFR antibody or its fragment, as well as applying the antibody and its fragment for treating EGFR-associated disorders. Besides, there are described versions of glycosylation of the anti-EGFR antibody or its fragment.

EFFECT: invention can find further application in therapy of various EGFR-mediated diseases.

30 cl, 6 ex, 32 dwg, 39 tbl

FIELD: medicine, pharmaceutics.

SUBSTANCE: present invention refers to immunology and biotechnology. There are offered versions of a TNF-alpha polypeptide wherein a number of heavy-chain single domain antibodies is equal to two. What is described is coding nucleic acid. There are disclosed versions of the compositions, a polypeptide-based kit, as well as versions of using it. What is described is a method for producing the polypeptide with using nucleic acid.

EFFECT: use of the invention provides the substantial growth of cytotoxicity lC50 (of the order of 10-9) that can find further application in therapy of TNFα-mediated disorders.

52 cl, 18 dwg, 11 tbl, 9 ex

FIELD: medicine, pharmaceutics.

SUBSTANCE: this invention relates to biotechnology and immunology. One proposes: JAM-A protein antibody or functional fragment thereof, hybridoma secreting such antibody, nucleic acid, expression vector and host cell as well as a method for the antibody and composition production. One considers application of the JAM-A protein antibody or functional fragment thereof.

EFFECT: invention usage ensures creation of new JAM-A protein antibodies which may be further applied in treatment or prevention of diseases related to proliferation of tumour cells extracting JAM-A protein.

34 cl, 31 dwg, 5 tbl, 19 ex

FIELD: medicine.

SUBSTANCE: polypeptide (versions) immunogenic with respect to meningococcal infections contains: an amino acid sequence at least 90 % identical to a sequence presented in the description (SEQ ID NO: 32), or said amino acid sequence, or a fragment of 80 sequenced amino acids of said sequence. What is described is an antibody which contacts with the polypeptide under the invention and which may be used as a drug. What is described is nucleic acid of the preset structure which codes the polypeptide or its versions and which may be used for treating or preventing a disease and/or an infection caused by Neisseria meningitides. The invention provides additional polypeptides applicable in advanced vaccines for preventing and/or treating meningococcal meningitis. The peptides can also find application in diagnosing of the disease and as targets of antibiotics.

EFFECT: higher clinical effectiveness for meningococcal meningitis.

19 cl, 2 tbl

FIELD: chemistry, pharmaceutics.

SUBSTANCE: present invention refers to biotechnology and immunology. There are offered: a monoclonal antibody or its fragment specifically bound with GDF8 and not bound with BMP11, a polynucleotide coding it, an expression vector and a host cell for antibody expression. There are studied: a method for producing the GDF8-specific antibody, a method for GDF8 presence test, a method of treating a GDF8-associated disorder.

EFFECT: use of the invention provides the new GDF8-specific antibodies that can find further application in the therapy of the GDF8-mediated diseases.

22 cl, 33 dwg, 8 tbl, 7 ex

FIELD: medicine.

SUBSTANCE: what is offered is an antibody or its antigen-binding fragment which specifically coupling hlL-4R with KD less than 200-pM measured with using surface plasmon resonance. What is described is a recovered nucleic acid molecule coding the antibody, and a based vector for producing the antibody. There are disclosed a host-vector system for producing the antibody or its antigen-binding fragment, and a method for producing the substances stated above with using such system. What is disclosed is using the antibody or antigen-binding fragment for preparing a drug for relieving (inhibiting) hlL-4R mediated diseases. What is disclosed is a composition on the basis of the antibody or antigen-binding fragment to be used in a method for treating a hlL-4R mediated disease or disorder in humans.

EFFECT: inventions can find application in therapy of the hlL-4R mediated diseases.

15 cl, 3 dwg, 5 tbl, 6 ex

FIELD: immunology and bioengineering.

SUBSTANCE: present invention refers to immunology and bioengineering. The variants of an antisubstance that is specific in relation to at least one globulomer Aβ(20-42) have been suggested. Each of the variants is characterized by the fact that it includes VH and VL parts; each of these parts contains three corresponding CDR. The antisubstance antigen-binding section has been revealed. They described: a coding nucleic acid and the vector that contains it, and a host cell that bears the vector that are used for the antisubstance production. The way of antisubstance production with the use of a cell has been discovered. The suggested inventions can find their application in therapy and diagnostics of Alzheimer's disease and other amyloid diseases.

EFFECT: antosubstances that can be used in therapy and diagnostics of Alzheimer's disease and other amyloid diseases.

10 cl, 28 dwg, 9 tbl, 12 ex

FIELD: medicine.

SUBSTANCE: what is described is a hybrid cultured cell strain of the animals Mus museums Sp2/0Ag14-SpBcG/APC-15/A3 that is a produced of a monoclonal antibody specific to human protein C (to hPROC). The strain is deposited in the Russian Collection of Vertebrata Cell Culture of the Institute of Cytology of the Russian Academy of Sciences, No. 733(D). What is described is a monoclonal antibody prepared of the strain, specific to hPROC and showing the conformational properties. It binds hPROC in the presence of calcium ions and does not bind it in the presence of chelating agents. What is presented is an immunosorbent on the basis of said antibody.

EFFECT: applicability of the strain for preparing the MCA to hPROC, and producing on its basis an immune-affine sorbent for hPROC purification and concentration.

3 cl, 2 dwg, 3 tbl, 5 ex

Up!